VCP inhibitor suppresses glioblastoma development through inducing the formation of aggregates and disrupting mitochondrial homeostasis

VCP inhibitor suppresses glioblastoma development through inducing the formation of aggregates and disrupting mitochondrial homeostasis | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 21 February 2025 V1 Latest version Share on VCP inhibitor suppresses glioblastoma development through inducing the formation of aggregates and disrupting mitochondrial homeostasis Authors : xuejun cao 0009-0001-5645-789X , Yishen Li , Bin Guo , Yan Liu , Baoshuai Wang , Hao Wang , Jingbo Lu , Libin Wei , Yuan Gao , Tao Wu [email protected] , and Yongjian Guo 0009-0009-8774-6713 Authors Info & Affiliations https://doi.org/10.22541/au.174013895.54282743/v1 319 views 64 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract The effective treatment strategies for glioblastoma (GBM) are still limited at present. Identifying therapeutic targets in GBM and developing corresponding drugs are unmet needs. Here, we find that VCP is highly expressed in GBM cells and correlates with glioma malignancy. V8 is derived from Wogonin analogues, which bind to VCP to inhibit GBM growth. V8 inactivates its ATPase activity, and induces protein aggregates in cytoplasm and mitochondria. Abnormally accumulated VCP on mitochondria induced by VCP inhibitor further recruits PRKN, leading to the co-localization of mitophagy receptors with mitochondria to initiate mitophagy. However, inhibiting VCP also disturbs lysosomal pH, preventing the degradation of abnormal mitochondria. As a consequence, mitochondria with protein aggregates accumulate and release excessive mt-ROS which lead to the demise of GBM cells. In conclusion, VCP not only maintains mitochondrial proteostasis, but also keeps the integrity of lysosome to clear damaged mitochondria by mitophagy. Targeting VCP with its inhibitors, such as V8, causes mitochondria dysfunction, effectively suppresses the viability of GBM and may represent a potential strategy for GBM treatment. VCP inhibitor suppresses glioblastoma development through inducing the formation of aggregates and disrupting mitochondrial homeostasis Xuejun Cao a, * , Yishen Li a, * , Bin Guo a , Yan Liu b , Baoshuai Wang a , Hao Wang a , Jingbo Lu a , Libin Wei a , Yuan Gao a , Yongjian Guo c , Tao Wu a a State Key Laboratory of Natural Medicines, Jiangsu Key Laboratory of Carcinogenesis and Intervention, School of Basic Medicine and Clinical Pharmacy, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009, People’s Republic of China b Department of Pathology, BaogangHospital of InnerMongolia, The Third Affiliated Hospital of Inner Mongolia Medical University, 20 Shaoxian Road, Kun District, Baotou 014010, People’s Republic of China c School of Biopharmacy, China Pharmaceutical University Jiangning Campus, 639 longmian Avenue, Jiangning District, Nanjing 211198, People’s Republic of China Correspondence: Tao Wu: [email protected] ; Yongjian Guo: [email protected] *These authors contributed equally to this work. Conflicts of interests：No potential conflict of interest was reported by the authors. Acknowledgements This work was supported by the National Natural Science Foundation of China （No. 82073877），“Double First-Class” University project（CPU2022PZQ11，and the Fundamental Research Funds for the Central Universities (NO. 2632024TD07) Availability of data The data that support the findings of this study are available from the corresponding author upon reasonable request. Some data may not be made available because of privacy or ethical restrictions. Author contributions Tao Wu, Yongjian Guo and XueJun Cao conceived and oversaw the study and writing of the manuscript. XueJun Cao identify the relation of V8 and VCP, performed enzyme activity analysis, western blotting, cloning and mechanistic characterization experiments. Yishen Li performed cell biology and biochemistry experiments, and analysis of Tissue microarrays of gliomas. Bin Guo, Yan Liu purified vcp protein and generated key functional data., Baoshuai Wang, Hao Wang, Jingbo Lu, Libin Wei, Yuan Gao supported generation of mass spectrometry data and manuscript