Wastewater and clinical based epidemiology for viral surveillance in urban sewage and clinical samples from Egypt

Wastewater and clinical based epidemiology for viral surveillance in urban sewage and clinical samples from Egypt | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Wastewater and clinical based epidemiology for viral surveillance in urban sewage and clinical samples from Egypt Mohamed N. F. Shaheen, Nehal Ibrahim Ahmed, Elmahdy M. Elmahdy This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4658498/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The release of inadequately treated wastewater, containing human viruses, into the water environment or agricultural use represent a major problem in public health. In this study we evaluated the presence of polyomavirus (HPyV), papillomavirus (HPV), hepatitis A virus (HAV), and hepatitis E virus (HEV) in urban sewage and among children with acute gastroenteritis by real time PCR. The seasonal distribution in wastewater and viral removal by wastewater treatment process were also evaluated. HPyV, HPV, HAV, and HEV, were detected in 68%, 39.6% 42.4%, and 33.3% of the raw sewage and in 21%, 9.4%, 18.7%, and 0% of the treated sewage samples. Among the 200 children with acute gastroenteritis, HPyV, HPV, HAV, and HEV were detected in 72.5%, 50%, 13%, and 5% of stool samples tested, respectively. HPyV was more prevalent in both environmental and clinical samples. The concentration of these viruses (HPyV, HPV, HAV, HEV) in raw sewage, treated sewage, and stool samples ranged from 1.30×10 1 GC/ml to 9.86×10 7 GC/ml with a mean concentration of 3.62 ×10 6 , from 0 GC/ml and 2.15×10 5 GC/ml with a mean concentration of 4.03×10 3 , and from 1.40×10 1 to 9.85×10 7 GC/g with a mean concentration of 4.05×10 6 GC/g, respectively. Examination of wastewater treatment process efficiency based on mean concentration values at entry and exit observed an overall reduction of 49.5%, 47.9%, 41.2%, 100%, for HPyV, HPV, HAV, and HEV respectively. This study showed the benefit of environmental monitoring as an additional tool to investigate the epidemiology of these viruses circulating in a given community. urban sewage enteric viruses stool gastroenteritis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Wastewater-based epidemiology (WBE) is a useful surveillance tool for tracking the enteric viral pathogens circulating at the community level (Hellmér et al., 2014 ). This approach has been effectively used for tracking epidemics or for the early identification of emerging/re-emerging infections. (Tiwari et al., 2023 ; WHO - World Health Organization, 2022 ). Despite that, there is few research studying the applicability of this approach for many waterborne viruses (Prevost et al., 2015 ), such as polyomavirus (HPyV), papillomavirus (HPV), and also for hepatitis A virus (HAV), hepatitis E virus (HEV). HPVs (dsDNA virus; 50–60 nm; family Papillomaviridae ) are classified into 5 genera (alpha, beta, mu, and nu). Recently, HPVs has been detected in all vertebrates and were identified in stool and urine samples from infected and healthy individuals (Di et al., 2015; Enerly et al., 2013 ; Yu et al., 2015 ). Furthermore, the prevalence of HPVs in various water matrices (e.g. sewage, river water, and recreational water) have recently been documented (Bibby and Peccia, 2013 ; La Rosa et al., 2015 ; Shaheen et al., 2024 ). HPV is transmitted between people by different ways: direct contact between the skin and mucous membranes, sexual contact, from mother to child, through fomites, clothing, surgical materials, and objects. However, the potential viral waterborne transmission is still understood and considered great challenges for future studies (Reynolds, 2012 ). HPyV (non-enveloped viruses, dsDNA virus, 40–45 nm in diameter, family Poliomaviridae) is divided into eight genotypes (JCPyV 1 - JCPyV 8) (Moens et al., 2017 ; Torres, 2020 ). These viruses are prevalent in over 80% of the population worldwide, detected in the water environment and released in urine of infected persons, suggesting the potential of transmission from person to person via close contact and / or urine-fecal-oral in contact with polluted water, food, and surfaces (Cortese et al., 2021). This virus was detected in high concentrations in sewage and showed persistence and wide distribution in various environmental matrices without a clear preferred season (Shaheen et al., 2024 ; Condez et al., 2021 ). HAV are small non-enveloped, RNA viruses, and belonging to family Picornaviridae). HAVs are primarily transmitted through the faecal–oral modes either by direct or indirect contact, HAVs are generally transmitted via the ingestion of polluted water or food, especially when there is poor hygiene practices and inadequate sanitation (Pallansch 2013; Vaughan et al. 2014 ). HAV is the major cause of acute hepatitis globally and has been linked to many outbreaks associated with sewage contamination of oysters or to polluted water, used for irrigation, drinking, recreational use or vegetable washing (Morace et al. 2002 ; Vantarakis et al. 2009 ). HEV is non-enveloped, ssRNA virus, 28–35 nm, belonging to family Hepeviridae which consisting of two subfamilies called Parahepevirinae and Orthohepevirinae ). HEV is one of the most causes of acute hepatitis globally, generally transmitted through the fecal–oral mode via contaminated food and water. It is estimates that approximately 20 million hepatitis E infections occur annually, resulting in more than 3 million symptomatic cases ( http://www.who.int/mediacentre/factsheets/fs280/en/ ). The Orthohepevirinae subfamily is further classified into 4 genera ( Paslahepevirus, Avihepevirus, Rocahepevirus and Chirohepevirus (that could infect humans and wild and domestic mammals (Sridhar et al., 2018 ). Genotypes HEV1 and HEV2 belonging to Paslahepevirus (previously identified as Orthohepevirus A) are commonly restricted to humans, while genotypes HEV3 and HEV4 are isolated in both animals (deer, pig, rabbit, wild boar) and humans in industrialized and developing countries (Zhang et al., 2008 ; Myrmel et al., 2015 ). The virus enters the human body primarily via direct consumption of contaminated meat in high-income countries or contaminated drinking water low- and middle-income countries, while less frequently via blood and vertical transmission (Perez-Gracia et al., 2014 ). The purpose of the present study was to identify the presence of enteric oncogenic viruses (HPyV and HPV), and enteric hepatitis viruses (HAV and HAV) in urban sewage. We have also investigated the presence of these viruses stool samples obtained from hospitalized children with a cute gastroenteritis. Materials and Methods Study area The Zenin WWTP, situated in Giza, Egypt, is built to accommodate a population equal to roughly 2,250,000 individuals. The activated sludge process is crucial for the biological treatment process. The Zenin WWTP, built on the outskirts, is now encircled by housing complexes. This WWTP can handle up to 330,000 cubic meters of wastewater per day and releases the fully treated effluent into the Nahia effluent system before it flows into the River Nile. Wastewater Samples Grab sampling technique was used to collect samples of wastewater, measuring 0.5 − 0.1 L, from both the inlet and outlet of the Zenin WWTP. During the period from January 2022 to December 2023, 96 samples were collected each week at both the inlet and outlet locations, then transported on ice to the lab and kept at 4°C until they were analyzed. Clinical Samples In 2021, fecal specimens were obtained from 200 children aged ≤ 5 showing signs of gastroenteritis at three children's hospitals in Cairo, Egypt. Collected samples were placed in sterile containers and transported on ice to the Virology Lab. at the Environment and Climate Change Research Institute, National Research Center, within 4 hours for analysis. Ethics Statement Approval for the collection of stool samples (Ref No: 129072023) was granted by the Medical Research Ethics Committee of the National Research Centre in Egypt. Virus concentration by polyethylene glycol precipitation A method involving polyethylene glycol (PEG) precipitation was used to concentrate viruses from 250 ml of wastewater, with slight adjustments (Borchardt et al. 2017 ). Before the viral concentration process, the samples were agitated at 4°C with a speed of 100 rpm for 30 minutes in order to move the viruses to the water phase. Centrifuging the samples at 12,000 rpm for 60 minutes at 4°C removed bacterial debris and large particles (Thermo Fisher Scientific - US). The PEG 8000 (10% w/v; Sigma-Aldrich, USA) and 0.2 M NaCl (1.8% w/v, Sigma, lot # BCCF5919, Switzerland) were added to the supernatant and shaken for 2 minutes. To concentrate the viruses, they were spun down in a centrifuge at 12,000 rpm for 150 minutes at 4°C. The top liquid layer was then gently poured off without disrupting the solid particles. The pellets in every falcon tube were mixed with 1 ml of phosphate buffer saline and then kept at -20°C. Viral RNA and DNA extraction The extraction of RNA from 200 µl of concentrate was conducted following the manufacturer's instructions with IDEXX Water DNA/RNA Magnetic Bead Kit (Lot # 20853, USA). The process yielded 0.4 mL of extracted RNA/DNA. Nuclease-free water served as a control in each viral RNA/DNA extraction set to check for potential cross contamination. Serial dilutions were carried out on nucleic acids to decrease inhibitor concentration and improve PCR performance. Moreover, in order to investigate PCR inhibition, a sample was injected with 4.7 x 10 8 GC/ml murine norovirus (MNV-1) as a sample process control virus (SPCV) previously tested negative for MNV-1 by qPCR, and no inhibitory effects were noted. One-Step quantitative real-time PCR RNA viruses (HAV and HEV) were quantified with Xpert One-Step Fast qPCR master mix kit (Grisp, Portugal) and DNA virus (HPyV and HPV) was quantified using Xpert Fast SYBR (uni) kit (Grisp, Portugal), following the manufacturer's guidelines. The real-time PCR mixture for measuring HAV, and HEV consisted of 20 µL, with 5 µL of nucleic acid extract, 10 µL fast qPCR mastermix (Syber), 1 µL RTase mix, 1 µL of each primer (10 µM), and 3 µL nuclease-free water to make up the total volume of 20 µL. The identical combination was used for HPyV and HPV testing, this time omitting the RTase mix. For assessing HAV, and HEV levels, the temperature conditions included 50°C for 10 minutes, accompanied by 40 rounds of 95°C for 5 seconds and 60°C for 30 seconds. The HPyV and HPV were treated under identical thermal conditions, excluding the initial step. Each positive control's PCR amplicon was produced by inserting the amplicon into a plasmid (pGEM-T Easy Vector for HAV, pCR4-TOPO vector for HEV, pCR2.1-TOPO for HPV and HPyV) for every assay. Plasmids were measured using UV spectroscopy at Denovix. In the USA, plasmids were diluted ten times in series to create standard curves. Ultra-pure water without templates was used in every test to verify the absence of contamination in the test. The mixture was moved into the Rotor-Gene system, and fluorescence data were collected after the annealing step to determine if the sample was positive based on surpassing the threshold. The sequences for the primer and probe can be found in Table 1 . Table 1 Primers sequence for of HPyV, HPV, HAV, and HEV Virus 3´ − 5´ Ref. HPyV TCTATTACTAAACACAGCTTGACT GGTGCCAACCTATGGAACAG de Araujo et al. ( 2009 ) HPV TTTGTTACTGTGGTAGATACTAC GAAAAATAAACTGTAAATCATATTC de Roda Husman et al., ( 1995 ) HAV GAGATGCCTTGGATAGGGTAAC GAGACAGCCCTGACAATCAA Kozak et al., 2022 HEV TAG AGA ATG CTC AGC AGG ATA AG CGG CTC ATA CTG GTC AGG TGAAT Li et al., ( 2006 ) PCR specificity, sensitivity, and detection limits. The specificity of each set of real-time primers and probes used in this study was evaluated. The four real-time PCR procedures were applied to the 105 copies of each of the HPyV, HPV, HAV, and HEV plasmid DNA standards. When primers were used as a template, plasmid DNA standards showed no cross-reactivity. The highest dilution at which virus quantification was feasible was used to calculate the qPCR detection limit for each virus (the detection limits for HAV and HEV were 2.6 x 10 1 genome copies/L of sample, and 2.1 x 10 1 genome copies/L of sample for HPyV and HPV). The analysis produced standard curves with linear regression data displayed on them: the coefficient of determination (R 2 ) was 0.965 ± 0.001, the reaction efficiency was ≥ 96%, and the slope was 3.45 ± 0.11. Statistical Analysis GraphPad Prism version 5.0 (USA) was used for statistical analysis. The critical P-value for the test was set at < 0.05. The Pearson correlation was used to assess the relationships between viral dispersion and water samples. A one-way variance analysis was used to compare the mean virus loads between samples. Results Detection of HPyV, HAV, HAV, and HEV in wastewater RNAs for enteric hepatitis viruses (HAV and HEV) were found in raw with 42.4% and 33.3%, respectively while percentages of these viruses were 