Full text
91,823 characters
· extracted from
preprint-html
· click to expand
A Saccharomyces boulardii synthetic biotic platform for delivery of therapeutic nanobodies to ameliorate gastrointestinal inflammation | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results A Saccharomyces boulardii synthetic biotic platform for delivery of therapeutic nanobodies to ameliorate gastrointestinal inflammation View ORCID Profile Roger Palou , View ORCID Profile Almer M. van der Sloot , Aline A. Fiebig , Megan T. Zangara , Naseer Sangwan , María Sánchez Osuna , Bushra Ilyas , Haley Zubyk , Michael Cook , View ORCID Profile Gerard D. Wright , View ORCID Profile Brian K. Coombes , View ORCID Profile Mike Tyers doi: https://doi.org/10.1101/2025.05.15.652971 Roger Palou 1 Program in Molecular Medicine, The Hospital for Sick Children Research Institute , Toronto, Ontario, Canada M5G 0A4 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Roger Palou Almer M. van der Sloot 2 Mila - Quebec Artificial Intelligence Institute , Montréal, QC, Canada H2S 3H1 3 Université de Montréal , Montréal, QC, Canada H3C 3J7 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Almer M. van der Sloot Aline A. Fiebig 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Megan T. Zangara 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Naseer Sangwan 6 Microbial Sequencing & Analytics Resource (MSAAR) Facility, Lerner Research Institute, Cleveland Clinic , Cleveland, Ohio, USA 44106; Department of Cardiovascular and Metabolic Sciences, Lerner Research Institute, Cleveland Clinic , Cleveland, Ohio, USA 44106; Lerner College of Medicine, Case Western Reserve University , Cleveland, Ohio, USA 44106 Find this author on Google Scholar Find this author on PubMed Search for this author on this site María Sánchez Osuna 1 Program in Molecular Medicine, The Hospital for Sick Children Research Institute , Toronto, Ontario, Canada M5G 0A4 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bushra Ilyas 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Haley Zubyk 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Michael Cook 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gerard D. Wright 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 5 Department of Biochemistry and Biomedical Sciences, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Gerard D. Wright Brian K. Coombes 4 David Braley Center for Antibiotic Discovery, Michael G. DeGroote Institute for Infectious Disease Research, McMaster University , Hamilton, Ontario, Canada L8S 4K1 5 Department of Biochemistry and Biomedical Sciences, McMaster University , Hamilton, Ontario, Canada L8S 4K1 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Brian K. Coombes For correspondence: coombes{at}mcmaster.ca mike.tyers{at}sickkids.ca Mike Tyers 1 Program in Molecular Medicine, The Hospital for Sick Children Research Institute , Toronto, Ontario, Canada M5G 0A4 7 Department of Molecular Genetics, University of Toronto , Toronto, Ontario, Canada M5S 1A8 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Mike Tyers For correspondence: coombes{at}mcmaster.ca mike.tyers{at}sickkids.ca Abstract Full Text Info/History Metrics Preview PDF Abstract Protein-based pharmaceuticals, such as engineered antibodies, form a major drug class of steadily increasing market share. However, these biologic medicines are costly to manufacture, are subject to strict supply chain and storage constraints and often require invasive administration routes. Engineered microbes that secrete bioactive products directly within the microbiome milieu may mitigate these challenges. Here, we describe a cell microfactory platform based on the probiotic yeast Saccharomyces boulardii for the production of nanobody biologics in the gastrointestinal (GI) tract. High-level secretion of nanobodies by S. boulardii was achieved by optimizing promoters, secretion signals, and antibody formats. In mice, oral gavage of S. boulardii allowed efficient and transient colonization of the colonic compartment and in situ production of a therapeutic nanobody directed against tumor necrosis factor (TNF). In a mouse model of chemical-induced colitis, GI-delivery of anti-mTNF nanobody via live S. boulardii improved both survival and disease severity without causing overt perturbation of microbiome composition. These results position S. boulardii as a synthetic biotic platform for the in situ production and delivery of protein-based therapeutics to the GI tract. Introduction The concept of using live microbial cells to manufacture and deliver therapeutic agents to the microbiome – variously termed synthetic biotics, engineered probiotics, cell microfactories or living therapeutics – holds promise for cost-effective, site-specific therapeutic intervention 1 , 2 . Synthetic biotics may be designed to produce biosynthesized small molecules such as nutrients, vitamins and antibiotics, or more complex protein-based agents such as antibodies, peptides, growth factors and cytokines. The in-situ synthesis of active biomolecules in the gastrointestinal (GI) tract by cell microfactories is now well-established for bacterial platforms, including Lactobacillus lactis , Lactococcus lactis and E. coli Nissle 1917 3 – 6 . However, the use of bacterial species as orally administered synthetic biotics can be compromised by loss of viability in the acidic environment of the stomach, the inability to produce high levels of secreted complex biologic molecules such as antibodies, and the risk of lateral gene transfer to other species in the microbiome or external environment 3 , 7 . Although the gut microbiome is dominated by bacterial species, fungal, archaeal and protozoal species form another important component of the microbiome 8 . To overcome the problems inherent to bacterial-based synthetic biotics, the yeast Saccharomyces boulardii has been explored as an alternative platform for in situ production of biologic agents 9 – 13 . S. boulardii is closely related to the budding yeast Saccharomyces cerevisiae 14 , also known as baker’s or brewer’s yeast, a mainstay model organism for eukaryotic molecular genetics that is also widely used in food and biotechnology production processes. S. boulardii is a generally recognized as safe (GRAS) organism that is widely used as an over-the-counter probiotic for the treatment of Clostridium difficile infections and antibiotic-associated diarrhea 15 . S. boulardii has inherent potential advantages as a synthetic biotic that include relative ease of genetic manipulation that benefits from extensive molecular genetic tools developed over many decades for S. cerevisiae . Like budding yeast, S. boulardii can be readily produced at an industrial scale and at low cost, retains long term viability in desiccated form, and shows negligible rates of lateral gene transfer 15 , 16 . Moreover, S. cerevisiae spp. are part of the normal human mycobiome 17 . Unlike S. cerevisiae however , S. boulardii has an optimal growth temperature of 37°C, increased acid tolerance and a robust cell wall that survives passage through the GI tract 18 . These physiological properties make S. boulardii well-suited for development as a synthetic biotic platform in humans. Previous work has demonstrated the biosynthesis of small molecules (e.g., β-carotene, violacin) 9 , and recombinant proteins (e.g., HIV-GAG, lysozyme, IL-10, anti- Clostridium difficile nanobody tetramers) using engineered S. boulardii strains 11 , 19 – 24 . Currently, biopharmaceuticals or biologics, and in particular recombinant monoclonal antibodies (mAbs) or other antibody-like molecules, comprise more than 20% of new drug approvals and offer important new therapies for a variety of autoimmune diseases and cancers 25 . Notwithstanding these successes, antibody-based therapeutics present major challenges for therapeutic use including expensive manufacturing and quality control, product instability, requirements for a cold chain of storage and distribution, pharmacokinetic limitations, and injection-based delivery. These liabilities preclude access for many patient populations and impose substantial costs to healthcare systems. Inflammatory bowel disease (IBD), including Crohn’s disease (CD) and ulcerative colitis (UC), are chronic inflammatory disorders of the GI tract caused by a combination of host genetics, environmental factors, and microbiome composition 26 . CD and UC are debilitating, life-long conditions that reduce quality of life and often result in complications that require surgery or other interventions. Tumor necrosis factor alpha (TNF, also known as TNFα) and other inflammatory cytokines are primary effectors of bowel inflammation and contribute to microbiome dysbiosis in CD 26 . A validated therapeutic approach is the administration of anti-TNF mAbs 27 to suppress the immune response. Although successful in achieving remission for some CD patients, treatment with an injectable mAb is cumbersome and expensive (> USD $10,000/patient/year) 28 . Moreover, mAbs against TNF have shortcomings that include failure to provide durable relief, unpredictable pharmacodynamics, systemic immune suppression, immunogenicity, and complex dosing regimens that preclude consistent attainment of therapeutically effective levels 29 . For these reasons, we focused on the development of S. boulardii as a synthetic biotic for the in situ production of neutralizing anti-TNF antibodies in the GI tract. We optimized gene expression, protein secretion signals, and antibody-like scaffolds to build a robust S. boulardii synthetic biotic platform to produce biologics in the GI tract ( Fig. 1A ). Nanobodies (nAbs) based on a camelid heavy chain-single variable (VHH) scaffold yielded far higher levels of secretion that conventional antibody variants. We optimized the formulation and oral administration of S. boulardii for VHH delivery to the mouse GI tract. Administration of S. boulardii that secrete anti-TNF VHH to mice resulted in transient high-level colonization of the GI tract and in situ production of VHH at therapeutic concentrations without altering overall microbiome composition. An anti-TNF VHH-secreting strain significantly ameliorated disease symptoms and improved survival compared to control S. boulardii strains in a dextran sulfate sodium salt (DSS)-induced colitis mouse model. These results demonstrate localized production and delivery of a therapeutic VHH nAb via S. boulardii mitigates inflammatory disease activity in the gut. Download figure Open in new tab Figure 1. Optimization of secretion signals and antibody scaffold formats. A) Overview of S. boulardii synthetic biotic platform. B) Secretion signal efficiency. S. cerevisiae and S. boulardii were transformed