Insights into MITF-expressing cells derived from human iPSCs in melanogenesis

Insights into MITF-expressing cells derived from human iPSCs in melanogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Insights into MITF-expressing cells derived from human iPSCs in melanogenesis Hang Zhou, Yu-Yun Xiong, Yun Wang, Yan-Yan Chen, Zi-Han Wang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7850188/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Currently, surgical treatment options for pigment loss disorders are well-established. Studies have shown that melanocyte transplantation or melanin transplantation can yield favorable outcomes. However, this approach has not been widely adopted. The reasons for this may include insufficient sources of melanocytes, the lengthy process of extracting autologous melanocytes, and the high costs associated with their cultivation. Objective To improve the isolation of highly proliferative melanocytes, we seek to identify surface markers for selecting those with robust proliferative and differentiation potential. Methods Using clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) technology to label microphthalmia-associated transcription factor (MITF), induced melanocytes are obtained by differentiating pluripotent stem cells, and the proliferative capacity of different cell populations is assessed through a single-cell colony formation assay. Results This study verified that MITF-positive cells possess high proliferative capacity and consequently identified KIT proto-oncogene, receptor tyrosine kinase (KIT, CD117) as a characteristic surface marker. Conclusion The use of KIT allows for the isolation of induced melanocytes with high proliferative capacity, thereby improving production efficiency, though it may also lead to the loss of some highly proliferative cell subpopulations. CRISPR/Cas9 iPSC Melanocyte stem cells MITF KIT Depigmentary disorders Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction There are a lot of depigmentation diseases derived from the loss of melanocytes stimulated by stress or autoimmune disorders, the treatment principle is the pigment replenish(Thakur, Bishnoi et al.). There are many known treatments for restoring of pigmentation like surgical skin grafting(Dai, Chang et al.), phototherapy(Kim, Singer et al.), microneedling(Salloum, Bazzi et al. 2020 ), topical drugs therapy(Rosmarin, Pandya et al.), etc. But these treatments include faults but not limited to severe scar formation, long treatment cycle, low efficiency, uneven pigment dispersion, un-predicted hypopigmentation and endless recurrence. People have put forward isolating and manipulating melanocyte stem cells (McSCs) for tissue engineering as a source of abundant pure dependable human pigment for many years(Lang, Mascarenhas et al., Lee and Fisher 2014 ). However, this treatment still not implemented yet, separation and purification of primary McSCs are still a complexity which is hindered by the lack of clear definition. Studies have confirmed that melanocytes constitute a relatively low proportion of cells in the skin, existing predominantly in the basal layer, with one mature melanocyte for every ten keratinocytes(Cichorek, Wachulska et al. 2013 ). This indicates that the proportion of melanocyte stem cells is even lower. Consequently, isolating enough melanocytes for the study of melanocyte stem cells presents a significant challenge. However, systems that facilitate the differentiation of pluripotent stem cells towards the melanocyte lineage may offer a potential solution to this issue. MITF plays a crucial role in the development of melanocytes(Levy, Khaled et al. 2006 , Goding and Arnheiter 2019 ). The MITF can activate over 25 genes in pigment cells(Vachtenheim and Borovanský 2010 ). It is not only an important regulatory factor for the development, proliferation, and survival of melanocytes, but also plays a critical role in ensuring the expression of enzymes and structural proteins necessary for melanin production. SRY-box transcription factor 10 (SOX10) and paired box 3 (PAX3) are considered to play important roles in the development of McSCs in early mice studies(Lang, Lu et al. 2005 , Harris, Buac et al. 2013 ). However, their expression during melanocyte development may occur prematurely, and they may also promote neural differentiation and skeletal muscle formation in addition to their role in melanocyte development(Buckingham and Relaix 2015 , Wang, Liu et al. 2021 ). By visualizing MITF in induced pluripotent stem cells (iPSCs), through an embryoid differentiation system of human fluid microenvironment homologous, this work tried to characterize the human McSCs derived from iPSCs. In this study, we confirmed that MITF-expressing induced melanocytes have the stem cell property of self-renewing capability. At the same time, we obtained KIT as a possible surface marker for isolating human McSCs, it may provide an alternative treatment option for depigmented disorders. Materials and Methods iPSCs maintaining The control human iPSC (hiPSC) line is UCSFi001-A (Coriell#GM25256), alternative name is WTC11(Kreitzer, Salomonis et al. 2013); the MITF-mutated familial WTC11-iPSC lines M10-21, M10-36, M10-38, M10-123, M10-131, M10-123 were cultured with Matrigel(stemcell 354277) in mTeSR medium(stemcell 85850).H9 were cultured with mitomycin C-treated SNL murine fbroblast feeder cells in ES0 medium containing 20% knockout serum replacement (KSR) (Termo Fisher), 0.1mM non-essential amino acids (Sigma-Aldrich), 0.1mM 2-mercaptoethanol (Sigma-Aldrich), and 4ng ml–1 fibroblast growth factor 2 (FGF-2) (PeproTech) in an atmosphere containing 5% CO2. All cells were tested for mycoplasma monthly during culture and differentiation using the MycoBlue Mycoplasma Detector (Vazyme #D101-01). CRISPR/Cas9 and gene editing In this study, enhanced green fluorescent protein (EGFP) was knocked in MITF by the CRISPR/Cas9 gene editing system. The following primers were synthesized by BGI Genomics: MITF10-1-F (CACCGAGTGGATCAGTGACACCGA ), MITF10-1-R (AAACTCGGTGTCACTGATCCACTC ), MITF6-1-F (CACCGGAAGCTCCGGGGGACACTG ), MITF6-1-R (AAACCAGTGTCCCCCGGAGCTTCC ), 800-F (ACTGCCAGTGGTACTTCTCCT ), 800-R (GGATCACACTCATTGATGAAGAA), Knock out cloning was performed using Addgene_ pU6-(BbsI)_CBh-Cas9-T2A-BFP vector, which was a gift from Feng Zhang (Addgene plasmid #64323; https://www.addgene.org/64323/; RRID:Addgene_64323), single guide RNA (sgRNA) sequences are list in supplementary table 3. Homologous recombination cloning was performed using Addgene_ T-2A-EGFP-PGK-Puro vector, which was a gift from James Thomson lab (Addgene plasmid #83344; https://www.addgene.org/83344/; RRID: Addgene_83344). The ligated vector was inserted into DH5α Chemically competent cells (Vazyme, China). Through vector construction, we replaced the homologous arm sequence based on the pUC57 vector (YSY biotech), and constructed the homologous recombination template of MITF gene, and used the T-2A-EGFP-PGK-Puro vector (addgene#83344) donated by James Thomson lab. Plasmid construction was performed according to protocol and confirmed by sequencing. The WTC11 cell line was transfected with reconstructed plasmid from Addgene_ pU6-(BbsI)_CBh-Cas9-T2A-BFP and Addgene_ T-2A-EGFP-PGK-Puro by Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Thermo Fisher #CMAX00003) for 24 h (Calatayud, Carola et al. 2019). After one day the transfected cells were selected with puromycin (concentration 5 ng/µL). ROCK Inhibitor Y-27632 (Selleck Chemicals LLC, #S1049) was added to the clone culture medium. Thereafter, single-cell cloning was performed in 96-well plates to grow single clones. After growth, PCR and sequencing were performed to detect the knock-in. Generation of MITF mutated iPSCs iPSCs were transferred with plasmids containing sgRNA and Cas9 protein sequence and recombination templates. The quantity of sgRNA plasmids is triple the template plasmids. After transfection, iPSCs were single cell digested with Accutase(stemcell #07922), and planted in Matrigel filled culture plate with density of 5*10^5cells per 9cm dish, add 10 uM Y27632(Selleck Chemicals LLC, #S1049). Cells were screened in mTeSR medium containing 0.5ug/ml Purinomycin(Thermo Fisher #A1113803) for 14 days. We picked the single cell derived cell clones into 96well plates one clone per well and detect the genome sequence of these clones. Confirmation of fluorescent reporter after knock-in For primary detect, cells were scraped for 2ul mixed with MightyAmp™ DNA Polymerase (Takara R071A), perform the polymerase chain reaction and DNA gel electrophoresis. For samples with positive results, we extract DNA from the sample with MiniBEST Universal Genomic DNA Extraction Kit(Takara Cat. No. 9765), amplifying the target sequences and sequencing. Melanocyte induction in vitro For in vitro differentiation, we implemented the human melanocyte differentiation system as reported in earlier work (Liu, Li et al. 2019, Liu, Guo et al. 2020). hPSCs were cultured in hiPSC medium for 5–7 days. The medium was changed every day. On day 5–7, hPSC colonies were detached from the feeder layers using ReLeSR™ (stemcell 100–0484). The dissociated cells were cultured in suspension at a density of 2×10 5 cells per ml in ultra-low attachment culture dishes (Corning) in mTeSR medium consisting of 10 µM Y27632 in a humidified atmosphere (5% CO2, 37℃) for 3 days. The medium of spheres that get a diameter of 300-500um were changed into differentiation medium(Liu, Guo et al. 2020). Half of the medium was changed every 1 day, or full medium was changed every 2 days. After 2 weeks of suspension differentiation, pick these spheres into ordinary petri dishes without changing the differentiation medium. The iPSCs deriver melanocytes crabbed onto the plate, then passed by 0.025% Trypsin. Single cell-based clonal formation assay iPSCs deriver melanocytes were detached from the plate using DMEM contain 0.025% Trypsin, then sortied by flow sorting instrument (BD). Seeded into ultra-low attachment culture dishes, supported by the differentiation medium supplemented with 0.6% methyl cellulose (Sigma-Aldrich). Analysis of cell spheroids Spheroids formed by single-cell cloning, we took pictures using Nikon's inverted microscope, synthesized them with image J image analysis software, and then calculated the number and size of spheroids, and the radius of a single cell was about 8 µm on the first day of sorting, so we only counted spheroids with a body surface area greater than 200 µm 2 . Immunocytochemistry. Cells were fixed in phosphate-buffered saline (PBS) containing 2% paraformaldehyde (PFA) for 20min at 4℃. Thereafter, all cells were ruptured by 10% Tween100 incubation 5 minutes for 3 times, then blocked with 10% normal goat serum (NGS) for 1 hour and incubated with the primary antibodies described in Supplementary Table 1. The cells were then rinsed with PBS and incubated with species-specific Alexa Fluor 488- (1/500; Invitrogen), Alexa Fluor 647- (1/500; Invitrogen), or cy3- (1/500; Jackson) conjugated secondary antibodies, followed by staining with DAPI (10µg/ml; Sigma-Aldrich) to counterstain the nuclei. Images were obtained using an inverted fluorescence microscope (Nikon). The details of primary and secondary antibodies are described Supplementary Table 1. Flow cytometry analysis of MITF expression. Cells were fixed in 1% PFA for 15min on ice, rupture of membranes by 0.3%Triton (Bomei, BQ0694), cells were incubated with the primary antibodies for 60 minutes, then incubated with species-specific Alexa Fluor 647-conjugated secondary antibodies (1/1000; BioLegend). Flow cytometry data analysis was performed using the BD FACS (Canto10). Magnetic-activated cell sorting (MACS) We dissociated the cells into single-cell suspensions using Accutase (StemCell Technologies, #07920) and subsequently sorted them into CD117-negative and CD117-positive populations following the manufacturer’s protocol (Miltenyi Biotec, #130-091-332). Quantitative RT–PCR Total RNA was isolated by trizol extraction method (ambion, 15596018), then RNA was treated with RevertAid First Strand cDNA Synthesis Kit (Thermo, K1622). Quantitative RT–PCR was performed using SYBR Premix Ex Taq II (Takara Bio) on a QuantStudio 3 Real-Time PCR System (Applied Biosystem). The details of qRT–PCR primers are described in Supplementary Table 2. Statistical analysis Values are expressed as mean ± s.d. Statistical significance was calculated with GraphPad Prism (GraphPad Software). The effect of the treatments on the cell lines was analyzed using a two tailed paired t -test. A two-tailed non-paired t -test was used to compare differences between two groups, and one-way ANOVA followed by Dunnett’s or Tukey’s multiple comparisons test were used to compare three or more groups. Two-tailed Fisher’s exact test was used for the pathway/gene ontology enrichment analysis. P values less than 0.05 were considered significant differences. Results Report on MITF in iPSCs A stable human melanocyte differentiation system has