18.7% and 0%, respectively in treated sewage. DNAs for the enteric oncogenic viruses (HPyV and HPV) were found in raw sewage with 70.8% and 39.6% while their percentage were 21.9% and 9.4%, respectively in treated sewage. The virus most frequently detected in wastewater samples tested by qPCR was HPyV (70.8% in inlet and 21.9% in outlet samples) followed by HPV as shown in Table 2 . Table 2 Prevalence of HPyV, HPV, HAV, HEV in raw sewage and treated sewage samples from Zenin WWTP HPyV HPV HAV HEV Raw sewage (pos/n) b Treated sewage (pos/n) b Raw sewage (pos/n)b Treated sewage (pos/n) b Raw sewage (pos/n) b Treated sewage (pos/n) b Raw sewage (pos/n) b Treated sewage (pos/n) b Jan 22 3/4 2/4 3/4 1/4 3/4 1/4 3/4 0/4 Feb 22 2/4 1/4 2/4 1/4 2/4 1/4 3/4 0/4 Mar 22 3/4 1/4 3/4 0/4 3/4 2/4 1/4 0/4 Apr 22 3/4 1/4 1/4 0/4 1/4 0/4 1/4 0/4 May 22 2/4 0/4 1/4 0/4 1/4 1/4 1/4 0/4 Jun 22 2/4 1/4 1/4 0/4 1/4 1/4 1/4 0/4 July 22 3/4 1/4 2/4 1/4 1/4 1/4 1/4 0/4 Aug 22 2/4 0/4 0/4 0/4 1/4 0/4 0/4 0/4 Sept 22 3/4 0/4 1/4 0/4 0/4 0/4 1/4 0/4 Oct 22 4/4 1/4 1/4 0/4 3/4 2/4 1/4 0/4 Nov 22 2/4 1/4 2/4 0/4 1/4 0/4 2/4 0/4 Dec 22 4/4 0/4 2/4 0/4 1/4 0/4 1/4 0/4 Jan 23 4/4 1/4 4/4 1/4 4/4 2/4 2/4 0/4 Feb 23 4/4 2/4 3/4 1/4 4/4 2/4 2/4 0/4 Mar 23 3/4 1/4 3/4 1/4 4/4 1/4 3/4 0/4 Apr 23 3/4 2/4 1/4 0/4 1/4 0/4 1/4 0/4 May 23 3/4 0/4 1/4 1/4 1/4 1/4 1/4 0/4 Jun 23 3/4 1/4 2/4 1/4 1/4 0/4 0/4 0/4 July 23 3/4 1/4 0/4 0/4 1/4 1/4 1/4 0/4 Aug 23 1/4 0/4 0/4 0/4 1/4 0/4 1/4 0/4 Sept 23 3/4 1/4 0/4 0/4 1/4 0/4 0/4 0/4 Oct 23 2/4 0/4 1/4 0/4 1/4 1/4 2/4 0/4 Nov 23 2/4 1/4 2/4 1/4 2/4 0/4 2/4 0/4 Dec 23 4/4 2/4 2/4 0/4 2/4 1/4 1/4 0/4 Total 68/96 21/96 38/96 9/96 41/96 18/96 32/96 0/96 % 70.8 21.9 39.6 9.4 42.4 18.7 33.3 0 b No. of samples positive for virus/no. samples tested per month Seasonality Distribution Of Hpyv, Hpv, Hav, And Hev In Raw Sewage Samples The four targeted viruses were detected thought the four seasons of 2022 and 2023. However, the higher detection rates of these viruses were found during the two winter seasons. When we combined the data of 2022 and 2023 seasons, the data analysis observed that the rates of HPyV, HPV, HAV, and HEV detection were 79.2% (19/24), 75% (18/24%) 83.3% (20/24%), 58.3% (14/24%) in winter season, respectively. In spring season, the detection rates of HPyV, HPV, HAV, and HEV were 66.7% (16/24), 29.2% (7/24), 25.0% (6/25), and 20.8% (5/24) respectively. The detection rates of these viruses in autumn season were 75% (18/24), 41.7 (10/24), 41.7% (10/24), 37.5% (9/24), and for HPyV, HPV, HAV, HEV respectively. The lowest detection rates of HPyV (15/24; 62.5%), HPV (4/24; 16.7%), HAV (5/24; 20.8%), HEV (4/24; 16.7%) as shown in Fig. 1 , were recorded in summer season. The peak detection rates of these viruses in raw sewage were observed during winter seasons. A total of 200 patients hospitalized with acute gastroenteritis included in this study. Among these cases, HPyV was the most identified virus (145/200; 72.5%) followed by HPV (102/200; 51%), HAV (26/200; 13%), and HEV (10/200; 5%). In addition, the four viruses were detected in all age groups, except HEV was not detected in the age group 37–48 months. The higher prevalence of HPyV (90%) and HPV (66.7%) were observed among children younger than one year of age while the higher detection rates of HAV (28.6%), HEV (10.8) were found among age group 37–48 months and 37–48 months, respectively. HEV was not detected in children older than 48 months. Also, HAV RNA was not detected among children aged 25–48 months as shown in Table 3 . Table 3 Prevalence of HPyV, HPV, HAV, and HEV in clinical sample (n = 200) among the different age groups Virus 1–12 m (n = 60) 13–24 m (n = 43) 25–36 m (n = 32) 37–48 m (n = 28) 49–60 m (n = 37) Total (%) HPyV 54 (90%) 37 (86%) 23 (71.9%) 12 (42.87%) 19 (51.4%) 145 (72.5%) HPV 40 (66.7%) 19 (44.2%) 14 (43.7%) 17 (60.7%) 10 (27%) 100 (50%) HAV 5 (8.3%) 10 (23.2%) 3 (9.4%) 8 (28.6%) 0 (0%) 26 (13%) HEV 3 (5%) 3 (7%) 0 (0%) 0 (0%) 4 (10.8%) 10 (5%) Quantification Of Human Enteric Viruses In Wastewater And Stool Samples HPyV was found in the highest viral load in both raw sewage (up to 9.86×107 GC/ mL) and treated sewage (up to 2.15×10 5 GC/ mL). The virus detected in the lowest titers was HEV (2.22×10 4 GC/L) in raw sewage and clinical samples (2.59 × 10 4 GC/g) while it was not found in treated sewage. The mean concentration values in raw sewage samples were ranked as follows: HPyV (1.42×10 7 GC/L) > HPV (1.83×10 5 GC/L) > HAV (2.76×10 5 GC/L) > HEV (2.22×10 4 GC/L). A smaller finding was found in stool samples where the mean concentrations of these viruses were ranked as follows: HPyV (1.11 ×10 7 GC/g) > HPV (2.01×10 6 GC/g) > HAV (3.16 × 10 5 GC/g) > HEV (2.59 × 10 4 GC/g). Regarding to treated sewage these viruses were ranked as follows: HPyV (6.36×10 4 GC/L) > HAV (1.57×10 3 GC/L) > HPV (5.49×10 2 GC/L) > HEV (0 GC/L). The lowest concentrations of HPyV (1.5×10 2 GC/L), HAV (2.02×10 2 GC/L), HEV (1.30×10 1 GC/L), and HPV (1.00×10 2 GC/L) in raw sewage were recorded in September 2023, August 2023, July 2022, and January 2022, respectively, while the highest concentrations of HPyV (9.86×10 7 GC/L), HAV (4.57×10 6 GC/L), HEV (8.38×10 4 GC/L), and HPV (9.87×10 5 GC/L) in raw sewage were seen in January 2022, February 2023, January 2022, and May 2023, respectively. The data analysis showed that the majority of treated effluent samples were free of viruses where 62.5% (60/96) were completely cleared of all viruses (Fig. 2 ). There were statistically significant differences between the concentrations of HPyV, and HPV in sewage samples ( P < 0.001) as shown in Fig. 2 . Virus Removal During Wastewater Treatment Process As observed in Fig. 3 , the treatment processes applied in Zenin WWTP did not completely remove all targeted viruses from the treated effluent samples. Considering the four viruses together, the average GC number was 5.4 log 10 in inlet, and 3.1 log 10 in outlet, for a total removal of 57.4%. In an overall virus removal efficiency, based on mean concentration values at entry and exit, the virus most efficiently removed were HEV with a mean removal of 4.35 log 10 (100%); HPV with mean removal of 2.52 log 10 (47.9%). The least efficiently removed virus was HPyV with a mean removal of 32.8 log 10 (41.2% removal), Followed by HPV with mean removal of 3.22 log10 (49.5%) Distribution Of Single And Multiple Viral Agents In The Positive Raw Sewage Samples One or more viral genomes were found in 89.6% (86/96) of raw sewage samples. HPyV, HAV, HEV, and HPV were found in 24(27.9%), 4(4.6%), 5(5.8%), 3(3.5%) as a single viral agent in the positive raw sewage samples. Sixteen samples contained two viral agents while twenty-five samples contained three viral genomes. Among those, the combination of HPyV/HAV (7/86; 8.1%) and HPyV/HAV/HPV (10/86; 11.6%) were the most common. The four viruses were found in 9 (10.5%) positive raw sewage samples. Furthermore, among the 200 stool specimens from children with gastroenteritis, 199 (99.5%) contained at least one virus of the four targeted viruses, whereas only one samples was negative for the four viruses. The frequency of each single viral agent was as follows: HPyV 80/199 (40.2%), HPV 42/199 (21.1%), HAV 6/199 (3%) and HAV 2/199 (1%). Dual or three viral infections were found in 58 (29.1%) and 9 (4.5%) out of the 199 positive samples, respectively. HPyV and HPV were found together in 46 (23%) while HPyV, HAV, and HPV were detected together in 7(3.5%) stool samples. The four viral agents were detected in only 2 samples (1%) as shown in Fig. 4 . Discussion This study examined the presence and seasonal variations of human oncogeneic viruses and also enteric hepatitis viruses in raw sewage, influent, and clinical samples. The study also evaluated the degree of elimination of these viruses over two years of investigation. Our research uncovered that the current wastewater treatment methods are inadequate in eliminating these viruses, since we identified the presence of these viruses in samples obtained from sewage, intake, and sewage. The main sources of these viruses are the infected individuals' blood, urine and/or feces. Extended excreta of these viruses in urine and feaces, which is then released into wastewater, poses serious environmental risks and may serve as a vehicle for the spread of viruses to other peoples due to resistance of these viruses to wastewater treatment procedures. The results of our study align with previously published data that demonstrate the durability and resilience of these viruses to various environmental conditions in different bodies of water. Later, it was discovered that these viruses were present in the urban sewage of several other countries, including South America (Comerlato et al., 2016 , Castro et al., 2023), Pakistan (Ijaz et al., 2023 ), Italy (Iaconelli et al., 2015 ), and Australia (Ahmed et al., 2010 ). Castro et al., 2023 found high prevalence for HAV and HEV as following 61.1% of clinical samples and 39% of sewage samples had HAV. 15.9% of clinical samples and 22.5% of sewage samples had HEV identified; this high prevalence may be due to high number of tourists and immigrants in the city. In contrast La Rosa et al., 2014 found a low prevalence for HAV during two year of survey where a total of 38/157 wastewater samples (24.2%) were positive for HAV and these results are corresponded to Italy's designation as a low- to intermediate-endemic nation. Even with preventive efforts including better sanitation, water supply, and the HAV National Vaccination Programme, the presence of HEV and HAV in clinical samples and sewage supports the notion that the virus is still circulating in Egypt Our HPyV results was in accordance with Kokkinos et al., 2011 where they found that PyVs were detected in 68.8% (33/48), of the samples collected from untreated urban sewage (plant's inlet) from Greece. Hamza and Hamza, 2018 found high prevalence about 73% for HPyV in wastewater samples. There was a little difference in detection rate of HPyVs obtained by Macena et al., ( 2021 ) where they detected high percentage with 90% of JC Polyomaviruses in wastewater samples at Brazil and this could be as a result of the small number of samples that were collected which limits the study results. High prevalence HPyV in stool samples are remarkable during the current study in contrary the other study done by Yu et al., ( 2012 ) where they found only 56% in Diarrhea samples. There could be a number of reasons for this variation in results, including variations in the sample type, primer sets, and geographic location. Hamza and Hamza, ( 2018 ) detected HPVs in 30.5% of wastewater samples which considered slightly lower than our results. The percentage of HPV either in sewage or stool samples (40% and 50%) were slightly higher than in our previous study (Ahmed et al., 2019 ) where HPVs were the detected rate in sewage and stool samples was 24.4% and 28.3%, respectively. Di Bonito et al., 2015 found low prevalence rate for HPVs with 12.5% are detected in human stool samples this low detection rate may be due to sample size where very little sample material was collected for the investigation also the sensitivity of the molecular assays used during this study might have been lowered by partial inhibitor removal. Future post-treatment water virological controls are crucial, as demonstrated by environmental monitoring of these viruses. HAV and HEV were detected in sewage in all seasons, demonstrating the circulation of these viruses over time. Higher HAV detection was found during the winter while HEV was observed more frequently in summer. The findings also showcased the capacity of these viruses to serve as markers of water source contamination (Hundesa et al., 2006 ; Hamza et al., 2009 , Ahmed et al., 2019 ). Many viruses, harmful bacteria, helminth eggs, protozoan cysts, and other microorganisms can be found in human faeces, and human excreta is linked to a number of serious infectious diseases Based on Rusin et al. ( 2000 ), the majority of enteric viruses result in non-apparent infection. The release of these viruses in feces, urine, and respiratory secretions can occur at any time during infection highest concentration in feces and with the lowest infective dose (Toze, 1997 and 1999 ) causing acute gastroenteritis which is one of the viral infections that affects the population the most. A number of variables, including the infectious dosage, the infectious agent's pathogenicity (the ability of virus to infect and harm the host), and host and environmental conditions, influence how the disease develops. The incubation period, which varies according on the virus, is the interval of time between infection and the onset of clinical symptoms (Bitton et al., 1997). Wastewater is a promising method for tracking the epidemiology of enteric viruses circulating in the population, as evidenced by the scientific literature. This is because wastewater samples can be used to identify, quantify, and concentrate the genetic material of these viruses. In addition, analyzing the genetic material of these enteric