with a galactose-inducible plasmid containing the light chain of a Fab’ against TcdA fused to nine secretion signals at the N-terminus and the FLAG epitope at the C-terminus. Cells were grown in SC-Ura media with 1% galactose + 1% raffinose at 30°C for 3 days in a shaker-reader. Secreted (culture medium) and retained (cell extract) Fab’ were detected by anti-FLAG immunoblot. Ponceau S stain was used as a loading control for cell extracts. C) S . boulardii were transformed with expression plasmids for a nanobody (VHH) against GFP, a single-chain antibody (scFv) against TcdA, or a light chain Fab’ fragment against TcdA, all fused to the Matα wild type secretion signal. Cells were grown in SC-Ura with 1% galactose + 1% raffinose at 30°C for 3 days. Retained and secreted Fab’ were detected by anti-FLAG immunoblot. Mean ± SD are indicated. n.d., not detected. Results Secretion tags and antibody scaffolds Protein secretion requires the presence of a signal peptide at the N-terminus of the protein of interest to engage with the secretory pathway 30 . To enable the secretion of heterologous antibody scaffolds, a panel of nine candidate secretion signal peptide sequences was fused to the N-terminus of the light chain of a Fab’ dimer directed against Clostridium difficile toxin A (TcdA 31 ) and tested for secretion yield. Secretion signals were derived from S. cerevisiae (amylase, glucanase, inulase, invertase), chicken (lysozyme), three variants of the S. cerevisiae Matα leader peptide (wild type; Matα variant App8 (‘Ala22a’) and variant Val22 (‘Val22a’) 32 , and a synthetic consensus signal peptide called BBaK 33 (see Supplementary Table 1 for all sequences and sources). These signal peptides were previously shown to support protein secretion of antibodies, antibody-like scaffolds, and other heterologous proteins in S. cerevisiae 34 . Signal sequence Fab’ constructs were expressed under the control of the GAL1 inducible promoter on a 2 μm high copy URA3 plasmid to alleviate potential toxic effects of Fab’ expression/secretion on yeast growth. As wild type S. boulardii yeast lacks the common auxotrophic markers available in S. cerevisiae laboratory strains, an auxotrophic S. boulardii strain was engineered by CRISPR-Cas9 mediated knockout of URA3 to facilitate cloning and allow plasmid interoperability between S. cerevisiae and S. boulardii . To allow CRISPR-based gene engineering, we generated a plasmid that encodes S. pyogenes Cas9 and the Aspergillus nidulans acetamidase gene ( amdS ), a dominant prototrophic marker that allows S. cerevisiae to grow on acetamide as the sole nitrogen source 35 . After gene editing, removal of the Cas9 plasmid was achieved by counter selection on fluoroacetamide, which generates a toxic metabolite 35 . This method allowed scarless gene editing and subsequent elimination of the vector containing Cas9 and the sgRNA to minimize possible off-target cutting effects 36 . The signal peptide constructs were first tested using a Fab’ fragment in the wild type S. cerevisiae strain Sigma1278b. All signal peptides enabled secretion of the Fab’ fragment except for the amylase, invertase and MatαVal22 constructs ( Fig. 1B left panel). The Matα wild type sequence was the most efficient secretion signal in S. cerevisiae , with only low amounts of detectable Fab’ fragments remaining inside the cell. In S. boulardii , only the Fab’ fragment fused to a Matα wild type signal peptide or, to a lesser extent, the inulase signal peptide, was expressed and secreted. We also observed higher retention of the Fab’ inside S. boulardii cells compared to the same constructs in S. cerevisiae cells ( Fig. 1B , right panel). As the Matα leader sequence is conserved between S. boulardii and S. cerevisiae 14 the basis for this difference is unclear. These results illustrate that even highly related yeast species can exhibit unexpected differences, underscoring the need for systematic characterization of chassis parts in biotechnological applications. Optimization of antibody scaffolds Without considerable additional engineering of the secretion system, yeast species such as S. cerevisiae and Pichia pastoris are relatively inefficient in expressing canonical full-length antibodies 37 . We observed that while the Fab’ light chain readily produced detectable protein levels in S. cerevisiae , expression of a Fab’ heavy chain construct failed to produce detectable protein (data not shown). To overcome the requirement for Fab’ heterodimer expression, we assessed the production of human antibody-derived single-chain variable fragments (scFv) and monomeric antigen-binding VHH domains derived from cameloid species (sometimes referred to as nanobodies, nAbs). Both antibody-like scaffolds ( Fig. 1C ) have favorable properties compared to conventional antibodies or Fab fragments, including smaller size and improved protein stability while maintaining similar affinity for the target as conventional antibodies 38 . To determine which antibody scaffold format was most compatible with S. boulardii , we compared the expression and secretion of a scFv against Staphylococcal enterotoxin B (scFv-GC132) 39 , a Fab against C. difficile toxin A (TcdA, ToxA-A03 31 ) and a VHH against HIV-1 spike protein 40 . Scaffolds were fused to the Matα wild type secretion signal peptide and expressed under the control of GAL1 promoter. In S. boulardii , the expression and secretion of the VHH construct was four times higher than the scFv construct, while the Fab light chain was not detectably expressed ( Fig. 1C ). The VHH format was therefore chosen as the preferred scaffold for further studies. Optimization of VHH production Use of S. boulardii as a living cell microfactory platform to deliver protein-based therapeutic agents to the GI tract requires high level expression and secretion of the protein of interest. Promoters used to drive expression should ideally be active in the low oxygen and low glucose environment of the distal GI tract 41 . We considered the ADH2 promoter ( ADH2 pr ) as a potential constitutive promoter candidate as it is highly active at low glucose concentrations and under hypoxic conditions 42 . To assess the potential influence of protein sequence on expression, a panel of VHHs with different sequence characteristics was cloned into a 2 µm plasmid under the control of ADH2 pr and N-terminally fused to the Matα wild type signal peptide 42 . For these experiments, we used the prototrophic S. boulardii parental strain (MYA-796) rather than a ura3 auxotrophic derivative to maximize strain fitness. We expressed various ADH2 pr -VHH constructs using a 2 µm plasmid bearing kan antibiotic selection that confers resistance to G418. This selection marker had the added benefit of allowing recovery and assessment of VHH-expressing S. boulardii strains after passage through the mouse GI tract (see below). S. boulardii strains bearing these plasmids expressed, secreted and properly processed the Matα-VHH fusion proteins at similar levels such that, on average, 95% of each VHH was secreted ( Fig. 2A ). Download figure Open in new tab Figure 2. Characterization of secreted VHH nanobodies in S. boulardii . A) VHH nanobody secretion in S. boulardii. A panel of VHHs against HIV gp140 (HIV-1, HIV-2, HIV-3), Clostridium difficile TcdA (CD-1, CD-2, CD-3) and TcdB (CD-5) toxins and enterotoxigenic E. coli (ETEC) F4 fimbrae (CJ-1, CJ-2) and Stxe2 (ETEC-1, ETEC-2) were FLAG tagged and constitutively expressed from the ADH2 promoter in S. boulardii grown at 37°C for 3 days. Retained and secreted Fab’ from 60 µL of culture were detected by anti-FLAG immunoblot. Ponceau S stain was used as a loading control for cell extracts. B) Effect of VHH secretion on S. boulardii growth rate. A panel of the indicated VHHs directed against various antigens were N-terminally fused to the Matα wild type secretion signal and expressed from the ADH2 promoter. Growth in liquid culture was monitored by OD 595 and normalized to wild type growth rate based on curve slope during exponential phase. Statistical analysis was performed using Dunnett’s ANOVA test (* p<0.05, ** p<0.01, *** p<0.001). Mean ± SD are indicated. C) Optimization of anti-mTNF VHH expression in vitro. Anti-mTNF VHH (m3F) was expressed from the indicated yeast promoters. Top . Growth rates determined from growth curves. Bottom . Secreted mTNF VHH levels quantified by ELISA. Statistical analysis was performed using Tukey’s ANOVA test (* p<0.05, ** p<0.01, *** p<0.001, **** p <0.0001). Mean ± SD are indicated. A reduction in fitness of engineered S. boulardii strains could cause a deleterious effect on growth in vivo and represent a potential liability for colonization of the GI tract, especially in competition with other Saccharomyces species in the host mycobiome 43 . To analyze the impact of VHH expression and secretion on S. boulardii fitness, we assessed yeast growth at human physiological temperature (37°C) and used growth rate as a proxy for fitness. Constitutive expression of VHHs did not impact S. boulardii growth rate in 12 out of 16 different VHH nanobodies tested ( Fig. 2B and Fig. S1 ). Unfortunately, the VHHs that adversely affected fitness included an anti-mouse TNF VHH (m3F) and a corresponding tandem VHH dimer (m3F-m3F), which we had prioritized for use in vivo experiments (see below). For these constructs, we explored whether the promoter controlling VHH expression could have an impact on cell fitness. The growth rate of strains expressing either the m3F anti-mTNF VHH or the m3F-m3F VHH dimer, each under the control of four different promoters ( ADH2 , ADH5 , PGK1 , and TEF1 ) 42 , was compared during three days of growth at 37°C. ELISA was used to measure the amount of secreted VHH monomer or tandem VHH dimer after 3 days. For strains expressing the VHH monomer, the ADH5 and PGK1 promoters rescued full cell fitness without compromising VHH secretion. In contrast, although the use of the ADH5 promoter rescued fitness for the VHH dimer strain, this was accompanied by a substantially decreased yield of secreted VHH dimer ( Fig. 2C ). These optimization steps yielded an S. boulardii strain that optimally expressed an anti-mTNF VHH monomer at 37°C without overt fitness defects. Optimization of VHH secretion Deletion of the HDA2 , VPS5 and TDA3 genes, which are implicated in trafficking and secretory functions, can increase protein secretion in S. cerevisiae 44 . The Cas9- amdS counter selection plasmid was used to generate CRISPR-mediated deletions for these three genes in S. boulardii . We analyzed the secretion of the anti-mTNF VHH under control of ADH2 , ADH5 , PGK1 , TEF1 and TDH3 promoters. Secretion of each VHH was increased at 30°C in the individual knockout