Molecular typing of clinical, colonizing, and environmental isolates of Staphylococcus aureus and comparison with World isolates

Molecular typing of clinical, colonizing, and environmental isolates of Staphylococcus aureus and comparison with World isolates | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular typing of clinical, colonizing, and environmental isolates of Staphylococcus aureus and comparison with World isolates Azra Naseem, Malini Shariff This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6712641/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Staphylococcus aureus ( S.aureus ) is a facultative anaerobe that colonizes humans' nasal cavity, skin, and other mucosal surfaces. The bacterium can cause local and systemic infections, including skin and soft tissue infections, bacteremia, endocarditis, and osteomyelitis. It is associated with hospital-acquired infections, and the emergence of Methicillin-resistant S.aureus (MRSA), a difficult-to-treat pathogen, is of concern in hospitals. This is a retrospective analytical study. A hundred S. aureus isolates from various sources stored in our repository were used in the study. These isolates were obtained from clinical samples, surveillance samples from healthcare workers and patients and hospital environmental samples. Fragments of seven housekeeping genes were amplified as given in the PUBMLST site. ( https://pubmlst.org/organisms/ staphylococcus aureus). The amplified fragments were sequenced. STs were determined by comparing the known alleles in the database. New Sequence types were assigned to novel STs. We analyzed all the isolates in the database according to the country, isolate types, etc. A total of 100 isolates of S. aureus from clinical, surveillance and hospital environmental samples, present in the repository, were included. MLST was performed for 55 isolates. Sequence types encountered were ST22, ST5, ST364, ST1910, ST5939, ST5529, ST7442, ST672, and ST9162. The rest were new types. Most of our isolates belonged to CC5. These were compared with those of the Indian and World isolates in the PUBMLST site. Sequence types help to understand their evolution. Efficient infection control and surveillance strategies will help control the transmission of MRSA in the hospital. Staphylococcus aureus MRSA MLST Burst analysis Clonal complex Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Staphylococcus aureus ( S.aureus ) colonizes the nasal cavity, skin, and other mucosal surfaces of humans [ 1 ]. It can cause various infections, including skin and soft tissue infections, bacteremia, endocarditis, and osteomyelitis [ 2 ]. It causes hospital-acquired infections. The emergence of Methicillin-resistant S.aureus (MRSA) in hospitals, causing severe infections, poses challenges for treatment [ 3 ]. Apart from healthcare-related MRSA (HA-MRSA), community-associated MRSA (CA-MRSA) strains are a source of infections in society. CA-MRSA strains often differ genetically from HA-MRSA strains and are associated with distinct risk factors and clinical manifestations [ 4 ]. Understanding genetic and phenotypic differences between these strains is essential for focused treatment and preventative plans. Nasal carriage of S. aureus is a well-documented phenomenon, with about 20–30% of healthy people being persistent carriers [ 5 ]. Colonizers may not exhibit symptoms but serve as reservoirs for the bacterium, potentially leading to infection if the bacteria enter through breaks in the skin or mucous membranes. Various factors, including host genetics, immune response, and environmental conditions, influence the colonization of S.aureus . [ 6 ]. Colonizing strains can be either methicillin-sensitive or methicillin-resistant, and their presence can influence the dynamics of infection spread in communities and healthcare settings. Molecular characterization of colonizing strains helps in identifying potential reservoirs and developing strategies for decolonization to prevent infection [ 7 ]. Environmental isolates of S. aureus are found in diverse settings, including hospitals, community environments, and natural habitats [ 8 ]. Healthcare environments, surfaces, medical equipment, and hands of healthcare workers can harbour S. aureus , contributing to its transmission [ 9 ]. The ability of S. aureus to survive in various environmental conditions and its potential to colonize both human hosts and environmental surfaces highlight the importance of effective cleaning and disinfection protocols. In community settings, environmental reservoirs such as gyms, schools, and public transportation can also serve as sources of S. aureus infections. The environmental persistence of S. aureus poses a challenge to public health, emphasizing the need for ongoing surveillance and preventative measures [ 10 ]. The characterization and typing of S. aureus isolates are essential for several reasons: Identifying and tracking the spread of strains helps in understanding the epidemiology of infections and monitoring trends in antibiotic resistance [ 11 ]. Molecular typing allows for the investigation of outbreaks by linking isolates from patients, environments, and carriers, and facilitating targeted interventions. To develop efficient infection control measures, it is necessary to know the resistance and genetic makeup of the S. aureus. S. aureus isolates can be distinguished using different techniques, each with a distinct advantage and drawback. PCR-based methods, such as spa typing and multi-locus sequence typing (MLST), help to track the clonal spread with similar genetic make-up. [ 12 , 13 ]. Spa typing focuses on the sequence variation in the staphylococcal protein A gene, while MLST involves sequencing internal fragments of seven housekeeping genes to define sequence types (STs), providing detailed insights into the genetic relatedness, diversity, and evolutionary relationships of MRSA clones [ 3 ]. Multilocus Sequence typing is a highly discriminatory and widely used molecular typing method for S. aureus , especially for studying MRSA strains. This method is invaluable for tracking the global epidemiology, population structure, and evolution of MRSA, and understanding the spread of epidemic clones and the emergence of antimicrobial resistance. Rolo et al. investigated the genetic relatedness and transmission dynamics of MRSA isolates collected from a hospital outbreak in Portugal with MLST. The research revealed that a single MRSA clone that had acquired mobile genetic elements containing antibiotic-resistance genes caused the outbreak. This points out that S.aureus evolve and adapts using horizontal gene transfer. The study highlighted how mobile genetic elements contribute to the rapid spread of resistance traits among MRSA strains, emphasizing the importance of molecular epidemiologic tools like MLST in monitoring and controlling MRSA outbreaks in healthcare settings [ 14 ]. Hence, S. aureus strains of different origin were typed using MLST to compare them with the world isolates. 2. Methods This is a retrospective analytical study. We used S. aureus isolates from various sources stored in our repository. We obtained these isolates from: ▪ Clinical samples: Sputum, Bronchial aspirate, Blood, Endotracheal Tip, Foley’s catheter Tip and Pleural Fluid from patients in (e.g., OPD, Emergency, HDU and ICU wards). ▪ Surveillance sample, from healthcare workers and patients (e.g., Nose and Hand) and ▪ Environmental sample: From hospital surfaces (e.g., bed railings, switchboard, side table, and stethoscope). A total of a hundred isolates belonging to various categories were included in the study. The institutional Human Ethics Committee cleared up the project. We maintain the isolates in the repository in 16% Glycerol broth at -80ºC. We revived the isolates, reconfirmed them using conventional biochemical tests and MALDI-TOF and used them to study further. 2.1. DNA isolation DNA was isolated using HIMedia’s Genomic DNA Purification Kit (Cat. No MB505) according to the manufacturer’s instructions. Briefly, a 1.5 ml aliquot of overnight bacterial broth culture was taken in a 2 ml capped collection tube, centrifuged for 2 minutes at 13,000 rpm at room temperature, and the supernatant was removed and discarded. The pellet was resuspended in 200 µl of lysozyme solution and incubated for 30 minutes at 37°C. Then, 20 µl of Proteinase K solution and 20 µl of RNase A solution were added, mixed, and incubated for 5 minutes at room temperature. Next, 200 µl of Lysis Solution was added, vortexed for a few seconds and incubated at 55°C for 10 minutes. After incubation, 200 µl of ethanol (95–100%) was added to the lysate and vortexed for a few seconds. The lysate was then transferred onto a HiElute Miniprep Spin Column (capped) and centrifuged at 10,000 rpm for 1 minute at room temperature. The flow-through liquid was discarded, and the spin column was placed back into the same 2 ml collection tube. The column was washed with 500 µl of Prewash Solution followed by 500 µl of diluted Wash Solution. The flow-through was discarded, and the column was spun again at the same speed for 1 minute to dry the column. The column must be free of ethanol before eluting the DNA. The HiElute Miniprep Spin Column (capped) was transferred to a fresh, uncapped collection tube. Then, 200 µl of Elution Buffer was added directly into the column. After 1 minute of incubation at room temperature, the tube was centrifuged at 10,000 rpm for 1 minute at room temperature to elute the DNA. The eluate, containing pure genomic DNA, was transferred to a freshly capped 2 ml collection tube, labelled, and stored at -20°C for further tests. 2.2 Multilocus Sequence Typing (MLST): Fragments of seven housekeeping genes: arcC, aroE, glpF, gmk, pta, tpi, and yqiL were amplified using the Primers and methods given in the PUBMLST site. ( https://pubmlst.org/organisms/ staphylococcus aureus [ 15 ]. The final volume of 50µl of amplification mixture contained 1U Taq polymerase, 1X of PCR buffer (with MgCl2), 40pM of primers, 0.2 mM of dNTPs and 2 µl of DNA template. Primers for MLST and PCR conditions used are given in Table 1 .[ 13 ]. The amplified fragments were sequenced by outsourcing (BioServe Biotechnologies (India) Pvt Ltd, Hyderabad-500076). Table 1 Primers and PCR conditions for MLST genes Sequence (5’-3’) Product size (bp) PCR conditions arcC F: TTGATTCACCAGCGC GTATTGTC R: AGGTATCTGCTTCAATCAGCG 456 Initial Denaturation, 95 º C, 5 Min Denaturation, 95 º C, 1 Min Hybridization, 55 º C, 1 Min Elongation, 72 º C, 1 Min Final elongation,72 º C, 5 Min Number of cycles,30 aroE F: ATCGGAAATCCTATTTCACATTC R: GGTGTTGTATTAATA ACGATATC 456 glpF F: CTAGGAACTGCAATCTTAATCC R: TGGTAAAATCGCAT GTCCAATTC 465 gmk F: ATCGTTTTATCGGGACCATC R:TCATTAACTACAACG TAATCGTA 429 pta F: GTTAAAATCGTATTA CCTGAAGG R: GACCCTTTTGTTGAA AAGCTTAA 474 tpi F: TCGTTCATTCTGAAC GTCGTGAA R: TTTGCACCTTCTAAC AATTGTAC 402 yqiL F: CAGCATACAGGACA CCTATTGGC R: CGTTGAGGAATCGA TACTGGAAC 516 Allele sequences were uploaded to the Staphylococcus aureus MLST sequence database ( https://pubmlst.org/organisms/staphylococcus-aureus ) to determine the allele types and sequence types (ST). Using eBURST ( http://pubmlst.org/analysis ) , clonal complexes (CCs)were assigned. They were further defined as single-locus variants(SLVs) and double-locus variants (DLVs). All the isolates in the database were further analyzed according to the country, isolate types, etc. 3. Results A total of one hundred isolates of S. aureus present in the repository were revived and studied further. These isolates were from clinical samples from the patient (50), surveillance isolates from the patients and healthcare workers (40) and environmental isolates from hospital beds, bed railings, and side tables (10). All the hundred isolates were confirmed to be S. aureus by MALDI TOF MS. Fifty-two isolates were from males, 40 from females and 8 were from hospital beds, bed railings, side tables, switchboards, nursing stations, mobile phones and stethoscopes. 