viruses present in wastewater allows us to partly monitor asymptomatic and pre-symptomatic cases that have appeared in the community, thereby can help create and manage prevention and control measures through mitigation medical surveillance agency to control epidemic pathogens in a certain location (Ázara et al., 2023 ). Furthermore, various infectious diseases caused by microorganisms found in wastewater can also be monitored by the WBE. The extension and enhancement of fundamental urban sanitation practices would, therefore, immediately contribute to the diagnosis of people's health. This study addressed the presence of enteric hepatitis and enteric oncogenic viruses in sewage and the removal of these pathogens in WWTPs, as well as concentration and detection/quantification methods viral in this type of sample Conventional treatment processes in wastewater systems have low effectiveness in removing disease-causing organisms, because traditional wastewater treatment plants are not specifically designed for this purpose (Bhatt et al., 2020 ). Otherwise of virus adsorption to sediment appears greatly prolong the infectivity of viruses (Reynolds and Pepper, 2000 ). Viral pathogen discovery in treated effluent, as reported in a number of places worldwide (Baggi et al., 2001 ; Enriquez et al., 1995 ; Van Berg et al., 2005 ; Ueki et al., 2005 ), is a sign that the methods currently in use are ineffective. In addition to enteric viruses, raw sewage contains bacteria from all phylogenetic domains as well as other types of viruses (Haji Ali et al., 2021 , Ázara et al., 2023 ). This study has some limitations such as the genotyping for the detected viruses where is too much important to know the strains that are common in the studied geographical area. Conclosion In conclusion, the wastewater-based epidemiological monitoring approach highlights the necessity of making investments in sanitation systems in order to create extensive networks for collecting wastewater in cities, particularly in developing nations such as Egypt. The limited effectiveness of conventional wastewater treatment plants (WWTPs), which are not specifically designed to remove pathogens, combined with the significant potential for bioaccumulation of these microorganisms, has prompted the scientific community to refocus their attention on specific pathogens that have a significant socio-environmental impact, known as emerging pathogens. Generally, the inability to physically separate the viral particles from the phase liquid or the challenge of denaturing viral genomes and extracellular proteins render primary and secondary levels of treatment ineffective for eliminating viruses from sewage. However, tertiary or advanced treatment systems have the potential to significantly reduce viral load. Declarations Competing Interests The authors declare no conflict of interest, financial or otherwise. Author Contribution Mohamed N.F. Shaheen: methodology, formal analysis, data acuration, visualization, Elmahdy M. Elmahdy: investigation, methodology, conceptualization, writing—review, writing-original draft and editing. Nehal Ismail Ahmed: investigation, methodology, writing—review and editing. All authors reviewed the manuscript. References Ahmed, N.I., Elmahdy E.M., Allayeh, A.K., Mohamed, E.B., SLoutfy, S.A., Barakat, A. & Ali, M.A. (2019). Prevalence of human polyomavirus and papillomavirus in wastewater and in stool of Egyptian patients. Egyptian Journal of Aquatic Biology & Fisheries Vol. 23(2): 29 – 41. Ahmed, W., Wan, C., Goonetilleke, A. & Gardner, T. (2010). Evaluating sewage-associated JCV and BKV polyomaviruses for sourcing human fecal pollution in a coastal river in Southeast Queensland, Australia. J Environ Qual 39:1743–1750. https:// doi. org/ 10. 2134/ jeq20 10. 0062. Ahmed, W., Wan, C., Goonetilleke, A. & Gardner, T. (2010). Evaluating sewage-associated JCV and BKV polyomaviruses for sourcing human fecal pollution in a coastal river in Southeast Queensland, Australia. J Environ Qual 39:1743–1750. https:// doi. org/ 10. 2134/ jeq20 10. 0062. Ázara, M.S., Crippa, R.A., Silva, L.M.M., Siqueira, J.C., Lopes, B.C., Batista, A.M.M. & Siniscalchi, L.A.B. (2023). Viruses in sewage: monitoring as an epidemiologic prediction tool in environmental sanitation. A SARS-CoV-2 case study Revista DAE, São Paulo, v. 71, n 242 : pp 67-92. Baggi, F., Demarta, A. & Peduzzi, R. (2001). Persistence of viral pathogens and bacteriophages during sewage treatment: lack of correlation with indicator bacteria. Res Microbiol. 2001;152:743-51. Bero, D.M., da Silva, E.E., de Sousa Júnior, I.P., Nhassengo, S.A., Machado, R.S., Bauhofer, A.F.L. & de Deus, N. (2023). Enterovirus detection in stool samples from Mozambican children with acute gastroenteritis. Acta Tropica , 238 , 106755. ‏ Bhatt, A., Arora, P. & Prajapati, S. K. (2020). Occurrence, fates and potential treatment approaches for removal of viruses from wastewater: A review with emphasis on SARS-CoV-2. Journal of Environmental Chemical Engineering, v. 8, n. 5, p. 104429. https://doi.org/10.1016/j.jece.2020.104429. Bibby, K. & Peccia, J. (2013). Identification of viral pathogen diversity in sewage sludge by metagenome analysis. Environ. Sci. Technol. 47 (4), 1945–1951. Biel, S.S., Held, T.K., Landt, O., Niedrig, M., Gelderblom, H.R., Siegert, W. & Nitsche, A. (2000). Rapid quantification and differentiation of human polyomavirus DNA in undiluted urine from patients after bone marrow transplantation. J Clin Microbiol 38:. https://doi.org/10.1128/jcm.38.10.3689-3695.2000. Bitton, D. (1997). Pathogens and parasites in domestic wastewater. In:Wastewater Microbiology 2 nd ed. New York: Wiley-Liss. Chapter 4. Borchardt, M.A., Spencer, S.K., Hubbard, L.E., Firnstahl, A.D., Stokdyk, J.P. & Kolpin, D.W. (2017). Avian influenza virus RNA in groundwater wells supplying poultry farms affected by the 2015 influenza outbreak. Environ Sci Tech Let, 4, 268–272. https://doi.org/10.1021/acs.estlett.7b00128. Comerlato, J., Souza-Campos, F., Souza-Arantes, T., Roos-Kulmann, M., Trindade-Oliveira, M., Rosado-Spilki, F., Guedes-Frazzon, A., Roehe, P.M. & Franco, A.C. (2016). Distribution and genetic diversity of the human polyomaviruses JC and BK in surface water and sewage treatment plant during 2009 in Porto Alegre, Southern Brazil. Braz J Biol 77:459–468. https:// doi. org/ 10. 1590/ 1519- 6984. 15415. Condez, A.C., Nunes, M., Filipa-Silva, A., Leonardo, I. & Parreira, R. (2021). Human Polyomaviruses (HPyV) in Wastewater and Environmental Samples from the Lisbon Metropolitan Area: Detection and Genetic Characterization of Viral Structural Protein-Coding Sequences. Pathogens 2021, 10, 1309. https:// doi.org/10.3390/pathogens10101309. Costán-Longares, A., Mocé-Llivina, L., Avellón A., Jofre, J. & Lucena, F. (2008). Occurrence and distribution of culturable enteroviruses in wastewater and surface waters of north-eastern Spain. J Appl Microbiol. 105(6):1945-55 De Araujo, M.R., De Marco, L., Santos, C.F., Rubira-Bullen, I.R., Ronco, G., Pennini, I., Vizzini, L., Merletti, F. & Gillio-Tos, A. (2009). GP5+/6+ SYBR Green methodology for simultaneous screening and quantification of human papillomavirus. Journal of Clinical Virology. 45: 90–95. de Roda Husman, A.M., Walboomers, J.M., van den Brule, A.J., Meijer, C.J. & Snijders, P.J., (1995). The use of general primers GP5 and GP6 elongated at their 3′ ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J. Gen. Virol. 76 (Pt 4), 1057–1062. Di Bonito, P., Della Libera, S., Petricca, S., Iaconelli, M., Sanguinetti, M., Graffeo, R., Accardi, L. & La Rosa, G. (2015). A large spectrumof alpha and beta papillomaviruses are detected in human stool samples. J. Gen. Virol. 96 (Pt 3), 607–613. Enerly, E., Olofsson, C. & Nygard, M. (2013). Monitoring human papillomavirus prevalence in urine samples: a review. Clin. Epidemiol. 5, 67–79. Enriquez, C.E., Hurst, C.J. & Gerba, C.P. (1995). Survival of the enteric adenoviruses 40 and 41 in tap, sea and waste water. Wat Res. 1995;29:2548-53. Haji Ali, B., Shahin, M.S., Sangani, M.M.M., Faghihinezhad, M. & Baghdadi, M. (2021). Wastewater aerosols produced during flushing toilets, WWTPs, and irrigation with reclaimed municipal wastewater as indirect exposure to SARS-CoV-2. Journal of Environmental Chemical Engineering, v. 9, n. 5, p. 106201. https://doi. org/10.1016/j.jece.106201. Hamza, H., and Hamza I.A. (2018). Oncogenic papillomavirus and polyomavirus in urban sewage in Egypt. Science of the Total Environment 610–611, 1413–1420. Hamza, I.A., Jurzik, L., Stang, A., Sure, K., Uberla, K., Wilhelm, M. (2009). Detection of human viruses in rivers of a densly-populated area in Germany using a virus adsorption elution method optimized for PCR analyses. Water Res.. Hellmér, M., Paxéus, N., Magnius, L., Enache, L., Arnholm, B., Johansson, A., et al. (2014). Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks. Appl Environ Microbiol.80:6771–81. Hundesa, A., Maluquer de Motes, C., Bofill-Mas, S., Albinana-Gimenez, N. & Girones, R. (2006) Identification of human and animal adenoviruses and polyomaviruses for determination of sources of fecal contamination in the environment. Appl. Environ. Microbiol. 72 (12), 7886–7893. Iaconelli, M., Petricca, S., Libera, S.D., Di Bonito, P. & La Rosa, G. (2015). First detection of human papillomaviruses and human polyomaviruses in river waters in Italy. Food Environ Virol 7:309–315. https:// doi. org/ 10. 1007/ s12560- 015- 9203-7. Ijaz, R., Shahzad, N. & UI Haque, M.F. (2023). Detection of BK and JC polyomaviruses in sewage water of the urban areas of Lahore, Pakistan. Biologia, 78:2895–2902. Kokkinos PA, Ziros PG, Mpalasopoulou A, Galanis A, Vantarakis A: Molecular detection of multiple viral targets in untreated urban sewage from Greece. Virol J 2011, 8:195–195. Kozak, .RA., Rutherford, C., Richard-Greenblatt, M., Chau, N.Y.E., Cabrera, A., Biondi, M., Borlang, J., Day, J., Osiowy, C., Ramachandran, S., Mayer, N., Glaser, L. & Smieja, M. (2022). Development and Evaluation of a Molecular Hepatitis A Virus Assay for Serum and Stool Specimens. Viruses. 15;14(1):159. doi: 10.3390/v14010159. PMID: 35062362; PMCID: PMC8777614. La Rosa, G., Della Libera, S., Petricca, S., Iaconelli,M., Briancesco, R., Paradiso, R., Semproni, M., Di Bonito, P. & Bonadonna, L. (2015). First detection of papillomaviruses and polyomaviruses in swimming pool waters: unrecognized recreational water-related pathogens? J. Appl. Microbiol. 119 (6), 1683–1691. Li, J., Liu, J., Yu, H., Zhao, W., Xia, X., You, S., Zhang, J., Tong, H. & Wei, L. (2022). Sources, fates and treatment strategies of typical viruses in urban sewage collection/treatment systems: A review. Desalination, v. 534, p. 115798. https://doi.org/10.1016/j.desal.2022.115798 Li, R.C., Ge, S.X., Li, Y.P., Zheng, Y.J., Nong, Y., Guo, Q.S., Zhang, J., Ng, M.H. & Xia, N.S. (2006). Seroprevalence of hepatitis E virus infection, rural southern People’s Republic of China. Emerg. Infect. Dis. 12, 1682–1688. Lo Castro, I., Espul, C., de Paula, V.S., Altabert, N.R., Gonzalez, J.E., Lago, B.V. & Villar, L.M. (2023). High prevalence of hepatitis A and E viruses in environmental and clinical samples from West Argentina. Braz J Infect Dis. 27(2):102738. doi: 10.1016/j.bjid.2022.102738. Epub 2023 Jan 3. PMID: 36603828; PMCID: PMC9926214. Macena, L. da G., Vieira, C.B., Maranhão, A.G., Ferreira, F.C., Lemos, E.R.S. & Miagostovich, M.P. (2021). Genetic Diversity and Quantification of Human Adenoviruses and JC Polyomaviruses in Wastewater Samples. International Journal of Plant, Animal and Environmental Sciences 11: 614-626. Moens, U., Calvignac-Spencer, S., Lauber, C., et al. (2017). ICTV Report Consortium. ICTV Virus Taxonomy Profile: Polyomaviridae. Journal of General Virology 98 : 1159-1160. Morace, G., Aulicino, F., Angelozzi, C., Costanzo, L., Donadio, F., & Rapicatta, M. (2002). Microbial quality of wastewater: detection of hepatitis A virus by reverse transcriptase-polymerase chain reaction. Journal of Applied Microbiology, 92(5), 823–836. Myrmel, M., Lange, H. & Rimstad, E. (2015). A 1-Year Quantitative Survey of Noro-, Adeno-, Human Boca-, and Hepatitis E Viruses in Raw and Secondarily Treated Sewage from Two Plants in Norway. Food Environ. Virol., 7, 213–223. Pallansch, M. A., Cherste, O. M., & Whitton, J. L. (2013). Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer enteroviruses. In D. M. Knipe, P. M. Howley, J. I. Cohen, D. G. Griffen, R. A. Lamb, M. A. Martin, V. R. Racaniello, & B. Roizman (Eds.), Fields Virology (pp. 490–530). Philadelphia, PA: Lippincott Williams & Wilkins. Pedrosa de Macena, L.G., Vieira, C.B., Maranhão, A.G., Ferreira, F.C., Lemos, E.R.S. & Miagostovich. M.P. (2021). Genetic Diversity and Quantification of Human Adenoviruses and JC Polyomaviruses in Wastewater Samples. International Journal of Plant, Animal and Environmental Sciences 11: 614-626. Perez-Gracia, M.T., Suay, B. & Mateos-Lindemann, M.L. (2014). Hepatitis E: an emerging disease. Infect Genet Evol. 22:40–59. Prevost, B., Lucas, F.S., Goncalves, A., Richard, F., Moulin, L. & Wurtzer, S. (2015). Large scale survey of enteric viruses in river and waste water underlines the health status of the local population. Environ. Int. 79, 42–50. Reynolds, K.A. (2012). On Tap: Viruses and Cancer: Potential for Waterborne Transmission. January 2012: Volume 54, Number 1. Reynolds, K.A. & Pepper, I.A. (2000). Microrganisms in the environment. In : Maier RM, Pepper IL, Gerba CP, editors. Environmental microbiology. Academic Press: San Diego, p. 8-40. Rusin, P., Enriquez, C.E., Jonhson, D. & Gerba, C.P. (2000) Environmental transmitte pathogens, In:maier Rm PepperII, Gerba CP. Editores. Environmnetal microbiology. Acaemic press: San Diego. P. 447-85. Shaheen, M., Ahmed, N., Radi, K. & Elmahdy, E.M. (2024). Detection and quantification of adenovirus, polyomavirus, and papillomavirus in urban sewage. Journal of Water and Health, jwh2024322. ‏ Sridhar, S., Yip, C.C.Y., Wu, S., Cai, J., Zhang, A-X., Leung, K-H., Chung, T.W.H., Chan, J.F.W., Chan, W-M., Teng, J.L.L., Au-Yeung, R.K.H., Cheng, V.C.C., Chen, H., Lau, S.K.P., Woo, P.C.Y., Xia, N-S., Lo, C-M. & Yuen, K-Y. (2018). Rat hepatitis E virus as cause of persistent hepatitis after liver transplant. Emerg Infect Dis 24:2241–2250. Stanway, G., Brown, F., Christian, P., Hovi, T., Hyypi€a, T., King, A.M.Q., Knowles, N.J., Lemon, S.M. et al. (2005). Family Picornaviridae. In Virus Taxonomy. Eight Report of the International Committee on Taxonomy of Viruses eds Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A. pp. 757–778. London: Elsevier/Academic Press.). Tiwari, A., Adhikari, S., Kaya, D., Islam, M.A., Malla, B., Sherchan, S.P., et al., (2023). Monkeypox outbreak: wastewater and environmental surveillance perspective. Sci. Total Environ. 856 (Pt 2), 159166. Torres, C. (2020). Evolution and molecular epidemiology of polyomaviruses. Infect. Genet. Evol. 2020, 79, 104150. Toze, S. (1997). Microbial pathogens in the wastewater. Literature review for urban water systems. C SIRO land and wate. Australia. Technical report n 1/97. Toze, S. (1999). PCR and the detection of microbial pathogens in water and wastewater. Water Res 33:3545–3556. Ueki, Y., Sano, D., Watanabe, T., Akiyama, K. & Omura, T. (2005). Norovirus pathway in water environment estimated by genetic analysis of strains from patients of gastroenteritis, sewage, treated wastewater, river water and oysters. Wat Res. 39:4271-80. Van den Berg, H., Lodder, W., van der Poel Wim, Vennema, H. & Husman, A.N.R. (2005). Genetic diversity of noroviruses in raw and treated sewage water. Res in Microbiol. 2005;156: 532-40. Vantarakis, A., Nearxou, A., Pagonidis, D., Melegos, F., Seretidis, J., Kokkinos, P., et al. (2009). An outbreak of hepatitis A in Roma populations living in three prefectures in Greece. Epidemiology and Infection, 27, 1–7. Vaughan, G., Goncalves Rossi, L. M., Forbi, J. C., de Paula, V. S., Purdy, M. A., Xia, G., et al. (2014). Hepatitis A virus: Host interactions, molecular epidemiology and evolution. Infection, Genetics and Evolution, 21, 227–243. WHO - World Health Organization, (2022). Environmental Surveillance for SARS-COV-2 to Complement Public Health Surveillance. Interim Guidance, 14 April 2022, COVID- 19: Infection Prevention and Control/WASH. https://www.who.int/publications/i/ item/WHO-HEP-ECH-WSH-2022.1. Yu, G., Greninger, A.L., Isa, P., Phan, T.G., Martınez, M.A., et al. (2012). Discovery of a Novel Polyomavirus in Acute Diarrheal Samples from Children. PLoS ONE 7(11): e49449. doi:10.1371/journal.pone.0049449. Yu, J.M., Zhao, G., Ao, Y.Y., Li, L.L.,Wang, D. & Duan, Z.J., (2015). Complete genome sequence of a novel human papillomavirus identified by metagenomic analysis from a child with diarrhea in China. Arch. Virol. 160 (2), 549–552. Zhang,W., Shen, Q., Mou, J., Gong, G., Yang, Z., Cui, L., Zhu, J., Ju, G. & Hua, X. (2008). Hepatitis E virus infection among domestic animals in eastern China. Zoonoses Public Health, 55, 291–298. Additional Declarations Competing interest reported. The authors declare no conflict of interest, financial or otherwise. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4658498","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":329743247,"identity":"33e945bd-821a-4268-b987-68e239beb068","order_by":0,"name":"Mohamed N. F. Shaheen","email":"","orcid":"","institution":"National Research Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"N. F.","lastName":"Shaheen","suffix":""},{"id":329743248,"identity":"caf22f7f-115a-4ef1-b461-0f088b2d391d","order_by":1,"name":"Nehal Ibrahim Ahmed","email":"","orcid":"","institution":"National Research Center","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nehal","middleName":"Ibrahim","lastName":"Ahmed","suffix":""},{"id":329743249,"identity":"220ba359-b292-4bdf-92c3-0de3c4042619","order_by":2,"name":"Elmahdy M. Elmahdy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIiWNgGAWjYFACHgYJEMXPwMBGohbJBpK1GBwgVotu+9mDt3l33JM3vpH87MGHCgZ5frED+LWYnclLtuY9U2y47UaaueGMMwyGM2cnENByIMdMmrctIcHsRgKIwZBgcJuQlvNvIFqMZ6R/I1LLDagtBhI5xNpy442x5dy2BKA33pRJzjgjQYRfzucY3njbliDP356+TeJDhY08vzQBLSDAxAMiBcAqJQgrBwHGHyCS/wBxqkfBKBgFo2DkAQC4E0CcAyF2fAAAAABJRU5ErkJggg==","orcid":"","institution":"National Research Center","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Elmahdy","middleName":"M.","lastName":"Elmahdy","suffix":""}],"badges":[],"createdAt":"2024-06-29 09:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4658498/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4658498/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60853433,"identity":"fb7c35e5-d0ae-45d9-888b-89d7fb207ae5","added_by":"auto","created_at":"2024-07-22 21:22:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":40337,"visible":true,"origin":"","legend":"\u003cp\u003eSeasonal distribution of HPyV, HPV, HAV, and HEV in raw sewage samples.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4658498/v1/06008789d02ce4fd2c374cd3.png"},{"id":60853098,"identity":"3b7c911b-693c-4700-84df-932888df9f5f","added_by":"auto","created_at":"2024-07-22 21:14:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":462939,"visible":true,"origin":"","legend":"\u003cp\u003eConcentration of HPyV, HAV, HEV, and HPV in sewage and clinical samples\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4658498/v1/d234ee16a95f1ed0c4b0dae9.png"},{"id":60853101,"identity":"c7d8258c-f3b9-45fc-9a39-ddafe7caf7b8","added_by":"auto","created_at":"2024-07-22 21:14:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":373600,"visible":true,"origin":"","legend":"\u003cp\u003eEfficiency of virus removal in Zenine WWTP which was calculated as viral titers in raw sewage (inlet) compared to viral titers in treated effluent (outlet).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4658498/v1/766bd756c9c88624298a27cd.png"},{"id":60853100,"identity":"af1da3e1-aa38-4b5b-868f-7e396a4fd3b0","added_by":"auto","created_at":"2024-07-22 21:14:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1685166,"visible":true,"origin":"","legend":"\u003cp\u003eProfiles of HPyV, HPV, HAV, and HEV identified in the raw sewage (n=96) and stool (n=200) samples\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4658498/v1/3ae3ef1af10c045fe0564b94.png"},{"id":60984075,"identity":"ad9ed9b0-50df-40dc-83e7-a62b1f451395","added_by":"auto","created_at":"2024-07-24 09:41:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2531638,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4658498/v1/499b031f-15df-41db-88ff-d635ea188a15.pdf"}],"financialInterests":"Competing interest reported. The authors declare no conflict of interest, financial or otherwise.","formattedTitle":"Wastewater and clinical based epidemiology for viral surveillance in urban sewage and clinical samples from Egypt","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWastewater-based epidemiology (WBE) is a useful surveillance tool for tracking the enteric viral pathogens circulating at the community level (Hellm\u0026eacute;r et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). This approach has been effectively used for tracking epidemics or for the early identification of emerging/re-emerging infections. (Tiwari et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; WHO - World Health Organization, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Despite that, there is few research studying the applicability of this approach for many waterborne viruses (Prevost et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), such as polyomavirus (HPyV), papillomavirus (HPV), and also for hepatitis A virus (HAV), hepatitis E virus (HEV).\u003c/p\u003e \u003cp\u003eHPVs (dsDNA virus; 50\u0026ndash;60 nm; family \u003cem\u003ePapillomaviridae\u003c/em\u003e) are classified into 5 genera (alpha, beta, mu, and nu). Recently, HPVs has been detected in all vertebrates and were identified in stool and urine samples from infected and healthy individuals (Di et al., 2015; Enerly et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Yu et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Furthermore, the prevalence of HPVs in various water matrices (e.g. sewage, river water, and recreational water) have recently been documented (Bibby and Peccia, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; La Rosa et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Shaheen et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). HPV is transmitted between people by different ways: direct contact between the skin and mucous membranes, sexual contact, from mother to child, through fomites, clothing, surgical materials, and objects. However, the potential viral waterborne transmission is still understood and considered great challenges for future studies (Reynolds, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHPyV (non-enveloped viruses, dsDNA virus, 40\u0026ndash;45 nm in diameter, family Poliomaviridae) is divided into eight genotypes (JCPyV 1 - JCPyV 8) (Moens et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Torres, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). These viruses are prevalent in over 80% of the population worldwide, detected in the water environment and released in urine of infected persons, suggesting the potential of transmission from person to person via close contact and / or urine-fecal-oral in contact with polluted water, food, and surfaces (Cortese et al., 2021). This virus was detected in high concentrations in sewage and showed persistence and wide distribution in various environmental matrices without a clear preferred season (Shaheen et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Condez et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHAV are small non-enveloped, RNA viruses, and belonging to family Picornaviridae). HAVs are primarily transmitted through the faecal\u0026ndash;oral modes either by direct or indirect contact, HAVs are generally transmitted via the ingestion of polluted water or food, especially when there is poor hygiene practices and inadequate sanitation (Pallansch 2013; Vaughan et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). HAV is the major cause of acute hepatitis globally and has been linked to many outbreaks associated with sewage contamination of oysters or to polluted water, used for irrigation, drinking, recreational use or vegetable washing (Morace et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Vantarakis et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHEV is non-enveloped, ssRNA virus, 28\u0026ndash;35 nm, belonging to family Hepeviridae which consisting of two subfamilies called \u003cem\u003eParahepevirinae\u003c/em\u003e and \u003cem\u003eOrthohepevirinae\u003c/em\u003e). HEV is one of the most causes of acute hepatitis globally, generally transmitted through the fecal\u0026ndash;oral mode via contaminated food and water. It is estimates that approximately 20\u0026nbsp;million hepatitis E infections occur annually, resulting in more than 3\u0026nbsp;million symptomatic cases (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.who.int/mediacentre/factsheets/fs280/en/\u003c/span\u003e\u003cspan address=\"http://www.who.int/mediacentre/factsheets/fs280/en/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The \u003cem\u003eOrthohepevirinae\u003c/em\u003e subfamily is further classified into 4 genera (\u003cem\u003ePaslahepevirus, Avihepevirus, Rocahepevirus and Chirohepevirus\u003c/em\u003e (that could infect humans and wild and domestic mammals (Sridhar et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Genotypes HEV1 and HEV2 belonging to \u003cem\u003ePaslahepevirus\u003c/em\u003e (previously identified as \u003cem\u003eOrthohepevirus\u003c/em\u003e A) are commonly restricted to humans, while genotypes HEV3 and HEV4 are isolated in both animals (deer, pig, rabbit, wild boar) and humans in industrialized and developing countries (Zhang et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Myrmel et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The virus enters the human body primarily via direct consumption of contaminated meat in high-income countries or contaminated drinking water low- and middle-income countries, while less frequently via blood and vertical transmission (Perez-Gracia et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe purpose of the present study was to identify the presence of enteric oncogenic viruses (HPyV and HPV), and enteric hepatitis viruses (HAV and HAV) in urban sewage. We have also investigated the presence of these viruses stool samples obtained from hospitalized children with a cute gastroenteritis.