strains, except when expression was controlled by the ADH2 promoter. At 37°C, the triple hda2Δvps5Δtda3Δ mutant expressing the anti-mTNF VHH under the control of PGK1 promoter exhibited the highest level of VHH secretion, approximately 1.4-fold more than in the corresponding wild type strain ( Fig. S3 ). However, all single, double and triple deletion mutants adversely affected cell growth rate at both 30°C and 37°C ( Fig. S3 ). Due to this evident growth disadvantage compared to wild type S. boulardii , and the relatively minor improvement in VHH secretion yield, these gene deletions were not included in the final S. boulardii chassis used for VHH delivery in vivo . Secretion of functional anti-TNF VHH We then quantified the yield of the secreted anti-TNF VHHs and tested for binding and neutralizing activity in vitro . We extended this analysis to human TNF (hTNF) in anticipation of future use of S. boulardii -based synthetic biotics in humans. VHHs directed against mTNF (i.e., m3F) and hTNF (termed hTNF−1, −2 and −3) were all produced and secreted ( Fig. 3A ). The maximum concentration in the culture supernatant was 6.9 μg/mL for the hTNF-1 VHH, a yield that is 6-fold higher than previously reported for an anti-hTNF VHH secreted by the Gram-positive bacterial probiotic L. lactis 4 . VHH oligomerization can increase apparent binding affinity to its target 38 , for example an anti-hTNF-3/anti-hTNF-1 VHH tandem dimer (called hTNF-4) has 1000 times more affinity for hTNF than the corresponding VHH domain alone 45 . Despite VHH dimer being similar in size to a scFv scaffold, S. boulardii secreted the VHH dimers at similar concentrations to the single VHHs, for both the hTNF-4 and m3F-m3F dimers ( Fig. 3A ). We used ELISA to demonstrate that the various secreted anti-TNF VHHs could bind recombinant TNF. The VHHs secreted by S. boulardii were functional and had a similar affinity (EC 50 ) towards recombinant mouse and human TNF ( Fig. 3B ), as previously reported for E. coli -produced VHH 45 , 46 . Download figure Open in new tab Figure 3. Characterization of anti-TNF VHH nanobodies produced in S. boulardii . A) Secreted levels of indicated VHH in yeast culture medium (60 µL) were quantified by comparison to a dilution series of purified recombinant His-tagged control nanobody (CD-2). Proteins were detected with Coomassie Brilliant Blue stain. Left, secreted anti-mTNF m3F VHH. Middle, s ecreted anti-mTNF m3F-m3F VHH tandem dimer. Right , secreted anti-hTNF VHH (hTNF-1, hTNF-2, hTNF-3) and anti-hTNF VHH tandem dimer (hTNF-4 = hTNF-3/hTNF-1). Estimated concentrations in culture medium were: 6.9 µg/mL for anti-mTNF m3F VHH; 4.4 µg/m for anti-mTNF m3F-m3F tandem dimer VHH; 5.5 µg/mL for hTNF-1 VHH; 1 µg/mL for hTNF-2 VHH; 3.4 µg/mL for hTNF-3 VHH; 4.9 µg/mL for hTNF-4 tandem VHH. B) Binding affinities of secreted anti-TNF VHH nanobodies. Binding of anti-mTNF VHH (m3F) to mTNF or anti-hTNF hTNF-1 VHH to hTNF was quantified by ELISA. Means ± SD are indicated. C) Neutralization of hTNF-induced cytotoxicity in human T98G glioblastoma cells treated with 40 nM actinomycin D to sensitize cells to hTNF. Left , effect of indicated anti-hTNH VHHs on viability of cells treated with 500 ng/mL hTNF. An anti-HIV-1 VHH (HIV-2) served as a non-specific VHH control. Mean ± SD are indicated. Right , cell viability 48 h after treatment with the highest concentrations of anti-hTNF VHHs used in neutralization assays (2.04 µM for hTNF-1; 0.28 µM for hTNF-2; 1.33 µM for hTNF-4; 1.45 µM for HIV-2). Viability effects of 40 nM actinomycin D alone or in the presence of the indicated concentrations of hTNF are also shown. Mean ± SD are indicated. As a biological readout for the inhibition of hTNF by anti-hTNF VHH, we used a human T98G glioblastoma cell line assay in which actinomycin D was used to sensitize the cells to hTNF 47 , 48 . The anti-hTNF VHHs secreted by S. boulardii were able to protect against hTNF -induced cytotoxicity with high potency (EC 50 < 100 nM) whereas an irrelevant control VHH had no effect ( Fig. 3C , left). Importantly, we did not observe non-specific toxicity when T98G cells were treated with the VHHs alone ( Fig. 3C , right). These results demonstrated that anti-hTNF VHHs secreted by S. boulardii retained neutralizing activity in vitro. S. boulardii colonization is influenced by the endogenous murine microbiome, pH and dose Previous studies have suggested that S. boulardii does not stably colonize the murine GI tract in the absence of inflammation 17 . One possible explanation for this observation is that S. boulardii is partially outcompeted by the endogenous microbiome. To explore this possibility, C57BL/6 mice were treated with a single dose of streptomycin for 24 h, which is known to reduce colonization resistance of the mouse gut 49 . Mice were then gavaged with a single dose of 2×10 8 colony forming units (CFUs) of S. boulardii resuspended in phosphate buffered saline (PBS; 10 mM phosphate pH 7.4, 137 mM NaCl, 2.7 mM KCl) and the residence time with or without streptomycin was determined by plating serial dilutions of resuspended feces on G418 medium to select for the kan resistance marker plasmid. In both streptomycin-pretreated and control mice, the S. boulardii CFUs recovered from feces peaked 24 h post-gavage and were undetectable after 72 h ( Fig. 4A , left panel). However, when we examined the colonic tissue population of S. boulardii two days after gavage, streptomycin pretreated mice had almost two orders of magnitude higher S. boulardii colonization in the cecum and colon compared to the untreated controls ( Fig. 4A , right panel). Download figure Open in new tab Figure 4. In situ production of anti-mTNF in the mouse GI tract by S. boulardii . A) Colonization of the GI tract by S. boulardii . Animals were untreated or pretreated with a single oral dose of 20 mg streptomycin 24 h prior to gavage with a single dose of 2 × 10 8 CFU of S. boulardii in PBS bearing an empty vector. CFU were determined in feces by serial dilution for a 4 day time course and in the indicated tissues after 2 days. B) Effect of increased dose and pH neutralization on S. boulardii colonization. Animals were gavaged on days 0, 2 and 4 with 2×10 8 CFU S. boulardii bearing an empty plasmid. Animals were either pretreated with 5% sodium bicarbonate prior to gavage in HEPES buffered saline (0.9% NaCl, 100 mM HEPES pH 7.5), or gavaged with 5% sodium bicarbonate + HEPES buffered saline, or gavaged with HEPES buffered saline only. CFUs were determined by serial dilution. Mean ± SD are indicated. C) Quantification of anti-mTNF VHH production from two different promoters in the GI tract. Animals were pretreated with a single oral dose of 20 mg streptomycin 24 h prior to gavage. Animals were gavaged on days 0, 1 and 2 with 2 × 10 8 CFU S. boulardii transformed with an empty plasmid or plasmids expressing anti-mTNF VHH under the control of the ADH2 or ADH5 promoter. Left, S. boulardii CFU per gram of feces or tissue after 3 days of treatment under the HEPES buffered saline regime for indicated strains. Right, anti-mTNF VHH quantification in feces and tissues by ELISA for indicated strains after three days of treatment. Purified anti-mTNF VHH (m3F) produced in E.coli was used to generate a standard curve for ELISA. D) Quantification of mTNF levels in tissues by ELISA. Despite better survival of S. boulardii over S. cerevisiae in acidic conditions 17 , the low pH of the stomach might still affect S. boulardii fitness and decrease colonization rates. To test whether delivery in more alkaline conditions might improve colonization, mice were pretreated with a 5% bicarbonate buffered solution followed by gavage with wild type S. boulardii in HEPES buffered saline (0.9% saline, 100 mM HEPES pH 7.5), or with Sb in 5% bicarbonate and HEPES buffer, or with Sb in HEPES buffered saline only. To further increase colonization, we also doubled the gavage dose of S. boulardii to 2×10 8 CFU and repeated the gavage every other day for 5 days. Higher levels of colonization in tissue were observed with each of these pH neutralization schemes ( Fig. 4B ). Compared to the lower dose of S. boulardii in PBS, the higher dose combined with pH neutralization increased colonization 30-fold (from 7×10 2 to 2.3×10 4 CFU/g tissue) in the cecum and 70-fold (from 2×10 2 to 1.4×10 4 CFU/g tissue) in the colon ( Fig. 4A versus B ). For simplicity of administration, subsequent experiments used HEPES buffered saline alone. In vivo synthesis of VHH nanobodies by S. boulardii We observed above that S. boulardii fitness and VHH secretion were impacted by the choice of promoter. To explore if these in vitro results extended to GI tract colonization in vivo , S. boulardi i expressing anti-mTNF VHH under the control of the ADH2 or ADH5 promoter, or S. boulardii with an empty plasmid vector, or HEPES buffered saline alone were gavaged for 3 successive days. Three days after the first gavage, VHH content was analyzed in the ileum, cecum, colon and feces by ELISA. S. boulardii that expressed anti-mTNF VHH from the ADH2 promoter yielded higher VHH levels in all tissues analyzed, with a 3-fold increase in the colon compared to expression from the ADH5 promoter (245± 96.86 pg/mL for ADH2 versus 79 ± 30.48 pg/mL for ADH5 ) ( Fig 4C , right panel). This increased level of secretion was not due to differential colonization of the GI tract between the two strains ( Fig. 4C , left panel). We therefore prioritized the ADH2 -driven anti-mTNF VHH expression strains for subsequent testing in a mouse model of colitis. A critical question for in vivo efficacy was whether sufficient levels of neutralizing VHH are produced compared to mTNF. We therefore quantified relative anti-mTNF VHH and mTNF levels by ELISA and converted these values to concentration estimates using standard curves with recombinant proteins (see Methods). Because mTNF levels in the uninflamed colon were expected to be low, we assessed mTNF levels in DSS-treated animals, which exhibit a high degree of colonic inflammation. We found that anti-mTNF VHH levels in tissues from untreated animals, as driven by the ADH2 promoter, exceeded the levels of mTNF ( Fig. 4C versus 4D ; between 25-50 pg/100 uL TNF detected by ELISA in feces or different tissues = 5-10 pM of active TNF trimer, compared to 10-30 pM of anti-TNF VHH detected in feces or different tissues). These results suggested that strains producing anti-mTNF VHH would have the potential to neutralize endogenous mTNF and remediate GI inflammation in the DDS model. Passage of S. boulardii through the intestinal tract does not affect VHH production or stability An important question for any synthetic biotic is whether the intestinal environment selects against