been formed in previous study (Liu, Li et al. 2019 , Liu, Guo et al. 2020 ). Melanocytes were differentiated successfully from iPSCs as expected. iPSCs induced melanocytes (iMels) have a similar morphology to the human epidermal melanocyte (HEM). To visualize melanocyte cells during differentiation and tracking the differentiation process of melanocyte in real time, we visualized MITF. The fluorescent reporter system is robustly established by CRISPR-Cas9 and the EGFP gene was inserted at the terminal end of the MITF gene (Fig. 1 A). This reporter gene is expressed solely in conjunction with MITF expression, allowing real-time tracking of MITF expression. The knock-in (KI) iPSCs were differentiated according to the previously established protocol to determine its potential for differentiation (Liu, Guo et al. 2020 ). As predicted, the KI cell lines retain their stem cell characteristics and can differentiate into mature melanocytes (Figure 1 B). The overlap of EGFP with MITF and DAPI was intuitively observed, and EGFP fluorescence was visible in almost all MITF-positive cells (Figure 1 C). Eventually, pigmentation was also visible by cytocentrifugation (Figure 1 D). Compared with gene expression, there was no significant difference between the knock-in group and the control group at the mRNA expression level (Figure 1 E), and it was observed that the expression of stem cell-related markers POU class 5 homeobox 1 (OCT4) and SRY-box transcription factor 2 (SOX2) was higher on day 0 of differentiation. In the middle phase of differentiation, melanin markers such as MITF, PAX3, and SOX10 are expressed. Moreover, in the late stage of differentiation, the markers of mature melanocytes such as tyrosinase (TYR), and tyrosinase-related protein 1 (TYRP1) were expressed in large quantities. These all indicate that there is no significant difference in differentiation between the knock-in group and the control group. visualize melanocyte cells during differentiation subsequently, we verified the reporter function of the KI cell lines in our differentiation system. To confirm that the stem cells can express EGFP after differentiation following knock-in, the expression of EGFP in mRNA was measured. It was observed that the expression of EGFP was not present in undifferentiated pluripotent stem cells, and the expression of EGFP gradually increased with differentiation (Fig. 2 A). Then, the expressions of MITF and EGFP were analyzed by fitting curves and flow cytometry., and it was found that the expressions of MITF and EGFP were highly correlated, which proved that EGFP was not expressed independently, but was expressed with MITF (Fig. 2 B, F). In addition, the presence of fluorescence was observed under a fluorescence microscope. Compared to induced melanocytes differentiated under the same conditions as gene-edited and unedited stem cells, cells without knock-in EGFP showed only faint background fluorescence, while knock-in iMel showed punctate green fluorescence (Fig. 2 C). Flow cytometry analysis also showed that the expression of EGFP protein in the knock-in group gradually increased with the progress of differentiation (Fig. 2 D-E). The green fluorescence positive rate and fluorescence intensity of the knock-in group were significantly higher than those of the control group(Fig. 2 G). The above experimental results confirm the successful construction of our in-vitro observation model. In summary, we have established a pluripotent stem cell line that reports the expression of the MITF gene, allowing for real-time observation of MITF expression during the differentiation process. MITF is the key point from nerve spines to melanocytes and MITF positive iMels have self-renewal capability In the process of iPSCs differentiating into melanocytes, we confirmed that MITF is an invaluable gene for human McSCs. Since MITF has long been thought to be a lineage gene for melanocytes(Shibahara, Takeda et al. 2001 ), cells were sorted into EGFP-positive and negative cells by flow cytometry (Fig. 3 A). We have validated the sorting effect by evaluating the Mitf and Egfp mRNA expression. Compared with the EGFP-negative and positive cells after fluorescence-activated cell sorting (FACS) sorting, the positive cells had higher MITF and EGFP expression levels (Fig. 3 C). Using an extremely low-density suspension culture, we assessed the ability of EGFP-positive and EGFP-negative cells to form clonal clumps from single cells. Analysis of flow cytometry-sorted EGFP-positive and negative cells revealed that EGFP-positive cells exhibited strong spherical formation at 21 days of differentiation (Fig. 3 B). In addition, we observed a higher number and volume of cell clumps formed by the EGFP-positive subpopulation at 7 days (Fig. 3 D). Compared with the cell clumps formed by the negative population, the positive population had larger clumps with partial EGFP fluorescence expression (Fig. 3 E). This phenomenon indicates that MITF-positive cells retain their self-renewal and differentiation abilities. The continuously cultured cells could produce both McSCs that express MITF with EGFP and mature cells that do not express MITF. KIT expressing on the cellular membrane of MITF-positive iMels The EGFP + and EGFP- cells analyzed by high-throughput sequencing, and the positive cells were highly expressing genes related to the melanogenesis signaling pathway. We compared the differential genes in six groups of samples, of which 1594 genes were up-regulated, and 1492 genes were down-regulated, and the up-regulated genes contained MITF, indicating that the samples were successfully sorted (Fig. 4 A-B). Principal component analysis of the sorted samples showed a significant difference in gene expression between the positive and negative cells sorted by MITF (Fig. 4 C). Principal component analysis of the sorted samples reveals distinct differences in gene expression between MITF-positive and MITF-negative cells. Moreover, the differences associated with passaging appear to be even more pronounced than those between MITF-negative and -positive cells (Fig. 4 C). To eliminate the variations caused by other factors associated with passaging during differentiation, we conducted an analysis of the co-expression gene modules in relation to phenotypic correlations. It indicates that the fourth module remains stable regardless of the number of passages, suggesting that the genes included in this module are likely directly related to the expression of the MITF gene (Fig. 4 D). Gene ontology (GO) enrichment analyzed the gene set contained within this module, revealing significant enrichment in the "Wnt signaling pathway," "melanocyte differentiation," and "pigmentation" categories (Fig. 4 E). These findings align with the previous understanding of the MITF gene and provide indirect support for the hypothesis that the gene set may be directly related to the function and regulation of MITF. Additionally, it was found that this gene set is also enriched in processes related to melanocyte differentiation, positive regulation of cell proliferation, positive regulation of DNA template transcription and initiation, and positive regulation of the cell cycle (Fig. 4 F). These results are consistent with the cellular experiments, indicating that MITF may serve as a key driver or marker gene for melanocyte stem cells. It is consistent with cell-based experiments and demonstrates that MITF may be a promoter or hallmark gene of melanocytes. We further screened the cell membrane surface proteins within this module and identified nine potential membrane surface proteins (Fig. 4 G). Through gene co-expression analysis, it was found that the protein KIT showed significant overlap with MITF. Then we tested the KIT expression in both MITF-positive and MITF-negative cells, which showed that KIT was highly expressed in MITF-positive cells and expressed at low levels in MITF-negative cells (Fig. 4 H). We also analyzed KIT and MITF expressions by flow cytometry, which confirmed the hypothesis that MITF-positive iMels express KIT (Fig. 4 I). KIT may be a reference marker for isolating highly proliferative melanocytes. KIT-sorted induced melanocytes exhibit clonogenic capacity. Based on the co-expression pattern of MITF and KIT, it was sought to determine whether KIT is regulated by MITF and therefore designed an MITF knockdown experiment. It is found that in melanocytes, MITF knockdown led to decreased gene expression of both MITF and KIT (Fig. 5 A-B), suggesting that KIT is regulated by MITF . Subsequently, we investigated whether KIT-based sorting could enrich highly proliferative melanocytes. On day 21 of induced melanocyte differentiation, KIT-positive and KIT-negative cells were isolated via magnetic beads sorting, and qPCR was performed to assess KIT and MITF expressions in the two populations (Fig. 5 C). The results showed a significant difference in KIT expression between the two groups, whereas MITF expression, though differing, did not reach statistical significance. Flow cytometry analysis further revealed that over 90% of KIT-positive cells were EGFP-positive, whereas the KIT-negative population still contained more than 50% EGFP-positive cells (Fig. 5 D). KIT-positive cells exhibit single-cell clonogenic capacity, though the possibility, meanwhile, KIT-negative cells may also possess relatively weaker clonogenic potential (Fig. 5 E-G). Although KIT expression does not strictly correlate with MITF expression, the isolated cells alone may not fully represent the entire population of highly proliferative cells, KIT can be used to isolate a subset of highly proliferative cells. Discussion MITF is a transcription factor in melanocyte development, which can maintain the proliferation and differentiation of melanocytes from melanocytes to melanocytes, it is also a lineage gene commonly expressed by melanocytes(Levy, Khaled et al. 2006 , Sheinboim, Maza et al. 2017 , Joshi, Tandukar et al. 2019 ). In the process of iPSCs differentiating into melanocytes, we confirmed that MITF is a support gene for human McSCs. In addition, MITF is a key transcription factor that determines the melanocyte fate, regulate the expression of several key melanogenesis-related genes, such as TYR, TYRP1 and dopachrome tautomerase (DCT), which maintains the proliferation and differentiation of McSCs to melanocytes(Goding and Arnheiter 2019 , Zhou, Zeng et al. 2021 ). It is believed that expressing MITF can lead to the differentiation of cells with melanocyte functions (Sáez-Ayala, Montenegro et al. 2013 , Tirosh, Izar et al. 2016 ). Our study clearly establishes MITF as a marker for melanocytes with expansion capability and differentiation potential, and we have experimentally validated the ability of MITF-positive cells to form single-cell clones. In summary, MITF positive cells may possess stem-like properties. Furthermore, Autologous melanocytes have been used in the treatment of vitiligo to promote repigmentation. However, since MITF is not a surface marker, it is hard to isolate live MITF positive melanocytes. For the application of isolating melanocytes, direct implantation of highly expanded melanocyte cells may be an appealing treatment option. Interestingly, we found that nearly all MITF-positive cells in differentiated melanocytes express KIT. KIT is considered a commonly expressed protein in various cell types with stem cell characteristics, such as cholangiocytes (Fujio, Hu et al. 1996 ), mast cells (Galli, Tsai et al. 1993 ), and hematopoietic stem cells (Okada, Nakauchi et al. 1992 , Broudy, Lin et al. 1996 , Gao, Carpenter et al. 2024 ). The molecular mechanisms of KIT as a stem cell marker have been partially elucidated. Recent studies have identified the receptor tyrosine kinase c-Kit as a marker for stem cell trogocytosis, through which it acquires C-X-C motif chemokine receptor 4 (CXCR4) from adjacent macrophages to maintain the stable stem cell characteristics of hematopoietic stem cells (HSCs) in the bone marrow (Gao, Carpenter et al. 2024 ). A similar role may exist in melanocytes, where it supports the amplification and functional activation of melanocytes under dynamic environmental stimuli. With current separation techniques, it is now possible to roughly isolate melanocytes. For clinical applications, we can screen KIT-positive cells prior to transplantation, thereby improving the survival rate and efficiency of the transplant. Our study also identified limitations of KIT as a sorting marker. Although most MITF-positive cells express KIT protein, KIT may not be exclusively distributed in MITF-positive cells. Furthermore, we found that while isolated KIT-positive cells exhibit relatively strong clonogenic capacity, the negative population may also possess stemness properties. Therefore, using KIT alone to isolate highly proliferative melanocytes, while potentially improving cell culture efficiency, may lead to the loss of a subset of target cells. Conclusion In conclusion, by labeling, sorting, and single-cell clone formation of