3.1. MLST: 3.1.1 Study Isolates: MLST was performed for 55 isolates. Isolates were from sputum (24), bronchoalveolar lavage (1), hand (8), nose (10), Pleural fluid (1), environmental Medical (9), urine (1), and Blood (1). Sequence types encountered were ST22 (4 ), ST5 (1), ST364 (1), ST1910 (1), ST5939 (1), ST5529 (1), ST7442 (1), ST672 (1), and ST9162 (1) (Table 2 ). New STs were submitted to the PUBMLST site and were assigned new sequence types. Forty colonizing isolates from carriers were obtained from nasal swabs (23) and hand swabs (17). MLST was performed on 18 of these. The isolates belonged to ST 364, ST1910, and ST 7442. Most of our isolates belonged to CC5 (Table 2 & Fig. 1 ). Burst analysis grouped the isolates into 4 groups and 24 singletons. Group 1 was the largest with 18 isolates belonging to 16 STs. All these belonged to clonal complex 5. The second group consisted of 9 isolates with 6 STs. Four of them were ST22. They belonged to CC22 (Fig. S1 ). Table 2 Sequence types of S. aureus isolates used in this study (n = 55) S.No Lab ID ST Type Sample Type Source Category Methicillin R/S Details (First isolation, Year, Country, etc) 1 609/23 22 Blood Clinical MRSA Ireland, 1993, CC 22, MRSA 2 496/23 5 Sputum Clinical MRSA England, 1997, carrier and Invasive, MSSA, CC5 3 3210/23 22 Sputum Clinical MRSA CC22 4 1475/22 22 Pleural fluid Clinical MRSA CC 22 5 2212/22 9411* Sputum Clinical MRSA SLV of ST6014, 2020, UK 6 4849/22 22 Sputum Clinical MRSA CC 22 7 3580/21 672 Sputum Clinical MSSA India 2003, 5 isolates, MRSA, later isolated from Iran, Egypt, Haiti, and Australia 8 3414/23 364 Nose Colonizer MSSA CC5, two isolates, one each from Japan, type unknown and present study 9 3950/23 1910 Nose Colonizer MSSA CC5, Human lung aspirate, Poland, 2005, MSSA 10 C3/23 9412* Nose Colonizer MSSA CC5, SLV of ST5 11 C16/24 9413* Hand Colonizer MSSA CC22, DLV of ST2892, UK, Blood, 2002 12 En3/23 5939 Bed railing swab Env MSSA CC5, single isolate, UK, 2019 13 3289/23 9453* Nose Colonizer MSSA CC5, SLV of 5529 14 C8/23 9414* Hand Colonizer MRSA New 15 1014/23 9415* Nose Colonizer MRSA New 16 2877/22 9445* Sputum Clinical MRSA New 17 C21/23 7442 Hand Colonizer MRSA Single isolate, Jordan 2018 carrier CC22 18 2186/22 9416* Bronchoalveolar lavage Clinical MSSA CC5,SLV of 5529 19 En1/23 9417* Switch swab Env MSSA CC5, DLV of ST4005, UK, 2016 Human 20 2211/22 9418* Sputum Clinical MRSA SLV of ST4313, England, 2017 21 1116/24 9438* Hand Colonizer MRSA CC5, DLV of ST5638, Ethiopia, 2018, Human 22 En8/23 9439* Side table swab Env MRSA New 23 980/22 9440* Sputum Clinical MRSA New 24 C26/23 9447* Hand Colonizer MRSA New 25 3317/23 9441* Sputum Clinical MRSA New 26 3397/22 9442* Sputum Clinical MRSA SLV of 9162, CC2 27 En7/23 9443* Bed surface swab Env MSSA CC5, DLV of ST950, China, 2006 28 En2/23 9454* Switch swab Env MSSA CC5, Origin from ST 860, Norway, human carrier, 2005 29 C6/23 9444* Nose Colonizer MSSA CC5, SLV of ST5529, China, Human carrier 30 En20/23 9455* Stethoscope Env MSSA CC5, DLV of ST9454 31 1216/14 9456* Hand Colonizer MRSA New 32 En4/23 9444* switch swab Env MSSA CC5, SLV of ST5529, China, Human carrier 33 C12/24 9446* Nose Colonizer MSSA CC5, SLV of ST4184, China, Food 34 3735/21 8914* Sputum Clinical MSSA CC5 descendent of ST5 35 1910/22 9444* Sputum Clinical MSSA CC5, SLV of ST5529, China, Human carrier 36 En25/23 9162 Stethoscope Env MRSA Single isolate, Netherlands, 2024 CC22 37 En6/23 9448* Mobile phone swab Env MSSA DLV of 6262, China, 1 carrier isolate from animal. 38 C4/23 9457* Nose Colonizer MSSA SLV of ST672, 39 3657/22 9458* Sputum Clinical MSSA New 40 1037/24 9449* Hand Coloniser MSSA Originated from ST672 41 2351/21 9459* Sputum Clinical MSSA New 42 4593/22 9450* Sputum Clinical MSSA CC5, DLV of ST6743, China, Human carrier, 2017 43 2260/21 9460* Sputum Clinical MSSA From ST 361 44 1050/21 9461* Sputum Clinical MSSA New 45 4626/22 9451* Sputum Clinical MRSA From ST12 46 3120/23 9462* Sputum Clinical MRSA New 47 3487/23 9463* Hand Colonizer MSSA From ST7371, Spain, 2015, Carrier isolate 48 384/23 9464* Sputum Clinical MRSA CC22, DLV of 2101, Spain, 2009 49 4861/23 9452* Urine Clinical MSSA CC5, SLV of ST5529, China, Carrier, Human faeces 50 4129/23 9465* Nose Colonizer MSSA CC5, SLV of ST9454 51 392/23 9466* Sputum Clinical MRSA CC5, DLV of ST462, 52 2918/23 9467* Nose Colonizer MRSA DLV of ST9444 (All study isolates 53 2302/22 9470* Sputum Clinical MSSA DLV of ST5638 54 2236/21 9469* Sputum Clinical MRSA CC22, DLV of ST636, single isolate from Algeria, 2004, wound swab 55 2196/21 9468* Sputum Clinical MSSA DLV of ST7077, Single isolate from Jordan, 2019, Environment Env - Environmental, MRSA - Methicillin resistant Staph. aureus , MSSA - Methicillin sensitive Staph. aureus, *- New STs from the study 3.1.2 Indian Isolates: There were 286 isolates of S. aureus in the PUBMLST site (accessed on 21st February 2025), of which 177 were human isolates. These 177 isolates were included for further analysis. The isolates were from patients suffering from various diseases, viz., Pharyngitis (33), wound (25), Invasive (unspecified) (33), Skin (13), Bacteremia (6), and Pneumonia (5), among others. Twenty isolates were from carriers, 18 of which were from the present study. Ninety-one isolates were MRSA. Burst analysis showed that these 177 isolates belonged to 12 groups, and 33 were singletons. (Fig S2 ). Group V was the largest with 45 isolates and 20 STs. ST 22 was the primary founder with 9 isolates, 13 SLVs and 4 DLVs. Group 1 was the second largest, having 39 isolates with 10 STs. ST 772 was the primary founder with 28 isolates, 6 SLVs and 2 DLVs. Group 3 was next with 16 isolates, 13 STs, and 239 was the primary founder with 10 SLVs and 2 DLVs. ST 772 was the commonest, with 28 isolates, followed by ST2371 (13), ST 22 (9), ST 672 (6), 3 each of ST1037, ST1713, ST30, and ST 368. There were 14 carrier isolates, of which 12 were from the present study. These belonged to ST1298, isolated in 2007, and ST772, isolated in 2009. Both were isolated from nasal swabs (Fig. 2 ). Most study carrier isolates had new sequences and were assigned new sequence types. 3.1.3 World Isolates: The PUBMLST website has 43,233 isolates in the database. (accessed on 20th February 2025), 11326 isolates from humans were included for further analysis. Most of the isolates were from Europe (4811), followed by North America (1266), Asia (2455), Africa (1095), and South America (769). In 44.3%, the disease was unknown. Amongst the known, carriers were a majority with 1734 (15.3%), followed by Invasive (unspecified) 1387(12.2%), bacteremia-1160 (10.2%), Skin infections-420 (3.7%), wound-394 (3.5%), etc. The samples from carriers were taken from the nose (1193), Skin (74), Feces (26), and Throat (18). The grape tree analysis showed that ST 5 was the most common (620), followed by ST 8 (423), ST 30 (313), ST 22 (274), ST 15 (205), ST 45 (201), etc. (Fig. 3 ). 3.1.4 Common Sequence Types (STs) from Around the World (Fig. 3 ) ST 5 was the most common amongst the world isolates with 618 isolates. It was first isolated from carriers in 1997 and then from Blood. The isolates were methicillin-sensitive. Later, they were isolated from all over the world. Only two isolates are available from India in the database. One was isolated from sputum from the present study. The other was from Pus. Both were MRSA. However, many STs were found in the present study, including ST364, ST1910, ST9412, ST5939, ST9416, and ST9417, which belonged to the same clonal complex 5 as ST5. ST 8 is the second most common, seen in 423 isolates. They were isolated from both carriers and patients. The first was isolated in 1997 from a patient with community-acquired blood infection in Oxford (UK). It was MSSA. ST 30 was the third most common amongst the world isolates, with 313 isolates, and was first seen in England, UK, in 1997. Later, about 49 isolates were observed from Canada and other countries from 2002 to 2014. In India, it has been seen in only 3 isolates. ST 22 (CC22) with 266 isolates was first identified in Ireland in 1993. Later, in 1997, it was seen in a blood isolate. ST15 Two hundred and five isolates are present in the database. It was first isolated in 1997 from the blood of a patient in Oxford (UK) and was methicillin-sensitive. From then on, many Invasive isolates (66), carriers (58), Bacteremia (13) and others were observed. 3.1.5 Indian Scenario ST 772 (28) of CC1 was the most common among the Indian STs. It was isolated in India from human pus in 2003, followed by isolation from Bangladesh (wound swab), a neighboring country to India, in 2004, the Netherlands, and Norway (biopsy). It has been prevalent in India since then. However, this was not found in the present study. ST 2371 (CC2) was the next abundant ST from India. Only 14 isolates are present in the database, thirteen are from India. It was first isolated from the United Kingdom (UK) from a skin swab of a carrier in 2011. In India, it was isolated in 2012, mainly from skin infections. Two of these were from Mysuru, from recurrent furunculosis. ST 22 with five isolates was seen from blood in 2019 from Lucknow, Uttar Pradesh. These were all MRSA. ST 672 Twelve isolates are present in the database, of which 5 are from India. It was first seen in India in 2003 and then in 2007. Thereafter, it was seen in 2010 in Iran (3), in 2014 in Haiti (1), Egypt (1) in 2021 and Australia (2) in 2022. Only one isolate was observed in the present study. ST 1037 (CC22) was the third common with 7 isolates. It was first isolated from Algeria (n-3), all from nasal carriers. In India (3), it was from eye suppuration in 2012. ST 1713 with 4 isolates was first observed in 2009 in the UK. In 2011, it was seen in India in isolates from pharyngitis cases. ST 30 was seen in 3 cases, one each from invasive, internal abscess and pharyngitis cases. 