the production of the desired biologically active agent. To address this issue, we compared anti-mTNF VHH levels produced by input S. boulardii strains to strains isolated as individual clones from feces 2 days post-gavage. We found no difference in VHH production between the input and output strains recovered after passage through the GI tract ( Fig. S2A ). This result suggested that there was negligible counter-selective pressure against VHH-producing S. boulardii in the GI tract. A further question was whether the secreted VHH was stable in the intestinal environment. To address this question, we assessed the stability of the anti-mTNF VHH when spiked into GI extracts. The anti-mTNF VHH was stable in feces, and in cecum and colon extracts, but was degraded when incubated with an ileum extract, which is estimated to have 20-fold more proteolytic activity than the feces 50 ( Fig S2B ). We concluded that the activity of the S. boulardii -produced anti-mTNF VHH would likely not be impaired in the large intestine. DSS-induced colitis does alter S. boulardii colonization or anti-mTNF VHH production To assess efficacy in vivo , we evaluated the anti-mTNF VHH strain in the well-established dextran sulfate sodium (DSS)-induced mouse colitis model, which is commonly used to evaluate anti-inflammatory therapeutic strategies in IBD 4 , 5 , 51 . DSS is a sulfated polysaccharide that is toxic to colonic epithelium and when administered to mice in drinking water causes disruption of the intestinal epithelial barrier and inflammation limited to the colon 52 . We first determined whether DSS treatment altered S. boulardii colonization of the GI tract. We gavaged C57BL/6 mice once every two days with 2×10 8 CFU of the anti-mTNF strain in HEPES buffered saline for 7 days in the presence or absence of 3% DSS in drinking water ( Fig. 5A ). DSS did not cause any significant difference in CFU counts in either feces or colonic tissue ( Fig. 5B ). Although it has been previously shown that S. boulardii retention in the mouse intestinal epithelium is increased by inflammation 17 , we did not observe any significant increase in S. boulardii CFUs in cecum and colon tissue upon DSS-induced inflammation. We then determined VHH levels in tissues at experimental endpoint of the DSS treatment time course. As controls, we used a strain that secreted an irrelevant VHH (anti-Gp140 HIV 40 , termed HIV-2 above) or treatment with HEPES buffered saline only. The secreted anti-mTNF VHH and control VHH were readily detected by ELISA in feces, as well as in in cecum and colonic fractions ( Fig. 5C ). This result demonstrated that VHH secretion in vivo was not affected by DSS-induced colitis. Download figure Open in new tab Figure 5. In situ production of anti-mTNF VHH by S. boulardii increases survival and improves symptoms in a DSS colitis model. A) Schematic of experimental time course for S. boulardii colonization and VHH production. B ) S. boulardii colonization with or without DSS-induced colitis in feces over 7 day time course ( left ) and in GI tissue ( right ) at 7-day experimental endpoint. Animals were pretreated with a single dose of 20 mg streptomycin 24 h prior to initial S. boulardii administration then gavaged once every 2 days with 2×10 8 CFU wild type S. boulardii or S. boulardii expressing anti-mTNF VHH from the ADH2 promoter in HEPES buffered saline. CFUs were determined by serial dilution of feces at each time point or in indicated tissues at either humane (>20% weight loss) or experimental endpoint. Means ± SEM are shown. C) Relative levels of anti-mTNF VHH or control anti-HIV-1 VHH (HIV-2) in tissues at 7-day experimental endpoint as determined by ELISA. D) Schematic of 12 day experimental time course for survival after DSS treatment. E) S. boulardii colonization with or without DSS-induced colitis in feces GI tissue at 12-day experimental endpoint. Animals were pretreated with a single dose of 20 mg streptomycin 24 h prior to initial S. boulardii administration then gavaged once every 2 days with 10 8 CFU S. boulardii expressing anti-mTNF VHH (m3F) or control anti-HIV-1 VHH (HIV-2) from the ADH2 promoter in HEPES buffered saline. CFUs were determined in tissues at either humane (>20% weight loss) or experimental endpoint. Each datapoint indicates an individual animal. Means ± SEM are shown. F). Survival curves after DDS-induced colitis with administration of S. boulardii secreting either anti-mTNF VHH or control anti-HIV VHH versus HEPES buffered saline alone. G) Schematic of 14 day experimental time course for disease severity. Animals were pretreated with a single dose of 20 mg streptomycin 24 h prior to initial S. boulardii administration then gavaged once every 2 days with 10 8 CFU wild type S. boulardii or S. boulardii expressing anti-mTNF VHH (m3F) from the ADH2 promoter in HEPES buffered saline. CFU were determined by serial dilution of feces at each time point or in indicated tissues at either humane (>20% weight loss) or experimental endpoint. H) S. boulardii colonization with or without DSS-induced colitis in feces ( left ) and GI tissue ( right ) at 14 day experimental endpoint. Means ± SEM are shown. I) Disease activity index (DAI) scores after DSS-induced colitis with administration of S. boulardii secreting either anti-mTNF VHH (m3F) or control anti-HIV VHH (HIV-2) versus HEPES buffered saline alone or HEPES buffered saline without DSS treatment. Animals were pretreated with a single dose of 20 mg streptomycin 24 h prior to the first S. boulardii administration. DAI was scored at day 12 of the time course. DAI scores were: DSS + vehicle only, 5.43; wild type S. boulardii , 5.86; S. boulardii anti-mTNF VHH (m3F) 2.44; water, 0. Statistical analysis was by Mann-Whitney T-test (p < 0.05, ** p < 0.01, *** p<0.001, **** p<0.0001). Means ± SEM are indicated. S. boulardii expressing anti-mTNF VHH reduces disease severity in DSS-induced colitis To assess whether in situ secretion of anti-mTNF reduced mortality in the DDS model, we carried out a 12 day time course experiment in which animals were allowed to progress after DSS treatment ( Fig. 5D ). Animals were gavaged once every 2 days with 2×10 8 CFU of S. boulardii in HEPES buffered saline for 7 days in the presence of 3% DSS in drinking water from days 2 to 7, followed by 5 days of daily gavage in the absence of DSS. Animals treated with a strain expressing the anti-HIV VHH or with HEPES buffered saline only were used as controls. No difference in S. boulardii retention was detected in GI tissues at the end of the experiment ( Fig. 5E ). Administration of the anti-mTNF VHH strain increased survival of mice treated with DSS by 60% compared to administration of HEPES buffered saline alone (Gehan-Breslow-Wilcoxon test, p = 0.0022) ( Fig. 5F ). The control VHH strain conferred a survival benefit of 40% over HEPES buffered saline alone but this effect was lower than for the anti-mTNF VHH strain (control VHH versus anti-mTNF VHH, p= 0.0087, log-rank Mantel-Cox test). To further characterize the effect of the anti-mTNF VHH strain, we performed a second time course-recovery experiment for 14 days and monitored disease activity index (DAI) with a strain bearing an empty vector as the control ( Fig. 5G ). As expected, no differences in colonization between the strains were observed in feces or tissues ( Fig. 5H ). However, as measured by DAI score, the anti-mTNF VHH strain had a significant benefit over both the vector only control strain and the HEPES buffered saline control in reducing disease severity at the end of the experiment (anti-mTNF versus empty vector strain p=0.0001; anti-mTNF versus HEPES only p=0.0104) ( Fig. 5I ). Collectively, these results demonstrated that in situ production of the anti-mTNF VHH by S. boulardii had a pronounced beneficial effect on both survival and disease severity in the DSS model. S. boulardii expressing anti-mTNF VHH does not alter the endogenous microbiome Long term administration S. boulardii in the mouse DSS colitis model has been previously shown to increase bacterial diversity of the microbiome 53 . We thus explored whether mice treated with S. boulardii expressing anti-mTNF VHH exhibited alterations in the microbiome. Mice were treated with strains expressing anti-mTNF VHH or control anti-HIV Gp140 VHH, or HEPES buffered saline alone, administered DSS for 5 days ( Fig. 6A ), and then evaluated for alterations to the microbiome composition by 16S rRNA amplicon sequencing. As assessed by Shannon diversity index, which measures alpha diversity of the intestinal microbiome, we observed no significant difference between mice administered the buffer control versus strains expressing either VHH ( Fig. 6B ). Thus, the engineered probiotics did not influence the diversity of the intestinal microbiota. The similarity between microbiome composition (i.e., beta-diversity) of the different sample groups was then assessed using canonical correspondence analysis (CCA). Dispersion of beta diversity was computed using permutational multivariate analysis of variance (PERMANOVA). We observed that samples taken prior to colitis induction, after DSS treatment or at endpoint clustered together independently of the treatment ( Fig. 6C ). Based on these results, we concluded that the beneficial effects of acute treatment with the anti-mTNF VHH strain were due to the anti-mTNF VHH itself and not a general effect of S. boulardii on the microbiome. We also concluded that short term administration of the anti-mTNF VHH strain did not disrupt the overall composition of the microbiome. Download figure Open in new tab Figure 6. Assessment of the endogenous GI microbiome in the presence or absence of S. boulardii expressing anti-mTNF VHH. Cecal contents from animals administered the indicated S. boulardii strains with or without DSS-induced colitis were sequenced in the V3-4 region of bacterial 16S rRNA. A) Schematic of 8 day experimental time course. B) Alpha diversity assessed by Shannon index. Statistical significance was assessed by ANOVA. C) Beta diversity assessed by principal component analysis of amplicon sequence variants. Statistical significance was assessed by PERMANOVA. Discussion Wild type S. boulardii has been extensively studied and used as a probiotic for the treatment of antibiotic-induced diarrhea, Clostridium difficile infections, as well as in patients suffering from ulcerative colitis and Crohn’s disease 15 , 54 . The engineering of S. boulardii to deliver therapeutic biologics such as nanobodies directly to the GI tract has the potential to combine the general therapeutic effect of this commonly used yeast probiotic with highly targeted therapies 2 , 23 . Importantly, the use of S. boulardii as a living cell