MITF, it was confirmed that the MITF gene can be used as a marker gene for proliferating melanocytes. In future studies on human melanocytes, the important role of MITF in the development and differentiation of melanocytes may provide some inspiration to other researchers. KIT-positive cells may be part of a source of McSCs, and it may be an efficient but not precise strategy to expand them extensively in vitro to obtain a significant supply of human melanocytes. It provides a resource for cell therapy for vitiligo, burns, and other pigment loss diseases. Maximum yield can be achieved with minimal cell volume, reducing the waste of media resources and the waiting time required for cell transplantation. At the same time, these cells can be provided to individuals in need, such as those with vitiligo, premature graying, or beauty institutions. Abbreviations Abbreviation Full name CAS9 CRISPR-associated protein 9 CRISPR clustered regularly interspaced short palindromic repeats CXCR4 C-X-C motif chemokine receptor 4 DCT dopachrome tautomerase EGFP enhanced green fluorescent protein FACS fluorescence-activated cell sorting FGF2 fibroblast growth factor 2 GO Gene ontology HEM human epidermal melanocyte HIPSC human induced pluripotent stem cell HSCS hematopoietic stem cells IMELS induced pluripotent stem cell derived melanocytes IPSCS induced pluripotent stem cells KIT KIT proto-oncogene receptor tyrosine kinase KI knock-in KSR knockout serum replacement MACS Magnetic-activated cell sorting MCSCS melanocyte stem cells MITF Microphthalmia-associated transcription factor NGS normal goat serum OCT4 POU class 5 homeobox 1 PAX3 paired box 3 PBS phosphate-buffered saline PFA paraformaldehyde SGRNA single guide RNA SOX10 SRY-box transcription factor 10 SOX2 SRY-box transcription factor 2 TYR tyrosinase TYRP1 tyrosinase-related protein 1 Declarations Ethics approval and consent to participate The study utilized the WTC11 cell line, and its origin (the Coriell Institute) has verified that the initial collection of the human cells was conducted under ethical approval and that informed consent was obtained from the donors (Kreitzer, Salomonis et al. 2013). Consent for publication Not applicable. Availability of data and materials The healthy human skin scRNA-seq dataset was obtained from the publicly accessible repository: GEO: GSE151091(Belote, Le et al. 2021). The data supporting the findings of the current study are available from the corresponding author upon reasonable request. Competing interests Not applicable. Funding This research was partially funded by the China National Natural Science Foundation (82270697), Jiangsu Provincial Key Discipline Cultivation Unit (JSDW202229), Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX22_3717), the Science and Technology Planning Project of Guangdong Province of China (2021B1212040016), Guangdong Basic and Applied Basic Research Foundation (2023A1515012574); Haihe Laboratory of Cell Ecosystem Innovation Fund (HH24KYZX0008). Authors' contributions Conceptualization, YWZ and LPL; methodology, HZ, LPL, YYX and YWZ.; experiment, HZ, YW, ZHW, CT, YYC; Bioinformatic and other formal analyses, HZ and JY; investigation, HZ, LPL and YWZ; resources, YWZ, YML, LPL and YYX; writing – original draft, HZ; writing – review & editing, HZ and YWZ; supervision, YWZ, LPL and YML; project administration, YWZ; funding acquisition, YWZ, YML, LPL and HZ. Acknowledgements We gratefully acknowledge Ningning Guo, Yumu Song, and Jing Niu for their technical support. The authors declare that they have not use AI-generated work in this manuscript. References Belote, R. L., D. Le, A. Maynard, U. E. Lang, A. Sinclair, B. K. Lohman, V. Planells-Palop, L. Baskin, A. D. Tward, S. Darmanis and R. L. Judson-Torres (2021). "Human melanocyte development and melanoma dedifferentiation at single-cell resolution." Nat Cell Biol 23 (9): 1035-1047. Broudy, V. C., N. L. Lin, G. V. Priestley, K. Nocka and N. S. Wolf (1996). "Interaction of stem cell factor and its receptor c-kit mediates lodgment and acute expansion of hematopoietic cells in the murine spleen." Blood 88 (1): 75-81. Buckingham, M. and F. Relaix (2015). "PAX3 and PAX7 as upstream regulators of myogenesis." Semin Cell Dev Biol 44 : 115-125. Calatayud, C., G. Carola, I. Fernandez-Carasa, M. Valtorta, S. Jimenez-Delgado, M. Diaz, J. Soriano-Fradera, G. Cappelletti, J. Garcia-Sancho, A. Raya and A. Consiglio (2019). "CRISPR/Cas9-mediated generation of a tyrosine hydroxylase reporter iPSC line for live imaging and isolation of dopaminergic neurons." Sci Rep 9 (1): 6811. Cichorek, M., M. Wachulska, A. Stasiewicz and A. Tymińska (2013). "Skin melanocytes: biology and development." Postepy Dermatol Alergol 30 (1): 30-41. Dai, N.-T., H.-I. Chang, Y.-W. Wang, K.-Y. Fu, T.-C. Huang, N.-C. Huang, J.-K. Li, P.-S. Hsieh, L.-G. Dai, C.-K. Hsu and P. K. Maitz "Restoration of skin pigmentation after deep partial or full-thickness burn injury." Advanced drug delivery reviews 123 : 155-164. Fujio, K., Z. Hu, R. P. Evarts, E. R. Marsden, C. H. Niu and S. S. Thorgeirsson (1996). "Coexpression of stem cell factor and c-kit in embryonic and adult liver." Exp Cell Res 224 (2): 243-250. Galli, S. J., M. Tsai and B. K. Wershil (1993). "The c-kit receptor, stem cell factor, and mast cells. What each is teaching us about the others." Am J Pathol 142 (4): 965-974. Gao, X., R. S. Carpenter, P. E. Boulais, D. Zhang, C. R. Marlein, H. Li, M. Smith, D. J. Chung, M. Maryanovich, B. Will, U. Steidl and P. S. Frenette (2024). "Regulation of the hematopoietic stem cell pool by C-Kit-associated trogocytosis." Science 385 (6709): eadp2065. Goding, C. R. and H. Arnheiter (2019). "MITF-the first 25 years." Genes Dev 33 (15-16): 983-1007. Harris, M. L., K. Buac, O. Shakhova, R. M. Hakami, M. Wegner, L. Sommer and W. J. Pavan (2013). "A dual role for SOX10 in the maintenance of the postnatal melanocyte lineage and the differentiation of melanocyte stem cell progenitors." PLoS Genet 9 (7): e1003644. Joshi, S. S., B. Tandukar, L. Pan, J. M. Huang, F. Livak, B. J. Smith, T. Hodges, A. A. Mahurkar and T. J. Hornyak (2019). "CD34 defines melanocyte stem cell subpopulations with distinct regenerative properties." PLoS Genet 15 (4): e1008034. Kim, H. J., G. K. Singer, E. Del Duca, B. J. Abittan, M. A. Chima, G. Kimmel, J. Bares, M. Gagliotti, J. Genece, J. Chu, G. Wilding, A. B. Pavel, E. Guttman-Yassky and M. G. Lebwohl "Combination of apremilast and narrowband ultraviolet B light in the tr eatment of generalized vitiligo in skin phototypes IV to VI: A randomi zed split-body pilot study." Journal of the American Academy of Dermatology 85 (6): 1657-1660. Kreitzer, F. R., N. Salomonis, A. Sheehan, M. Huang, J. S. Park, M. J. Spindler, P. Lizarraga, W. A. Weiss, P. L. So and B. R. Conklin (2013). "A robust method to derive functional neural crest cells from human pluripotent stem cells." Am J Stem Cells 2 (2): 119-131. Lang, D., M. M. Lu, L. Huang, K. A. Engleka, M. Zhang, E. Y. Chu, S. Lipner, A. Skoultchi, S. E. Millar and J. A. Epstein (2005). "Pax3 functions at a nodal point in melanocyte stem cell differentiation." Nature 433 (7028): 884-887. Lang, D., J. B. Mascarenhas and C. R. Shea "Melanocytes, melanocyte stem cells, and melanoma stem cells." Clinics in dermatology 31 (2): 166-178. Lee, J. H. and D. E. Fisher (2014). "Melanocyte stem cells as potential therapeutics in skin disorders." Expert Opin Biol Ther 14 (11): 1569-1579. Levy, C., M. Khaled and D. E. Fisher (2006). "MITF: master regulator of melanocyte development and melanoma oncogene." Trends Mol Med 12 (9): 406-414. Liu, L. P., N. N. Guo, Y. M. Li and Y. W. Zheng (2020). "Generation of Human iMelanocytes from Induced Pluripotent Stem Cells through a Suspension Culture System." STAR Protoc 1 (1): 100004. Liu, L. P., Y. M. Li, N. N. Guo, S. Li, X. Ma, Y. X. Zhang, Y. Gao, J. L. Huang, D. X. Zheng, L. Y. Wang, H. Xu, L. Hui and Y. W. Zheng (2019). "Therapeutic Potential of Patient iPSC-Derived iMelanocytes in Autologous Transplantation." Cell Rep 27 (2): 455-466.e455. Okada, S., H. Nakauchi, K. Nagayoshi, S. Nishikawa, Y. Miura and T. Suda (1992). "In vivo and in vitro stem cell function of c-kit- and Sca-1-positive murine hematopoietic cells." Blood 80 (12): 3044-3050. Rosmarin, D., A. G. Pandya, M. Lebwohl, P. Grimes, I. Hamzavi, A. B. Gottlieb, K. Butler, F. Kuo, K. Sun, T. Ji, M. D. Howell and J. E. Harris "Ruxolitinib cream for treatment of vitiligo: a randomised, controlled, phase 2 trial." Lancet (London, England) 396 (10244): 110-120. Sáez-Ayala, M., M. F. Montenegro, L. Sánchez-Del-Campo, M. P. Fernández-Pérez, S. Chazarra, R. Freter, M. Middleton, A. Piñero-Madrona, J. Cabezas-Herrera, C. R. Goding and J. N. Rodríguez-López (2013). "Directed phenotype switching as an effective antimelanoma strategy." Cancer Cell 24 (1): 105-119. Salloum, A., N. Bazzi, D. Maalouf and M. Habre (2020). "Microneedling in vitiligo: A systematic review." Dermatol Ther 33 (6): e14297. Sheinboim, D., I. Maza, I. Dror, S. Parikh, V. Krupalnik, R. E. Bell, A. Zviran, Y. Suita, O. Hakim, Y. Mandel-Gutfreund, M. Khaled, J. H. Hanna and C. Levy (2017). "OCT4 impedes cell fate redirection by the melanocyte lineage master regulator MITF in mouse ESCs." Nat Commun 8 (1): 1022. Shibahara, S., K. Takeda, K. Yasumoto, T. Udono, K. Watanabe, H. Saito and K. Takahashi (2001). "Microphthalmia-associated transcription factor (MITF): multiplicity in structure, function, and regulation." J Investig Dermatol Symp Proc 6 (1): 99-104. Thakur, V., A. Bishnoi, K. Vinay, S. M. Kumaran and D. Parsad "Vitiligo: Translational research and effective therapeutic strategies." Pigment cell & melanoma research 34 (4): 814-826. Tirosh, I., B. Izar, S. M. Prakadan, M. H. Wadsworth, 2nd, D. Treacy, J. J. Trombetta, A. Rotem, C. Rodman, C. Lian, G. Murphy, M. Fallahi-Sichani, K. Dutton-Regester, J. R. Lin, O. Cohen, P. Shah, D. Lu, A. S. Genshaft, T. K. Hughes, C. G. Ziegler, S. W. Kazer, A. Gaillard, K. E. Kolb, A. C. Villani, C. M. Johannessen, A. Y. Andreev, E. M. Van Allen, M. Bertagnolli, P. K. Sorger, R. J. Sullivan, K. T. Flaherty, D. T. Frederick, J. Jané-Valbuena, C. H. Yoon, O. Rozenblatt-Rosen, A. K. Shalek, A. Regev and L. A. Garraway (2016). "Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq." Science 352 (6282): 189-196. Vachtenheim, J. and J. Borovanský (2010). ""Transcription physiology" of pigment formation in melanocytes: central role of MITF." Exp Dermatol 19 (7): 617-627. Wang, H., M. Liu, Z. Ye, C. Zhou, H. Bi, L. Wang, C. Zhang, H. Fu, Y. Shen, J. J. Yang, Y. Hu and G. Chen (2021). "Akt Regulates Sox10 Expression to Control Oligodendrocyte Differentiation via Phosphorylating FoxO1." J Neurosci 41 (39): 8163-8180. Zhou, S., H. Zeng, J. Huang, L. Lei, X. Tong, S. Li, Y. Zhou, H. Guo, M. Khan, L. Luo, R. Xiao, J. Chen and Q. Zeng (2021). "Epigenetic regulation of melanogenesis." Ageing Res Rev 69 : 101349. Additional Declarations No competing interests reported. Supplementary Files SupplementaryTables.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7850188","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":549295772,"identity":"05df6d11-6298-4332-9767-ae313daa50ef","order_by":0,"name":"Hang Zhou","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Zhou","suffix":""},{"id":549295773,"identity":"2253c10a-e264-478c-8b20-1ad440098bc1","order_by":1,"name":"Yu-Yun Xiong","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Yu-Yun","middleName":"","lastName":"Xiong","suffix":""},{"id":549295774,"identity":"846685dc-397f-4868-a099-6bb436d99f5c","order_by":2,"name":"Yun Wang","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Wang","suffix":""},{"id":549295775,"identity":"899afc15-b526-415c-88c9-d4aedc5a76a0","order_by":3,"name":"Yan-Yan Chen","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Yan-Yan","middleName":"","lastName":"Chen","suffix":""},{"id":549295776,"identity":"7b8464e9-8700-48c2-b346-ca6b49ff20a0","order_by":4,"name":"Zi-Han Wang","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Zi-Han","middleName":"","lastName":"Wang","suffix":""},{"id":549295777,"identity":"963f9256-29ee-4d3d-87a2-c1b8bdd6b15e","order_by":5,"name":"Chen Tan","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Tan","suffix":""},{"id":549295778,"identity":"c56f0039-4a17-4775-98dc-d84d9f6a0ee3","order_by":6,"name":"Jie Yang","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Yang","suffix":""},{"id":549295779,"identity":"fb671ece-5843-452a-adae-ad1ab8e7635e","order_by":7,"name":"Yu-Mei Li","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Yu-Mei","middleName":"","lastName":"Li","suffix":""},{"id":549295780,"identity":"0539fd30-e720-443c-b636-53ad857efd22","order_by":8,"name":"Li-Ping Liu","email":"","orcid":"","institution":"Affiliated Hospital of Jiangsu University","correspondingAuthor":false,"prefix":"","firstName":"Li-Ping","middleName":"","lastName":"Liu","suffix":""},{"id":549295781,"identity":"4c5d7f4f-958f-4e36-b826-cfbbf1d5a4a2","order_by":9,"name":"Yun-Wen Zheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYDACCQST8UFiA4lamA1I1sImwUiMFvnZzccefm07nGdwvPdYxcMddvK6/QcYP/xgsMvDpYVxzrF0Y9m2w8UGZ86l3Ug8k2y47UYCs2QPQ3IxLi3MEjlm0pJthxO33cgxu5HYdoBx2w0GBmkGhgM4/cUmkf8NouX+G7MCoBb7becPMP/Gp4VHIodN8iPYFh4zBqCWxG0HEtjw2iIhkWYmzXAuPXH/mRxjicS25ORtQOdZ9hgk49QiPyP5meSPMuvEme1nDD/+bLOz3Xb+8OEbPyrs8MYRMy8bCh8UOwZ41IOU/PiDX8EoGAWjYBSMcAAAR6leNpIpcgAAAAAASUVORK5CYII=","orcid":"","institution":"Wuyi University","correspondingAuthor":true,"prefix":"","firstName":"Yun-Wen","middleName":"","lastName":"Zheng","suffix":""}],"badges":[],"createdAt":"2025-10-13 14:38:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7850188/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7850188/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96914230,"identity":"2e34889d-f900-4c60-9c26-d68c0861682b","added_by":"auto","created_at":"2025-11-27 14:05:37","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11158985,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript251024.docx","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/14f45f2db86e7e314074113b.docx"},{"id":96914260,"identity":"c56401b8-4ad3-43d9-8964-67a687553b81","added_by":"auto","created_at":"2025-11-27 14:05:39","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10537,"visible":true,"origin":"","legend":"","description":"","filename":"8331137abe914b22a157d9b82a114c3e.json","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/eba4a3d2825f795dbebde3e4.json"},{"id":96913962,"identity":"6deead89-f47b-4627-a88e-0bfae31cce7d","added_by":"auto","created_at":"2025-11-27 14:04:54","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":130400,"visible":true,"origin":"","legend":"","description":"","filename":"8331137abe914b22a157d9b82a114c3e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/42923ca439d16893df4a2c12.xml"},{"id":96747238,"identity":"3c39c1bd-457a-4cbf-962c-f008ac9bc2f9","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/870a35f107f93a09ae27343e.jpeg"},{"id":96914653,"identity":"2186703b-361c-4524-ab90-0e6bec5c2b5f","added_by":"auto","created_at":"2025-11-27 14:06:12","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/fc36dab4e7edcb4855b82bbd.jpeg"},{"id":96747240,"identity":"ce66f3a6-2e44-47d4-ba50-30ad0f22b301","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93881,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/bbebe6a376fe1a55d3abf840.jpeg"},{"id":96914473,"identity":"c168ca53-8713-43b3-9f5e-eb75c9b78963","added_by":"auto","created_at":"2025-11-27 14:05:57","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":125313,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/17e68c1d497de71f737eae8c.jpeg"},{"id":96747248,"identity":"72d846d5-c585-4495-af73-1a448d5b4eea","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":75659,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/f1ea00966b31a9e07dc199d9.jpeg"},{"id":96914471,"identity":"49556579-f764-47e9-b05c-6d5bd72716f7","added_by":"auto","created_at":"2025-11-27 14:05:57","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77402,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/9385e966ea87514f7b4a2a2a.jpeg"},{"id":96913684,"identity":"f27b4eb1-e7fb-4fa5-b430-68e2df43f76d","added_by":"auto","created_at":"2025-11-27 14:03:50","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60602,"visible":true,"origin":"","legend":"","description":"","filename":"groupimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/2b7f10be55c4861474472a56.jpeg"},{"id":96913756,"identity":"68c744dc-d4a4-4da6-b3b0-ff6766367ed9","added_by":"auto","created_at":"2025-11-27 14:04:11","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/08d66875d830981d6dd45dca.png"},{"id":96747244,"identity":"028dde82-cdca-4bdc-bd49-163725f0ff43","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/351284c06094a67d97fabd72.png"},{"id":96747252,"identity":"f87a2d02-c5c4-44b6-b5bb-cfb78cd692a5","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33529,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/51210719f421b091873d57e4.png"},{"id":96747254,"identity":"5bdd0e43-111f-449a-8cbe-0eafa1358072","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43173,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/b93a3d455c433c7ac7691dd4.png"},{"id":96913653,"identity":"0ff7cd79-48be-41fd-ba9c-f4ec0e4bac3f","added_by":"auto","created_at":"2025-11-27 14:03:25","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22945,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/1af4b121da5176c67f168ea1.png"},{"id":96747256,"identity":"fa4f6991-448a-4eb7-9ab8-e1de7568969b","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":24466,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/bb3b561b84b2db57919c9bed.png"},{"id":96747255,"identity":"a0f9546e-6d87-49d7-8d47-996450e00316","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17329,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegroupimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/8673e850bb63458335dd0638.png"},{"id":96915402,"identity":"4523b7e8-1e93-42fa-b46e-c5d053c3d2ff","added_by":"auto","created_at":"2025-11-27 14:07:13","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":129938,"visible":true,"origin":"","legend":"","description":"","filename":"8331137abe914b22a157d9b82a114c3e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/abbfe74b366e0e013792e19a.xml"},{"id":96747257,"identity":"53427e8f-9702-4048-9036-1423606e8128","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"html","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139299,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/d5d62fa8c1719804747b3a48.html"},{"id":96747234,"identity":"95a588bc-cab4-4734-8171-c2fd37ad3212","added_by":"auto","created_at":"2025-11-25 16:11:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1328562,"visible":true,"origin":"","legend":"\u003cp\u003eTargeted insertion of the enhanced green fluorescent protein (EGFP) reporter gene into the microphthalmia-associated transcription factor (MITF) locus. A, Schematic of the EGFP fusion construct targeted to the endogenous gene locus. B, Representative images of knock-in induced pluripotent stem cells (iPSCs) before differentiation and their subsequently differentiated melanocytes at the indicated time points (days -3, 0, 7, 15, and 22). Scale bar = 100 µm. C, Centrifugation pellet of melanocytes derived from the differentiation of knock-in iPSCs. D, Immunofluorescence analysis of differentiated melanocytes shows EGFP expression (green) overlapping with the endogenous MITF protein (red, white arrow), the melanocyte marker tyrosinase-related protein 1(TYRP1; yellow), and nuclear DNA counterstained with 4′,6-diamidino-2-phenylindole (DAPI; blue). Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/43ad89f676f8a0cb82ac135b.png"},{"id":96914468,"identity":"37611a3f-c630-4c8f-baf1-d35b08b79b0d","added_by":"auto","created_at":"2025-11-27 14:05:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1357633,"visible":true,"origin":"","legend":"\u003cp\u003eCo-expression of microphthalmia-associated transcription factor (MITF) and enhanced green fluorescent protein (EGFP) in differentiating melanocytes. \u003cstrong\u003eA,\u003c/strong\u003e Comparison of \u003cem\u003eEGFP\u003c/em\u003e gene expression during the differentiation of knock-in (KI) and wild-type (WT) unmodified induced pluripotent stem cells (iPSCs) into melanocytes. Data are presented as mean ± SEM (WT, n=7; KI, n=10). Multiple unpaired *t* tests; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant. \u003cstrong\u003eB,\u003c/strong\u003e Correlation analysis of \u003cem\u003eMITF\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e gene expression values shows a strong positive correlation (R² = 0.91, P\u0026lt;0.0001). \u003cstrong\u003eC,\u003c/strong\u003e Fluorescence micrograph showing EGFP expression (green) in differentiated melanocytes. Cell nuclei are counterstained with Hoechst (blue). Scale bar = 100 µm. \u003cstrong\u003eD,\u003c/strong\u003e Flow cytometric analysis demonstrates the gradual increase in EGFP expression throughout the differentiation time course of KI iPSC-derived melanocytes. \u003cstrong\u003eE,\u003c/strong\u003e Quantification of the EGFP-positive cell rate (left) and mean fluorescence intensity (MFI, right) from flow cytometric analysis. Data are presented as mean ± SD. Paired *t* test; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant. \u003cstrong\u003eF,\u003c/strong\u003e Scatter plot showing the correlation between MITF and EGFP protein expression levels in individual cells on day 21 of differentiation, as measured by flow cytometry. \u003cstrong\u003eG,\u003c/strong\u003e The EGFP-positive rate within the MITF-positive cell population (left) and the corresponding MFI (right) on day 21. Data are presented as mean ± SD (WT, n=4; KI, n=5). Unpaired *t* test; ****, p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/519f1cb77badbac6e722f4ae.png"},{"id":96747243,"identity":"fd8a5e81-ad39-41e9-aca7-574b65b2d011","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":933364,"visible":true,"origin":"","legend":"\u003cp\u003eMITF-positive cells exhibit enhanced proliferative capacity. \u003cstrong\u003eA,\u003c/strong\u003e Schematic of the flow cytometry strategy for sorting cells based on enhanced green fluorescent protein (EGFP) signal, with representative plots showing the distribution of cells pre- and post-sorting. \u003cstrong\u003eB,\u003c/strong\u003e Schematic of the single-cell colony formation assay, where sorted single cells were cultured at clonal density for 7 days. \u003cstrong\u003eC,\u003c/strong\u003e Expression of \u003cem\u003eMITF\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e mRNA in sorted EGFP-negative and EGFP-positive cell populations. Data are presented as mean ± SD (n=8 biological replicates). Paired *t* tests; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant. \u003cstrong\u003eD,\u003c/strong\u003e Quantification of the average number of colonies formed (left) and their average Feret's diameter (right) from sorted EGFP-negative and EGFP-positive cells. Data are presented as mean ± SD (n=5 biological replicates). Paired *t* tests; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant. \u003cstrong\u003eE,\u003c/strong\u003e Representative bright-field (left) and fluorescence (right) micrographs of cell aggregates (colonies) derived from single-cell clones. Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/0cb2c05aec8d0654c73a372e.png"},{"id":96914376,"identity":"e940f495-01c5-4408-95d0-cd1bd9b9a718","added_by":"auto","created_at":"2025-11-27 14:05:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1075336,"visible":true,"origin":"","legend":"\u003cp\u003eMITF-positive cells express the surface marker KIT. \u003cstrong\u003eA,\u003c/strong\u003e Volcano plot of differentially expressed genes (DEGs) between enhanced green fluorescent protein (EGFP)-positive and EGFP-negative cell populations. The x-axis shows the log2 fold change; the y-axis shows the -log10 (Q value). Red points, upregulated DEGs; blue points, downregulated DEGs; gray points, non-significant genes (DESeq2; Q value ≤0.05). \u003cstrong\u003eB,\u003c/strong\u003e Bar plot summarizing the number of upregulated (red) and downregulated (blue) DEGs in the EGFP-positive group compared to the EGFP-negative control group (DESeq2; control: EGFP-negative, n=6; treatment: EGFP-positive, n=6). \u003cstrong\u003eC,\u003c/strong\u003e Principal component analysis (PCA) plot based on normalized read counts from RNA sequencing of sorted cells. The x-axis (PC1) and y-axis (PC2) represent the first and second principal components, respectively. Each point represents a single sample, colored by group. PV, proportion of variance; SD, standard deviation. \u003cstrong\u003eD,\u003c/strong\u003e Heatmap depicting the correlation between gene co-expression modules and sample phenotypes. The color scale represents the Pearson correlation coefficient for each module-sample pair. Corresponding P values were calculated using the corPvalueStudent function in R. \u003cstrong\u003eE,\u003c/strong\u003e Table of significant Gene Ontology (GO) biological process terms enriched in genes from module 4. Enrichment analysis was performed using the phyper function in R; Q values were calculated by P value adjustment. \u003cstrong\u003eF,\u003c/strong\u003e Table of significant Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enriched in genes from module 4. Enrichment analysis was performed using the phyper function in R; Q values were calculated by P value adjustment. \u003cstrong\u003eG,\u003c/strong\u003e Expression distribution of selected candidate surface markers, including KIT, from single-cell RNA sequencing data. Co-expression analysis revealed extensive overlap between KIT and MITF. \u003cstrong\u003eH,\u003c/strong\u003e Expression of KIT in sorted EGFP-positive and EGFP-negative cells, referenced against the pluripotent stem cell line WTC11 and primary human epidermal melanocytes (HEMs). Data are presented as mean ± SD (n=9 biological replicates). Paired t tests; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant. \u003cstrong\u003eI,\u003c/strong\u003e Representative flow cytometry plots showing co-expression of the KIT surface protein and MITF (reported by EGFP) in differentiated melanocytes. \u003cstrong\u003eJ,\u003c/strong\u003e Quantification of the KIT-positive rate within the MITF(EGFP)-positive cell population. NC, unstained negative control. Data are presented as mean ± SD (NC, n=5; KI iMels, n=5). Paired t test; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, not significant.