3.1.6 STs from Carrier Isolates (Figs. 4 & 5 ) One thousand seven hundred and thirty-four world isolates from humans were from carriers. The majority were from the UK (275), followed by Germany (265), the USA (141), Switzerland (137), China (121), and India (20). Amongst the continents, Europe was the foremost (893) followed by Africa (287), Asia (283), North America (146) and South America (101). ST 22 (99) was the most abundant, followed by ST 30 (92), ST45 (79), ST5 (68), and ST 15(58). The majority (89%) were MSSA. Fifty-five per cent of Indian carrier isolates were MSSA (Fig. 4). In the present study, we had 40 carrier isolates, of which 15 were MRSA and 25 were MSSA. MLST was performed in 18 isolates, 15 of which were new STs identified only in this study. Three were SLVs of ST 5, i.e., ST 9412, ST 1910, and ST 364. One (ST 7442) was an SLV of ST 22, and the other ST 9413 was a DLV of ST 22. (Table 2 & Fig. 5 ) 4. Discussion Multilocus sequence typing is a highly discriminatory and widely used molecular typing method for S. aureus , especially for studying MRSA strains. MLST provides detailed insights into the genetic relatedness, diversity, and evolutionary relationships of MRSA clones. This helps in tracking the global epidemiology, population structure, and evolution of MRSA, as well as understanding the spread of epidemic clones and the emergence of antimicrobial resistance. It influences complications, severity and mortality [ 16 ]. Moreover, unlike PFGE, it is an absolute method, the results of which can be compared without having any inter-laboratory variations. Isolates belonging to ST 5 of CC5 were the most abundant among the world isolates. Multiple clones belonging to CC5 MRSA cause hospital-associated infections in the Western Hemisphere [ 17 ]. It has undergone genetic variation to be classified under 4 clades. CC5 Basal comprises ST 5, ST100, ST 1125, ST 1184, ST 1186, and ST 2625. Other clades included CC5-I, CC5-II and CC5-IIb. Chen et al studied the Asian isolates of S. aureus ST5 and found the isolates belonging to 5 clades. There was an overlap of the clades when compared to the Western clades. However, Asian strains showed higher carriage and coexistence rates of tst , sec , and sel genes compared to MRSA strains isolated in North America and European countries [ 18 ]. Clades I-IV showed enterotoxin genes found in blaZ plasmids. [ 19 ]. This suggests that ST5-MRSA isolates cluster by geographical location because of a combination of enterotoxin genes. The ST5 New York/Japan clone represents the worldwide clade. Genetic traits of the American clade I were like Asian clade III, which belongs to the New York/Japan clone, while Asian clade II considerably differed from the New York/Japan clone. The ST5-MSSA from China, having a different genetic make-up, differed from its MRSA counterpart and was grouped into clade IVA. This clade was found all over the world. Therefore, it is reasonable to conclude that the extracellular polymeric substances (EPS) and gene content of clade IV are higher than those of clades II and III. Genomic analysis of clades II, III, and IV suggested that mobile genetic elements (MGEs) contributed to these three clades. Moreover, due to the separation of virulence from resistance genes, the spread of these genes among S. aureus populations was confined by genetic pressure, thus delaying the emergence of fully virulent and resistant strains [ 18 ]. In the present study, many of our isolates belonged to CC5, with many being new ST types. They were of different origins and differed in their resistance pattern. This finding shows that CC5 is still evolving and causing serious hospital infections. However, it is not so prevalent among the other Indian isolates. ST22 MRSA clone has replaced the common clones and has spread from the United Kingdom to Europe, Asia, Africa, Australia/New Zealand, and the Middle East [ 20 – 22 ]. Of particular concern is that ST22-MRSA, which contains the lukS/F gene (encoding the Panton-Valentine leucocidin), is causing severe infections. ST22 strains belong to three major clades (I–III), consistent with previous studies [ 23,24]. However, a new clade, subclade IIc, in China was introduced from abroad. Among them, the ST22 SCC mec IVa clone carrying both pvl and tst displayed significantly higher in vitro and in vivo virulence than other clades/subclades of ST22 strains and other strains prevalent in China. A similar hyper-virulent ST22 was found in Japan. Fukuoka clone I (one PVL gene and one TSST-1 gene), Fukuoka clone II (addition of a TSST-1 gene to Fukuoka clone I), and Fukuoka clone III ( chromosomal inversion of a large region from Fukuoka clone II) were found among the ST22-PT clones. The study revealed dynamic genetic recombination among MRSA strains and showed that most genomic alterations can occur without delay [ 25 ]. In the present study, we found 4 isolates of ST22 from clinical samples, and all were MRSA. However, ST 22 was found in clinical settings and among carriers globally. Two of our isolates harbored PVL and Hla , all had SPA and Fnb A (data not shown). ST22 MRSA IV clones were seen in Bangalore, India, from Hospital and community isolates [ 26 ]. Since we have not done the SCC-Mec typing, we cannot place it in any clade. However, being MRSA and having the virulent genes make it a hypervirulent ST 22 strain. Most of the study isolates were new, and we could not compare them to existing isolates in the country or world. 5. Conclusion MRSA was isolated from various types of samples in the hospital. STs found in our study belonged to the prevalent worldwide clones. We had novel STs, but they were variants of the known STs. Hence, clones, especially CC5 and CC22, are evolving, becoming multi-drug resistant and producing virulent factors leading to treatment failure in hospitals. Complications, severity, and mortality in patients are impacted by the genotype of S.aureus . Hence, sequence typing should be undertaken to know the local STs, which will help understand the evolution of the types. Efficient infection control and surveillance strategies should be developed to monitor and control its transmission, more importantly, in the hospital. There should be a curb on the availability of over-the-counter antibiotics so that MRSA can be controlled, if not eradicated. Declarations Ethical Approval: The institutional ethics committee approved the study. Ref: VPCI/DIR/IHEC/2023/249. Consent for publication: Not applicable Funding: No external funding was received for this study. Competing interests : The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Author contributions: MS conceptualized the research, reviewed the world data in the MLST database and wrote the manuscript AN performed the experiments, tabulated the results, and wrote the original draft. References Lowy, F. D. Staphylococcus aureus infections. N. Engl. J. Med.1998; 339, 520–532 Kreiswirth BN, Kornblum J, Arbeit RD, Goering RV, Hargrave J, Kreiswirth RN, et al. The role of Staphylococcus aureus in the development of hospital-acquired infections. J Clin Microbiol. 1993;31(4):786–9. Harris SR, Smith DL, Johnson JD, Brown TM, Lee RG, Taylor PA, et al. Methicillin-resistant Staphylococcus aureus in the United States. N Engl J Med. 2002; 346: 493 501. Otto M. Coagulase-negative staphylococci as reservoirs of genes facilitating MRSA infection: Staphylococcal commensal species such as Staphylococcus epidermidis are being recognized as important sources of genes promoting MRSA colonization and virulence. Bioessays. 2013; 35(1): 4–11. Kluytmans JA, van Belkum A, Verbrugh H. Prevalence of nasal carriage of Staphylococcus aureus in healthy individuals. J Clin Microbiol. 1997;35(7):1454–7. Wertheim HF, Melles DC, Vos MC, van Leeuwen W, van Belkum A, Verbrugh HA, et al. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect Dis. 2005; 5(12): 751 – 62. doi: 10.1016/S1473-3099(05)70295-4 . PMID: 16310147 Martin RM, Cao J, Brisse S, Passet V, Wu W, Zhao L, et al. Molecular Epidemiology of Colonizing and Infecting Isolates of Klebsiella pneumoniae . mSphere. 2016;1(5):e00261-16. doi: 10.1128/mSphere.00261-16 . Larsen AR, Sloth BK, Agersø Y, Larsen J, Torfs H, Skov R, et al. Characterization of Staphylococcus aureus isolated from the environment. J Clin Microbiol. 2006;44(4):1226–34. Perry JD, Galloway A. Detection of MRSA in hospitals. J Hosp Infect. 2009;73(4):378–86. Anderson M, Smith J, Brown T, Taylor R, Johnson P. Environmental reservoirs of Staphylococcus aureus and infection risk. J Environ Health. 2015;77(1):24–30. Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus . Clin Microbiol Infect. 2007;13(3):222 – 35. doi: 10.1111/j.1469-0691.2006.01573.x . PMID: 17391376. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999;29(5):1128–32. Enright, M. C., Day, N. P., Davies, C. E., Peacock, S. J., & Spratt, B. G. (2000). Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus . Journal of Clinical Microbiology, 38(3), 1008–1015. Rolo J, Miragaia M, Turlej-Rogacka A, Empel J, Bouchami O, Faria NA, et al. High prevalence of international methicillin-resistant Staphylococcus aureus clones in a Portuguese hospital: establishing transmission chains by MLST. Microorganisms. 2020;8(2):163. doi: 10.3390/microorganisms8020163 Jolley KA, Bray JE, Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018;3:124. doi: 10.12688/wellcomeopenres.14826.1 . PMID: 30345391; PMCID: PMC6192448. Li X, Huang T, Xu K, Li C, Li Y. Molecular characteristics and virulence gene profiles of Staphylococcus aureus isolates in Hainan, China. BMC Infect Dis. 2019; 19(1): 873. doi: 10.1186/s12879-019-4547-5 . PMID: 31640587; PMCID: PMC6805582. Challagundla L, Reyes J, Rafiqullah I, Sordelli DO, Echaniz-Aviles G, Velazquez Meza ME, et al. Phylogenomic Classification and the Evolution of Clonal Complex 5 Methicillin-Resistant Staphylococcus aureus in the Western Hemisphere. Front Microbiol. 2018; 9: 1901. doi: 10.3389/fmicb.2018.01901 . PMID: 30186248; PMCID: PMC6113392. Chen F, Yin Y, Chen H, Wang R, Wang S, Wang H. Global genetic diversity and Asian clades evolution: a phylogeographic study of Staphylococcus aureus sequence type 5. Antimicrob Agents Chemother. 2024; 68(3): e0117523. doi: 10.1128/aac.01175-23 . Epub 2024. PMID: 38259089; PMCID: PMC10916392. Fisher EL, Otto M, Cheung GYC. Basis of virulence in enterotoxin-mediated Staphylococcal food poisoning. Front Microbiol. 2018; 9: 436. doi: 10.3389/fmicb.2018.00436 Holden MTG, Hsu L-Y, Kurt K, Weinert LA, Mather AE, Harris SR, et al. A genomic portrait of the emergence, evolution, and global spread of a methicillin-resistant Staphylococcus aureus pandemic. Genome Res. 2013;23(5):653–64. doi: 10.1101/gr.147710.112 . Hsu L-Y, Harris SR, Chlebowicz MA, Lindsay JA, Koh T-H, Krishnan P, et al. Evolutionary dynamics of methicillin-resistant Staphylococcus aureus within a healthcare system. Genome Biol. 2015;16:81. doi: 10.1186/s13059-015-0643-z . Knight GM, Budd EL, Whitney L, Thornley A, Al-Ghusein H, Planche T, et al. Shift in dominant hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) clones over time. J Antimicrob Chemother. 2012;67(10):2514–22. doi: 10.1093/jac/dks245 . Gostev V, Ivanova K, Kruglov A, Kalinogorskaya O, Ryabchenko I, Zyryanov S, et al. Comparative genome analysis of global and Russian strains of community-acquired methicillin-resistant Staphylococcus aureus ST22, a “Gaza clone.” Int J Antimicrob Agents 2021; 57: 106264. Zhao H, Wu X, Wang B, Shen L, Rao L, Wang X, et al. Phenotypic and genomic analysis of the hypervirulent ST22 methicillin-resistant Staphylococcus aureus in China. mSystems. 2023. 8: e01242-22. Yamaguchi T, Furuno K, Komori K, Abe T, Sato T, Ito T, et al. Evolutionary dynamics of the novel ST22-PT methicillin-resistant Staphylococcus aureus clone co-harbouring Panton–Valentine leukocidin and duplicated toxic shock syndrome toxin 1 genes. Clin Microbiol Infect. 2024;30(7): 779.e1-779.e6. Shambat S, Nadig S, Prabhakara S, Bes M, Etienne J, Arakere G. Clonal complexes and virulence factors of Staphylococcus aureus from several cities in India. BMC Microbiol. 2012; 12: 64. Additional Declarations No competing interests reported. Supplementary Files FIGS1.docx FIGS2.