microfactory for in situ production of VHH nanobodies, may provide an accessible and cost-effective alternative to conventional recombinant biologic therapies that currently require systemic intravenous administration. Here, we demonstrate that anti-mTNF VHH nanobodies secreted in the GI tract can alleviate symptoms in a mouse model of colitis. Our platform was optimized for (i) VHH nanobody expression under low nutrient conditions that mimic the GI environment, (ii) maximal levels of VHH nanobody secretion without causing proteostatic stress, and (iii) delivery regimes that maximize transient population of the GI tract. We specifically avoided use of auxotrophic markers for strain engineering and instead used a fully prototrophic wild type strain to maximize strain fitness in the GI environment, as enabled by a combination of CRISPR/Cas9-based genome engineering and the dominant counter-selectable amdS marker 55 . These features represent improvements over previous engineering methods in S. boulardii based on laterally transferrable plasmid vectors and dominant antibiotic resistance markers 21 , 56 . Our results also underscore the importance of optimization for in vitro versus in vivo applications. Notably, while the ADH2 and ADH5 promoters yielded similar amounts of VHH in culture media, the ADH2 promoter clearly outperformed ADH5 for the production of VHH in tissues of the GI tract, despite no difference in CFU levels between the two strains. Tandem bivalent or multivalent versions of VHH nanobodies can improve the affinity toward target epitopes 12 . For example, high avidity nanobody multimers can neutralize influenza, SARS-CoV-2 and C. difficile 12 , 57 , 58 . We tested several anti-human and anti-mouse TNF bivalent tandem VHH constructs but found that secretion of larger fusion proteins tended to reduce S. boulardii fitness, likely due to proteotoxic stress. While secretion of bivalent VHHs might be improved by engineering the S. boulardii protein secretion system 37 , 44 , modifications to S. boulardii need to be carefully assessed for impact on both secretion efficiency and fitness. Despite the close relationship between S. boulardii and S. cerevisiae , our secretion signal optimization experiments demonstrated that improvements in S. cerevisiae do not necessarily translate to S. boulardii , as shown by the deleterious effects of deleting HDA2 , VPS5 and TDA3 in S. boulardii. These unexpected negative effects may partly be because the optimization of S. cerevisiae protein secretion has been in the context of improving yields of recombinant proteins under optimal growth conditions in fermenters. In the context of synthetic biotic development, S. boulardii secretion needs to be compatible with the relatively nutrient-poor conditions in the GI tract and competitive fitness with the complex GI microbiome. S. boulardii is a generally recognized as safe agent and we observed no adverse effects upon oral administration of either wild type or engineered S. boulardii to mice. In addition, we did not observe any significant changes in the microbiome associated with the acute administration of either wild type or engineered S. boulardii strains. Further advantages of S. boulardii as a synthetic biotic platform include its relatively short residency time in the GI tract and the absence of horizontal gene transfer that is a risk with bacterial synthetic biotics 59 . Our results demonstrate the pre-clinical efficacy of engineered S. boulardii as a biotherapeutic production platform for anti-TNF VHH-based remediation of IBD, positioning this approach for consideration in future human clinical trials. The S. boulardii platform developed here can be readily adapted for the delivery of other therapeutic biologics. For example, S. boulardii -mediated secretion of neutralizing nanobodies directed at targets implicated in IBD such as IL-12/IL-23 and α4β7/α4β1 integrins may have advantages compared to systemic delivery of approved monoclonal antibodies against these targets 60 . This approach may be extended to S. boulardii -mediated delivery of nanobodies that neutralize bacterial antigens associated with IBD pathogenesis 61 . The S. boulardii platform may also be readily deployed for veterinary applications, for instance, in the prevention and treatment of various diseases and infections in livestock. S. boulardii probiotics are already approved for use in livestock to increase production, reduce cost, and mitigate dependence on antibiotics 62 – 66 . Further development of the S. boulardii platform holds promise for the low-cost production and facile oral delivery of highly specific biologic agents in manifold contexts. Methods Plasmid construction All constructs consisted of a promoter, secretion signal, antibody, secretion tag, CYC1 terminator, selection marker, 2 µm origin of replication, ampicillin resistance gene and E. coli origin (see Fig. S4A for plasmid map). Promoters were amplified from S. cerevisiae or S. boulardii and secretion signals ( Supplementary Table 1 ) and nanobodies ( Supplementary Table 2 ) were obtained as gBlocks (Integrated DNA Technologies). Antibody sequences were as reported 31 , 39 . Plasmids were constructed using Gibson Assembly cloning 67 . To generate gene knockouts, the plasmid pGZ110 that expresses SpCas9 and a targeting sgRNA (gift from Bruce Futcher, SUNY Stony Brook) was modified to replace the URA3 auxotrophic selection marker with the amdS recyclable selectable marker, which confers resistance to acetamide and can be counter-selected using fluoroacetamide 35 . Guides to target URA3 , HDA2 , TDA3 and VPS5 were designed using the Synthego Knockout Guide Design tool ( https://design.synthego.com/ #/). The vector also contained a homology repair region that introduced several stop codons and a frameshift to prevent readthrough into each coding region, as well as a PAM site deletion to prevent continuous Cas9 nucleolytic activity (see Supplementary Table 3 for sequences). After homozygotic deletion was confirmed by Sanger sequencing ( Fig. S3A ) , the plasmid was removed by counter-selection on fluoroacetamide medium. All plasmids used in this work are listed in Supplementary Table 4 . Yeast strain construction Yeast cells were transformed using the lithium acetate method 68 . S. boulardii (MYA-796, obtained from ATCC) and S. cerevisiae (Sigma1278b) were inoculated overnight at 30°C with shaking at 220 rpm, then diluted to an OD 595 of 0.5, and incubated at 30°C and 220 rpm until an OD 595 of 1.5 was reached. Cells were then washed with distilled water, resuspended in transformation mix (240 µL 50% PEG 3350, 36 µL 1M lithium acetate, 50 µL single-stranded carrier DNA (2 mg/mL in TE), 36 µL 1M DTT, and 16 µL water + plasmid DNA (1 μg in S. boulardii and 100 ng in S. cerevisiae ). Cells were incubated at 42°C for 40 min, pelleted and washed with 1 mL sterile water, re-suspended in 200 µL water and immediately plated onto appropriate selective medium. For G418 selection cells were recovered overnight in XY rich medium (YEPD + 0.01% w/v adenine and 0.02% w/v tryptophan) at 30°C and 220 rpm. The transformation efficiency of S. boulardii was typically 30 to 50-fold lower than for S. cerevisiae 36 . All strains used in this work are listed in Supplementary Table 5 . Antibody and nanobody detection Cells expressing antibody fragments or VHH nanobodies under the control of the GAL1 promoter were precultured overnight in XY + 2% raffinose at 30°C, diluted 200-fold into XY + 2% galactose for 2-4 days. Cells expressing antibodies/nanobodies under the control of constitutive promoters were grown for 3 days in XY + 2% glycerol+ 2% ethanol or XY + glucose at the indicated concentrations and at the indicated temperatures. Cultures were centrifuged, supernatant collected, and pellets washed with cold water. Proteins in the culture medium were precipitated in 10% TCA dissolved in acetone at a 1:10 ratio. Cell pellets were dissolved with 2 M LiOAc and 0.4 M NaOH for five min in each solution 69 . For immunoblot analysis, antibodies/nanobodies were resolved by SDS-PAGE containing 15% acrylamide (VHH) or 12% acrylamide (Fab’) (BioRad) then transferred to PVDF membrane using a wet transfer system (Bio Rad) or directly stained with Coomassie Blue. Membranes were probed with mouse monoclonal anti-FLAG-HRP (Sigma A8592) at 1:5000 dilution or anti-VHH-HRP (GenScript A01861) at 1:3000 dilution and signals visualized by chemiluminescence (Western Lightning Plus-ECL) and a ChemiDoc imaging system (BioRad). Growth rate analysis A preculture was grown overnight until saturation in XY + 2% ethanol+ 2%glycerol or 2% glucose then diluted 20-fold in 96-well clear flat-bottomed microplates (Corning Costar) in the same medium. The plates were sealed and incubated for 72 h on a Sunrise shaker-reader (Tecan) at 37°C with shaking at 564 rpm. Absorbance at 595 nm was measured every 15 min for 24 h. Growth rate was calculated as the linear portion of the curve using PRISM software. VHH nanobody purification Cells were grown in XY + 2% ethanol + 2% glycerol for 3 days in 500 mL culture at 30°C. The culture was centrifuged at 3000 rpm and the supernatant was adjusted to pH 8.0 with 10 N NaOH. The supernatant was applied on a His-Trap HP column (GE Healthcare), washed with buffer (50 mM Tris pH 8.0, 120 mM NaCl, 10% glycerol, 20 mM imidazole), and eluted with wash buffer with 500 mM imidazole. Eluted fractions were concentrated by ultrafiltration using a 3 kDa cutoff spin filter (Vivaspin). Quantification of VHH abundance was performed using a Pierce 660 nm colorimetric assay (ThermoFisher). Direct ELISA For proteins in yeast culture medium, 100 ng of either mTNF or mouse monoclonal anti-VHH in PBS were incubated for 2 h at 4°C on protein-binding Nunc MaxiSorp® flat-bottom 96-well plates and then blocked with 100 µL of 0.1 M NaHCO 3 pH 8.6 + 2% BSA for 1 h at room temperature (RT). The protein of interest was diluted in PBS and incubated with the plate for 1 h at RT, followed by incubation with anti-FLAG-HRP or anti-HIS-HRP (1:5000 in PBS) for 1 h at RT and subsequent development with 50 µL of 3,3′,5,5′-tetramethylbenzidine (TMB, R&D Systems #555214) substrate. The reaction was stopped with 100 µL of 1 M sulfuric acid and the plate was read in a microplate reader (Tecan). Absorbance at 450 nm on an EnVision microplate reader (Perkin Elmer) was used to determine the amount of bound antibody. For mouse tissues, 100 ng of the protein of interest in PBS was coated overnight at 4°C on protein-binding Nunc MaxiSorp® flat-bottom 96-well plates and then blocked with 100 µL of FBS blocking ELISA/ELISPOT diluent (eBioscience). To generate tissue samples, female C57BL/6N (Charles River) 6- to 8-week-old mice were