preparation. All the authors read and approved the manuscript. Abstracts The effective treatment strategies for glioblastoma (GBM) are still limited at present. Identifying therapeutic targets in GBM and developing corresponding drugs are unmet needs. Here, we find that VCP is highly expressed in GBM cells and correlates with glioma malignancy. V8 is derived from Wogonin analogues, which bind to VCP to inhibit GBM growth. V8 inactivates its ATPase activity, and induces protein aggregates in cytoplasm and mitochondria. Abnormally accumulated VCP on mitochondria induced by VCP inhibitor further recruits PRKN, leading to the co-localization of mitophagy receptors with mitochondria to initiate mitophagy. However, inhibiting VCP also disturbs lysosomal pH, preventing the degradation of abnormal mitochondria. As a consequence, mitochondria with protein aggregates accumulate and release excessive mt-ROS which lead to the demise of GBM cells. In conclusion, VCP not only maintains mitochondrial proteostasis, but also keeps the integrity of lysosome to clear damaged mitochondria by mitophagy. Targeting VCP with its inhibitors, such as V8, causes mitochondria dysfunction, effectively suppresses the viability of GBM and may represent a potential strategy for GBM treatment. Keywords: autolysosome; aggregates; glioblastoma; mitophagy; PRKN; VCP. Abbreviation BNIP3: BCL2 interacting protein 3; CCCP: carbonyl cyanide p-trichloromethoxy- phenylhydrazone; GBM: glioblastoma; MitoSOX: mitochondrial reactive oxygen species; mito-Keima: mitochondria-targeted and pH-sensitive fluorescent protein; PRKN: parkin RBR E3 ubiquitin protein ligase; PINK1: PTEN induced kinase 1; SQSTM1/p62: Sequestosome 1; TAX1BP1: Tax1 Binding Protein 1; VCP: Valosin containing protein; Introduction Gliomas are tumors originating from glial cells in the brain, of which glioblastoma (GBM) is the most common and deadly representative of primary malignant brain tumors(Aldape, Zadeh, Mansouri, Reifenberger, & von Deimling, 2015). Although GBMs can be treated with surgical resection and chemoradiotherapy, they are characterised by high ”recurrent” potential and poor prognosis. Malignant tumors, including GBM, are highly proliferative, and require machineries to maintain cellular homeostasis (Fabian et al., 2019). The ubiquitin-proteasome system (UPS) represents a mechanism to maintain proteostasis in cells by regulating protein turnover(Pohl & Dikic, 2019). The UPS targets a multitude of proteins with diverse functions, making it an essential regulator of cell fate. Mounting evidence have demonstrated that dysregulation of UPS plays a role in tumorigenesis through disrupting proteostasis and causing aberrent signaling pathways (Park, Cho, & Song, 2020). Accumulating data has demonstrated a significant correlation between UPS and the survival and rapid growth of glioma cell(Vlachostergios, Voutsadakis, & Papandreou, 2013). However, The intricate biological processes of numerous UPS components in gliomas remain largely unknown. To develop an efficient treatment strategy that targets UPS components, it is essential to consider the distinctive expression patterns of UPS member in gliomas and GBM subtypes and their influence on pivotal downstream signalling cascades(Vriend & Klonisch, 2023). Valosin containing protein (VCP)/p97 (also designated as Cdc48, CDC 48, or Ter94) is an essential component of the UPS. It is an AAA+ ATPase that contains a regulatory N-terminal domain and two ATPase domains, D1 and D2, which enable VCP to change the conformation of substrate proteins. VCP binds to a multitude of ubiquitinated proteins and facilitates their degradation, controlling various aspects of the cellular stress response and playing a central role in coping with proteotoxic stress (Chu, Xie, Payan, & Stochaj, 2023; Ferrari et al., 2022). So any impairment to VCP functionality may impact the cellular homeostasis. VCP and ubiquitin-X domain adaptor 8 (UBXD8) have been implicated in mitophagy when mitochondria are damaged, mediating the degradation of multiple BH3-only proteins(Ganji et al., 2023). Studies have also demonstrated that VCP is recruited to mitochondria by mutant huntingtin