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6712641","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":465065380,"identity":"c3a9d2a1-fc39-40d2-8fb5-5b2a47d5583d","order_by":0,"name":"Azra Naseem","email":"","orcid":"","institution":"University of Delhi","correspondingAuthor":false,"prefix":"","firstName":"Azra","middleName":"","lastName":"Naseem","suffix":""},{"id":465065381,"identity":"a3a67698-4006-442a-a4bc-628e8daefa7b","order_by":1,"name":"Malini Shariff","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIie2PMQrCMBSGX3Fw6QG8hJCpLqE9iEtKIE5CRweHOrl4AC8hOAluTwJO1awFF7s4Ky4ODiZRRIdG3ATzEUjy8z7+BMDj+UkaOQIBswAHlOotGKFbCV6UQohH8kGxm1GgENJenEp7vBrJLIOk09xUiEzFs7HULUParVOiIs3llEC6nPSIVnZ8oROEtejndQpqJSTACAqQp8uOmwSDXNYrqrJKQtQBdMuWm8StlPeWYF4Ko2Bskg+KbWml89K2cGYSZK6/KC7P4ZXqh4nGEVmcRKpX7Y9DWqs8aD1PqZ1k7vF3km+GPR6P5z+4AUr8bpDSIYtqAAAAAElFTkSuQmCC","orcid":"","institution":"University of Delhi","correspondingAuthor":true,"prefix":"","firstName":"Malini","middleName":"","lastName":"Shariff","suffix":""}],"badges":[],"createdAt":"2025-05-21 05:23:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6712641/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6712641/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83913066,"identity":"40ee11a8-3d31-4f01-98f0-c1a4fa1ab0e8","added_by":"auto","created_at":"2025-06-04 12:15:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":280567,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMinimal spanning tree(MS Tree) of MLST data of Study\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e S. aureus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e isolates\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/5c218f7de785e8aa3c88d86d.png"},{"id":83913065,"identity":"440ac32d-cd2b-4edc-bd15-f60fc29a7371","added_by":"auto","created_at":"2025-06-04 12:15:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":272574,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMinimal spanning tree (MS Tree) of MLST data on Indian isolates of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS. aureus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e showing the sequence types\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/6ec6c201c8d8355b9facde72.png"},{"id":83913061,"identity":"9a2a4edd-64cd-417e-9330-8f242515f476","added_by":"auto","created_at":"2025-06-04 12:15:19","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":153070,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMinimal spanning tree (MS Tree) of MLST data showing population snapshot of the world\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS. aureus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eisolates showing the sequence types\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/764871082cb9f60fcf1e126f.jpeg"},{"id":83913064,"identity":"557a268f-8889-40b1-986e-1b2f7f6bc6ea","added_by":"auto","created_at":"2025-06-04 12:15:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":224796,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMinimal Spanning Tree (MS Tree) of MLST data showing population snapshot of the world carrier isolates of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e\u0026nbsp;S. aureus \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eisolates\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/c620579bb73bbec39b5ecf60.png"},{"id":83913551,"identity":"7a381599-aa19-4c9d-8022-5613701c423b","added_by":"auto","created_at":"2025-06-04 12:23:19","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":92986,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMinimal spanning tree (MS Tree) of MLST data showing Study carrier isolates of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS. aureus\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/6d8c166fb02e9a1d79e4bb71.jpeg"},{"id":83914510,"identity":"460197a9-34b8-4272-8cc2-657e4e2e30c8","added_by":"auto","created_at":"2025-06-04 12:31:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2226608,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/93c73586-b0ce-4ade-9fc1-e0b12958d323.pdf"},{"id":83913552,"identity":"abab3f46-1f62-4e77-8b8e-2be5f83be52f","added_by":"auto","created_at":"2025-06-04 12:23:19","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":239086,"visible":true,"origin":"","legend":"","description":"","filename":"FIGS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/e5c725d500e913caf9e2384d.docx"},{"id":83913062,"identity":"75a25637-012f-439d-a952-33f9289b344d","added_by":"auto","created_at":"2025-06-04 12:15:19","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":120702,"visible":true,"origin":"","legend":"","description":"","filename":"FIGS2.docx","url":"https://assets-eu.researchsquare.com/files/rs-6712641/v1/c61bcb38a405343b900885b1.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eMolecular typing of clinical, colonizing, and environmental isolates of Staphylococcus aureus and comparison with World isolates\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS.aureus\u003c/em\u003e) colonizes the nasal cavity, skin, and other mucosal surfaces of humans [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It can cause various infections, including skin and soft tissue infections, bacteremia, endocarditis, and osteomyelitis [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It causes hospital-acquired infections. The emergence of Methicillin-resistant \u003cem\u003eS.aureus\u003c/em\u003e (MRSA) in hospitals, causing severe infections, poses challenges for treatment [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Apart from healthcare-related MRSA (HA-MRSA), community-associated MRSA (CA-MRSA) strains are a source of infections in society. CA-MRSA strains often differ genetically from HA-MRSA strains and are associated with distinct risk factors and clinical manifestations [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Understanding genetic and phenotypic differences between these strains is essential for focused treatment and preventative plans.\u003c/p\u003e \u003cp\u003eNasal carriage of \u003cem\u003eS. aureus\u003c/em\u003e is a well-documented phenomenon, with about 20\u0026ndash;30% of healthy people being persistent carriers [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Colonizers may not exhibit symptoms but serve as reservoirs for the bacterium, potentially leading to infection if the bacteria enter through breaks in the skin or mucous membranes. Various factors, including host genetics, immune response, and environmental conditions, influence the colonization of \u003cem\u003eS.aureus\u003c/em\u003e. [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Colonizing strains can be either methicillin-sensitive or methicillin-resistant, and their presence can influence the dynamics of infection spread in communities and healthcare settings. Molecular characterization of colonizing strains helps in identifying potential reservoirs and developing strategies for decolonization to prevent infection [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Environmental isolates of \u003cem\u003eS. aureus\u003c/em\u003e are found in diverse settings, including hospitals, community environments, and natural habitats [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Healthcare environments, surfaces, medical equipment, and hands of healthcare workers can harbour \u003cem\u003eS. aureus\u003c/em\u003e, contributing to its transmission [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The ability of \u003cem\u003eS. aureus\u003c/em\u003e to survive in various environmental conditions and its potential to colonize both human hosts and environmental surfaces highlight the importance of effective cleaning and disinfection protocols. In community settings, environmental reservoirs such as gyms, schools, and public transportation can also serve as sources of \u003cem\u003eS. aureus\u003c/em\u003e infections. The environmental persistence of \u003cem\u003eS. aureus\u003c/em\u003e poses a challenge to public health, emphasizing the need for ongoing surveillance and preventative measures [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe characterization and typing of \u003cem\u003eS. aureus\u003c/em\u003e isolates are essential for several reasons: Identifying and tracking the spread of strains helps in understanding the epidemiology of infections and monitoring trends in antibiotic resistance [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Molecular typing allows for the investigation of outbreaks by linking isolates from patients, environments, and carriers, and facilitating targeted interventions. To develop efficient infection control measures, it is necessary to know the resistance and genetic makeup of the \u003cem\u003eS. aureus. S. aureus\u003c/em\u003e isolates can be distinguished using different techniques, each with a distinct advantage and drawback. PCR-based methods, such as spa typing and multi-locus sequence typing (MLST), help to track the clonal spread with similar genetic make-up. [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Spa typing focuses on the sequence variation in the staphylococcal protein A gene, while MLST involves sequencing internal fragments of seven housekeeping genes to define sequence types (STs), providing detailed insights into the genetic relatedness, diversity, and evolutionary relationships of MRSA clones [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Multilocus Sequence typing is a highly discriminatory and widely used molecular typing method for \u003cem\u003eS. aureus\u003c/em\u003e, especially for studying MRSA strains. This method is invaluable for tracking the global epidemiology, population structure, and evolution of MRSA, and understanding the spread of epidemic clones and the emergence of antimicrobial resistance. Rolo et al. investigated the genetic relatedness and transmission dynamics of MRSA isolates collected from a hospital outbreak in Portugal with MLST. The research revealed that a single MRSA clone that had acquired mobile genetic elements containing antibiotic-resistance genes caused the outbreak. This points out that S.aureus evolve and adapts using horizontal gene transfer. The study highlighted how mobile genetic elements contribute to the rapid spread of resistance traits among MRSA strains, emphasizing the importance of molecular epidemiologic tools like MLST in monitoring and controlling MRSA outbreaks in healthcare settings [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Hence, S. aureus strains of different origin were typed using MLST to compare them with the world isolates.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003eThis is a retrospective analytical study. We used \u003cem\u003eS. aureus\u003c/em\u003e isolates from various sources stored in our repository. We obtained these isolates from: ▪ Clinical samples: Sputum, Bronchial aspirate, Blood, Endotracheal Tip, Foley\u0026rsquo;s catheter Tip and Pleural Fluid from patients in (e.g., OPD, Emergency, HDU and ICU wards). ▪ Surveillance sample, from healthcare workers and patients (e.g., Nose and Hand) and ▪ Environmental sample: From hospital surfaces (e.g., bed railings, switchboard, side table, and stethoscope). A total of a hundred isolates belonging to various categories were included in the study. The institutional Human Ethics Committee cleared up the project. We maintain the isolates in the repository in 16% Glycerol broth at -80\u0026ordm;C. We revived the isolates, reconfirmed them using conventional biochemical tests and MALDI-TOF and used them to study further.