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy area\u003c/h2\u003e \u003cp\u003eThe Zenin WWTP, situated in Giza, Egypt, is built to accommodate a population equal to roughly 2,250,000 individuals. The activated sludge process is crucial for the biological treatment process. The Zenin WWTP, built on the outskirts, is now encircled by housing complexes. This WWTP can handle up to 330,000 cubic meters of wastewater per day and releases the fully treated effluent into the Nahia effluent system before it flows into the River Nile.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eWastewater Samples\u003c/h2\u003e \u003cp\u003eGrab sampling technique was used to collect samples of wastewater, measuring 0.5\u0026thinsp;\u0026minus;\u0026thinsp;0.1 L, from both the inlet and outlet of the Zenin WWTP. During the period from January 2022 to December 2023, 96 samples were collected each week at both the inlet and outlet locations, then transported on ice to the lab and kept at 4\u0026deg;C until they were analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eClinical Samples\u003c/h2\u003e \u003cp\u003eIn 2021, fecal specimens were obtained from 200 children aged\u0026thinsp;\u0026le;\u0026thinsp;5 showing signs of gastroenteritis at three children's hospitals in Cairo, Egypt. Collected samples were placed in sterile containers and transported on ice to the Virology Lab. at the Environment and Climate Change Research Institute, National Research Center, within 4 hours for analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003eApproval for the collection of stool samples (Ref No: 129072023) was granted by the Medical Research Ethics Committee of the National Research Centre in Egypt.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eVirus concentration by polyethylene glycol precipitation\u003c/h2\u003e \u003cp\u003eA method involving polyethylene glycol (PEG) precipitation was used to concentrate viruses from 250 ml of wastewater, with slight adjustments (Borchardt et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Before the viral concentration process, the samples were agitated at 4\u0026deg;C with a speed of 100 rpm for 30 minutes in order to move the viruses to the water phase. Centrifuging the samples at 12,000 rpm for 60 minutes at 4\u0026deg;C removed bacterial debris and large particles (Thermo Fisher Scientific - US). The PEG 8000 (10% w/v; Sigma-Aldrich, USA) and 0.2 M NaCl (1.8% w/v, Sigma, lot # BCCF5919, Switzerland) were added to the supernatant and shaken for 2 minutes. To concentrate the viruses, they were spun down in a centrifuge at 12,000 rpm for 150 minutes at 4\u0026deg;C. The top liquid layer was then gently poured off without disrupting the solid particles. The pellets in every falcon tube were mixed with 1 ml of phosphate buffer saline and then kept at -20\u0026deg;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eViral RNA and DNA extraction\u003c/h2\u003e \u003cp\u003eThe extraction of RNA from 200 \u0026micro;l of concentrate was conducted following the manufacturer's instructions with IDEXX Water DNA/RNA Magnetic Bead Kit (Lot # 20853, USA). The process yielded 0.4 mL of extracted RNA/DNA. Nuclease-free water served as a control in each viral RNA/DNA extraction set to check for potential cross contamination. Serial dilutions were carried out on nucleic acids to decrease inhibitor concentration and improve PCR performance. Moreover, in order to investigate PCR inhibition, a sample was injected with 4.7 x 10\u003csup\u003e8\u003c/sup\u003e GC/ml murine norovirus (MNV-1) as a sample process control virus (SPCV) previously tested negative for MNV-1 by qPCR, and no inhibitory effects were noted.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eOne-Step quantitative real-time PCR\u003c/h2\u003e \u003cp\u003eRNA viruses (HAV and HEV) were quantified with Xpert One-Step Fast qPCR master mix kit (Grisp, Portugal) and DNA virus (HPyV and HPV) was quantified using Xpert Fast SYBR (uni) kit (Grisp, Portugal), following the manufacturer's guidelines. The real-time PCR mixture for measuring HAV, and HEV consisted of 20 \u0026micro;L, with 5 \u0026micro;L of nucleic acid extract, 10 \u0026micro;L fast qPCR mastermix (Syber), 1 \u0026micro;L RTase mix, 1 \u0026micro;L of each primer (10 \u0026micro;M), and 3 \u0026micro;L nuclease-free water to make up the total volume of 20 \u0026micro;L. The identical combination was used for HPyV and HPV testing, this time omitting the RTase mix.\u003c/p\u003e \u003cp\u003eFor assessing HAV, and HEV levels, the temperature conditions included 50\u0026deg;C for 10 minutes, accompanied by 40 rounds of 95\u0026deg;C for 5 seconds and 60\u0026deg;C for 30 seconds. The HPyV and HPV were treated under identical thermal conditions, excluding the initial step. Each positive control's PCR amplicon was produced by inserting the amplicon into a plasmid (pGEM-T Easy Vector for HAV, pCR4-TOPO vector for HEV, pCR2.1-TOPO for HPV and HPyV) for every assay. Plasmids were measured using UV spectroscopy at Denovix. In the USA, plasmids were diluted ten times in series to create standard curves. Ultra-pure water without templates was used in every test to verify the absence of contamination in the test. The mixture was moved into the Rotor-Gene system, and fluorescence data were collected after the annealing step to determine if the sample was positive based on surpassing the threshold. The sequences for the primer and probe can be found in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers sequence for of HPyV, HPV, HAV, and HEV\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVirus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u0026acute; \u0026minus;\u0026thinsp;5\u0026acute;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRef.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHPyV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTATTACTAAACACAGCTTGACT\u003c/p\u003e \u003cp\u003eGGTGCCAACCTATGGAACAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ede Araujo et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2009\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHPV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGTTACTGTGGTAGATACTAC\u003c/p\u003e \u003cp\u003eGAAAAATAAACTGTAAATCATATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ede Roda Husman et al., (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1995\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHAV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGATGCCTTGGATAGGGTAAC\u003c/p\u003e \u003cp\u003eGAGACAGCCCTGACAATCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKozak et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHEV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAG AGA ATG CTC AGC AGG ATA AG\u003c/p\u003e \u003cp\u003eCGG CTC ATA CTG GTC AGG TGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLi et al., (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2006\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR specificity, sensitivity, and detection limits.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe specificity of each set of real-time primers and probes used in this study was evaluated. The four real-time PCR procedures were applied to the 105 copies of each of the HPyV, HPV, HAV, and HEV plasmid DNA standards. When primers were used as a template, plasmid DNA standards showed no cross-reactivity. The highest dilution at which virus quantification was feasible was used to calculate the qPCR detection limit for each virus (the detection limits for HAV and HEV were 2.6 x 10\u003csup\u003e1\u003c/sup\u003e genome copies/L of sample, and 2.1 x 10\u003csup\u003e1\u003c/sup\u003e genome copies/L of sample for HPyV and HPV).\u003c/p\u003e \u003cp\u003eThe analysis produced standard curves with linear regression data displayed on them: the coefficient of determination (R\u003csup\u003e2\u003c/sup\u003e) was 0.965\u0026thinsp;\u0026plusmn;\u0026thinsp;0.001, the reaction efficiency was \u0026ge;\u0026thinsp;96%, and the slope was 3.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism version 5.0 (USA) was used for statistical analysis. The critical P-value for the test was set at \u0026lt;\u0026thinsp;0.05. The Pearson correlation was used to assess the relationships between viral dispersion and water samples. A one-way variance analysis was used to compare the mean virus loads between samples.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDetection of HPyV, HAV, HAV, and HEV in wastewater\u003c/h2\u003e \u003cp\u003eRNAs for enteric hepatitis viruses (HAV and HEV) were found in raw with 42.4% and 33.3%, respectively while percentages of these viruses were 18.7% and 0%, respectively in treated sewage. DNAs for the enteric oncogenic viruses (HPyV and HPV) were found in raw sewage with 70.8% and 39.6% while their percentage were 21.9% and 9.4%, respectively in treated sewage. The virus most frequently detected in wastewater samples tested by qPCR was HPyV (70.8% in inlet and 21.9% in outlet samples) followed by HPV as shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrevalence of HPyV, HPV, HAV, HEV in raw sewage and treated sewage samples from Zenin WWTP\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eHPyV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003eHPV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003eHAV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e \u003cp\u003eHEV\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRaw sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTreated sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRaw sewage\u003c/p\u003e \u003cp\u003e(pos/n)b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTreated sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRaw sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTreated sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRaw sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eTreated sewage\u003c/p\u003e \u003cp\u003e(pos/n)\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJan 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFeb 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMar 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eApr 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMay 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJun 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJuly 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAug 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSept 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eOct 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNov 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDec 22\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJan 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFeb 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMar 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eApr 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMay 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJun 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eJuly 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAug 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSept 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eOct 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNov 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eDec 23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e1/4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e68/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e38/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e41/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e18/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e32/96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0/96\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e%\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e70.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e39.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e9.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e18.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e33.