in Huntington’s disease. The accumulation of VCP in mitochondria facilitates mitophagy by interacting with microtubule-associated protein 1 light chain 3 (LC3) through the LC3-interacting region (LIR)(Guo et al., 2016). Nevertheless, mutations in VCP cause severe damage to mitochondrial structure and function, leading to degenerative diseases such as amyotrophic lateral sclerosis (ALS)(Iannibelli et al., 2023). Although VCP is essential for mitochondrial protein homeostasis, the mechanism by which VCP abnormalities lead to mitochondrial damage in mammalian cells remains unknown. VCP is highly expressed in many types of cancers, including liver, pancreatic, and breast cancers, compared to normal tissues(Kilgas & Ramadan, 2023; Lan, Chai, Wang, & Wang, 2017; Wang et al., 2023). Therefore researchers are attempting to discover novel molecules that inhibit VCP, including quinazoline, pyrimidine, triazole/thiazole, indole derivatives, CB5083(Kilgas & Ramadan, 2023). CB-5083 was the first selective VCP inhibitor with promising preclinical anti-tumor efficacy (Tang, Odzorig, Jin, & Xia, 2019; Zhao et al., 2020). However, the clinical trials of CB-5083 were terminated due to the adverse effects on vision caused by the inhibition of phosphodiesterase-6 (PDE6) (Leinonen et al., 2021). Thereby, there is a continuous necessity for the development of a secure and selective inhibitor of VCP. V8 is a derivative of Wogonin, a flavonoid from Scutellaria baicalensis Georgi, that has cytotoxic and anti-proliferative activities with undefined mechanisms (Nishida & Ishihama, 2022; Zhong et al., 2016). In our present study we find that V8 exerts its anti-GBM effect by targeting VCP. V8 is capable of binding to VCP and reducing its ATPase activity in vitro , establishing it as a novel VCP inhibitor. Inhibition of VCP with V8 causes ubiquitinated proteins to form aggregates within cytoplasm and mitochondria, leading to mitophagy and mitochondrial misfolding stress. Meanwhile, VCP inhibition results in lysosomal damage. As a consequence, mitochondria with protein aggregates could not be effectively cleared through mitophagy, promoting the accumulation of damaged mitochondria and the death of GBM cells. Our research thus provides insights into a novel mechanism through which inhibition of VCP function disrupts mitochondrial homeostasis. Targeting VCP could be a potential strategy to against tumors including GBM. VCP was the major target of V8 in GBM cells The impact of V8 on the viability of U87 and T98G cells was evaluated through the MTT assay. U87 and T98G cells were treated with varying concentrations of V8 and for different time periods. The IC50 of V8 at 24 h and 48 h was 14 ±0.5 μm and 8 ±0.4 μm in U87, while they were 16 ±0.5 μm and 9±0.5 μm in T98G, respectively (Fig. 1A-1C) . Annexin-PI staining demonstrated that V8 induced apoptosis in both U87 and T98G cells (Fig. 1D) . The above results suggested that V8 has anti-GBM activity in vitro . In order to identify the targets of V8 in GBM cells, cellular thermal shift assay (CETSA) were performed with the lysate of U87 cells (Tu, Tan, Tao, Li, & Liu, 2023). The proteins stabilized by V8 were determined by liquid chromatography-mass spectrometry (LC-MS) analysis (Fig. 1E and 1F) . The results showed that VCP was significantly enriched after V8 treatment (Table S1) , suggesting that V8 may bind to VCP in GBM cells. Western blot analysis also revealed that the thermal stability of VCP increased in parallel with V8 concentration (Fig. 1G) . To validate the interaction of VCP and V8, VCP proteins were purified and subjected to isothermal calorimetry analysis (ITC). The results showed that the affinity constant (KD) value of V8 and VCP was 1.51E-06, indicating that V8 could interact with VCP with a moderate binding affinity in vitro (Fig. 1H) . Molecular docking analysis indicated that V8 could potentially bind to VCP Arg144, Thr385 (Fig. 1I) . Given that VCP is an ATPase with ATP hydrolysis properties, we performed an ATP hydrolysis assay to test whether V8 affected the ATPase activity of VCP. The results demonstrated that V8 effectively inhibited the capability of VCP in hydrolyzing ATP, similar as the