gavaged with 20 mg streptomycin then administered ∼10 8 CFU daily doses of saturated S. boulardii yeast cultures via oral gavage 1 day and 3 days later. Mice were euthanized 1 day later, and the ileum, cecum and colon tissues were removed. Fecal pellets and tissues, including luminal contents, were homogenized in 1 mL PBS using a Retsch mixer mill homogenizer (RM400). Samples were centrifuged and the amount of mF3 VHH nanobody in the supernatants was quantified using a standard curve generated with purified m3F-FLAG VHH. For ELISA, an anti-FLAG capture antibody (Genescript #A00170) was used at 1:4000 dilution, followed by an anti-VHH-HRP detection antibody (Genescript # A01861) at 1:4000. ELISAs were developed using TMB (R&D Systems #555214) and read at 450 and 570 nm using an Envision plate reader (Perkin Elmer). Nanobody toxicity assays T98G cells (ATCC) were grown in Dulbecco’s modified Eagle’s medium supplemented with 100 units/mL penicillin, 100 μg/mL streptomycin and 10% heat-inactivated fetal bovine serum. Cells were maintained at 37°C in 5% CO 2 and 100% humidity. For cytotoxicity assays, cells were seeded in 384-well plates for 24 h, followed by VHH addition using an Echo 555 acoustic dispenser (Labcyte). Cell viability was evaluated after 48 h by Cell Titer Glo in a Tecan reader (luminescence, gain 135, integration time 40 s). To evaluate the neutralization potential of different VHH preparations, a combination of actinomycin D (40 nM) and hTNF (500 ng/mL) was empirically chosen to provide an optimal dynamic range for the assay. Cells were treated with 500 ng/mL hTNF and 40 nM actinomycin D in the presence of increasing concentrations of the VHH purified from yeast culture medium. Neutralization activity was calculated by normalizing cell viability in actinomycin D as 1 and cell viability in actinomycin D + hTNF as 0. Colonization of mice with S. boulardii All mouse experiments were performed in the Central Animal Facility at McMaster University under animal use protocol 20-12-41 as approved by the Animal Research Ethics Board and under compliance with Canadian ethical regulations. Six- to ten-week-old female C57BL/6N mice (Charles River, 027) were used in experiments. One day prior to S. boulardii administration, groups of 2 to 5 mice were pretreated with a single dose of 20 mg of streptomycin as indicated. The following day, 5% sodium bicarbonate pretreatment, if indicated, was carried out 30 min prior to yeast gavage ( S. boulardii bearing ADH2 -m3F VHH or ADH2 control HIV-2 VHH). Mice were administered 2×10 8 CFU of the appropriate yeast suspension in either HEPES buffered saline (0.9% NaCl, 100 mM HEPES pH 7.5) or 5% sodium bicarbonate with HEPES buffer via oral gavage at the indicated frequency for each experiment. Fecal pellets were collected at the times indicated and homogenized in 1 mL PBS for 5 min at 30 rps (Retsch MM400) for determination of yeast CFU by serial dilution. At the experimental endpoint, ileum, cecum, and colon tissue, including luminal contents, were collected and homogenized in 1 mL PBS for 10 min at 30 rps. All homogenates were serially diluted and plated on YPD containing 200 μg/mL G418 and 100 μg/mL ampicillin for CFU determination. DSS colitis model Two days following the initial gavage of S. boulardii strains or control buffer, mice were administered sterile 2% to 3% DSS (Thermo Fisher Scientific, CAS: 9011-18-1 Cat#J1448922) in double distilled water ad libitum . After 5 days, mice were shifted to regular drinking water and euthanized after having reached either 20% weight loss or experimental endpoint (up to 2 weeks post initial gavage). Fecal pellets and tissue were collected and processed as above. Disease activity index (DAI) was scored as described previously 70 . Briefly, DAI scores were determined by evaluating for body weight loss, stool consistency and occult/gross bleeding on the days indicated, as stratified in Supplementary Table 6 . DIA scores are consistent with clinical symptoms observed in human inflammatory bowel disease. Statistical analyses were performed using GraphPad Prism v.98. Significance was tested by one-way ANOVA on ranks with Kruskal–Wallis test and Dunn’s post hoc analysis for multiple comparisons. 16S rDNA microbiome sequencing Genomic DNA was extracted as described with modifications 71 . Samples were transferred to screw cap tubes containing 2.8 mm ceramic beads, 0.1 mm glass beads, 5M guanidinium thiocyanate, 0.1M EDTA, 0.5% sarcosyl, and sodium phosphate buffer as described 71 . Samples were homogenized with a bead beater, centrifuged, and the supernatant processed using a MagMAXExpress 96-Deep Well Magnetic Particle Processor (Applied Biosystems) with a Multi-Sample kit (Life Technologies, catalogue #4413022). Purified DNA was used to amplify variable regions 3 and 4 of the 16S rRNA gene by two-stage nested PCR. Initially samples were amplified in the 8f (AGAGTTTGATCCTGGCTCAG) to 926r (CCGTCAATTCCTTTRAGTTT) region of the 16S gene. The reaction was carried out at 94°C for 5 min, 15 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 60 sec, with a final extension of 72°C for 10 min. PCR products were used as template in the second stage of PCR in which the 341F (CCTACGGGNGGCWGCAG) to 806R (GGACTACNVGGGTWTCTAAT) region was amplified as previously described 72 . The reaction was carried out at 94°C for 5 min, 5 cycles at 94°C for 30 sec, 47°C for 30 sec and 72°C for 30 sec, followed by 25 cycles of 94°C for 30 seco, 50°C for 30 sec and 72°C for 30 sec, with a final extension of 72°C for 10 min. Resulting PCR products were visualized on a 1.5% agarose gel. Positive amplicons were normalized by pooling appropriately based on band intensity and sequenced on an Illumina MiSeq platform. Bioinformatic analysis was performed as previously described 73 – 75 . Briefly, raw 16S amplicon sequences and metadata were demultiplexed using split_libraries_fastq. py script implemented in QIIME2 76 . Demultiplexed fastq files were split into sample-specific fastq files using split_sequence_file_on_sample_ids .py script from QIIME2 . Individual fastq files without non-biological nucleotides were processed using Divisive Amplicon Denoising Algorithm (DADA) pipeline 77 . The output of the dada2 pipeline (feature table of amplicon sequence variants) was processed for alpha and beta diversity analysis using phyloseq 78 , and microbiomeSeq ( http://www.github.com/umerijaz/microbiomeSeq ) packages in R. We analyzed variance (ANOVA) among sample categories while measuring the of α-diversity measures using plot_anova_diversity function in microbiomeSeq package. Permutational multivariate analysis of variance (PERMANOVA) with 999 permutations was performed on all principal coordinates obtained during CCA with the ordination function of the microbiomeSeq package. The pairwise correlation was performed between the microbiome (genera) and metabolomics (metabolites) data using the microbiomeSeq package. Author contributions Roger Palou: methodology, formal analysis, investigation, writing - original draft, writing - review & editing, visualization; Almer van der Sloot: conceptualization, methodology, writing - original draft, writing - review & editing, supervision; Aline Fiebig: methodology, formal analysis, investigation, writing - review & editing, visualization; Megan Zangara: methodology, formal analysis, investigation; Naseer Sangwan: methodology, formal analysis; Maria Sanchez Osuna: methodology, formal analysis, investigation; Bushra Ilyas: methodology, investigation; Haley Zubyk: methodology, investigation; Michael Cook: investigation; Gerard D Wright: conceptualization, supervision, funding acquisition; Brian Coombes: conceptualization, writing - review & editing, supervision, funding acquisition; Mike Tyers: conceptualization, writing - original draft, writing - review & editing, supervision, funding acquisition Conflict of interest The authors declare no conflict of interest. Funding This study was supported by grants from The W. Garfield Weston Foundation (to B.K.C., G.D.W. and M.T.), Genome Canada and Genome Quebec (to G.D.W. and M.T.), and the Canadian Institutes of Health Research (PJT-180315 to B.K.C.; FDN-167277 to M.T.). Supplementary Figure Legends Download figure Open in new tab Figure S1. Effect of anti-mTNF VHH on S. boulardii proliferation in vitro . A) Growth rate of strains producing anti-mTNF VHH (m3F) produced under the control of ADH2 , ADH5 , PGK1 and TEF1 promoters were determined by OD 595 in a shaker-reader at 37°C. B) Growth rate of strains producing anti-mTNF VHH tandem dimer (m3F-m3F) produced under the control of ADH2 , ADH5 , PGK1 and TEF1 promoters were determined by OD 595 in a shaker-reader at 37°C. Wild type S. boulardii (Sb) was used as a control. Download figure Open in new tab Figure S2. Production of anti-mTNF VHH by S. boulardii after passage through the mouse GI tract. A) Individual S. boulardii colonies obtained from feces were assessed for anti-mTNF VHH (m3F) expression by ELISA. B) Stability of anti - mTNF m3F VHH activity in indicated tissue and feces extracts. Dilutions of anti-mTNF VHH produced by S. boulardii in culture medium were incubated with tissue extracts and assessed for binding activity by ELISA. Download figure Open in new tab Figure S3. Effect of secretory pathway mutations on VHH production by S. boulardii . The secretory pathway genes TDA3, VPA5 and HDA2 were disrupted by CRISPR-mediated introduction of frameshift mutations. A) Sequence validation of mutant alleles. Sequences were rendered and visualized in Benchling. B) Single, double, and triple mutants were transformed with plasmids expressing anti-mTNF VHH (m3F) under the control of the ADH2 , ADH5 , PGK1 , TEF1 and TDH3 promoters. Cells were grown in XY rich medium with 2% glycerol+2% ethanol at 30°C ( left ) in a shaker-reader for 3 days. VHH secretion was quantified by ELISA using immobilized anti-VHH antibody (top) and normalized to wild type S. boulardii expressing anti-mTNF m3F VHH from the PGK1 promoter (middle). Mean ± SEM are indicated. Statistical analysis by Tukey’s ANOVA (* p<0.05, ** p<0.01, *** p<0.001, **** p <0.0001). Cell fitness was measured as the slope of the exponential growth phase for three independent colonies and normalized to wild type S. boulardii expressing anti-mTNF (m3F) VHH from the ADH2 promoter (bottom). C) As for panel B but with cell culture at 37°C. Download figure Open in new tab Figure S4. Plasmid map for constructs used in this study. A) pKS-p ADH2 - MAT αWT-VHH-FLAG- CYC1 term-KanMX for VHH expression and secretion. Variations of this construct replaced promoters, secretion signals and VHH coding regions. B) pGZ110-Cas9-amdSYM for S. boulardii genome engineering. Variations of