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/960598728f7362470e204bb0.png"},{"id":96747242,"identity":"37d54681-25c1-426c-aabd-b2742cbde8a2","added_by":"auto","created_at":"2025-11-25 16:11:45","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":388693,"visible":true,"origin":"","legend":"\u003cp\u003eKIT-positive cells exhibit progenitor-like properties in melanocyte populations. \u003cstrong\u003eA,\u003c/strong\u003e Relative mRNA expression of \u003cem\u003eKIT\u003c/em\u003e and \u003cem\u003eMITF\u003c/em\u003e after siRNA-mediated \u003cem\u003eMITF\u003c/em\u003e knockdown. Data are presented as mean ± SD (n=8 biological replicates); *, p \u0026lt; 0.05; **, p \u0026lt; 0.01 (paired Student's t-test). \u003cstrong\u003eB,\u003c/strong\u003e Representative flow cytometry contour plots depicting concurrent protein expression of MITF (via EGFP reporter) and KIT (CD117) in control and \u003cem\u003eMITF\u003c/em\u003e knockdown conditions. \u003cstrong\u003eC,\u003c/strong\u003e qPCR analysis of \u003cem\u003eKIT\u003c/em\u003e and \u003cem\u003eMITF\u003c/em\u003e expression in MACS-sorted CD117+ versus CD117- cell fractions. Data are presented as mean ± SD (n=5 biological replicates); **, p \u0026lt; 0.01 (unpaired Student's t-test). \u003cstrong\u003eD,\u003c/strong\u003e Flow cytometric histograms showing EGFP (MITF) expression intensity in MACS-sorted CD117+ and CD117- populations. \u003cstrong\u003eE,\u003c/strong\u003e Representative micrographs of colonies formed in methylcellulose-based CFU assays from single CD117-sorted cells after 7 days of culture. Scale bar = 100 μm. \u003cstrong\u003eF,\u003c/strong\u003e Quantification of colony-forming units (CFUs) from CD117+ and CD117- sorted cell populations. Data are presented as mean ± SD (n=5 biological replicates). \u003cstrong\u003eG,\u003c/strong\u003e Measurement of average colony diameters from CD117-sorted cell populations. Data are presented as mean ± SD (n=5 biological replicates).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/f44c74fcb1e4317f941292a0.png"},{"id":98421744,"identity":"ba61e589-5631-4ceb-b6c7-d79f6e042275","added_by":"auto","created_at":"2025-12-17 16:29:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6536443,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/9d648399-aaca-40e1-a2a3-e15a1945da47.pdf"},{"id":96747233,"identity":"24bd0564-e114-4988-adec-55f283c0370c","added_by":"auto","created_at":"2025-11-25 16:11:44","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":18649,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTables.docx","url":"https://assets-eu.researchsquare.com/files/rs-7850188/v1/37483ab0b3e5d50e0aec5b73.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Insights into MITF-expressing cells derived from human iPSCs in melanogenesis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThere are a lot of depigmentation diseases derived from the loss of melanocytes stimulated by stress or autoimmune disorders, the treatment principle is the pigment replenish(Thakur, Bishnoi et al.). There are many known treatments for restoring of pigmentation like surgical skin grafting(Dai, Chang et al.), phototherapy(Kim, Singer et al.), microneedling(Salloum, Bazzi et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), topical drugs therapy(Rosmarin, Pandya et al.), etc. But these treatments include faults but not limited to severe scar formation, long treatment cycle, low efficiency, uneven pigment dispersion, un-predicted hypopigmentation and endless recurrence. People have put forward isolating and manipulating melanocyte stem cells (McSCs) for tissue engineering as a source of abundant pure dependable human pigment for many years(Lang, Mascarenhas et al., Lee and Fisher \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). However, this treatment still not implemented yet, separation and purification of primary McSCs are still a complexity which is hindered by the lack of clear definition.\u003c/p\u003e\u003cp\u003eStudies have confirmed that melanocytes constitute a relatively low proportion of cells in the skin, existing predominantly in the basal layer, with one mature melanocyte for every ten keratinocytes(Cichorek, Wachulska et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This indicates that the proportion of melanocyte stem cells is even lower. Consequently, isolating enough melanocytes for the study of melanocyte stem cells presents a significant challenge. However, systems that facilitate the differentiation of pluripotent stem cells towards the melanocyte lineage may offer a potential solution to this issue. MITF plays a crucial role in the development of melanocytes(Levy, Khaled et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Goding and Arnheiter \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The MITF can activate over 25 genes in pigment cells(Vachtenheim and Borovansk\u0026yacute; \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). It is not only an important regulatory factor for the development, proliferation, and survival of melanocytes, but also plays a critical role in ensuring the expression of enzymes and structural proteins necessary for melanin production. SRY-box transcription factor 10 (SOX10) and paired box 3 (PAX3) are considered to play important roles in the development of McSCs in early mice studies(Lang, Lu et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, Harris, Buac et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, their expression during melanocyte development may occur prematurely, and they may also promote neural differentiation and skeletal muscle formation in addition to their role in melanocyte development(Buckingham and Relaix \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Wang, Liu et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBy visualizing MITF in induced pluripotent stem cells (iPSCs), through an embryoid differentiation system of human fluid microenvironment homologous, this work tried to characterize the human McSCs derived from iPSCs. In this study, we confirmed that MITF-expressing induced melanocytes have the stem cell property of self-renewing capability. At the same time, we obtained KIT as a possible surface marker for isolating human McSCs, it may provide an alternative treatment option for depigmented disorders.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003eiPSCs maintaining\u003c/h2\u003e\n \u003cp\u003eThe control human iPSC (hiPSC) line is UCSFi001-A (Coriell#GM25256), alternative name is WTC11(Kreitzer, Salomonis et al. 2013); the MITF-mutated familial WTC11-iPSC lines M10-21, M10-36, M10-38, M10-123, M10-131, M10-123 were cultured with Matrigel(stemcell 354277) in mTeSR medium(stemcell 85850).H9 were cultured with mitomycin C-treated SNL murine fbroblast feeder cells in ES0 medium containing 20% knockout serum replacement (KSR) (Termo Fisher), 0.1mM non-essential amino acids (Sigma-Aldrich), 0.1mM 2-mercaptoethanol (Sigma-Aldrich), and 4ng ml–1 fibroblast growth factor 2 (FGF-2) (PeproTech) in an atmosphere containing 5% CO2. All cells were tested for mycoplasma monthly during culture and differentiation using the MycoBlue Mycoplasma Detector (Vazyme #D101-01).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eCRISPR/Cas9 and gene editing\u003c/h3\u003e\n\u003cp\u003eIn this study, enhanced green fluorescent protein (EGFP) was knocked in MITF by the CRISPR/Cas9 gene editing system. The following primers were synthesized by BGI Genomics: MITF10-1-F (CACCGAGTGGATCAGTGACACCGA ), MITF10-1-R (AAACTCGGTGTCACTGATCCACTC ), MITF6-1-F (CACCGGAAGCTCCGGGGGACACTG ), MITF6-1-R (AAACCAGTGTCCCCCGGAGCTTCC ), 800-F (ACTGCCAGTGGTACTTCTCCT ), 800-R (GGATCACACTCATTGATGAAGAA), Knock out cloning was performed using Addgene_ pU6-(BbsI)_CBh-Cas9-T2A-BFP vector, which was a gift from Feng Zhang (Addgene plasmid #64323; https://www.addgene.org/64323/; RRID:Addgene_64323), single guide RNA (sgRNA) sequences are list in supplementary table 3. Homologous recombination cloning was performed using Addgene_ T-2A-EGFP-PGK-Puro vector, which was a gift from James Thomson lab (Addgene plasmid #83344; https://www.addgene.org/83344/; RRID: Addgene_83344). The ligated vector was inserted into DH5α Chemically competent cells (Vazyme, China). Through vector construction, we replaced the homologous arm sequence based on the pUC57 vector (YSY biotech), and constructed the homologous recombination template of MITF gene, and used the T-2A-EGFP-PGK-Puro vector (addgene#83344) donated by James Thomson lab. Plasmid construction was performed according to protocol and confirmed by sequencing. The WTC11 cell line was transfected with reconstructed plasmid from Addgene_ pU6-(BbsI)_CBh-Cas9-T2A-BFP and Addgene_ T-2A-EGFP-PGK-Puro by Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Thermo Fisher #CMAX00003) for 24 h (Calatayud, Carola et al. 2019). After one day the transfected cells were selected with puromycin (concentration 5 ng/µL). ROCK Inhibitor Y-27632 (Selleck Chemicals LLC, #S1049) was added to the clone culture medium. Thereafter, single-cell cloning was performed in 96-well plates to grow single clones. After growth, PCR and sequencing were performed to detect the knock-in.\u003c/p\u003e\n\u003ch3\u003eGeneration of MITF mutated iPSCs\u003c/h3\u003e\n\u003cp\u003eiPSCs were transferred with plasmids containing sgRNA and Cas9 protein sequence and recombination templates. The quantity of sgRNA plasmids is triple the template plasmids. After transfection, iPSCs were single cell digested with Accutase(stemcell #07922), and planted in Matrigel filled culture plate with density of 5*10^5cells per 9cm dish, add 10 uM Y27632(Selleck Chemicals LLC, #S1049). Cells were screened in mTeSR medium containing 0.5ug/ml Purinomycin(Thermo Fisher #A1113803) for 14 days. We picked the single cell derived cell clones into 96well plates one clone per well and detect the genome sequence of these clones.\u003c/p\u003e\n\u003ch3\u003eConfirmation of fluorescent reporter after knock-in\u003c/h3\u003e\n\u003cp\u003eFor primary detect, cells were scraped for 2ul mixed with MightyAmp™ DNA Polymerase (Takara R071A), perform the polymerase chain reaction and DNA gel electrophoresis. For samples with positive results, we extract DNA from the sample with MiniBEST Universal Genomic DNA Extraction Kit(Takara Cat. No. 9765), amplifying the target sequences and sequencing.\u003c/p\u003e\n\u003ch3\u003eMelanocyte induction in vitro\u003c/h3\u003e\n\u003cp\u003eFor in vitro differentiation, we implemented the human melanocyte differentiation system as reported in earlier work (Liu, Li et al. 2019, Liu, Guo et al. 2020). hPSCs were cultured in hiPSC medium for 5–7 days. The medium was changed every day. On day 5–7, hPSC colonies were detached from the feeder layers using ReLeSR™ (stemcell 100–0484). The dissociated cells were cultured in suspension at a density of 2×10\u003csup\u003e5\u003c/sup\u003e cells per ml in ultra-low attachment culture dishes (Corning) in mTeSR medium consisting of 10 µM Y27632 in a humidified atmosphere (5% CO2, 37℃) for 3 days. The medium of spheres that get a diameter of 300-500um were changed into differentiation medium(Liu, Guo et al. 2020). Half of the medium was changed every 1 day, or full medium was changed every 2 days. After 2 weeks of suspension differentiation, pick these spheres into ordinary petri dishes without changing the differentiation medium. The iPSCs deriver melanocytes crabbed onto the plate, then passed by 0.025% Trypsin.\u003c/p\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eSingle cell-based clonal formation assay\u003c/h2\u003e\n \u003cp\u003eiPSCs deriver melanocytes were detached from the plate using DMEM contain 0.025% Trypsin, then sortied by flow sorting instrument (BD). Seeded into ultra-low attachment culture dishes, supported by the differentiation medium supplemented with 0.6% methyl cellulose (Sigma-Aldrich).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eAnalysis of cell spheroids\u003c/h3\u003e\n\u003cp\u003eSpheroids formed by single-cell cloning, we took pictures using Nikon's inverted microscope, synthesized them with image J image analysis software, and then calculated the number and size of spheroids, and the radius of a single cell was about 8 µm on the first day of sorting, so we only counted spheroids with a body surface area greater than 200 µm\u003csup\u003e2\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunocytochemistry.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were fixed in phosphate-buffered saline (PBS) containing 2% paraformaldehyde (PFA) for 20min at 4℃. Thereafter, all cells were ruptured by 10% Tween100 incubation 5 minutes for 3 times, then blocked with 10% normal goat serum (NGS) for 1 hour and incubated with the primary antibodies described in Supplementary Table 1. The cells were then rinsed with PBS and incubated with species-specific Alexa Fluor 488- (1/500; Invitrogen), Alexa Fluor 647- (1/500; Invitrogen), or cy3- (1/500; Jackson) conjugated secondary antibodies, followed by staining with DAPI (10µg/ml; Sigma-Aldrich) to counterstain the nuclei. Images were obtained using an inverted fluorescence microscope (Nikon). The details of primary and secondary antibodies are described Supplementary Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry analysis of MITF expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were fixed in 1% PFA for 15min on ice, rupture of membranes by 0.3%Triton (Bomei, BQ0694), cells were incubated with the primary antibodies for 60 minutes, then incubated with species-specific Alexa Fluor 647-conjugated secondary antibodies (1/1000; BioLegend). Flow cytometry data analysis was performed using the BD FACS (Canto10).\u003c/p\u003e\n\u003ch3\u003eMagnetic-activated cell sorting (MACS)\u003c/h3\u003e\n\u003cp\u003eWe dissociated the cells into single-cell suspensions using Accutase (StemCell Technologies, #07920) and subsequently sorted them into CD117-negative and CD117-positive populations following the manufacturer’s protocol (Miltenyi Biotec, #130-091-332).\u003c/p\u003e\n\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003eQuantitative RT–PCR\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated by trizol extraction method (ambion, 15596018), then RNA was treated with RevertAid First Strand cDNA Synthesis Kit (Thermo, K1622). Quantitative RT–PCR was performed using SYBR Premix Ex Taq II (Takara Bio) on a QuantStudio 3 Real-Time PCR System (Applied Biosystem). The details of qRT–PCR primers are described in Supplementary Table 2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eValues are expressed as mean ± s.d. Statistical significance was calculated with GraphPad Prism (GraphPad Software). The effect of the treatments on the cell lines was analyzed using a two tailed paired \u003cem\u003et\u003c/em\u003e-test. A two-tailed non-paired \u003cem\u003et\u003c/em\u003e-test was used to compare differences between two groups, and one-way ANOVA followed by Dunnett’s or Tukey’s multiple comparisons test were used to compare three or more groups. Two-tailed Fisher’s exact test was used for the pathway/gene ontology enrichment analysis. \u003cem\u003eP\u003c/em\u003e values less than 0.05 were considered significant differences.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eReport on\u003c/b\u003e \u003cb\u003eMITF\u003c/b\u003e \u003cb\u003ein iPSCs\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA stable human melanocyte differentiation system has been formed in previous study (Liu, Li et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Liu, Guo et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Melanocytes were differentiated successfully from iPSCs as expected. iPSCs induced melanocytes (iMels) have a similar morphology to the human epidermal melanocyte (HEM). To visualize melanocyte cells during differentiation and tracking the differentiation process of melanocyte in real time, we visualized MITF. The fluorescent reporter system is robustly established by CRISPR-Cas9 and the \u003cem\u003eEGFP\u003c/em\u003e gene was inserted at the terminal end of the \u003cem\u003eMITF\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This reporter gene is expressed solely in conjunction with MITF expression, allowing real-time tracking of MITF expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe knock-in (KI) iPSCs were differentiated according to the previously established protocol to determine its potential for differentiation (Liu, Guo et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). As predicted, the KI cell lines retain their stem cell characteristics and can differentiate into mature melanocytes (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The overlap of EGFP with MITF and DAPI was intuitively observed, and EGFP fluorescence was visible in almost all MITF-positive cells (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Eventually, pigmentation was also visible by cytocentrifugation (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Compared with gene expression, there was no significant difference between the knock-in group and the control group at the mRNA expression level (Figure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), and it was observed that the expression of stem cell-related markers POU class 5 homeobox 1 (OCT4) and SRY-box transcription factor 2 (SOX2) was higher on day 0 of differentiation. In the middle phase of differentiation, melanin markers such as MITF, PAX3, and SOX10 are expressed. Moreover, in the late stage of differentiation, the markers of mature melanocytes such as tyrosinase (TYR), and tyrosinase-related protein 1 (TYRP1) were expressed in large quantities. These all indicate that there is no significant difference in differentiation between the knock-in group and the control group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003evisualize melanocyte cells during differentiation\u003c/h2\u003e\u003cp\u003esubsequently, we verified the reporter function of the KI cell lines in our differentiation system. To confirm that the stem cells can express EGFP after differentiation following knock-in, the expression of EGFP in mRNA was measured. It was observed that the expression of EGFP was not present in undifferentiated pluripotent stem cells, and the expression of EGFP gradually increased with differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Then, the expressions of \u003cem\u003eMITF\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e were analyzed by fitting curves and flow cytometry., and it was found that the expressions of MITF and EGFP were highly correlated, which proved that EGFP was not expressed independently, but was expressed with MITF (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, F). In addition, the presence of fluorescence was observed under a fluorescence microscope. Compared to induced melanocytes differentiated under the same conditions as gene-edited and unedited stem cells, cells without knock-in EGFP showed only faint background fluorescence, while knock-in iMel showed punctate green fluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Flow cytometry analysis also showed that the expression of EGFP protein in the knock-in group gradually increased with the progress of differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E). The green fluorescence positive rate and fluorescence intensity of the knock-in group were significantly higher than those of the control group(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). The above experimental results confirm the successful construction of our in-vitro observation model.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn summary, we have established a pluripotent stem cell line that reports the expression of the \u003cem\u003eMITF\u003c/em\u003e gene, allowing for real-time observation of MITF expression during the differentiation process.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMITF is the key point from nerve spines to melanocytes and MITF positive iMels have self-renewal capability\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn the process of iPSCs differentiating into melanocytes, we confirmed that MITF is an invaluable gene for human McSCs. Since MITF has long been thought to be a lineage gene for melanocytes(Shibahara, Takeda et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), cells were sorted into EGFP-positive and negative cells by flow cytometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We have validated the sorting effect by evaluating the Mitf and Egfp mRNA expression. Compared with the EGFP-negative and positive cells after fluorescence-activated cell sorting (FACS) sorting, the positive cells had higher MITF and EGFP expression levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Using an extremely low-density suspension culture, we assessed the ability of EGFP-positive and EGFP-negative cells to form clonal clumps from single cells. Analysis of flow cytometry-sorted EGFP-positive and negative cells revealed that EGFP-positive cells exhibited strong spherical formation at 21 days of differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In addition, we observed a higher number and volume of cell clumps formed by the EGFP-positive subpopulation at 7 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Compared with the cell clumps formed by the negative population, the positive population had larger clumps with partial EGFP fluorescence expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). This phenomenon indicates that MITF-positive cells retain their self-renewal and differentiation abilities. The continuously cultured cells could produce both McSCs that express MITF with EGFP and mature cells that do not express MITF.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eKIT expressing on the cellular membrane of MITF-positive iMels\u003c/h2\u003e\u003cp\u003eThe EGFP\u0026thinsp;+\u0026thinsp;and EGFP- cells analyzed by high-throughput sequencing, and the positive cells were highly expressing genes related to the melanogenesis signaling pathway. We compared the differential genes in six groups of samples, of which 1594 genes were up-regulated, and 1492 genes were down-regulated, and the up-regulated genes contained MITF, indicating that the samples were successfully sorted (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). Principal component analysis of the sorted samples showed a significant difference in gene expression between the positive and negative cells sorted by MITF (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003ePrincipal component analysis of the sorted samples reveals distinct differences in gene expression between MITF-positive and MITF-negative cells. Moreover, the differences associated with passaging appear to be even more pronounced than those between MITF-negative and -positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). To eliminate the variations caused by other factors associated with passaging during differentiation, we conducted an analysis of the co-expression gene modules in relation to phenotypic correlations. It indicates that the fourth module remains stable regardless of the number of passages, suggesting that the genes included in this module are likely directly related to the expression of the MITF gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Gene ontology (GO) enrichment analyzed the gene set contained within this module, revealing significant enrichment in the \"Wnt signaling pathway,\" \"melanocyte differentiation,\" and \"pigmentation\" categories (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These findings align with the previous understanding of the MITF gene and provide indirect support for the hypothesis that the gene set may be directly related to the function and regulation of MITF. Additionally, it was found that this gene set is also enriched in processes related to melanocyte differentiation, positive regulation of cell proliferation, positive regulation of DNA template transcription and initiation, and positive regulation of the cell cycle (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These results are consistent with the cellular experiments, indicating that MITF may serve as a key driver or marker gene for melanocyte stem cells. It is consistent with cell-based experiments and demonstrates that MITF may be a promoter or hallmark gene of melanocytes.\u003c/p\u003e\u003cp\u003eWe further screened the cell membrane surface proteins within this module and identified nine potential membrane surface proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Through gene co-expression analysis, it was found that the protein KIT showed significant overlap with MITF. Then we tested the KIT expression in both MITF-positive and MITF-negative cells, which showed that KIT was highly expressed in MITF-positive cells and expressed at low levels in MITF-negative cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH). We also analyzed KIT and MITF expressions by flow cytometry, which confirmed the hypothesis that MITF-positive iMels express KIT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eKIT may be a reference marker for isolating highly proliferative melanocytes.