recognized VCP inhibitor NMS873 (Fig. 1J) . It has been shown that inhibition of VCP triggers endoplasmic reticulum (ER) stress (Ballar & Fang, 2008). Accordingly, we found that V8 upregulated the levels of ER stress-related protein, including p-EIF2α, XBP1S, ATF4, BIP, and IRE1 (Fig. 1K) . These findings suggested that V8 bound to VCP and inhibited its ATPase activity. To study the functions of VCP in GBM and its roles in V8-mediated anti-GBM effects, U87 cells were infected with lentivirus to construct cell lines in which VCP was overexpressed or knocked down. The overexpression of VCP in U87 cells rendered GBM cells tolerant to V8, whereas the knockdown of VCP increases the sensitivity of GBM cells to V8 (Fig. 1L and 1M) . In addition, overexpression of VCP alleviated the ER stress levels induced by V8 (Fig. 1N) . These data suggested that V8 inhibited the viability of GBM cells by disrupting the function of VCP. High expression of VCP promoted GBM growth VCP regulates tumor growth by modulating diverse signal transduction pathways (Asai et al., 2002; Yamamoto et al., 2004). Our data also suggested that VCP played important roles in GBM cells. To further investigate the function of VCP in GBM cells, the proliferation rate of established VCP-overexpressing (VCP-OE) and VCP-knockdown (VCP-KD) cell lines was measured. Compared with control cells, VCP overexpression enhanced cell growth. In contrast, knockdown of VCP suppressed cell proliferation (Fig. 2A and 2B) . Similar results were observed in colony formation assays (Fig. 2C and 2D) . Ki67 is a marker of proliferating cell. The proportion of Ki67 positive cells in VCP-OE cells was higher than that in the control cells. However, much less VCP-KD cells expressed Ki67 than control cells (Fig. 2E and 2F) . These results demonstrated that VCP promoted GBM growth. Using the CGGA and GEPIA databases, we found that the expression level of VCP in GBM was higher than that in non-tumor tissues (Fig. 2G) . Additionally, its expression increased as GBM progressed, since WHO Grade IV GBM had the highest expression of VCP (Fig. 2H) . Our analyses also revealed that the expression of VCP was higher in wild-type gliomas than that in gliomas with IDH mutation or 1p/19q codeletion (Fig. 2I,2J and Supporting Information Fig.S1A) . The difference in VCP expression between males and females was not significant, but there was a tendency to upregulate VCP expression as glioma patients aged (age ≥42) (Fig. S1B and S1C) . Patients with higher VCP expression have significantly lower survival rate and disease-free survival rate, particularly in patients with WHO grades III and IV GBM (Fig. 2K and Supporting Information Fig.S1D-S1G) . We validated the expression of VCP in glioma by using a tissue microarray prepared from tumor samples of astrocytoma patients (Fig. 2L) . The results showed that VCP expression increased in tumor tissues compared to normal brain tissues and paraneoplastic tissues (Fig. 2M) , consistent with the analyses of the CGCA and GEPIA databases. The results of the tissue microarray analysis also demonstrated that elevated VCP expression was associated with an increased malignant grade of glioma (Fig. 2N) . These findings highlight that VCP is crucial for GBM progression and could be a therapeutic and prognostic marker for GBM. Dysfunction of VCP triggered the formation of cytoplasmic insoluble aggregates Next, we studied the mechanism by which V8 inhibits GBM cell growth by suppressing the function of VCP. Cellular VCP gradually formed pucta in U87 and T98G cells after V8 treatment over time (Fig. 3A and Supporting Information Fig.S2A) . As the concentration of V8 increased, the formation of VCP puncta in cells was significantly enhanced (Supporting Information Fig.S2B) . VCP is important in regulating the degradation of ubiquitinated proteins. Since inhibition of VCP promoted the formation of VCP puncta in GBM cells, we wondered whether these VCPs were insoluble and what effects were imposed on ubiquitinated proteins. U87 and T98G cells were treated with V8 for 0.5, 1 and 1.5 hours, after which the insoluble proteins were extracted. The results showed that the amount of VCP as