this construct replaced sgRNA and repair template regions. Supporting information View this table: View inline View popup Supplementary Table 1. List of secretion signals View this table: View inline View popup Supplementary Table 2. List of VHH nanobody sequences View this table: View inline View popup Download powerpoint Supplementary Table 3. List of homology repair and sgRNA sequences View this table: View inline View popup Supplementary Table 4. Plasmids used in this study View this table: View inline View popup Download powerpoint Supplementary Table 5. Strains used in this study View this table: View inline View popup Download powerpoint Supplementary Table 6: Disease activity index score scale Acknowledgments We thank Xingjian Xu for initial technical assistance, Jason Moffat and Dev Sidhu for antibody clones, and Bruce Futcher for plasmid pGZ110. Funder Information Declared Weston Family Foundation, https://ror.org/0512g3q82 Genome Canada, https://ror.org/029s29983 Genome Quebec Canadian Institutes of Health Research , PJT-180315 , FDN-167277 Footnotes ↵ # co-corresponding authors Abbreviations IBD inflammatory bowel disease TNF tumor necrosis factor VHH variable heavy domain of heavy chain antibody scFv single-chain fragment variable Fab fragment antigen-binding region References 1. ↵ Chua , K. J. , Kwok , W. C. , Aggarwal , N. , Sun , T. & Chang , M. W . Designer probiotics for the prevention and treatment of human diseases . Curr Opin Chem Biol 40 , 8 – 16 ( 2017 ). OpenUrl CrossRef PubMed 2. ↵ Heavey , M. K. , Durmusoglu , D. , Crook , N. & Anselmo , A. C. Discovery and delivery strategies for engineered live biotherapeutic products . Trends in Biotechnology vol. 40 354 – 369 Preprint at doi: 10.1016/j.tibtech.2021.08.002 ( 2022 ). OpenUrl CrossRef PubMed 3. ↵ Mimee , M. , Citorik , R. J. & Lu , T. K . Microbiome therapeutics - Advances and challenges . Adv Drug Deliv Rev 105 , 44 – 54 ( 2016 ). OpenUrl CrossRef PubMed 4. ↵ Vandenbroucke , K. et al. Orally administered L. lactis secreting an anti-TNF Nanobody demonstrate efficacy in chronic colitis . Mucosal Immunol 3 , 49 – 56 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 5. ↵ Wu , Y. Q. , Zou , Z. P. , Zhou , Y. & Ye , B. C . Dual engineered bacteria improve inflammatory bowel disease in mice . Appl Microbiol Biotechnol 108 , ( 2024 ). 6. ↵ Lynch , J. P. et al. Engineered Escherichia coli for the in situ secretion of therapeutic nanobodies in the gut . Cell Host Microbe 31 , 634 – 649 .e8 ( 2023 ). OpenUrl CrossRef PubMed 7. ↵ Munck , C. , Sheth , R. U. , Freedberg , D. E. & Wang , H. H . Recording mobile DNA in the gut microbiota using an Escherichia coli CRISPR-Cas spacer acquisition platform . Nat Commun 11 , 95 ( 2020 ). OpenUrl CrossRef PubMed 8. ↵ Richard , M. L. & Sokol , H . The gut mycobiota: insights into analysis, environmental interactions and role in gastrointestinal diseases . Nat Rev Gastroenterol Hepatol 16 , 331 – 345 ( 2019 ). OpenUrl CrossRef PubMed 9. ↵ Durmusoglu , D. et al. In Situ Biomanufacturing of Small Molecules in the Mammalian Gut by Probiotic Saccharomyces boulardii . ACS Synth Biol ( 2021 ) doi: 10.1021/acssynbio.0c00562 . OpenUrl CrossRef 10. Durmusoglu , D. et al. Improving Therapeutic Protein Secretion in the Probiotic Yeast Saccharomyces boulardii using a Multifactorial Engineering Approach . doi: 10.1101/2022.12.30.522352 . OpenUrl Abstract / FREE Full Text 11. ↵ Liu , C.-H. , Chang , J.-H. , Chang , Y.-C. & Mou , K. Y . Treatment of murine colitis by Saccharomyces boulardii secreting atrial natriuretic peptide . J Mol Med ( 2020 ). 12. ↵ Chen , K. et al. A probiotic yeast-based immunotherapy against Clostridioides difficile infection . Sci Transl Med 12 , ( 2020 ). 13. ↵ Deleu , S. et al. Effect of Mutant and Engineered High-Acetate-Producing Saccharomyces cerevisiae var. boulardii Strains in Dextran Sodium Sulphate-Induced Colitis . Nutrients 16 , 2668 ( 2024 ). OpenUrl CrossRef PubMed 14. ↵ Khatri , I. , Tomar , R. , Ganesan , K. , Prasad , G. S. & Subramanian , S . Complete genome sequence and comparative genomics of the probiotic yeast Saccharomyces boulardii . Sci Rep 7 , 371 ( 2017 ). OpenUrl CrossRef PubMed 15. ↵ Kelesidis , T. & Pothoulakis , C . Efficacy and safety of the probiotic Saccharomyces boulardii for the prevention and therapy of gastrointestinal disorders . Therap Adv Gastroenterol 5 , 111 – 125 ( 2012 ). OpenUrl CrossRef PubMed 16. ↵ Sen , S. & Mansell , T. J . Yeasts as probiotics: mechanisms, outcomes, and future potential . Fungal Genetics and Biology 103333 ( 2020 ) doi: 10.1016/j.fgb.2020.103333 . OpenUrl CrossRef 17. ↵ Hudson , L. E. et al. Characterization of the probiotic yeast Saccharomyces boulardii in the healthy mucosal immune system . PLoS One 11 , 1 – 21 ( 2016 ). OpenUrl CrossRef PubMed 18. ↵ Hudson , L. E. et al. Characterization of the probiotic yeast Saccharomyces boulardii in the healthy mucosal immune system . PLoS One 11 , ( 2016 ). 19. ↵ Palma , M. L. , Garcia-bates , T. M. , Martins , F. S. & Douradinha , B . Genetically engineered probiotic Saccharomyces cerevisiae strains mature human dendritic cells and stimulate Gag-specific memory CD8 + T cells ex vivo . ( 2019 ). 20. Michael , S. et al. Quantitative phenotyping of inflammatory bowel disease in the IL-10-deficient mouse by use of noninvasive magnetic resonance imaging . Inflamm Bowel Dis 19 , 185 – 193 ( 2013 ). OpenUrl CrossRef PubMed 21. ↵ Liu , J. et al. Metabolic Engineering of Probiotic Saccharomyces boulardii . Appl Environ Microbiol 82 , 2280 – 2287 ( 2016 ). OpenUrl Abstract / FREE Full Text 22. Li , R. , Wan , X. , Takala , T. M. & Saris , P. E. J . Heterologous Expression of the Leuconostoc Bacteriocin Leucocin C in Probiotic Yeast Saccharomyces boulardii . Probiotics Antimicrob Proteins ( 2020 ) doi: 10.1007/s12602-020-09676-1 . OpenUrl CrossRef 23. ↵ Chen , K. , et al. A probiotic yeast-based immunotherapy against Clostridioides difficile infection . 4905 , ( 2020 ). 24. ↵ Rebeck , O. N. et al. A yeast-based oral therapeutic delivers immune checkpoint inhibitors to reduce intestinal tumor burden . Cell Chem Biol ( 2024 ) doi: 10.1016/j.chembiol.2024.10.013 . OpenUrl CrossRef 25. ↵ Mullard , A . FDA approves 100th monoclonal antibody product . Nature reviews. Drug discovery vol. 20 491 – 495 Preprint at doi: 10.1038/d41573-021-00079-7 ( 2021 ). OpenUrl CrossRef PubMed 26. ↵ Wlodarska , M. , Kostic , A. D. & Xavier , R. J . An integrative view of microbiome-host interactions in inflammatory bowel diseases . Cell Host Microbe 17 , 577 – 591 ( 2015 ). OpenUrl CrossRef PubMed 27. ↵ Kim , E. S. Infliximab versus Adalimumab, Which One Is Better for Ulcerative Colitis? Gut Liver 15 , 149 – 150 ( 2021 ). OpenUrl CrossRef PubMed 28. ↵ Burisch , J. , Claytor , J. , Hernandez , I. , Hou , J. K. & Kaplan , G. G . The Cost of Inflammatory Bowel Disease Care – How to Make it Sustainable . Clinical Gastroenterology and Hepatology ( 2024 ) doi: 10.1016/j.cgh.2024.06.049 . OpenUrl CrossRef 29. ↵ Vulliemoz , M. et al. TNF-Alpha Blockers in Inflammatory Bowel Diseases: Practical Recommendations and a User’s Guide: An Update . Digestion 1 – 11 ( 2020 ) doi: 10.1159/000506898 . OpenUrl CrossRef PubMed 30. ↵ Hou , J. , Tyo , K. E. J. , Liu , Z. , Petranovic , D. & Nielsen , J . Metabolic engineering of recombinant protein secretion by Saccharomyces cerevisiae . FEMS Yeast Res 12 , 491 – 510 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 31. ↵ Wong , S. Wong , S (2013) The Generation of Synthetic Antibody Reagents for Clostridium difficile Toxins . MSc Thesis, University of Toronto . ( 2013 ). 32. ↵ Rakestraw , J. A. , Sazinsky , S. L. , Piatesi , A. , Antipov , E. & Wittrup , K. D . Directed evolution of a secretory leader for the improved expression of heterologous proteins and full-length antibodies in Saccharomyces cerevisiae . Biotechnol Bioeng 103 , 1192 – 1201 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 33. ↵ Clements , J. M. , Catlin , G. H. , Price , M. J. & Mark Edwards , R . Secretion of Human Epidermal Growth Factor from Saccharomyces Cerevisiae Using Synthetic Leader Sequences . Gene vol. 106 ( 1901 ). 34. ↵ Li , J. , Xu , H. , Bentley , W. E. & Rao , G . Impediments to secretion of green fluorescent protein and its fusion from Saccharomyces cerevisiae . Biotechnol Prog 18 , 831 – 838 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 35. ↵ Solis-Escalante , D. et al. amdSYM, A new dominant recyclable marker cassette for Saccharomyces cerevisiae . FEMS Yeast Res 13 , 126 – 139 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 36. ↵ Liu , J.-J. et al. Metabolic Engineering of Probiotic Saccharomyces boulardii . Appl Environ Microbiol 82 , 2280 – 2287 ( 2016 ). OpenUrl Abstract / FREE Full Text 37. ↵ de Ruijter , J. C. , Koskela , E. V. & Frey , A. D . Enhancing antibody folding and secretion by tailoring the Saccharomyces cerevisiae endoplasmic reticulum . Microb Cell Fact 15 , 1 – 18 ( 2016 ). OpenUrl CrossRef PubMed 38. ↵ Steeland , S. , Vandenbroucke , R. E. & Libert , C . Nanobodies as therapeutics: Big opportunities for small antibodies . Drug Discov Today 21 , 1076 – 1113 ( 2016 ). OpenUrl CrossRef PubMed 39. ↵ Chen , G. et al. Potent Neutralization of Staphylococcal Enterotoxin B In Vivo by Antibodies that Block Binding to the T-Cell Receptor . J Mol Biol 1 , ( 2019 ). 40. ↵ McCoy , L. E. et al. Potent and broad neutralization of HIV-1 by a llama antibody elicited by immunization . J Exp Med 209 , 1091 – 1103 ( 2012 ). OpenUrl Abstract / FREE Full Text 41. ↵ Albenberg , L. et al. Correlation between intraluminal oxygen gradient and radial partitioning of intestinal microbiota . Gastroenterology 147 , 1055 – 1063 .e8 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 42. ↵ Lai , L. C. , Kosorukoff , A. L. , Burke , P. V. & Kwast , K. E . Metabolic-state-dependent remodeling of the transcriptome in response to anoxia and subsequent reoxygenation in Saccharomyces cerevisiae . Eukaryot Cell 5 , 1468 – 1489 ( 2006 ). OpenUrl Abstract / FREE Full Text 43. ↵ Yan , Q. et al. A genomic compendium of cultivated human gut fungi characterizes the gut mycobiome and its relevance to common diseases . Cell 187 , 2969 – 2989 .e24 ( 2024 ). OpenUrl CrossRef PubMed 44. ↵ Huang , M. , Wang , G. , Qin , J. , Petranovic , D. & Nielsen , J . Engineering the protein secretory pathway of Saccharomyces cerevisiae enables improved protein production . Proceedings of the National Academy of Sciences 115 , E11025 – E11032 ( 2018 ). OpenUrl Abstract / FREE Full Text 45. ↵ Beirnaert , E. et al. Bivalent llama single-domain antibody fragments against tumor necrosis factor have picomolar potencies due to intramolecular interactions . Front Immunol 8 , ( 2017 ). 