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eKIT-sorted induced melanocytes exhibit clonogenic capacity. Based on the co-expression pattern of MITF and KIT, it was sought to determine whether KIT is regulated by MITF and therefore designed an \u003cem\u003eMITF\u003c/em\u003e knockdown experiment. It is found that in melanocytes, \u003cem\u003eMITF\u003c/em\u003e knockdown led to decreased gene expression of both \u003cem\u003eMITF\u003c/em\u003e and \u003cem\u003eKIT\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B), suggesting that \u003cem\u003eKIT\u003c/em\u003e is regulated by \u003cem\u003eMITF\u003c/em\u003e. Subsequently, we investigated whether KIT-based sorting could enrich highly proliferative melanocytes. On day 21 of induced melanocyte differentiation, KIT-positive and KIT-negative cells were isolated via magnetic beads sorting, and qPCR was performed to assess KIT and MITF expressions in the two populations (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The results showed a significant difference in \u003cem\u003eKIT\u003c/em\u003e expression between the two groups, whereas \u003cem\u003eMITF\u003c/em\u003e expression, though differing, did not reach statistical significance. Flow cytometry analysis further revealed that over 90% of KIT-positive cells were EGFP-positive, whereas the KIT-negative population still contained more than 50% EGFP-positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). KIT-positive cells exhibit single-cell clonogenic capacity, though the possibility, meanwhile, KIT-negative cells may also possess relatively weaker clonogenic potential (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-G). Although KIT expression does not strictly correlate with MITF expression, the isolated cells alone may not fully represent the entire population of highly proliferative cells, KIT can be used to isolate a subset of highly proliferative cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMITF is a transcription factor in melanocyte development, which can maintain the proliferation and differentiation of melanocytes from melanocytes to melanocytes, it is also a lineage gene commonly expressed by melanocytes(Levy, Khaled et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, Sheinboim, Maza et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Joshi, Tandukar et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In the process of iPSCs differentiating into melanocytes, we confirmed that MITF is a support gene for human McSCs. In addition, MITF is a key transcription factor that determines the melanocyte fate, regulate the expression of several key melanogenesis-related genes, such as TYR, TYRP1 and dopachrome tautomerase (DCT), which maintains the proliferation and differentiation of McSCs to melanocytes(Goding and Arnheiter \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Zhou, Zeng et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). It is believed that expressing MITF can lead to the differentiation of cells with melanocyte functions (S\u0026aacute;ez-Ayala, Montenegro et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Tirosh, Izar et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Our study clearly establishes MITF as a marker for melanocytes with expansion capability and differentiation potential, and we have experimentally validated the ability of MITF-positive cells to form single-cell clones. In summary, MITF positive cells may possess stem-like properties.\u003c/p\u003e\u003cp\u003eFurthermore, Autologous melanocytes have been used in the treatment of vitiligo to promote repigmentation. However, since MITF is not a surface marker, it is hard to isolate live MITF positive melanocytes. For the application of isolating melanocytes, direct implantation of highly expanded melanocyte cells may be an appealing treatment option. Interestingly, we found that nearly all MITF-positive cells in differentiated melanocytes express KIT. KIT is considered a commonly expressed protein in various cell types with stem cell characteristics, such as cholangiocytes (Fujio, Hu et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1996\u003c/span\u003e), mast cells (Galli, Tsai et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1993\u003c/span\u003e), and hematopoietic stem cells (Okada, Nakauchi et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1992\u003c/span\u003e, Broudy, Lin et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1996\u003c/span\u003e, Gao, Carpenter et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The molecular mechanisms of KIT as a stem cell marker have been partially elucidated. Recent studies have identified the receptor tyrosine kinase c-Kit as a marker for stem cell trogocytosis, through which it acquires C-X-C motif chemokine receptor 4 (CXCR4) from adjacent macrophages to maintain the stable stem cell characteristics of hematopoietic stem cells (HSCs) in the bone marrow (Gao, Carpenter et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). A similar role may exist in melanocytes, where it supports the amplification and functional activation of melanocytes under dynamic environmental stimuli. With current separation techniques, it is now possible to roughly isolate melanocytes. For clinical applications, we can screen KIT-positive cells prior to transplantation, thereby improving the survival rate and efficiency of the transplant.\u003c/p\u003e\u003cp\u003eOur study also identified limitations of KIT as a sorting marker. Although most MITF-positive cells express KIT protein, KIT may not be exclusively distributed in MITF-positive cells. Furthermore, we found that while isolated KIT-positive cells exhibit relatively strong clonogenic capacity, the negative population may also possess stemness properties. Therefore, using KIT alone to isolate highly proliferative melanocytes, while potentially improving cell culture efficiency, may lead to the loss of a subset of target cells.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, by labeling, sorting, and single-cell clone formation of MITF, it was confirmed that the MITF gene can be used as a marker gene for proliferating melanocytes. In future studies on human melanocytes, the important role of MITF in the development and differentiation of melanocytes may provide some inspiration to other researchers. KIT-positive cells may be part of a source of McSCs, and it may be an efficient but not precise strategy to expand them extensively in vitro to obtain a significant supply of human melanocytes. It provides a resource for cell therapy for vitiligo, burns, and other pigment loss diseases. Maximum yield can be achieved with minimal cell volume, reducing the waste of media resources and the waiting time required for cell transplantation. At the same time, these cells can be provided to individuals in need, such as those with vitiligo, premature graying, or beauty institutions.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAbbreviation\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFull name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eCAS9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eCRISPR-associated protein 9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eCRISPR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eclustered regularly interspaced short palindromic repeats\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eCXCR4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eC-X-C motif chemokine receptor 4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eDCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003edopachrome tautomerase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eEGFP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eenhanced green fluorescent protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eFACS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003efluorescence-activated cell sorting\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eFGF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003efibroblast growth factor 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eGO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eGene ontology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eHEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003ehuman epidermal melanocyte\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eHIPSC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003ehuman induced pluripotent stem cell\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eHSCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003ehematopoietic stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eIMELS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003einduced pluripotent stem cell derived melanocytes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eIPSCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003einduced pluripotent stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eKIT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eKIT proto-oncogene receptor tyrosine kinase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eKI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eknock-in\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eKSR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eknockout serum replacement\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eMACS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eMagnetic-activated cell sorting\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eMCSCS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003emelanocyte stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eMITF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eMicrophthalmia-associated transcription factor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eNGS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003enormal goat serum\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eOCT4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003ePOU class 5 homeobox 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003ePAX3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003epaired box 3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003ephosphate-buffered saline\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003ePFA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eparaformaldehyde\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eSGRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003esingle guide RNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eSOX10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eSRY-box transcription factor 10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eSOX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003eSRY-box transcription factor 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eTYR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003etyrosinase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 20.6204%;\"\u003e\n \u003cp\u003eTYRP1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 79.3796%;\"\u003e\n \u003cp\u003etyrosinase-related protein 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study utilized the WTC11 cell line, and its origin (the Coriell Institute) has verified that the initial collection of the human cells was conducted under ethical approval and that informed consent was obtained from the donors (Kreitzer, Salomonis et al. 2013).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe healthy human skin scRNA-seq dataset was obtained from the publicly accessible repository: GEO: GSE151091(Belote, Le et al. 2021). The data supporting the findings of the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was partially funded by the China National Natural Science Foundation (82270697), Jiangsu Provincial Key Discipline Cultivation Unit (JSDW202229), Postgraduate Research \u0026amp; Practice Innovation Program of Jiangsu Province (KYCX22_3717), the Science and Technology Planning Project of Guangdong Province of China (2021B1212040016), Guangdong Basic and Applied Basic Research Foundation (2023A1515012574); Haihe Laboratory of Cell Ecosystem Innovation Fund (HH24KYZX0008).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, YWZ and LPL; methodology, HZ, LPL, YYX and YWZ.; experiment, HZ, YW, ZHW, CT, YYC; Bioinformatic and other formal analyses, HZ and JY; investigation, HZ, LPL and YWZ; resources, YWZ, YML, LPL and YYX; writing – original draft, HZ; writing – review \u0026amp; editing, HZ and YWZ; supervision, YWZ, LPL and YML; project administration, YWZ; funding acquisition, YWZ, YML, LPL and HZ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe gratefully acknowledge Ningning Guo, Yumu Song, and Jing Niu for their technical support. The authors declare that they have not use AI-generated work in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBelote, R. L., D. Le, A. Maynard, U. E. Lang, A. Sinclair, B. K. Lohman, V. Planells-Palop, L. Baskin, A. D. Tward, S. Darmanis and R. L. Judson-Torres (2021). \u0026quot;Human melanocyte development and melanoma dedifferentiation at single-cell resolution.\u0026quot; \u003cu\u003eNat Cell Biol\u003c/u\u003e \u003cstrong\u003e23\u003c/strong\u003e(9): 1035-1047.