well as the ubiquitinated proteins in Triton X-100-insoluble fractions increased over time ( Fig. 3B) . Similarly, the treatment of U87 cells with another inhibitor NMS873 significantly elevated insoluble VCP and ubiquitinated proteins (Supporting Information Fig.S2C) . In consistent, we found that VCP and ubiquitinated proteins became immobilized in cytoplasm in Triton X-100-pre-extracted U87 cells by immunofluorescence (Fig. 3C and 3D) . HSPs, such as HSP70 and HSP90, bind to protein aggregates upon proteotoxic stress (Su & Dai, 2016). We confirmed the co-localication of HSP70 and HSP90 with VCP aggregates in pre-extracted cells (Supporting Information Fig.S2D and Fig. 3E) , indicating that aggregation of VCP triggers a heat shock reaction. When VCP was overexpressed in GBM cells, the insolubility of ubiquitinated proteins induced by V8 was alleviated (Fig. 3F and Supporting Information Fig.S2E) . Conversely, knockdown of VCP increased ubiquitinated proteins in DMSO or V8 treated cells (Supporting Information Fig.S2F) . The overexpression of exogenous VCP also alleviated the aggregation of endogenous VCP protein induced by V8 and NMS873 in U87 (Fig. 3G) . These results indicate that inhibition of VCP leads to the insolubility of VCP and ubiquitinated proteins. Congo red（CR）is a dye commonly used to detect protein aggregates (Ishii et al., 2003). In the present study, we observed more T98G and U87 cells with positive CR-staining after V8 treatment (Fig. 3H) . However, overexpression of VCP attenuated this change caused by V8 (Fig. 3I) . CR not only binds to but also dissemble protein aggregates (Bao, Sarkar, Uyama, & Rubinsztein, 2004). We found that CR exerts a protective effect against V8-induced inhibition in U87 and T98G cells (Supporting Information Fig.S2G) . Simultaneously, CR reduced the levels of insoluble ubiquitinated proteins induced by V8 or NMS873 in U87, but did not affect soluble ubiquitinated protein (Fig. 3J) . Similar results were observed by immunofluorescence analysis (Fig. 3K and Supporting Information Fig. S2H) . Consistently, CR treatment alleviated the ER stress triggered by V8 (Supporting Information Fig.S2I) . These results suggested that CR reduced GBM death by alleviating the formation of insoluble ubiquitinated proteins caused by VCP inhibition. While CR disrupted ubiquitinated protein aggregates, it was unable to dissemble VCP aggregates (Fig. 3L) . The chemical inhibitor of E1 ubiquitin-activating enzyme (MLN7243), which blocks cell ubiquitination, was found to be ineffective in preventing VCP aggregation and cytoplasmic immobilization (Supporting Information Fig. S2J) . This ruled out the possibility that VCP was immobilized by recognizing ubiquitinated substrates. Instead, these VCP aggregates formed upon V8 treatment may be attributed to the inhibition of VCP function, which decreased the mobility of VCP within the cell(Wall et al., 2021). Mitochondria damage and the formation of protein aggregates in mitochondria upon VCP inhibition The above studies demonstrated that VCP inhibition increased cytoplasmic insoluble proteins in GBM cells. Since VCP extracts proteins targeted for degradation from mitochondria and plays an important role in mitochondrial quality control(Ashrafi & Schwarz, 2013), we hypothesized that VCP inhibition would disrupt mitochondrial proteostasis, leading to the formation of aggregates in mitochondria and damaging mitochondria. Immunofluorescence analysis revealed that co-localization of VCP with mitochondria was enhanced after NMS873 and V8 treatment in U87, which was accompanied by an accumulation of ubiquitinated proteins in mitochondria (Fig. 4A-4C and Supporting Information Fig.S3A) . However, CR suppressed the NMS873-induced protein ubiquitination in mitochondria (Fig. 4C) . We then extracted soluble and insoluble mitochondrial proteins from control, V8 or NMS873 treated GBM cells, and found that V8 and NMS873 resulted in an increase in the level of mitochondrial insoluble proteins (Fig. 4D) . Moreover, V8 and NMS873 induced the ubiquitination of mitochondrial insoluble proteins (Supporting Information Fig.S3B) . These changes triggered by V8 and NMS873 can be mitigated