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. DNA isolation\u003c/h2\u003e \u003cp\u003eDNA was isolated using HIMedia\u0026rsquo;s Genomic DNA Purification Kit (Cat. No MB505) according to the manufacturer\u0026rsquo;s instructions. Briefly, a 1.5 ml aliquot of overnight bacterial broth culture was taken in a 2 ml capped collection tube, centrifuged for 2 minutes at 13,000 rpm at room temperature, and the supernatant was removed and discarded. The pellet was resuspended in 200 \u0026micro;l of lysozyme solution and incubated for 30 minutes at 37\u0026deg;C. Then, 20 \u0026micro;l of Proteinase K solution and 20 \u0026micro;l of RNase A solution were added, mixed, and incubated for 5 minutes at room temperature. Next, 200 \u0026micro;l of Lysis Solution was added, vortexed for a few seconds and incubated at 55\u0026deg;C for 10 minutes. After incubation, 200 \u0026micro;l of ethanol (95\u0026ndash;100%) was added to the lysate and vortexed for a few seconds. The lysate was then transferred onto a HiElute Miniprep Spin Column (capped) and centrifuged at 10,000 rpm for 1 minute at room temperature. The flow-through liquid was discarded, and the spin column was placed back into the same 2 ml collection tube. The column was washed with 500 \u0026micro;l of Prewash Solution followed by 500 \u0026micro;l of diluted Wash Solution. The flow-through was discarded, and the column was spun again at the same speed for 1 minute to dry the column. The column must be free of ethanol before eluting the DNA. The HiElute Miniprep Spin Column (capped) was transferred to a fresh, uncapped collection tube. Then, 200 \u0026micro;l of Elution Buffer was added directly into the column. After 1 minute of incubation at room temperature, the tube was centrifuged at 10,000 rpm for 1 minute at room temperature to elute the DNA. The eluate, containing pure genomic DNA, was transferred to a freshly capped 2 ml collection tube, labelled, and stored at -20\u0026deg;C for further tests.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Multilocus Sequence Typing (MLST):\u003c/h2\u003e \u003cp\u003eFragments of seven housekeeping genes: \u003cem\u003earcC, aroE, glpF, gmk, pta, tpi, and yqiL\u003c/em\u003e were amplified using the Primers and methods given in the PUBMLST site. (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmlst.org/organisms/\u003c/span\u003e\u003cspan address=\"https://pubmlst.org/organisms/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e staphylococcus aureus [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The final volume of 50\u0026micro;l of amplification mixture contained 1U Taq polymerase, 1X of PCR buffer (with MgCl2), 40pM of primers, 0.2 mM of dNTPs and 2 \u0026micro;l of DNA template. Primers for MLST and PCR conditions used are given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The amplified fragments were sequenced by outsourcing (BioServe Biotechnologies (India) Pvt Ltd, Hyderabad-500076).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and PCR conditions for MLST\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eProduct size\u003c/p\u003e \u003cp\u003e(bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR conditions\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003earcC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TTGATTCACCAGCGC GTATTGTC\u003c/p\u003e \u003cp\u003eR: AGGTATCTGCTTCAATCAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e456\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"6\" rowspan=\"7\"\u003e \u003cp\u003eInitial Denaturation, 95\u003csup\u003e\u0026ordm;\u003c/sup\u003eC, 5 Min\u003c/p\u003e \u003cp\u003eDenaturation, 95\u003csup\u003e\u0026ordm;\u003c/sup\u003eC, 1 Min\u003c/p\u003e \u003cp\u003eHybridization, 55\u003csup\u003e\u0026ordm;\u003c/sup\u003eC, 1 Min\u003c/p\u003e \u003cp\u003eElongation, 72\u003csup\u003e\u0026ordm;\u003c/sup\u003eC, 1 Min\u003c/p\u003e \u003cp\u003eFinal elongation,72\u003csup\u003e\u0026ordm;\u003c/sup\u003eC, 5 Min\u003c/p\u003e \u003cp\u003eNumber of cycles,30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003earoE\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATCGGAAATCCTATTTCACATTC\u003c/p\u003e \u003cp\u003eR: GGTGTTGTATTAATA ACGATATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e456\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eglpF\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTAGGAACTGCAATCTTAATCC\u003c/p\u003e \u003cp\u003eR: TGGTAAAATCGCAT GTCCAATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e465\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egmk\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATCGTTTTATCGGGACCATC\u003c/p\u003e \u003cp\u003eR:TCATTAACTACAACG TAATCGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e429\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epta\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GTTAAAATCGTATTA CCTGAAGG\u003c/p\u003e \u003cp\u003eR: GACCCTTTTGTTGAA AAGCTTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e474\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etpi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCGTTCATTCTGAAC GTCGTGAA\u003c/p\u003e \u003cp\u003eR: TTTGCACCTTCTAAC AATTGTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e402\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eyqiL\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CAGCATACAGGACA CCTATTGGC\u003c/p\u003e \u003cp\u003eR: CGTTGAGGAATCGA TACTGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e516\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAllele sequences were uploaded to the \u003cem\u003eStaphylococcus aureus\u003c/em\u003e MLST sequence database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmlst.org/organisms/staphylococcus-aureus\u003c/span\u003e\u003cspan address=\"https://pubmlst.org/organisms/staphylococcus-aureus\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e to determine the allele types and sequence types (ST). Using eBURST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://pubmlst.org/analysis\u003c/span\u003e\u003cspan address=\"http://pubmlst.org/analysis\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, clonal complexes (CCs)were assigned. They were further defined as single-locus variants(SLVs) and double-locus variants (DLVs). All the isolates in the database were further analyzed according to the country, isolate types, etc.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003eA total of one hundred isolates of \u003cem\u003eS. aureus\u003c/em\u003e present in the repository were revived and studied further. These isolates were from clinical samples from the patient (50), surveillance isolates from the patients and healthcare workers (40) and environmental isolates from hospital beds, bed railings, and side tables (10). All the hundred isolates were confirmed to be \u003cem\u003eS. aureus\u003c/em\u003e by MALDI TOF MS. Fifty-two isolates were from males, 40 from females and 8 were from hospital beds, bed railings, side tables, switchboards, nursing stations, mobile phones and stethoscopes.\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e3.1. MLST:\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e3.1.1 Study Isolates:\u003c/h2\u003e \u003cp\u003eMLST was performed for 55 isolates. Isolates were from sputum (24), bronchoalveolar lavage (1), hand (8), nose (10), Pleural fluid (1), environmental Medical (9), urine (1), and Blood (1). Sequence types encountered were ST22 (4 ), ST5 (1), ST364 (1), ST1910 (1), ST5939 (1), ST5529 (1), ST7442 (1), ST672 (1), and ST9162 (1) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). New STs were submitted to the PUBMLST site and were assigned new sequence types. Forty colonizing isolates from carriers were obtained from nasal swabs (23) and hand swabs (17). MLST was performed on 18 of these. The isolates belonged to ST 364, ST1910, and ST 7442. Most of our isolates belonged to CC5 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026amp; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Burst analysis grouped the isolates into 4 groups and 24 singletons. Group 1 was the largest with 18 isolates belonging to 16 STs. All these belonged to clonal complex 5. The second group consisted of 9 isolates with 6 STs. Four of them were ST22. They belonged to CC22 (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence types of \u003cem\u003eS. aureus\u003c/em\u003e isolates used in this study (n\u0026thinsp;=\u0026thinsp;55)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eS.No\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLab ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eST Type\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSample\u003c/p\u003e \u003cp\u003eType\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSource Category\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMethicillin R/S\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDetails (First isolation, Year, Country, etc)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e609/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBlood\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIreland, 1993,\u003c/p\u003e \u003cp\u003eCC 22, MRSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e496/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eEngland, 1997, carrier and Invasive, MSSA, CC5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3210/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1475/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePleural fluid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC 22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2212/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9411*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSLV of ST6014, 2020, UK\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4849/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC 22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3580/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e672\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIndia 2003, 5 isolates, MRSA, later isolated from Iran, Egypt, Haiti, and Australia\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3414/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e364\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, two isolates, one each from Japan, type unknown and present study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3950/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1910\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, Human lung aspirate, Poland, 2005, MSSA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC3/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9412*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC16/24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9413*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC22, DLV of ST2892, UK, Blood, 2002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn3/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5939\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBed railing swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, single isolate, UK, 2019\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3289/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9453*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of 5529\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC8/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9414*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1014/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9415*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2877/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9445*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC21/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7442\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSingle isolate, Jordan 2018 carrier CC22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2186/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9416*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBronchoalveolar lavage\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5,SLV of 5529\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn1/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9417*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSwitch swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST4005, UK, 2016 Human\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2211/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9418*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSLV of ST4313, England, 2017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1116/24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9438*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST5638, Ethiopia, 2018, Human\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn8/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9439*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSide table swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e980/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9440*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC26/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9447*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3317/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9441*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3397/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9442*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSLV of 9162, CC2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn7/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9443*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBed surface swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST950, China, 2006\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn2/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9454*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSwitch swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, Origin from ST 860, Norway, human carrier, 2005\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC6/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9444*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST5529, China, Human carrier\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn20/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9455*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStethoscope\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST9454\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1216/14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9456*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn4/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9444*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eswitch swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST5529, China, Human carrier\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC12/24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9446*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST4184, China, Food\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3735/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8914*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5 descendent of ST5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1910/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9444*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST5529, China, Human carrier\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn25/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eStethoscope\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSingle isolate, Netherlands, 2024 CC22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEn6/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9448*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMobile phone swab\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEnv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDLV of 6262, China, 1 carrier isolate from animal.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC4/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9457*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSLV of ST672,\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3657/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9458*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1037/24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9449*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColoniser\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eOriginated from ST672\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2351/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9459*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4593/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9450*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST6743, China, Human carrier, 2017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2260/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9460*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFrom ST 361\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1050/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9461*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4626/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9451*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFrom ST12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3120/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9462*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNew\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3487/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9463*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFrom ST7371, Spain, 2015, Carrier isolate\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e384/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9464*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC22, DLV of 2101, Spain, 2009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4861/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9452*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUrine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST5529, China, Carrier, Human faeces\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4129/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9465*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, SLV of ST9454\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e392/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9466*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC5, DLV of ST462,\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2918/23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9467*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eColonizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDLV of ST9444 (All study isolates\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2302/22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9470*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDLV of ST5638\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2236/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9469*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMRSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCC22, DLV of ST636, single isolate from Algeria, 2004, wound swab\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2196/21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9468*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSputum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eClinical\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMSSA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDLV of ST7077, Single isolate from Jordan, 2019, Environment\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEnv\u003c/b\u003e- Environmental, \u003cb\u003eMRSA\u003c/b\u003e- Methicillin resistant \u003cem\u003eStaph. aureus\u003c/em\u003e, \u003cb\u003eMSSA\u003c/b\u003e- Methicillin sensitive \u003cem\u003eStaph. aureus, *-\u003c/em\u003eNew STs from the study\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e3.1.2 Indian Isolates:\u003c/h2\u003e \u003cp\u003eThere were 286 isolates of \u003cem\u003eS. aureus\u003c/em\u003e in the PUBMLST site (accessed on 21st February 2025), of which 177 were human isolates. These 177 isolates were included for further analysis. The isolates were from patients suffering from various diseases, viz., Pharyngitis (33), wound (25), Invasive (unspecified) (33), Skin (13), Bacteremia (6), and Pneumonia (5), among others. Twenty isolates were from carriers, 18 of which were from the present study. Ninety-one isolates were MRSA.\u003c/p\u003e \u003cp\u003eBurst analysis showed that these 177 isolates belonged to 12 groups, and 33 were singletons. (Fig \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Group V was the largest with 45 isolates and 20 STs. ST 22 was the primary founder with 9 isolates, 13 SLVs and 4 DLVs. Group 1 was the second largest, having 39 isolates with 10 STs. ST 772 was the primary founder with 28 isolates, 6 SLVs and 2 DLVs. Group 3 was next with 16 isolates, 13 STs, and 239 was the primary founder with 10 SLVs and 2 DLVs.\u003c/p\u003e \u003cp\u003eST 772 was the commonest, with 28 isolates, followed by ST2371 (13), ST 22 (9), ST 672 (6), 3 each of ST1037, ST1713, ST30, and ST 368. There were 14 carrier isolates, of which 12 were from the present study. These belonged to ST1298, isolated in 2007, and ST772, isolated in 2009. Both were isolated from nasal swabs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Most study carrier isolates had new sequences and were assigned new sequence types.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e3.1.3 World Isolates:\u003c/h2\u003e \u003cp\u003eThe PUBMLST website has 43,233 isolates in the database. (accessed on 20th February 2025), 11326 isolates from humans were included for further analysis. Most of the isolates were from Europe (4811), followed by North America (1266), Asia (2455), Africa (1095), and South America (769). In 44.3%, the disease was unknown. Amongst the known, carriers were a majority with 1734 (15.3%), followed by Invasive (unspecified) 1387(12.2%), bacteremia-1160 (10.2%), Skin infections-420 (3.7%), wound-394 (3.5%), etc. The samples from carriers were taken from the nose (1193), Skin (74), Feces (26), and Throat (18).\u003c/p\u003e \u003cp\u003eThe grape tree analysis showed that ST 5 was the most common (620), followed by ST 8 (423), ST 30 (313), ST 22 (274), ST 15 (205), ST 45 (201), etc. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e3.1.4 Common Sequence Types (STs) from Around the World (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e)\u003c/h2\u003e \u003cp\u003e \u003cb\u003eST 5\u003c/b\u003e was the most common amongst the world isolates with 618 isolates. It was first isolated from carriers in 1997 and then from Blood. The isolates were methicillin-sensitive. Later, they were isolated from all over the world. Only two isolates are available from India in the database. One was isolated from sputum from the present study. The other was from Pus. Both were MRSA. However, many STs were found in the present study, including ST364, ST1910, ST9412, ST5939, ST9416, and ST9417, which belonged to the same clonal complex 5 as ST5.