\u003c/li\u003e\n\u003cli\u003eBroudy, V. C., N. L. Lin, G. V. Priestley, K. Nocka and N. S. Wolf (1996). \u0026quot;Interaction of stem cell factor and its receptor c-kit mediates lodgment and acute expansion of hematopoietic cells in the murine spleen.\u0026quot; \u003cu\u003eBlood\u003c/u\u003e \u003cstrong\u003e88\u003c/strong\u003e(1): 75-81.\u003c/li\u003e\n\u003cli\u003eBuckingham, M. and F. Relaix (2015). \u0026quot;PAX3 and PAX7 as upstream regulators of myogenesis.\u0026quot; \u003cu\u003eSemin Cell Dev Biol\u003c/u\u003e \u003cstrong\u003e44\u003c/strong\u003e: 115-125.\u003c/li\u003e\n\u003cli\u003eCalatayud, C., G. Carola, I. Fernandez-Carasa, M. Valtorta, S. Jimenez-Delgado, M. Diaz, J. Soriano-Fradera, G. Cappelletti, J. Garcia-Sancho, A. Raya and A. Consiglio (2019). \u0026quot;CRISPR/Cas9-mediated generation of a tyrosine hydroxylase reporter iPSC line for live imaging and isolation of dopaminergic neurons.\u0026quot; \u003cu\u003eSci Rep\u003c/u\u003e \u003cstrong\u003e9\u003c/strong\u003e(1): 6811.\u003c/li\u003e\n\u003cli\u003eCichorek, M., M. Wachulska, A. Stasiewicz and A. Tymińska (2013). \u0026quot;Skin melanocytes: biology and development.\u0026quot; \u003cu\u003ePostepy Dermatol Alergol\u003c/u\u003e \u003cstrong\u003e30\u003c/strong\u003e(1): 30-41.\u003c/li\u003e\n\u003cli\u003eDai, N.-T., H.-I. Chang, Y.-W. Wang, K.-Y. Fu, T.-C. Huang, N.-C. Huang, J.-K. Li, P.-S. Hsieh, L.-G. Dai, C.-K. Hsu and P. K. Maitz \u0026quot;Restoration of skin pigmentation after deep partial or full-thickness burn injury.\u0026quot; \u003cu\u003eAdvanced drug delivery reviews\u003c/u\u003e \u003cstrong\u003e123\u003c/strong\u003e: 155-164.\u003c/li\u003e\n\u003cli\u003eFujio, K., Z. Hu, R. P. Evarts, E. R. Marsden, C. H. Niu and S. S. Thorgeirsson (1996). \u0026quot;Coexpression of stem cell factor and c-kit in embryonic and adult liver.\u0026quot; \u003cu\u003eExp Cell Res\u003c/u\u003e \u003cstrong\u003e224\u003c/strong\u003e(2): 243-250.\u003c/li\u003e\n\u003cli\u003eGalli, S. J., M. Tsai and B. K. Wershil (1993). \u0026quot;The c-kit receptor, stem cell factor, and mast cells. What each is teaching us about the others.\u0026quot; \u003cu\u003eAm J Pathol\u003c/u\u003e \u003cstrong\u003e142\u003c/strong\u003e(4): 965-974.\u003c/li\u003e\n\u003cli\u003eGao, X., R. S. Carpenter, P. E. Boulais, D. Zhang, C. R. Marlein, H. Li, M. Smith, D. J. Chung, M. Maryanovich, B. Will, U. Steidl and P. S. Frenette (2024). \u0026quot;Regulation of the hematopoietic stem cell pool by C-Kit-associated trogocytosis.\u0026quot; \u003cu\u003eScience\u003c/u\u003e \u003cstrong\u003e385\u003c/strong\u003e(6709): eadp2065.\u003c/li\u003e\n\u003cli\u003eGoding, C. R. and H. Arnheiter (2019). \u0026quot;MITF-the first 25 years.\u0026quot; \u003cu\u003eGenes Dev\u003c/u\u003e \u003cstrong\u003e33\u003c/strong\u003e(15-16): 983-1007.\u003c/li\u003e\n\u003cli\u003eHarris, M. L., K. Buac, O. Shakhova, R. M. Hakami, M. Wegner, L. Sommer and W. J. Pavan (2013). \u0026quot;A dual role for SOX10 in the maintenance of the postnatal melanocyte lineage and the differentiation of melanocyte stem cell progenitors.\u0026quot; \u003cu\u003ePLoS Genet\u003c/u\u003e \u003cstrong\u003e9\u003c/strong\u003e(7): e1003644.\u003c/li\u003e\n\u003cli\u003eJoshi, S. S., B. Tandukar, L. Pan, J. M. Huang, F. Livak, B. J. Smith, T. Hodges, A. A. Mahurkar and T. J. Hornyak (2019). \u0026quot;CD34 defines melanocyte stem cell subpopulations with distinct regenerative properties.\u0026quot; \u003cu\u003ePLoS Genet\u003c/u\u003e \u003cstrong\u003e15\u003c/strong\u003e(4): e1008034.\u003c/li\u003e\n\u003cli\u003eKim, H. J., G. K. Singer, E. Del Duca, B. J. Abittan, M. A. Chima, G. Kimmel, J. Bares, M. Gagliotti, J. Genece, J. Chu, G. Wilding, A. B. Pavel, E. Guttman-Yassky and M. G. Lebwohl \u0026quot;Combination of apremilast and narrowband ultraviolet B light in the tr eatment of generalized vitiligo in skin phototypes IV to VI: A randomi zed split-body pilot study.\u0026quot; \u003cu\u003eJournal of the American Academy of Dermatology\u003c/u\u003e \u003cstrong\u003e85\u003c/strong\u003e(6): 1657-1660.\u003c/li\u003e\n\u003cli\u003eKreitzer, F. R., N. Salomonis, A. Sheehan, M. Huang, J. S. Park, M. J. Spindler, P. Lizarraga, W. A. Weiss, P. L. So and B. R. Conklin (2013). \u0026quot;A robust method to derive functional neural crest cells from human pluripotent stem cells.\u0026quot; \u003cu\u003eAm J Stem Cells\u003c/u\u003e \u003cstrong\u003e2\u003c/strong\u003e(2): 119-131.\u003c/li\u003e\n\u003cli\u003eLang, D., M. M. Lu, L. Huang, K. A. Engleka, M. Zhang, E. Y. Chu, S. Lipner, A. Skoultchi, S. E. Millar and J. A. Epstein (2005). \u0026quot;Pax3 functions at a nodal point in melanocyte stem cell differentiation.\u0026quot; \u003cu\u003eNature\u003c/u\u003e \u003cstrong\u003e433\u003c/strong\u003e(7028): 884-887.\u003c/li\u003e\n\u003cli\u003eLang, D., J. B. Mascarenhas and C. R. Shea \u0026quot;Melanocytes, melanocyte stem cells, and melanoma stem cells.\u0026quot; \u003cu\u003eClinics in dermatology\u003c/u\u003e \u003cstrong\u003e31\u003c/strong\u003e(2): 166-178.\u003c/li\u003e\n\u003cli\u003eLee, J. H. and D. E. Fisher (2014). \u0026quot;Melanocyte stem cells as potential therapeutics in skin disorders.\u0026quot; \u003cu\u003eExpert Opin Biol Ther\u003c/u\u003e \u003cstrong\u003e14\u003c/strong\u003e(11): 1569-1579.\u003c/li\u003e\n\u003cli\u003eLevy, C., M. Khaled and D. E. Fisher (2006). \u0026quot;MITF: master regulator of melanocyte development and melanoma oncogene.\u0026quot; \u003cu\u003eTrends Mol Med\u003c/u\u003e \u003cstrong\u003e12\u003c/strong\u003e(9): 406-414.\u003c/li\u003e\n\u003cli\u003eLiu, L. P., N. N. Guo, Y. M. Li and Y. W. Zheng (2020). \u0026quot;Generation of Human iMelanocytes from Induced Pluripotent Stem Cells through a Suspension Culture System.\u0026quot; \u003cu\u003eSTAR Protoc\u003c/u\u003e \u003cstrong\u003e1\u003c/strong\u003e(1): 100004.\u003c/li\u003e\n\u003cli\u003eLiu, L. P., Y. M. Li, N. N. Guo, S. Li, X. Ma, Y. X. Zhang, Y. Gao, J. L. Huang, D. X. Zheng, L. Y. Wang, H. Xu, L. Hui and Y. W. Zheng (2019). \u0026quot;Therapeutic Potential of Patient iPSC-Derived iMelanocytes in Autologous Transplantation.\u0026quot; \u003cu\u003eCell Rep\u003c/u\u003e \u003cstrong\u003e27\u003c/strong\u003e(2): 455-466.e455.\u003c/li\u003e\n\u003cli\u003eOkada, S., H. Nakauchi, K. Nagayoshi, S. Nishikawa, Y. Miura and T. Suda (1992). \u0026quot;In vivo and in vitro stem cell function of c-kit- and Sca-1-positive murine hematopoietic cells.\u0026quot; \u003cu\u003eBlood\u003c/u\u003e \u003cstrong\u003e80\u003c/strong\u003e(12): 3044-3050.\u003c/li\u003e\n\u003cli\u003eRosmarin, D., A. G. Pandya, M. Lebwohl, P. Grimes, I. Hamzavi, A. B. Gottlieb, K. Butler, F. Kuo, K. Sun, T. Ji, M. D. Howell and J. E. Harris \u0026quot;Ruxolitinib cream for treatment of vitiligo: a randomised, controlled, phase 2 trial.\u0026quot; \u003cu\u003eLancet (London, England)\u003c/u\u003e \u003cstrong\u003e396\u003c/strong\u003e(10244): 110-120.\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;ez-Ayala, M., M. F. Montenegro, L. S\u0026aacute;nchez-Del-Campo, M. P. Fern\u0026aacute;ndez-P\u0026eacute;rez, S. Chazarra, R. Freter, M. Middleton, A. Pi\u0026ntilde;ero-Madrona, J. Cabezas-Herrera, C. R. Goding and J. N. Rodr\u0026iacute;guez-L\u0026oacute;pez (2013). \u0026quot;Directed phenotype switching as an effective antimelanoma strategy.\u0026quot; \u003cu\u003eCancer Cell\u003c/u\u003e \u003cstrong\u003e24\u003c/strong\u003e(1): 105-119.\u003c/li\u003e\n\u003cli\u003eSalloum, A., N. Bazzi, D. Maalouf and M. Habre (2020). \u0026quot;Microneedling in vitiligo: A systematic review.\u0026quot; \u003cu\u003eDermatol Ther\u003c/u\u003e \u003cstrong\u003e33\u003c/strong\u003e(6): e14297.\u003c/li\u003e\n\u003cli\u003eSheinboim, D., I. Maza, I. Dror, S. Parikh, V. Krupalnik, R. E. Bell, A. Zviran, Y. Suita, O. Hakim, Y. Mandel-Gutfreund, M. Khaled, J. H. Hanna and C. Levy (2017). \u0026quot;OCT4 impedes cell fate redirection by the melanocyte lineage master regulator MITF in mouse ESCs.\u0026quot; \u003cu\u003eNat Commun\u003c/u\u003e \u003cstrong\u003e8\u003c/strong\u003e(1): 1022.\u003c/li\u003e\n\u003cli\u003eShibahara, S., K. Takeda, K. Yasumoto, T. Udono, K. Watanabe, H. Saito and K. Takahashi (2001). \u0026quot;Microphthalmia-associated transcription factor (MITF): multiplicity in structure, function, and regulation.\u0026quot; \u003cu\u003eJ Investig Dermatol Symp Proc\u003c/u\u003e \u003cstrong\u003e6\u003c/strong\u003e(1): 99-104.\u003c/li\u003e\n\u003cli\u003eThakur, V., A. Bishnoi, K. Vinay, S. M. Kumaran and D. Parsad \u0026quot;Vitiligo: Translational research and effective therapeutic strategies.\u0026quot; \u003cu\u003ePigment cell \u0026amp; melanoma research\u003c/u\u003e \u003cstrong\u003e34\u003c/strong\u003e(4): 814-826.\u003c/li\u003e\n\u003cli\u003eTirosh, I., B. Izar, S. M. Prakadan, M. H. Wadsworth, 2nd, D. Treacy, J. J. Trombetta, A. Rotem, C. Rodman, C. Lian, G. Murphy, M. Fallahi-Sichani, K. Dutton-Regester, J. R. Lin, O. Cohen, P. Shah, D. Lu, A. S. Genshaft, T. K. Hughes, C. G. Ziegler, S. W. Kazer, A. Gaillard, K. E. Kolb, A. C. Villani, C. M. Johannessen, A. Y. Andreev, E. M. Van Allen, M. Bertagnolli, P. K. Sorger, R. J. Sullivan, K. T. Flaherty, D. T. Frederick, J. Jan\u0026eacute;-Valbuena, C. H. Yoon, O. Rozenblatt-Rosen, A. K. Shalek, A. Regev and L. A. Garraway (2016). \u0026quot;Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq.\u0026quot; \u003cu\u003eScience\u003c/u\u003e \u003cstrong\u003e352\u003c/strong\u003e(6282): 189-196.\u003c/li\u003e\n\u003cli\u003eVachtenheim, J. and J. Borovansk\u0026yacute; (2010). \u0026quot;\u0026quot;Transcription physiology\u0026quot; of pigment formation in melanocytes: central role of MITF.\u0026quot; \u003cu\u003eExp Dermatol\u003c/u\u003e \u003cstrong\u003e19\u003c/strong\u003e(7): 617-627.\u003c/li\u003e\n\u003cli\u003eWang, H., M. Liu, Z. Ye, C. Zhou, H. Bi, L. Wang, C. Zhang, H. Fu, Y. Shen, J. J. Yang, Y. Hu and G. Chen (2021). \u0026quot;Akt Regulates Sox10 Expression to Control Oligodendrocyte Differentiation via Phosphorylating FoxO1.\u0026quot; \u003cu\u003eJ Neurosci\u003c/u\u003e \u003cstrong\u003e41\u003c/strong\u003e(39): 8163-8180.\u003c/li\u003e\n\u003cli\u003eZhou, S., H. Zeng, J. Huang, L. Lei, X. Tong, S. Li, Y. Zhou, H. Guo, M. Khan, L. Luo, R. Xiao, J. Chen and Q. Zeng (2021). \u0026quot;Epigenetic regulation of melanogenesis.\u0026quot; \u003cu\u003eAgeing Res Rev\u003c/u\u003e \u003cstrong\u003e69\u003c/strong\u003e: 101349.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CRISPR/Cas9, iPSC, Melanocyte stem cells, MITF, KIT, Depigmentary disorders","lastPublishedDoi":"10.21203/rs.3.rs-7850188/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7850188/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eCurrently, surgical treatment options for pigment loss disorders are well-established. Studies have shown that melanocyte transplantation or melanin transplantation can yield favorable outcomes. However, this approach has not been widely adopted. The reasons for this may include insufficient sources of melanocytes, the lengthy process of extracting autologous melanocytes, and the high costs associated with their cultivation.\u003c/p\u003e\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eTo improve the isolation of highly proliferative melanocytes, we seek to identify surface markers for selecting those with robust proliferative and differentiation potential.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eUsing clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) technology to label microphthalmia-associated transcription factor (MITF), induced melanocytes are obtained by differentiating pluripotent stem cells, and the proliferative capacity of different cell populations is assessed through a single-cell colony formation assay.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eThis study verified that MITF-positive cells possess high proliferative capacity and consequently identified KIT proto-oncogene, receptor tyrosine kinase (KIT, CD117) as a characteristic surface marker.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eThe use of KIT allows for the isolation of induced melanocytes with high proliferative capacity, thereby improving production efficiency, though it may also lead to the loss of some highly proliferative cell subpopulations.\u003c/p\u003e","manuscriptTitle":"Insights into MITF-expressing cells derived from human iPSCs in melanogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-25 16:11:40","doi":"10.21203/rs.3.rs-7850188/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3a24a8f1-f7f3-4a1b-bc00-cc3d1bbc89f2","owner":[],"postedDate":"November 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-10T23:38:24+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-25 16:11:40","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7850188","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7850188","identity":"rs-7850188","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}