by CR treatment or VCP overexpression (Fig. 4E -4H and Supporting Information Fig.S3C-S3F) . These results suggested that CR treatment or VCP overexpression not only alleviated the aggregation of ubiquitinated proteins in the cytoplasm but also those in mitochondria. Accumulating ubiquitinated proteins in mitochonria would cause mitochondrial misfolding stress. We then investigated the impact of VCP inhibition by V8 and NMS873 on mitochondrial function and found that inhibition of VCP induced mitochondrial unfolded protein response (mt-UPR). Several genes increased upon mt-UPR, including heat shock protein family D member 1 (HSPD1), heat shock protein family A member 9 (HSPA9), activating transcription factor 5 (ATF5) and LONP (mitochondrial Lon Protease)(Jin & Youle, 2013; Sutandy, Gößner, Tascher, & Münch, 2023), were upregulated after treatment with V8 and NMS873，suggesting that inhibiting VCP dysregulated mitochondrial homeostasis. (Fig. 4I and 4J) . The levels of mtROS were thus measured in GBM cells after V8 or NMS873 treatment by using Mitosox. It was found that inhibition of VCP caused the accumulation of mtROS (Fig. 4K and 4L) . More importantly, both VCP overexpression and CR reversed the alteration of mtROS levels caused by V8 and NMS873 (Fig. 4L and 4M) . We also investigated the ultrastructure of mitochondria by TEM (transmission electron microscopy) (Fig. 4N) , V8 and NMS873 caused the accumulation of many damaged mitochondria with swollen matrix and vacuoles in U87 cells. These results suggest that VCP plays a pivotal role in maintaining mitochondrial proteostasis, and inhibiting its function leads to mitochondrial dysfunction, increasing mtROS production. VCP dysfunction-induced mitochondrial damage triggered mitophagy Mitophagy, a form of selective autophagy, is dependent on the ubiquitination of mitochondrial proteins, which serves to mark damaged mitochondria for removal. The most common pathway of mitophagy is the PINK1-PRKN signalling pathway, which recognizes damaged mitochondrial and ubiquitinates a large number of mitochondrial proteins (Lazarou et al., 2015; Onishi, Yamano, Sato, Matsuda, & Okamoto, 2021). These ubiquitinated proteins then can be recognized by mitophagy receptors, including P62, TAX1BP1, which bind to LC3 and deliver damaged mitochondria for degradation in lysosomes. Our findings have indicated that inhibiting VCP resulted in mitochondrial damage and the formation of mitochondrial aggregates, which were primarily composed of ubiquitinated proteins. Therefore, we predicted that inhibiting VCP may induce the recruitment of autophagy receptors, and activated the mitophagy pathway. U87 cells were treated with V8 and NMS873 at varying time points, with CCCP as a positive control, and then the mitochondrial proteins were isolated and subjected for western blotting analysis. The results revealed that the levels of VCP, PRKN, BNIP3, P62, and protein ubiquitination in mitochondria increased over time after V8 and NMS873. Interestingly, while mitochondrial PINK1 proteins were upregulated by CCCP at early time point, they were not modulated by either V8 or NMS873 (Fig. 5A and Supporting Information Fig.S4A) . Immunofluorescence also demonstrated that PRKN accumulated on mitochondria after V8 and NMS873 treatment (Fig. 5B and Supporting Information Fig S4B) , but PINK1 did not (Supporting Information Fig.S4C) . Similarly, V8 and NMS873 promoted the localization of mitophagy receptors BNIP3, P62, TAX1BP1, as well as LC3 on mitochondria (Fig. 5C -5F and Supporting Information Fig. S4D) . We confirmed that inhibition of VCP resulted in the occurrence of mitophagy. Furthermore, it has been shown that VCP bound to LC3 on mitochondria to enhance mitophagosome production(Guo et al., 2016). VCP co-localized with LC3 in response to V8 (Supporting Information Fig.S4E) , suggesting that mitochondrial damage upon VCP inhibition also drove mitophagy by directly recruiting LC3 to mitochondria. To find out whether PRKN-mediated protein ubiquitination was involved in V8 and NMS873 induced mitophagy, Immunofluorescence analysis showed that V8 and NMS873 enhanced the co-localization of VCP and PRKN, (Supporting