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 8\u003c/b\u003e is the second most common, seen in 423 isolates. They were isolated from both carriers and patients. The first was isolated in 1997 from a patient with community-acquired blood infection in Oxford (UK). It was MSSA.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 30\u003c/b\u003e was the third most common amongst the world isolates, with 313 isolates, and was first seen in England, UK, in 1997. Later, about 49 isolates were observed from Canada and other countries from 2002 to 2014. In India, it has been seen in only 3 isolates.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 22\u003c/b\u003e (CC22) with 266 isolates was first identified in Ireland in 1993. Later, in 1997, it was seen in a blood isolate.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST15\u003c/b\u003e Two hundred and five isolates are present in the database. It was first isolated in 1997 from the blood of a patient in Oxford (UK) and was methicillin-sensitive. From then on, many Invasive isolates (66), carriers (58), Bacteremia (13) and others were observed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e3.1.5 Indian Scenario\u003c/h2\u003e \u003cp\u003eST 772 (28) of CC1 was the most common among the Indian STs. It was isolated in India from human pus in 2003, followed by isolation from Bangladesh (wound swab), a neighboring country to India, in 2004, the Netherlands, and Norway (biopsy). It has been prevalent in India since then. However, this was not found in the present study.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 2371\u003c/b\u003e (CC2) was the next abundant ST from India. Only 14 isolates are present in the database, thirteen are from India. It was first isolated from the United Kingdom (UK) from a skin swab of a carrier in 2011. In India, it was isolated in 2012, mainly from skin infections. Two of these were from Mysuru, from recurrent furunculosis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 22\u003c/b\u003e with five isolates was seen from blood in 2019 from Lucknow, Uttar Pradesh. These were all MRSA.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eST 672\u003c/strong\u003e \u003cp\u003eTwelve isolates are present in the database, of which 5 are from India. It was first seen in India in 2003 and then in 2007. Thereafter, it was seen in 2010 in Iran (3), in 2014 in Haiti (1), Egypt (1) in 2021 and Australia (2) in 2022. Only one isolate was observed in the present study.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eST 1037\u003c/b\u003e (CC22) was the third common with 7 isolates. It was first isolated from Algeria (n-3), all from nasal carriers. In India (3), it was from eye suppuration in 2012.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 1713\u003c/b\u003e with 4 isolates was first observed in 2009 in the UK. In 2011, it was seen in India in isolates from pharyngitis cases.\u003c/p\u003e \u003cp\u003e \u003cb\u003eST 30\u003c/b\u003e was seen in 3 cases, one each from invasive, internal abscess and pharyngitis cases.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e3.1.6 STs from Carrier Isolates (Figs.\u0026nbsp;4 \u0026amp; \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e)\u003c/h2\u003e \u003cp\u003eOne thousand seven hundred and thirty-four world isolates from humans were from carriers. The majority were from the UK (275), followed by Germany (265), the USA (141), Switzerland (137), China (121), and India (20). Amongst the continents, Europe was the foremost (893) followed by Africa (287), Asia (283), North America (146) and South America (101). ST 22 (99) was the most abundant, followed by ST 30 (92), ST45 (79), ST5 (68), and ST 15(58). The majority (89%) were MSSA. Fifty-five per cent of Indian carrier isolates were MSSA (Fig.\u0026nbsp;4).\u003c/p\u003e \u003cp\u003eIn the present study, we had 40 carrier isolates, of which 15 were MRSA and 25 were MSSA. MLST was performed in 18 isolates, 15 of which were new STs identified only in this study. Three were SLVs of ST 5, i.e., ST 9412, ST 1910, and ST 364. One (ST 7442) was an SLV of ST 22, and the other ST 9413 was a DLV of ST 22. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026amp; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cb\u003eMultilocus sequence typing\u003c/b\u003e is a highly discriminatory and widely used molecular typing method for \u003cem\u003eS. aureus\u003c/em\u003e, especially for studying MRSA strains. MLST provides detailed insights into the genetic relatedness, diversity, and evolutionary relationships of MRSA clones. This helps in tracking the global epidemiology, population structure, and evolution of MRSA, as well as understanding the spread of epidemic clones and the emergence of antimicrobial resistance. It influences complications, severity and mortality [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Moreover, unlike PFGE, it is an absolute method, the results of which can be compared without having any inter-laboratory variations.\u003c/p\u003e \u003cp\u003eIsolates belonging to ST 5 of CC5 were the most abundant among the world isolates. Multiple clones belonging to CC5 MRSA cause hospital-associated infections in the Western Hemisphere [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. It has undergone genetic variation to be classified under 4 clades. CC5 Basal comprises ST 5, ST100, ST 1125, ST 1184, ST 1186, and ST 2625. Other clades included CC5-I, CC5-II and CC5-IIb. Chen et al studied the Asian isolates of \u003cem\u003eS. aureus\u003c/em\u003e ST5 and found the isolates belonging to 5 clades. There was an overlap of the clades when compared to the Western clades. However, Asian strains showed higher carriage and coexistence rates of \u003cem\u003etst\u003c/em\u003e, \u003cem\u003esec\u003c/em\u003e, and \u003cem\u003esel\u003c/em\u003e genes compared to MRSA strains isolated in North America and European countries [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Clades I-IV showed enterotoxin genes found in \u003cem\u003eblaZ\u003c/em\u003e plasmids. [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This suggests that ST5-MRSA isolates cluster by geographical location because of a combination of enterotoxin genes. The ST5 New York/Japan clone represents the worldwide clade. Genetic traits of the American clade I were like Asian clade III, which belongs to the New York/Japan clone, while Asian clade II considerably differed from the New York/Japan clone. The ST5-MSSA from China, having a different genetic make-up, differed from its MRSA counterpart and was grouped into clade IVA. This clade was found all over the world. Therefore, it is reasonable to conclude that the extracellular polymeric substances (EPS) and gene content of clade IV are higher than those of clades II and III. Genomic analysis of clades II, III, and IV suggested that mobile genetic elements (MGEs) contributed to these three clades. Moreover, due to the separation of virulence from resistance genes, the spread of these genes among \u003cem\u003eS. aureus\u003c/em\u003e populations was confined by genetic pressure, thus delaying the emergence of fully virulent and resistant strains [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In the present study, many of our isolates belonged to CC5, with many being new ST types. They were of different origins and differed in their resistance pattern. This finding shows that CC5 is still evolving and causing serious hospital infections. However, it is not so prevalent among the other Indian isolates.\u003c/p\u003e \u003cp\u003eST22 MRSA clone has replaced the common clones and has spread from the United Kingdom to Europe, Asia, Africa, Australia/New Zealand, and the Middle East [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Of particular concern is that ST22-MRSA, which contains the \u003cem\u003elukS/F\u003c/em\u003e gene (encoding the Panton-Valentine leucocidin), is causing severe infections. ST22 strains belong to three major clades (I\u0026ndash;III), consistent with previous studies [ 23,24]. However, a new clade, subclade IIc, in China was introduced from abroad. Among them, the ST22 SCC\u003cem\u003emec\u003c/em\u003e IVa clone carrying both \u003cem\u003epvl\u003c/em\u003e and \u003cem\u003etst\u003c/em\u003e displayed significantly higher \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e virulence than other clades/subclades of ST22 strains and other strains prevalent in China. A similar hyper-virulent ST22 was found in Japan. Fukuoka clone I (one PVL gene and one TSST-1 gene), Fukuoka clone II (addition of a TSST-1 gene to Fukuoka clone I), and Fukuoka clone III ( chromosomal inversion of a large region from Fukuoka clone II) were found among the ST22-PT clones. The study revealed dynamic genetic recombination among MRSA strains and showed that most genomic alterations can occur without delay [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In the present study, we found 4 isolates of ST22 from clinical samples, and all were MRSA. However, ST 22 was found in clinical settings and among carriers globally. Two of our isolates harbored PVL and \u003cem\u003eHla\u003c/em\u003e, all had SPA and \u003cem\u003eFnb\u003c/em\u003eA (data not shown). ST22 MRSA IV clones were seen in Bangalore, India, from Hospital and community isolates [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Since we have not done the SCC-Mec typing, we cannot place it in any clade. However, being MRSA and having the virulent genes make it a hypervirulent ST 22 strain. Most of the study isolates were new, and we could not compare them to existing isolates in the country or world.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eMRSA was isolated from various types of samples in the hospital. STs found in our study belonged to the prevalent worldwide clones. We had novel STs, but they were variants of the known STs. Hence, clones, especially CC5 and CC22, are evolving, becoming multi-drug resistant and producing virulent factors leading to treatment failure in hospitals. Complications, severity, and mortality in patients are impacted by the genotype of \u003cem\u003eS.aureus\u003c/em\u003e. Hence, sequence typing should be undertaken to know the local STs, which will help understand the evolution of the types. Efficient infection control and surveillance strategies should be developed to monitor and control its transmission, more importantly, in the hospital. There should be a curb on the availability of over-the-counter antibiotics so that MRSA can be controlled, if not eradicated.\u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval:\u003c/strong\u003e The institutional ethics committee approved the study. Ref: \u0026nbsp;VPCI/DIR/IHEC/2023/249.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eNo external funding was received for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions: \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMS\u003c/strong\u003e conceptualized the research, reviewed the world data in the MLST database and wrote the manuscript\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAN\u003c/strong\u003e performed the experiments, tabulated the results, and wrote the original draft.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLowy, F. D. \u003cem\u003eStaphylococcus aureus\u003c/em\u003e infections. N. Engl. J. Med.1998; 339, 520\u0026ndash;532\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKreiswirth BN, Kornblum J, Arbeit RD, Goering RV, Hargrave J, Kreiswirth RN, et al. The role of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in the development of hospital-acquired infections. J Clin Microbiol. 