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003e\u003csup\u003eb\u003c/sup\u003e No. of samples positive for virus/no. samples tested per month\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSeasonality Distribution Of Hpyv, Hpv, Hav, And Hev In Raw Sewage Samples\u003c/h2\u003e \u003cp\u003eThe four targeted viruses were detected thought the four seasons of 2022 and 2023. However, the higher detection rates of these viruses were found during the two winter seasons. When we combined the data of 2022 and 2023 seasons, the data analysis observed that the rates of HPyV, HPV, HAV, and HEV detection were 79.2% (19/24), 75% (18/24%) 83.3% (20/24%), 58.3% (14/24%) in winter season, respectively. In spring season, the detection rates of HPyV, HPV, HAV, and HEV were 66.7% (16/24), 29.2% (7/24), 25.0% (6/25), and 20.8% (5/24) respectively. The detection rates of these viruses in autumn season were 75% (18/24), 41.7 (10/24), 41.7% (10/24), 37.5% (9/24), and for HPyV, HPV, HAV, HEV respectively. The lowest detection rates of HPyV (15/24; 62.5%), HPV (4/24; 16.7%), HAV (5/24; 20.8%), HEV (4/24; 16.7%) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, were recorded in summer season. The peak detection rates of these viruses in raw sewage were observed during winter seasons.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA total of 200 patients hospitalized with acute gastroenteritis included in this study. Among these cases, HPyV was the most identified virus (145/200; 72.5%) followed by HPV (102/200; 51%), HAV (26/200; 13%), and HEV (10/200; 5%). In addition, the four viruses were detected in all age groups, except HEV was not detected in the age group 37\u0026ndash;48 months. The higher prevalence of HPyV (90%) and HPV (66.7%) were observed among children younger than one year of age while the higher detection rates of HAV (28.6%), HEV (10.8) were found among age group 37\u0026ndash;48 months and 37\u0026ndash;48 months, respectively. HEV was not detected in children older than 48 months. Also, HAV RNA was not detected among children aged 25\u0026ndash;48 months as shown in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrevalence of HPyV, HPV, HAV, and HEV in clinical sample (n\u0026thinsp;=\u0026thinsp;200) among the different age groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVirus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026ndash;12 m\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;60)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u0026ndash;24 m\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;43)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e25\u0026ndash;36 m\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;32)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37\u0026ndash;48 m\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;28)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e49\u0026ndash;60 m\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;37)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTotal (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHPyV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e54\u003c/p\u003e \u003cp\u003e(90%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003cp\u003e(86%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003cp\u003e(71.9%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12\u003c/p\u003e \u003cp\u003e(42.87%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e19\u003c/p\u003e \u003cp\u003e(51.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e145\u003c/p\u003e \u003cp\u003e(72.5%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHPV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e40 (66.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003cp\u003e(44.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003cp\u003e(43.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e17\u003c/p\u003e \u003cp\u003e(60.7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003cp\u003e(27%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e100\u003c/p\u003e \u003cp\u003e(50%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHAV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003cp\u003e(8.3%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003cp\u003e(23.2%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(9.4%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003cp\u003e(28.6%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e26\u003c/p\u003e \u003cp\u003e(13%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHEV\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(5%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003cp\u003e(7%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003cp\u003e(0%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4\u003c/p\u003e \u003cp\u003e(10.8%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e10\u003c/p\u003e \u003cp\u003e(5%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eQuantification Of Human Enteric Viruses In Wastewater And Stool Samples\u003c/h2\u003e \u003cp\u003eHPyV was found in the highest viral load in both raw sewage (up to 9.86\u0026times;107 GC/ mL) and treated sewage (up to 2.15\u0026times;10\u003csup\u003e5\u003c/sup\u003e GC/ mL). The virus detected in the lowest titers was HEV (2.22\u0026times;10\u003csup\u003e4\u003c/sup\u003e GC/L) in raw sewage and clinical samples (2.59 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e GC/g) while it was not found in treated sewage. The mean concentration values in raw sewage samples were ranked as follows: HPyV (1.42\u0026times;10\u003csup\u003e7\u003c/sup\u003e GC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HPV (1.83\u0026times;10\u003csup\u003e5\u003c/sup\u003e GC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HAV (2.76\u0026times;10\u003csup\u003e5\u003c/sup\u003e GC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HEV (2.22\u0026times;10\u003csup\u003e4\u003c/sup\u003e GC/L). A smaller finding was found in stool samples where the mean concentrations of these viruses were ranked as follows: HPyV (1.11 \u0026times;10\u003csup\u003e7\u003c/sup\u003e GC/g)\u0026thinsp;\u0026gt;\u0026thinsp;HPV (2.01\u0026times;10\u003csup\u003e6\u003c/sup\u003e GC/g)\u0026thinsp;\u0026gt;\u0026thinsp;HAV (3.16 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e GC/g)\u0026thinsp;\u0026gt;\u0026thinsp;HEV (2.59 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e GC/g). Regarding to treated sewage these viruses were ranked as follows: HPyV (6.36\u0026times;10\u003csup\u003e4\u003c/sup\u003eGC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HAV (1.57\u0026times;10\u003csup\u003e3\u003c/sup\u003e GC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HPV (5.49\u0026times;10\u003csup\u003e2\u003c/sup\u003e GC/L)\u0026thinsp;\u0026gt;\u0026thinsp;HEV (0 GC/L). The lowest concentrations of HPyV (1.5\u0026times;10\u003csup\u003e2\u003c/sup\u003e GC/L), HAV (2.02\u0026times;10\u003csup\u003e2\u003c/sup\u003e GC/L), HEV (1.30\u0026times;10\u003csup\u003e1\u003c/sup\u003e GC/L), and HPV (1.00\u0026times;10\u003csup\u003e2\u003c/sup\u003e GC/L) in raw sewage were recorded in September 2023, August 2023, July 2022, and January 2022, respectively, while the highest concentrations of HPyV (9.86\u0026times;10\u003csup\u003e7\u003c/sup\u003e GC/L), HAV (4.57\u0026times;10\u003csup\u003e6\u003c/sup\u003e GC/L), HEV (8.38\u0026times;10\u003csup\u003e4\u003c/sup\u003e GC/L), and HPV (9.87\u0026times;10\u003csup\u003e5\u003c/sup\u003e GC/L) in raw sewage were seen in January 2022, February 2023, January 2022, and May 2023, respectively. The data analysis showed that the majority of treated effluent samples were free of viruses where 62.5% (60/96) were completely cleared of all viruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). There were statistically significant differences between the concentrations of HPyV, and HPV in sewage samples (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eVirus Removal During Wastewater Treatment Process\u003c/h2\u003e \u003cp\u003eAs observed in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, the treatment processes applied in Zenin WWTP did not completely remove all targeted viruses from the treated effluent samples. Considering the four viruses together, the average GC number was 5.4 log\u003csub\u003e10\u003c/sub\u003e in inlet, and 3.1 log\u003csub\u003e10\u003c/sub\u003e in outlet, for a total removal of 57.4%. In an overall virus removal efficiency, based on mean concentration values at entry and exit, the virus most efficiently removed were HEV with a mean removal of 4.35 log\u003csub\u003e10\u003c/sub\u003e (100%); HPV with mean removal of 2.52 log\u003csub\u003e10\u003c/sub\u003e (47.9%). The least efficiently removed virus was HPyV with a mean removal of 32.8 log\u003csub\u003e10\u003c/sub\u003e (41.2% removal), Followed by HPV with mean removal of 3.22 log10 (49.5%)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDistribution Of Single And Multiple Viral Agents In The Positive Raw Sewage Samples\u003c/h2\u003e \u003cp\u003eOne or more viral genomes were found in 89.6% (86/96) of raw sewage samples. HPyV, HAV, HEV, and HPV were found in 24(27.9%), 4(4.6%), 5(5.8%), 3(3.5%) as a single viral agent in the positive raw sewage samples. Sixteen samples contained two viral agents while twenty-five samples contained three viral genomes. Among those, the combination of HPyV/HAV (7/86; 8.1%) and HPyV/HAV/HPV (10/86; 11.6%) were the most common. The four viruses were found in 9 (10.5%) positive raw sewage samples. Furthermore, among the 200 stool specimens from children with gastroenteritis, 199 (99.5%) contained at least one virus of the four targeted viruses, whereas only one samples was negative for the four viruses. The frequency of each single viral agent was as follows: HPyV 80/199 (40.2%), HPV 42/199 (21.1%), HAV 6/199 (3%) and HAV 2/199 (1%). Dual or three viral infections were found in 58 (29.1%) and 9 (4.5%) out of the 199 positive samples, respectively. HPyV and HPV were found together in 46 (23%) while HPyV, HAV, and HPV were detected together in 7(3.5%) stool samples. The four viral agents were detected in only 2 samples (1%) as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study examined the presence and seasonal variations of human oncogeneic viruses and also enteric hepatitis viruses in raw sewage, influent, and clinical samples. The study also evaluated the degree of elimination of these viruses over two years of investigation. Our research uncovered that the current wastewater treatment methods are inadequate in eliminating these viruses, since we identified the presence of these viruses in samples obtained from sewage, intake, and sewage. The main sources of these viruses are the infected individuals' blood, urine and/or feces. Extended excreta of these viruses in urine and feaces, which is then released into wastewater, poses serious environmental risks and may serve as a vehicle for the spread of viruses to other peoples due to resistance of these viruses to wastewater treatment procedures. The results of our study align with previously published data that demonstrate the durability and resilience of these viruses to various environmental conditions in different bodies of water. Later, it was discovered that these viruses were present in the urban sewage of several other countries, including South America (Comerlato et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Castro et al., 2023), Pakistan (Ijaz et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), Italy (Iaconelli et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), and Australia (Ahmed et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Castro et al., 2023 found high prevalence for HAV and HEV as following 61.1% of clinical samples and 39% of sewage samples had HAV. 15.9% of clinical samples and 22.5% of sewage samples had HEV identified; this high prevalence may be due to high number of tourists and immigrants in the city. In contrast La Rosa et al., 2014 found a low prevalence for HAV during two year of survey where a total of 38/157 wastewater samples (24.2%) were positive for HAV and these results are corresponded to Italy's designation as a low- to intermediate-endemic nation. Even with preventive efforts including better sanitation, water supply, and the HAV National Vaccination Programme, the presence of HEV and HAV in clinical samples and sewage supports the notion that the virus is still circulating in Egypt\u003c/p\u003e \u003cp\u003eOur HPyV results was in accordance with Kokkinos et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2011\u003c/span\u003e where they found that PyVs were detected in 68.8% (33/48), of the samples collected from untreated urban sewage (plant's inlet) from Greece. Hamza and Hamza, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e found high prevalence about 73% for HPyV in wastewater samples. There was a little difference in detection rate of HPyVs obtained by Macena et al., (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) where they detected high percentage with 90% of JC Polyomaviruses in wastewater samples at Brazil and this could be as a result of the small number of samples that were collected which limits the study results. High prevalence HPyV in stool samples are remarkable during the current study in contrary the other study done by Yu et al., (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) where they found only 56% in Diarrhea samples. There could be a number of reasons for this variation in results, including variations in the sample type, primer sets, and geographic location.