Information Fig. S4F) . We knocked down PRKN with siRNA and found that the level of protein ubiquitination, P62, PRKN and BNIP3 on mitochondria in response to V8 and NMS873 treatment was reduced, but the localization of VCP on mitochondria was not affected (Fig. 5G and Supporting Information Fig.S4G) . suggesting that PRKN was potentially recruited by accumulating VCP on mitochondria rather than PINK1, which further expanded the ubiquitination of mitochondrial proteins and recruited mitophagy receptors after V8 and NMS873 treatment, in which PRKN was a key player. Since CR disintegrated ubiquitination aggregates of mitochondrial, we investigated the impact of CR on mitophagy. We confirmed that CR inhibited the level of BNIP3 and protein ubiquitination on mitochondrial in response to V8 and NMS873 (Supporting Information Fig.S4H) , indicating that CR decreased mitophagy receptors recruitment probabley by disrupting protein aggregates. We investigated the effect of VCP expression levels on mitophagy. Since VCP OE mitigated the effects of V8 on GBM and reduced mitochondrial damage resulted from VCP inhibitor, we checked whether VCP OE could rescue VCP inhibition-activated mitophagy. Overexpression of VCP indeed reduced mitochondrial BNIP3, TAXIBP1, PRKN, aberrant VCP aggregates, and protein ubiquitination after V8 and NMS873 treatment (Fig. 5H ). However, VCP knockdown did not decrease the accumulation of VCP and recruitment of mitophagy receptors on mitochondria induced by V8 and NMS873 (Supporting Information Fig.S4I) . These findings suggested that overexpression of VCP alleviated abnormal protein aggregation and inhibited mitophagy. Inhibiting VCP caused lysosomal damage to block Late mitophagy Previous studies have reported that VCP is involved in CCCP-induced mitophagy. When VCP function is inhibited, mitofusin-2 (MFN2) cannot be degraded normally, thereby blocking mitophagy (McLelland et al., 2018; Mengus et al., 2022). We confirmed that CCCP induced MFN2 degradation. However, the co-treatment with V8 and CCCP resulted in the failure of degrading mitochondrial MFN2 ( Supporting Information Fig.S5A) . However, our study also revealed that co-treatment with CCCP and V8 increased the mitochondrial localization of VCP compared to CCCP treatment alone, which was consistent with V8 treatment alone (Supporting Information Fig. S5B) . In addition, V8 did not influence the mitochondrial level of P62, BNIP3, and LC3 in CCCP-induced mitophagy (Supporting Information Fig. S5C-S5E) . The above studies demonstrated that inhibition of VCP with V8 promoted mitochondrial localization of autophagy receptors and LC3 in the presence of MFN2 during CCCP-induced mitophagy. Thereby, we examined whether inhibiting VCP disturbed the late stage of mitophagy. Immunofluorescence analysis demonstrated that treatment with V8 could induce the co-localization of mitochondria with LAMP2, the marker of lysosome (Fig. 6A) . Lysotracker and Mitotracker dyes were used to label lysosomes and mitochondria, respectively. The results demonstrated that Lysotracker and Mitotraker exhibited strong co-localization in the presence of V8 and NMS873 (Fig. 6B) . These findings suggested that during mitophagy induced by V8 and NMS873, damaged mitochondria could be delivered to lysosomes. To further characterize how VCP inhibition affect mitophagy, the fluorescent protein Mito-keima was employed to track mitophagy flux. During mitophagy, the acidic environment of lysosome causes a change in the excitation wavelength of Mito-keima, shifting from 440 nm to 560 nm(Yamashita & Kanki, 2018). In comparison to the CCCP-induced large red puncta, there was almost no red puncta following the treatment with V8 and NMS873, indicating that mitophagy flux was blocked (Fig. 6C and 6D) . We then detected the process of degradation of the damaged mitochondria by TEM. As shown in Fig. 6E , V8 and NMS873 caused the accumulation of many damaged mitochondria in lysosome，suggesting that the degradation of mitochondria in autolysosome was inhibited. Subsequently, mRFP-GFP-LC3 dual fluorescent fusion proteins were employed to track autolysosome formation. The GFP but not the mRFP fluorescence was