1993;31(4):786\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarris SR, Smith DL, Johnson JD, Brown TM, Lee RG, Taylor PA, et al. Methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in the United States. N Engl J Med. 2002; 346: 493 501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtto M. Coagulase-negative staphylococci as reservoirs of genes facilitating MRSA infection: Staphylococcal commensal species such as \u003cem\u003eStaphylococcus epidermidis\u003c/em\u003e are being recognized as important sources of genes promoting MRSA colonization and virulence. Bioessays. 2013; 35(1): 4\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKluytmans JA, van Belkum A, Verbrugh H. Prevalence of nasal carriage of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in healthy individuals. J Clin Microbiol. 1997;35(7):1454\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWertheim HF, Melles DC, Vos MC, van Leeuwen W, van Belkum A, Verbrugh HA, et al. The role of nasal carriage in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e infections. Lancet Infect Dis. 2005; 5(12): 751\u0026thinsp;\u0026ndash;\u0026thinsp;62. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S1473-3099(05)70295-4\u003c/span\u003e\u003cspan address=\"10.1016/S1473-3099(05)70295-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 16310147\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin RM, Cao J, Brisse S, Passet V, Wu W, Zhao L, et al. Molecular Epidemiology of Colonizing and Infecting Isolates of \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e. mSphere. 2016;1(5):e00261-16. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/mSphere.00261-16\u003c/span\u003e\u003cspan address=\"10.1128/mSphere.00261-16\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarsen AR, Sloth BK, Agers\u0026oslash; Y, Larsen J, Torfs H, Skov R, et al. Characterization of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e isolated from the environment. J Clin Microbiol. 2006;44(4):1226\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerry JD, Galloway A. Detection of MRSA in hospitals. J Hosp Infect. 2009;73(4):378\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnderson M, Smith J, Brown T, Taylor R, Johnson P. Environmental reservoirs of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e and infection risk. J Environ Health. 2015;77(1):24\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Clin Microbiol Infect. 2007;13(3):222\u0026thinsp;\u0026ndash;\u0026thinsp;35. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1469-0691.2006.01573.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-0691.2006.01573.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 17391376.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLina G, Pi\u0026eacute;mont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in primary skin infections and pneumonia. Clin Infect Dis. 1999;29(5):1128\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEnright, M. C., Day, N. P., Davies, C. E., Peacock, S. J., \u0026amp; Spratt, B. G. (2000). Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Journal of Clinical Microbiology, 38(3), 1008\u0026ndash;1015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRolo J, Miragaia M, Turlej-Rogacka A, Empel J, Bouchami O, Faria NA, et al. High prevalence of international methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e clones in a Portuguese hospital: establishing transmission chains by MLST. Microorganisms. 2020;8(2):163. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms8020163\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8020163\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJolley KA, Bray JE, Maiden MCJ. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018;3:124. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.12688/wellcomeopenres.14826.1\u003c/span\u003e\u003cspan address=\"10.12688/wellcomeopenres.14826.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 30345391; PMCID: PMC6192448.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Huang T, Xu K, Li C, Li Y. Molecular characteristics and virulence gene profiles of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e isolates in Hainan, China. BMC Infect Dis. 2019; 19(1): 873. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12879-019-4547-5\u003c/span\u003e\u003cspan address=\"10.1186/s12879-019-4547-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 31640587; PMCID: PMC6805582.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChallagundla L, Reyes J, Rafiqullah I, Sordelli DO, Echaniz-Aviles G, Velazquez Meza ME, et al. Phylogenomic Classification and the Evolution of Clonal Complex 5 Methicillin-Resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in the Western Hemisphere. Front Microbiol. 2018; 9: 1901. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2018.01901\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2018.01901\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 30186248; PMCID: PMC6113392.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen F, Yin Y, Chen H, Wang R, Wang S, Wang H. Global genetic diversity and Asian clades evolution: a phylogeographic study of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e sequence type 5. Antimicrob Agents Chemother. 2024; 68(3): e0117523. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/aac.01175-23\u003c/span\u003e\u003cspan address=\"10.1128/aac.01175-23\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2024. PMID: 38259089; PMCID: PMC10916392.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFisher EL, Otto M, Cheung GYC. Basis of virulence in enterotoxin-mediated Staphylococcal food poisoning. Front Microbiol. 2018; 9: 436. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2018.00436\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2018.00436\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolden MTG, Hsu L-Y, Kurt K, Weinert LA, Mather AE, Harris SR, et al. A genomic portrait of the emergence, evolution, and global spread of a methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e pandemic. Genome Res. 2013;23(5):653\u0026ndash;64. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gr.147710.112\u003c/span\u003e\u003cspan address=\"10.1101/gr.147710.112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsu L-Y, Harris SR, Chlebowicz MA, Lindsay JA, Koh T-H, Krishnan P, et al. Evolutionary dynamics of methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e within a healthcare system. Genome Biol. 2015;16:81. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13059-015-0643-z\u003c/span\u003e\u003cspan address=\"10.1186/s13059-015-0643-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnight GM, Budd EL, Whitney L, Thornley A, Al-Ghusein H, Planche T, et al. Shift in dominant hospital-associated methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (HA-MRSA) clones over time. J Antimicrob Chemother. 2012;67(10):2514\u0026ndash;22. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/jac/dks245\u003c/span\u003e\u003cspan address=\"10.1093/jac/dks245\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGostev V, Ivanova K, Kruglov A, Kalinogorskaya O, Ryabchenko I, Zyryanov S, et al. Comparative genome analysis of global and Russian strains of community-acquired methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e ST22, a \u0026ldquo;Gaza clone.\u0026rdquo; Int J Antimicrob Agents 2021; 57: 106264.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Wu X, Wang B, Shen L, Rao L, Wang X, et al. Phenotypic and genomic analysis of the hypervirulent ST22 methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e in China. mSystems. 2023. 8: e01242-22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamaguchi T, Furuno K, Komori K, Abe T, Sato T, Ito T, et al. Evolutionary dynamics of the novel ST22-PT methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e clone co-harbouring Panton\u0026ndash;Valentine leukocidin and duplicated toxic shock syndrome toxin 1 genes. Clin Microbiol Infect. 2024;30(7): 779.e1-779.e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShambat S, Nadig S, Prabhakara S, Bes M, Etienne J, Arakere G. Clonal complexes and virulence factors of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e from several cities in India. BMC Microbiol. 2012; 12: 64.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Staphylococcus aureus, MRSA, MLST, Burst analysis, Clonal complex","lastPublishedDoi":"10.21203/rs.3.rs-6712641/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6712641/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS.aureus\u003c/em\u003e) is a facultative anaerobe that colonizes humans' nasal cavity, skin, and other mucosal surfaces. The bacterium can cause local and systemic infections, including skin and soft tissue infections, bacteremia, endocarditis, and osteomyelitis. It is associated with hospital-acquired infections, and the emergence of Methicillin-resistant \u003cem\u003eS.aureus\u003c/em\u003e (MRSA), a difficult-to-treat pathogen, is of concern in hospitals. This is a retrospective analytical study. A hundred \u003cem\u003eS. aureus\u003c/em\u003e isolates from various sources stored in our repository were used in the study. These isolates were obtained from clinical samples, surveillance samples from healthcare workers and patients and hospital environmental samples. Fragments of seven housekeeping genes were amplified as given in the PUBMLST site. (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubmlst.org/organisms/\u003c/span\u003e\u003cspan address=\"https://pubmlst.org/organisms/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e staphylococcus aureus). The amplified fragments were sequenced. STs were determined by comparing the known alleles in the database. New Sequence types were assigned to novel STs. We analyzed all the isolates in the database according to the country, isolate types, etc. A total of 100 isolates of \u003cem\u003eS. aureus\u003c/em\u003e from clinical, surveillance and hospital environmental samples, present in the repository, were included. MLST was performed for 55 isolates. Sequence types encountered were ST22, ST5, ST364, ST1910, ST5939, ST5529, ST7442, ST672, and ST9162. The rest were new types. Most of our isolates belonged to CC5. These were compared with those of the Indian and World isolates in the PUBMLST site. Sequence types help to understand their evolution. Efficient infection control and surveillance strategies will help control the transmission of MRSA in the hospital.\u003c/p\u003e","manuscriptTitle":"Molecular typing of clinical, colonizing, and environmental isolates of Staphylococcus aureus and comparison with World isolates","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-04 12:15:14","doi":"10.21203/rs.3.rs-6712641/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b46d79b7-14f2-4700-9c3d-4cdcb171a567","owner":[],"postedDate":"June 4th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-06-04T12:15:14+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-04 12:15:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6712641","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6712641","identity":"rs-6712641","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}