\u003c/p\u003e \u003cp\u003eHamza and Hamza, (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) detected HPVs in 30.5% of wastewater samples which considered slightly lower than our results. The percentage of HPV either in sewage or stool samples (40% and 50%) were slightly higher than in our previous study (Ahmed et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) where HPVs were the detected rate in sewage and stool samples was 24.4% and 28.3%, respectively. Di Bonito et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e found low prevalence rate for HPVs with 12.5% are detected in human stool samples this low detection rate may be due to sample size where very little sample material was collected for the investigation also the sensitivity of the molecular assays used during this study might have been lowered by partial inhibitor removal.\u003c/p\u003e \u003cp\u003eFuture post-treatment water virological controls are crucial, as demonstrated by environmental monitoring of these viruses. HAV and HEV were detected in sewage in all seasons, demonstrating the circulation of these viruses over time. Higher HAV detection was found during the winter while HEV was observed more frequently in summer.\u003c/p\u003e \u003cp\u003eThe findings also showcased the capacity of these viruses to serve as markers of water source contamination (Hundesa et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Hamza et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e, Ahmed et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Many viruses, harmful bacteria, helminth eggs, protozoan cysts, and other microorganisms can be found in human faeces, and human excreta is linked to a number of serious infectious diseases\u003c/p\u003e \u003cp\u003eBased on Rusin et al. (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), the majority of enteric viruses result in non-apparent infection. The release of these viruses in feces, urine, and respiratory secretions can occur at any time during infection highest concentration in feces and with the lowest infective dose (Toze, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e1997\u003c/span\u003e and \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1999\u003c/span\u003e) causing acute gastroenteritis which is one of the viral infections that affects the population the most. A number of variables, including the infectious dosage, the infectious agent's pathogenicity (the ability of virus to infect and harm the host), and host and environmental conditions, influence how the disease develops. The incubation period, which varies according on the virus, is the interval of time between infection and the onset of clinical symptoms (Bitton et al., 1997).\u003c/p\u003e \u003cp\u003eWastewater is a promising method for tracking the epidemiology of enteric viruses circulating in the population, as evidenced by the scientific literature. This is because wastewater samples can be used to identify, quantify, and concentrate the genetic material of these viruses. In addition, analyzing the genetic material of these enteric viruses present in wastewater allows us to partly monitor asymptomatic and pre-symptomatic cases that have appeared in the community, thereby can help create and manage prevention and control measures through mitigation medical surveillance agency to control epidemic pathogens in a certain location (\u0026Aacute;zara et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, various infectious diseases caused by microorganisms found in wastewater can also be monitored by the WBE. The extension and enhancement of fundamental urban sanitation practices would, therefore, immediately contribute to the diagnosis of people's health. This study addressed the presence of enteric hepatitis and enteric oncogenic viruses in sewage and the removal of these pathogens in WWTPs, as well as concentration and detection/quantification methods viral in this type of sample Conventional treatment processes in wastewater systems have low effectiveness in removing disease-causing organisms, because traditional wastewater treatment plants are not specifically designed for this purpose (Bhatt et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Otherwise of virus adsorption to sediment appears greatly prolong the infectivity of viruses (Reynolds and Pepper, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Viral pathogen discovery in treated effluent, as reported in a number of places worldwide (Baggi et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Enriquez et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Van Berg et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Ueki et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2005\u003c/span\u003e), is a sign that the methods currently in use are ineffective. In addition to enteric viruses, raw sewage contains bacteria from all phylogenetic domains as well as other types of viruses (Haji Ali et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, \u0026Aacute;zara et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis study has some limitations such as the genotyping for the detected viruses where is too much important to know the strains that are common in the studied geographical area.\u003c/p\u003e"},{"header":"Conclosion","content":"\u003cp\u003eIn conclusion, the wastewater-based epidemiological monitoring approach highlights the necessity of making investments in sanitation systems in order to create extensive networks for collecting wastewater in cities, particularly in developing nations such as Egypt. The limited effectiveness of conventional wastewater treatment plants (WWTPs), which are not specifically designed to remove pathogens, combined with the significant potential for bioaccumulation of these microorganisms, has prompted the scientific community to refocus their attention on specific pathogens that have a significant socio-environmental impact, known as emerging pathogens.\u003c/p\u003e \u003cp\u003eGenerally, the inability to physically separate the viral particles from the phase liquid or the challenge of denaturing viral genomes and extracellular proteins render primary and secondary levels of treatment ineffective for eliminating viruses from sewage. However, tertiary or advanced treatment systems have the potential to significantly reduce viral load.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting Interests\u003c/h2\u003e\u003cp\u003eThe authors declare no conflict of interest, financial or otherwise.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eMohamed N.F. Shaheen: methodology, formal analysis, data acuration, visualization, Elmahdy M. Elmahdy: investigation, methodology, conceptualization, writing\u0026mdash;review, writing-original draft and editing. Nehal Ismail Ahmed: investigation, methodology, writing\u0026mdash;review and editing. All authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAhmed, N.I., Elmahdy E.M., Allayeh, A.K., Mohamed, E.B., SLoutfy, S.A., Barakat, A. \u0026amp; Ali, M.A. (2019). Prevalence of human polyomavirus and papillomavirus in wastewater and in stool of Egyptian patients. Egyptian Journal of Aquatic Biology \u0026amp; Fisheries Vol. 23(2): 29 \u0026ndash; 41.\u003c/li\u003e\n\u003cli\u003eAhmed, W., Wan, C., Goonetilleke, A. \u0026amp; Gardner, T. (2010). Evaluating sewage-associated JCV and BKV polyomaviruses for sourcing human fecal pollution in a coastal river in Southeast Queensland, Australia. J Environ Qual 39:1743\u0026ndash;1750. https:// doi. org/ 10. 2134/ jeq20 10. 0062.\u003c/li\u003e\n\u003cli\u003eAhmed, W., Wan, C., Goonetilleke, A. \u0026amp; Gardner, T. (2010). Evaluating sewage-associated JCV and BKV polyomaviruses for sourcing human fecal pollution in a coastal river in Southeast Queensland, Australia. J Environ Qual 39:1743\u0026ndash;1750. https:// doi. org/ 10. 2134/ jeq20 10. 0062.\u003c/li\u003e\n\u003cli\u003e\u0026Aacute;zara, M.S., Crippa, R.A., Silva, L.M.M., Siqueira, J.C., Lopes, B.C., Batista, A.M.M. \u0026amp; Siniscalchi, L.A.B. (2023). Viruses in sewage: monitoring as an epidemiologic prediction tool in environmental sanitation. A SARS-CoV-2 case study Revista DAE, S\u0026atilde;o Paulo, v. 71, n 242 : pp 67-92.\u003c/li\u003e\n\u003cli\u003eBaggi, F., Demarta, A. \u0026amp; Peduzzi, R. (2001). Persistence of viral pathogens and bacteriophages during sewage treatment: lack of correlation with indicator bacteria. Res Microbiol. 2001;152:743-51.\u003c/li\u003e\n\u003cli\u003eBero, D.M., da Silva, E.E., de Sousa J\u0026uacute;nior, I.P., Nhassengo, S.A., Machado, R.S., Bauhofer, A.F.L. \u0026amp; de Deus, N. (2023). Enterovirus detection in stool samples from Mozambican children with acute gastroenteritis. \u003cem\u003eActa Tropica\u003c/em\u003e, \u003cem\u003e238\u003c/em\u003e, 106755.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eBhatt, A., Arora, P. \u0026amp; Prajapati, S. K. (2020). Occurrence, fates and potential treatment approaches for removal of viruses from wastewater: A review with emphasis on SARS-CoV-2. Journal of Environmental Chemical Engineering, v. 8, n. 5, p. 104429. https://doi.org/10.1016/j.jece.2020.104429.\u003c/li\u003e\n\u003cli\u003eBibby, K. \u0026amp; Peccia, J. (2013). Identification of viral pathogen diversity in sewage sludge by metagenome analysis. Environ. Sci. Technol. 47 (4), 1945\u0026ndash;1951.\u003c/li\u003e\n\u003cli\u003eBiel, S.S., Held, T.K., Landt, O., Niedrig, M., Gelderblom, H.R., Siegert, W. \u0026amp; Nitsche, A. (2000). Rapid quantification and differentiation of human polyomavirus DNA in undiluted urine from patients after bone marrow transplantation. J Clin Microbiol 38:. https://doi.org/10.1128/jcm.38.10.3689-3695.2000.\u003c/li\u003e\n\u003cli\u003eBitton, D. (1997). Pathogens and parasites in domestic wastewater. In:Wastewater Microbiology 2\u003csup\u003end\u003c/sup\u003e ed. New York: Wiley-Liss. Chapter 4.\u003c/li\u003e\n\u003cli\u003eBorchardt, M.A., Spencer, S.K., Hubbard, L.E., Firnstahl, A.D., Stokdyk, J.P. \u0026amp; Kolpin, D.W. (2017). Avian influenza virus RNA in groundwater wells supplying poultry farms affected by the 2015 influenza outbreak. Environ Sci Tech Let, 4, 268\u0026ndash;272. https://doi.org/10.1021/acs.estlett.7b00128.\u003c/li\u003e\n\u003cli\u003eComerlato, J., Souza-Campos, F., Souza-Arantes, T., Roos-Kulmann, M., Trindade-Oliveira, M., Rosado-Spilki, F., Guedes-Frazzon, A., Roehe, P.M. \u0026amp; Franco, A.C. (2016). Distribution and genetic diversity of the human polyomaviruses JC and BK in surface water and sewage treatment plant during 2009 in Porto Alegre, Southern Brazil. Braz J Biol 77:459\u0026ndash;468. https:// doi. org/ 10. 1590/ 1519- 6984. 15415.\u003c/li\u003e\n\u003cli\u003eCondez, A.C., Nunes, M., Filipa-Silva, A., Leonardo, I. \u0026amp; Parreira, R. (2021). Human Polyomaviruses (HPyV) in Wastewater and Environmental Samples from the Lisbon Metropolitan Area: Detection and Genetic Characterization of Viral Structural Protein-Coding Sequences. Pathogens 2021, 10, 1309. https:// doi.org/10.3390/pathogens10101309.\u003c/li\u003e\n\u003cli\u003eCost\u0026aacute;n-Longares, A., Moc\u0026eacute;-Llivina, L., Avell\u0026oacute;n A., Jofre, J. \u0026amp; Lucena, F. (2008). Occurrence and distribution of culturable enteroviruses in wastewater and surface waters of north-eastern Spain. J Appl Microbiol. 105(6):1945-55\u003c/li\u003e\n\u003cli\u003eDe Araujo, M.R., De Marco, L., Santos, C.F., Rubira-Bullen, I.R., Ronco, G., Pennini, I., Vizzini, L., Merletti, F. \u0026amp; Gillio-Tos, A. (2009). GP5+/6+ SYBR Green methodology for simultaneous screening and quantification of human papillomavirus. Journal of Clinical Virology. 45: 90\u0026ndash;95.\u003c/li\u003e\n\u003cli\u003ede Roda Husman, A.M., Walboomers, J.M., van den Brule, A.J., Meijer, C.J. \u0026amp; Snijders, P.J., (1995). The use of general primers GP5 and GP6 elongated at their 3\u0026prime; ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J. Gen. Virol. 76 (Pt 4), 1057\u0026ndash;1062.\u003c/li\u003e\n\u003cli\u003eDi Bonito, P., Della Libera, S., Petricca, S., Iaconelli, M., Sanguinetti, M., Graffeo, R., Accardi, L. \u0026amp; La Rosa, G. (2015). A large spectrumof alpha and beta papillomaviruses are detected in human stool samples. J. Gen. Virol. 96 (Pt 3), 607\u0026ndash;613. \u003c/li\u003e\n\u003cli\u003eEnerly, E., Olofsson, C. \u0026amp; Nygard, M. (2013). Monitoring human papillomavirus prevalence in urine samples: a review. Clin. Epidemiol. 5, 67\u0026ndash;79.\u003c/li\u003e\n\u003cli\u003eEnriquez, C.E., Hurst, C.J. \u0026amp; Gerba, C.P. (1995). Survival of the enteric adenoviruses 40 and 41 in tap, sea and waste water. Wat Res. 1995;29:2548-53.\u003c/li\u003e\n\u003cli\u003eHaji Ali, B., Shahin, M.S., Sangani, M.M.M., Faghihinezhad, M. \u0026amp; Baghdadi, M. (2021). Wastewater aerosols produced during flushing toilets, WWTPs, and irrigation with reclaimed municipal wastewater as indirect exposure to SARS-CoV-2. Journal of Environmental Chemical Engineering, v. 9, n. 5, p. 106201. https://doi. org/10.1016/j.jece.106201.\u003c/li\u003e\n\u003cli\u003eHamza, H., and Hamza I.A. (2018). Oncogenic papillomavirus and polyomavirus in urban sewage in Egypt. Science of the Total Environment 610\u0026ndash;611, 1413\u0026ndash;1420.