46. ↵ Coppieters , K. et al. Formatted anti-tumor necrosis factor α VHH proteins derived from camelids show superior potency and targeting to inflamed joints in a murine model of collagen-induced arthritis . Arthritis Rheum 54 , 1856 – 1866 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 47. ↵ Wang , G. H. W. , Elwell , J. H. , Oberley , L. W. & Goeddel’ , D. V . Manganous Superoxide Dismutase Is Essential for Cellular Resistance to CytotoxiCity of Tumor Necrosis Factor . Cell vol. 58 ( 1989 ). 48. ↵ Sakuma , S. , et al. Responses of Human Glioblastoma Cells to Human Natural Tumor Necrosis Factor-c : Susceptibility, Mechanism of Resistance and Cytokine Production Studies . Journal of Neuro-Oncology vol. 15 ( 1993 ). 49. ↵ Stecher , B. et al. Comparison of Salmonella enterica serovar typhimurium colitis in germfree mice and mice pretreated with streptomycin . Infect Immun 73 , 3228 – 3241 ( 2005 ). OpenUrl Abstract / FREE Full Text 50. ↵ Macfarlane , G. T. , Allison , C. , Gibson , S. A. W. & Cummings , J. H . Contribution of the microflora to proteolysis in the human large intestine . Journal of Applied Bacteriology 64 , 37 – 46 ( 1988 ). OpenUrl CrossRef PubMed 51. ↵ Lynch , J. P. et al. Engineered Escherichia coli for the in situ secretion of therapeutic nanobodies in the gut . Cell Host Microbe 31 , 634 – 649 .e8 ( 2023 ). OpenUrl CrossRef PubMed 52. ↵ Chassaing , B. , Aitken , J. D. , Malleshappa , M. & Vijay-Kumar , M. Dextran Sulfate Sodium (DSS)-Induced Colitis in Mice . Curr Protoc Immunol 104 , ( 2014 ). 53. ↵ Rodríguez-Nogales , A. et al. Intestinal anti-inflammatory effect of the probiotic Saccharomyces boulardii in DSS-induced colitis in mice: Impact on microRNAs expression and gut microbiota composition . J Nutr Biochem 61 , 129 – 139 ( 2018 ). OpenUrl CrossRef PubMed 54. ↵ Sivananthan , K. & Petersen , A. M . Review of Saccharomyces boulardii as a treatment option in IBD . Immunopharmacol Immunotoxicol 40 , 465 – 475 ( 2018 ). OpenUrl CrossRef PubMed 55. ↵ Stovicek , V. , Holkenbrink , C. & Borodina , I . CRISPR/Cas system for yeast genome engineering: advances and applications . FEMS Yeast Res 17 , ( 2017 ). 56. ↵ Durmusoglu , D. , Al’Abri , I. , Collins , S. P. , Beisel , C. & Crook , N. Establishing Probiotic Saccharomyces boulardii as a Model Organism for Synthesis and Delivery of Biomolecules . bioRxiv 2020.01.22.915389 ( 2020 ) doi: 10.1101/2020.01.22.915389 . OpenUrl Abstract / FREE Full Text 57. ↵ Laursen , N. S. et al. Universal protection against influenza infection by a multidomain antibody to influenza hemagglutinin . Science (1979) 362 , 598 – 602 ( 2018 ). OpenUrl Abstract / FREE Full Text 58. ↵ Xiang , Y. et al. Versatile and multivalent nanobodies efficiently neutralize SARS-CoV-2 . Science (1979) 370 , 1479 – 1484 ( 2020 ). OpenUrl Abstract / FREE Full Text 59. ↵ Tóth , A. G. , et al. Mobile antimicrobial resistance genes in probiotics . Antibiotics 10 , ( 2021 ). 60. ↵ Zhou , X. et al. Inducible caspase-9 suicide gene controls adverse effects from alloreplete T cells after haploidentical stem cell transplantation . Blood 125 , 4103 – 4113 ( 2015 ). OpenUrl Abstract / FREE Full Text 61. ↵ Shaler , C. R. , Elhenawy , W. & Coombes , B. K . The Unique Lifestyle of Crohn’s Disease-Associated Adherent-Invasive Escherichia coli . J Mol Biol 431 , 2970 – 2981 ( 2019 ). OpenUrl CrossRef PubMed 62. ↵ Daudelin , J. F. et al. Administration of probiotics influences F4 (K88)-positive enterotoxigenic Escherichia coli attachment and intestinal cytokine expression in weaned pigs . Vet Res 42 , 69 ( 2011 ). OpenUrl CrossRef PubMed 63. O’Callaghan , T. F. , Ross , R. P. , Stanton , C. & Clarke , G . The gut microbiome as a virtual endocrine organ with implications for farm and domestic animal endocrinology . Domest Anim Endocrinol 56 , S44 – S55 ( 2016 ). OpenUrl CrossRef PubMed 64. Foo , J. L. , Ling , H. , Lee , Y. S. & Chang , M. W . Microbiome engineering: Current applications and its future . Biotechnol J 12 , 1 – 11 ( 2017 ). OpenUrl CrossRef 65. Massacci , F. R. et al. Dietary Saccharomyces cerevisiae boulardii CNCM I-1079 Positively Affects Performance and Intestinal Ecosystem in Broilers during a Campylobacter jejuni Infection . Microorganisms 7 , ( 2019 ). 66. ↵ Hancox , L. R. et al. Effect of a single dose of Saccharomyces cerevisiae var. boulardii on the occurrence of porcine neonatal diarrhoea . Animal 9 , 1756 – 1759 ( 2015 ). OpenUrl CrossRef PubMed 67. ↵ Gibson , D. G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases . Nat Methods 6 , 343 – 345 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 68. ↵ Gietz , D. , St Jean , A. , Woods , R. A. & Schiestl , R. H . Improved method for high efficiency transformation of intact yeast cells . Nucleic Acids Res 20 , 1425 ( 1992 ). OpenUrl CrossRef PubMed Web of Science 69. ↵ Zhang , T. et al. An improved method for whole protein extraction from yeast Saccharomyces cerevisiae . Yeast 28 , 795 – 798 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 70. ↵ Yao , J. et al. Anti-oxidant effects of resveratrol on mice with DSS-induced ulcerative colitis . Arch Med Res 41 , 288 – 294 ( 2010 ). OpenUrl CrossRef PubMed 71. ↵ Stearns , J. C. et al. Culture and molecular-based profiles show shifts in bacterial communities of the upper respiratory tract that occur with age . ISME J 9 , 1246 – 1259 ( 2015 ). OpenUrl CrossRef PubMed 72. ↵ Bartram , A. K. , Lynch , M. D. J. , Stearns , J. C. , Moreno-Hagelsieb , G. & Neufeld , J. D . Generation of Multimillion-Sequence 16S rRNA Gene Libraries from Complex Microbial Communities by Assembling Paired-End Illumina Reads . Appl Environ Microbiol 77 , 3846 – 3852 ( 2011 ). OpenUrl Abstract / FREE Full Text 73. ↵ Weiss , K. et al. Barrier Housing and Gender Effects on Allergic Airway Disease in a Murine House Dust Mite Model . Immunohorizons 5 , 33 – 47 ( 2021 ). OpenUrl Abstract / FREE Full Text 74. Barot , S. V et al. Tumor microbiome variation in young versus average onset colorectal cancer . Journal of Clinical Oncology 40 , 144 – 144 ( 2022 ). OpenUrl CrossRef 75. ↵ Chambers , L. M. et al. Disruption of the Gut Microbiota Confers Cisplatin Resistance in Epithelial Ovarian Cancer . Cancer Res 82 , 4654 – 4669 ( 2022 ). OpenUrl CrossRef PubMed 76. ↵ Bolyen , E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2 . Nat Biotechnol 37 , 852 – 857 ( 2019 ). OpenUrl CrossRef PubMed 77. ↵ Callahan , B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data . Nat Methods 13 , 581 – 583 ( 2016 ). OpenUrl CrossRef PubMed 78. ↵ McMurdie , P. J. & Holmes , S. phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data . PLoS One 8 , e61217 ( 2013 ). OpenUrl CrossRef PubMed 79. Paifer , E. et al. Efficient expression and secretion of recombinant alpha amylase in Pichia pastoris using two different signal sequences . Yeast 10 , 1415 – 1419 ( 1994 ). OpenUrl CrossRef PubMed Web of Science 80. Achstetter , T. , Nguyen-Juilleret , M. , Findeli , A. , Merkamm , M. & Lemoine , Y . A New Signal Peptide Useful for Secretion of Heterologous Proteins from Yeast and Its Application for Synthesis of Hirudin (Saccharomyces Cere∼siae; Recombinant DNA; Shuttle Vector; Fusion Protein; pro Peptide) . Gene vol. 110 ( 1992 ). 81. Massahi , A. & Çalik , P . In-silico determination of Pichia pastoris signal peptides for extracellular recombinant protein production . J Theor Biol 364 , 179 – 188 ( 2015 ). OpenUrl CrossRef PubMed 82. Chitoshi OKA et al. Human Lysozyme Secretion Increased by Alpha factor Pro-sequence in Pichia pastoris . Biosci Biotechnol Biochem 63 , 1977 – 1983 ( 1999 ). OpenUrl CrossRef PubMed 83. Hussack , G. et al. Neutralization of Clostridium difficile toxin A with single-domain antibodies targeting the cell receptor binding domain . Journal of Biological Chemistry 286 , 8961 – 8976 ( 2011 ). OpenUrl Abstract / FREE Full Text 84. Murase , T. et al. Structural basis for antibody recognition in the receptor-binding domains of toxins A and B from Clostridium difficile . J Biol Chem 289 , 2331 – 2343 ( 2014 ). OpenUrl Abstract / FREE Full Text 85. Vanmarsenille , C. et al. Nanobodies targeting conserved epitopes on the major outer membrane protein of Campylobacter as potential tools for control of Campylobacter colonization . Vet Res 48 , 86 ( 2017 ). OpenUrl CrossRef PubMed 86. Harmsen , M. M. , van Solt , C. B. , van Zijderveld-van Bemmel , A. M. , Niewold , T. A. & van Zijderveld , F. G . Selection and optimization of proteolytically stable llama single-domain antibody fragments for oral immunotherapy . Appl Microbiol Biotechnol 72 , 544 – 551 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 87. Tremblay , J. M. et al. A single VHH-based toxin-neutralizing agent and an effector antibody protect mice against challenge with Shiga toxins 1 and 2 . Infect Immun 81 , 4592 – 4603 ( 2013 ). OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted May 16, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following A Saccharomyces boulardii synthetic biotic platform for delivery of therapeutic nanobodies to ameliorate gastrointestinal inflammation Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share A Saccharomyces boulardii synthetic biotic platform for delivery of therapeutic nanobodies to ameliorate gastrointestinal inflammation Roger Palou , Almer M. van der Sloot , Aline A. Fiebig , Megan T. Zangara , Naseer Sangwan , María Sánchez Osuna , Bushra Ilyas , Haley Zubyk , Michael Cook , Gerard D. Wright , Brian K. Coombes , Mike Tyers bioRxiv 2025.05.15.652971; doi: https://doi.org/10.1101/2025.05.15.652971 Share This Article: Copy Citation Tools A Saccharomyces boulardii synthetic biotic platform for delivery of therapeutic nanobodies to ameliorate gastrointestinal inflammation Roger Palou , Almer M. van der Sloot , Aline A. Fiebig , Megan T. Zangara , Naseer Sangwan , María Sánchez Osuna , Bushra Ilyas , Haley Zubyk , Michael Cook , Gerard D. Wright , Brian K. Coombes , Mike Tyers bioRxiv 2025.05.15.652971; doi: https://doi.org/10.1101/2025.05.15.652971 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Synthetic Biology Subject Areas All Articles Animal Behavior and Cognition (7617) Biochemistry (17633) Bioengineering (13856) Bioinformatics (41841) Biophysics (21399) Cancer Biology (18529) Cell Biology (25422) Clinical Trials (138) Developmental Biology (13352) Ecology (19860) Epidemiology (2067) Evolutionary Biology (24281) Genetics (15582) Genomics (22461) Immunology (17700) Microbiology (40295) Molecular Biology (17140) Neuroscience (88413) Paleontology (666) Pathology (2823) Pharmacology and Toxicology (4813) Physiology (7632) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4284) Systems Biology (9808) Zoology (2267)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.