\u003c/li\u003e\n\u003cli\u003eHamza, I.A., Jurzik, L., Stang, A., Sure, K., Uberla, K., Wilhelm, M. (2009). Detection of human viruses in rivers of a densly-populated area in Germany using a virus adsorption elution method optimized for PCR analyses. Water Res..\u003c/li\u003e\n\u003cli\u003eHellm\u0026eacute;r, M., Pax\u0026eacute;us, N., Magnius, L., Enache, L., Arnholm, B., Johansson, A., et al. (2014). Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks. Appl Environ Microbiol.80:6771\u0026ndash;81. \u003c/li\u003e\n\u003cli\u003eHundesa, A., Maluquer de Motes, C., Bofill-Mas, S., Albinana-Gimenez, N. \u0026amp; Girones, R. (2006) Identification of human and animal adenoviruses and polyomaviruses for determination of sources of fecal contamination in the environment. Appl. Environ. Microbiol. 72 (12), 7886\u0026ndash;7893.\u003c/li\u003e\n\u003cli\u003eIaconelli, M., Petricca, S., Libera, S.D., Di Bonito, P. \u0026amp; La Rosa, G. (2015). First detection of human papillomaviruses and human polyomaviruses in river waters in Italy. Food Environ Virol 7:309\u0026ndash;315. https:// doi. org/ 10. 1007/ s12560- 015- 9203-7.\u003c/li\u003e\n\u003cli\u003eIjaz, R., Shahzad, N. \u0026amp; UI Haque, M.F. (2023). Detection of BK and JC polyomaviruses in sewage water of the urban areas of Lahore, Pakistan. Biologia, 78:2895\u0026ndash;2902.\u003c/li\u003e\n\u003cli\u003eKokkinos PA, Ziros PG, Mpalasopoulou A, Galanis A, Vantarakis A: Molecular detection of multiple viral targets in untreated urban sewage from Greece. Virol J 2011, 8:195\u0026ndash;195.\u003c/li\u003e\n\u003cli\u003eKozak, .RA., Rutherford, C., Richard-Greenblatt, M., Chau, N.Y.E., Cabrera, A., Biondi, M., Borlang, J., Day, J., Osiowy, C., Ramachandran, S., Mayer, N., Glaser, L. \u0026amp; Smieja, M. (2022). Development and Evaluation of a Molecular Hepatitis A Virus Assay for Serum and Stool Specimens. Viruses. 15;14(1):159. doi: 10.3390/v14010159. PMID: 35062362; PMCID: PMC8777614.\u003c/li\u003e\n\u003cli\u003eLa Rosa, G., Della Libera, S., Petricca, S., Iaconelli,M., Briancesco, R., Paradiso, R., Semproni, M., Di Bonito, P. \u0026amp; Bonadonna, L. (2015). First detection of papillomaviruses and polyomaviruses in swimming pool waters: unrecognized recreational water-related pathogens? J. Appl. Microbiol. 119 (6), 1683\u0026ndash;1691.\u003c/li\u003e\n\u003cli\u003eLi, J., Liu, J., Yu, H., Zhao, W., Xia, X., You, S., Zhang, J., Tong, H. \u0026amp; Wei, L. (2022). Sources, fates and treatment strategies of typical viruses in urban sewage collection/treatment systems: A review. Desalination, v. 534, p. 115798. https://doi.org/10.1016/j.desal.2022.115798\u003c/li\u003e\n\u003cli\u003eLi, R.C., Ge, S.X., Li, Y.P., Zheng, Y.J., Nong, Y., Guo, Q.S., Zhang, J., Ng, M.H. \u0026amp; Xia, N.S. (2006). Seroprevalence of hepatitis E virus infection, rural southern People\u0026rsquo;s Republic of China. Emerg. Infect. Dis. 12, 1682\u0026ndash;1688.\u003c/li\u003e\n\u003cli\u003eLo Castro, I., Espul, C., de Paula, V.S., Altabert, N.R., Gonzalez, J.E., Lago, B.V. \u0026amp; Villar, L.M. (2023). High prevalence of hepatitis A and E viruses in environmental and clinical samples from West Argentina. Braz J Infect Dis. 27(2):102738. doi: 10.1016/j.bjid.2022.102738. Epub 2023 Jan 3. PMID: 36603828; PMCID: PMC9926214.\u003c/li\u003e\n\u003cli\u003eMacena, L. da G., Vieira, C.B., Maranh\u0026atilde;o, A.G., Ferreira, F.C., Lemos, E.R.S. \u0026amp; Miagostovich, M.P. (2021). Genetic Diversity and Quantification of Human Adenoviruses and JC Polyomaviruses in Wastewater Samples. International Journal of Plant, Animal and Environmental Sciences 11: 614-626.\u003c/li\u003e\n\u003cli\u003eMoens, U., Calvignac-Spencer, S., Lauber, C., et al. (2017). ICTV Report Consortium. ICTV Virus Taxonomy Profile: Polyomaviridae. Journal of General Virology 98 : 1159-1160.\u003c/li\u003e\n\u003cli\u003eMorace, G., Aulicino, F., Angelozzi, C., Costanzo, L., Donadio, F., \u0026amp; Rapicatta, M. (2002). Microbial quality of wastewater: detection of hepatitis A virus by reverse transcriptase-polymerase chain reaction. Journal of Applied Microbiology, 92(5), 823\u0026ndash;836.\u003c/li\u003e\n\u003cli\u003eMyrmel, M., Lange, H. \u0026amp; Rimstad, E. (2015). A 1-Year Quantitative Survey of Noro-, Adeno-, Human Boca-, and Hepatitis E Viruses in Raw and Secondarily Treated Sewage from Two Plants in Norway. Food Environ. Virol., 7, 213\u0026ndash;223.\u003c/li\u003e\n\u003cli\u003ePallansch, M. A., Cherste, O. M., \u0026amp; Whitton, J. L. (2013). Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer enteroviruses. In D. M. Knipe, P. M. Howley, J. I. Cohen, D. G. Griffen, R. A. Lamb, M. A. Martin, V. R. Racaniello, \u0026amp; B. Roizman (Eds.), Fields Virology (pp. 490\u0026ndash;530). Philadelphia, PA: Lippincott Williams \u0026amp; Wilkins.\u003c/li\u003e\n\u003cli\u003ePedrosa de Macena, L.G., Vieira, C.B., Maranh\u0026atilde;o, A.G., Ferreira, F.C., Lemos, E.R.S. \u0026amp; Miagostovich. M.P. (2021). Genetic Diversity and Quantification of Human Adenoviruses and JC Polyomaviruses in Wastewater Samples. International Journal of Plant, Animal and Environmental Sciences 11: 614-626.\u003c/li\u003e\n\u003cli\u003ePerez-Gracia, M.T., Suay, B. \u0026amp; Mateos-Lindemann, M.L. (2014). Hepatitis E: an emerging disease. Infect Genet Evol. 22:40\u0026ndash;59.\u003c/li\u003e\n\u003cli\u003ePrevost, B., Lucas, F.S., Goncalves, A., Richard, F., Moulin, L. \u0026amp; Wurtzer, S. (2015). Large scale survey of enteric viruses in river and waste water underlines the health status of the local population. Environ. Int. 79, 42\u0026ndash;50.\u003c/li\u003e\n\u003cli\u003eReynolds, K.A. (2012). On Tap: Viruses and Cancer: Potential for Waterborne Transmission. January 2012: Volume 54, Number 1.\u003c/li\u003e\n\u003cli\u003eReynolds, K.A. \u0026amp; Pepper, I.A. (2000). Microrganisms in the environment. In : Maier RM, Pepper IL, Gerba CP, editors. Environmental microbiology. Academic Press: San Diego, p. 8-40.\u003c/li\u003e\n\u003cli\u003eRusin, P., Enriquez, C.E., Jonhson, D. \u0026amp; Gerba, C.P. (2000) Environmental transmitte pathogens, In:maier Rm PepperII, Gerba CP. Editores. Environmnetal microbiology. Acaemic press: San Diego. P. 447-85.\u003c/li\u003e\n\u003cli\u003eShaheen, M., Ahmed, N., Radi, K. \u0026amp; Elmahdy, E.M. (2024). Detection and quantification of adenovirus, polyomavirus, and papillomavirus in urban sewage. Journal of Water and Health, jwh2024322.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003eSridhar, S., Yip, C.C.Y., Wu, S., Cai, J., Zhang, A-X., Leung, K-H., Chung, T.W.H., Chan, J.F.W., Chan, W-M., Teng, J.L.L., Au-Yeung, R.K.H., Cheng, V.C.C., Chen, H., Lau, S.K.P., Woo, P.C.Y., Xia, N-S., Lo, C-M. \u0026amp; Yuen, K-Y. (2018). Rat hepatitis E virus as cause of persistent hepatitis after liver transplant. Emerg Infect Dis 24:2241\u0026ndash;2250.\u003c/li\u003e\n\u003cli\u003eStanway, G., Brown, F., Christian, P., Hovi, T., Hyypi\u0026euro;a, T., King, A.M.Q., Knowles, N.J., Lemon, S.M. et al. (2005). Family Picornaviridae. In Virus Taxonomy. Eight Report of the International Committee on Taxonomy of Viruses eds Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A. pp. 757\u0026ndash;778. London: Elsevier/Academic Press.). \u003c/li\u003e\n\u003cli\u003eTiwari, A., Adhikari, S., Kaya, D., Islam, M.A., Malla, B., Sherchan, S.P., et al., (2023). Monkeypox outbreak: wastewater and environmental surveillance perspective. Sci. Total Environ. 856 (Pt 2), 159166.\u003c/li\u003e\n\u003cli\u003eTorres, C. (2020). Evolution and molecular epidemiology of polyomaviruses. Infect. Genet. Evol. 2020, 79, 104150.\u003c/li\u003e\n\u003cli\u003eToze, S. (1997). Microbial pathogens in the wastewater. Literature review for urban water systems. C SIRO land and wate. Australia. Technical report n 1/97.\u003c/li\u003e\n\u003cli\u003eToze, S. (1999). PCR and the detection of microbial pathogens in water and wastewater. Water Res 33:3545\u0026ndash;3556.\u003c/li\u003e\n\u003cli\u003eUeki, Y., Sano, D., Watanabe, T., Akiyama, K. \u0026amp; Omura, T. (2005). Norovirus pathway in water environment estimated by genetic analysis of strains from patients of gastroenteritis, sewage, treated wastewater, river water and oysters. Wat Res. 39:4271-80.\u003c/li\u003e\n\u003cli\u003eVan den Berg, H., Lodder, W., van der Poel Wim, Vennema, H. \u0026amp; Husman, A.N.R. (2005). Genetic diversity of noroviruses in raw and treated sewage water. Res in Microbiol. 2005;156: 532-40.\u003c/li\u003e\n\u003cli\u003eVantarakis, A., Nearxou, A., Pagonidis, D., Melegos, F., Seretidis, J., Kokkinos, P., et al. (2009). An outbreak of hepatitis A in Roma populations living in three prefectures in Greece. Epidemiology and Infection, 27, 1\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eVaughan, G., Goncalves Rossi, L. M., Forbi, J. C., de Paula, V. S., Purdy, M. A., Xia, G., et al. (2014). Hepatitis A virus: Host interactions, molecular epidemiology and evolution. Infection, Genetics and Evolution, 21, 227\u0026ndash;243.\u003c/li\u003e\n\u003cli\u003eWHO - World Health Organization, (2022). Environmental Surveillance for SARS-COV-2 to Complement Public Health Surveillance. Interim Guidance, 14 April 2022, COVID- 19: Infection Prevention and Control/WASH. https://www.who.int/publications/i/ item/WHO-HEP-ECH-WSH-2022.1.\u003c/li\u003e\n\u003cli\u003eYu, G., Greninger, A.L., Isa, P., Phan, T.G., Martınez, M.A., et al. (2012). Discovery of a Novel Polyomavirus in Acute Diarrheal Samples from Children. PLoS ONE 7(11): e49449. doi:10.1371/journal.pone.0049449.\u003c/li\u003e\n\u003cli\u003eYu, J.M., Zhao, G., Ao, Y.Y., Li, L.L.,Wang, D. \u0026amp; Duan, Z.J., (2015). Complete genome sequence of a novel human papillomavirus identified by metagenomic analysis from a child with diarrhea in China. Arch. Virol. 160 (2), 549\u0026ndash;552.\u003c/li\u003e\n\u003cli\u003eZhang,W., Shen, Q., Mou, J., Gong, G., Yang, Z., Cui, L., Zhu, J., Ju, G. \u0026amp; Hua, X. (2008). Hepatitis E virus infection among domestic animals in eastern China. Zoonoses Public Health, 55, 291\u0026ndash;298.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"urban sewage, enteric viruses, stool, gastroenteritis","lastPublishedDoi":"10.21203/rs.3.rs-4658498/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4658498/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe release of inadequately treated wastewater, containing human viruses, into the water environment or agricultural use represent a major problem in public health. In this study we evaluated the presence of polyomavirus (HPyV), papillomavirus (HPV), hepatitis A virus (HAV), and hepatitis E virus (HEV) in urban sewage and among children with acute gastroenteritis by real time PCR. The seasonal distribution in wastewater and viral removal by wastewater treatment process were also evaluated. HPyV, HPV, HAV, and HEV, were detected in 68%, 39.6% 42.4%, and 33.3% of the raw sewage and in 21%, 9.4%, 18.7%, and 0% of the treated sewage samples. Among the 200 children with acute gastroenteritis, HPyV, HPV, HAV, and HEV were detected in 72.5%, 50%, 13%, and 5% of stool samples tested, respectively. HPyV was more prevalent in both environmental and clinical samples. The concentration of these viruses (HPyV, HPV, HAV, HEV) in raw sewage, treated sewage, and stool samples ranged from 1.30\u0026times;10\u003csup\u003e1\u003c/sup\u003e GC/ml to 9.86\u0026times;10\u003csup\u003e7\u003c/sup\u003e GC/ml with a mean concentration of 3.62 \u0026times;10\u003csup\u003e6\u003c/sup\u003e, from 0 GC/ml and 2.15\u0026times;10\u003csup\u003e5\u003c/sup\u003e GC/ml with a mean concentration of 4.03\u0026times;10\u003csup\u003e3\u003c/sup\u003e, and from 1.40\u0026times;10\u003csup\u003e1\u003c/sup\u003e to 9.85\u0026times;10\u003csup\u003e7\u003c/sup\u003e GC/g with a mean concentration of 4.05\u0026times;10\u003csup\u003e6\u003c/sup\u003e GC/g, respectively. Examination of wastewater treatment process efficiency based on mean concentration values at entry and exit observed an overall reduction of 49.5%, 47.9%, 41.2%, 100%, for HPyV, HPV, HAV, and HEV respectively. This study showed the benefit of environmental monitoring as an additional tool to investigate the epidemiology of these viruses circulating in a given community.\u003c/p\u003e","manuscriptTitle":"Wastewater and clinical based epidemiology for viral surveillance in urban sewage and clinical samples from Egypt","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 21:14:19","doi":"10.21203/rs.3.rs-4658498/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ccc39d8d-ff76-45dc-8811-d176ef06302b","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-07-24T09:33:15+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-22 21:14:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4658498","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4658498","identity":"rs-4658498","version":["v1"]},"buildId":"re_ckhLnmML6MCF96OHNJ","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}