quenched in acidic lysosome. (Yamaguchi & Otsu, 2010). Treatment with V8 and NMS873 resulted in a slight up-regulation of the RFP:GFP ratio, which was relatively minor in comparison to the changes caused by CCCP. When V8 or NMS873 were co-treated with CCCP, respectively, they both reversed the effect of CCCP (Fig. 6E and 6F) . these results suggested that inhibition of VCP might disrupt the acidic environment of lysosomes. Thereby, the Lysosensor probe, a pH fluorescent indicator of acidic organelles within the cell, was employed to detect the acidification of lysosomes. The fluorescence intensity of Lysosensor was diminished in the presence of V8 and NMS873, indicative of a disruption in the acidic environment within the lysosomal lumen (Fig. 6G) . To understand how V8 and NMS873 alter lysosome pH, we predicted that these inhibitors could cause lysosomal damage. When the lysosomal membrane is damaged, galectin-3 (Gal3) recognizes the damage and formed puncta on damaged lysosomes, which promotes lysosomal repair (Aits et al., 2015; Jia et al., 2020). Discernible galectin-3 puncta were detected after V8 and NMS873 treatment for 12h in U87 cells stably expressing mAG-galectin-3 (Fig. 6H), suggesting that inhibition of VCP cause a detrimental impact on lysosomal integrity which was consistent with previous report (Arhzaouy et al., 2019). Taken together, inhibition of VCP by V8 and NMS873 activated mitophagy but also damaged lysosomes, impeding mitophagy flux and resulting in the accumulation of damaged mitochondria. GBM growth was inhibited by V8 in vivo Above in vitro studies suggested that GBM required high levels of VCP for cell growth and V8 inhibited GBM cell growth by targeting VCP. To validated these findings, We then investigated the effect of V8 on GBM growth in vivo by subcutaneously inoculating nude mice with U87 cells to establish a cell line-derived xenograft (CDX) model of GBM. When tumor reached 100 mm 3 , the animals were randomly divided into three groups, treated with vehicle, V8, and temozolomide (TMZ) respectively. V8 not only inhibited the growth of U87 cell xenografts and reduced tumor size in vivo, but also had a low toxicity without reducing the body weight of mice (Fig. 7A-7D) . Pre-extraction with Triton X-100 significantly reduced VCP and ubiquitinated proteins in Vehicle-treated tumor tissues, but did not change their levels in V8-treated tumor tissues (Fig. 7E and 7F) , suggesting that VCP was non-extractable in U87 xenografts from mice treated with V8. The intensity of CR staining was higher in the V8-treated tumor tissues than that in the Vehicle-treated samples (Supporting Information Fig S4F) . This suggested the formation of insoluble aggregates after V8 treatment in vivo . Immunofluorescence of tissue sections showed that V8 enhanced the co-localization of LC3, P62, PRKN, and VCP with voltage-dependent anion channel 1 (VDAC1), a mitochondrial marker protein, indicating that V8 induced mitophagy in tumor tissues (Fig. 7G-7J) . The above studies show that V8 disrupted mitochondrial proteostasis, activated mitophagy and inhibited the growth of GBM in vivo . Discussion The present study has demonstrated that VCP is highly expressed in GBM and that VCP expression gradually increases with the malignancy of gliomas. Upregulation of VCP expression has been observed to promote the proliferation of GBM cells. These findings suggest that the expression level of VCP is closely related to the occurrence and development of GBM. Consequently, the development of a new VCP-targeted inhibitor may represent a potential treatment for GBM. V8, which suppress the viability of GBM, has been identified as a potential inhibitor of VCP. When V8 binds to VCP and inactivates its ATPase activity, VCP gradually became insoluble and is unable to extract ubiquitinated proteins which eventually form aggregates. These aggregates are formed in mitochondria, while it is quite possible to observe them in other organelles as well after V8 treatment. Nevertheless, these mitochrondrial aggregates disrupt mitochrondrial proteostasis and structure, trigger mtUPR and promote the production of mtROS. Normally, dysfuntional mitochondria are cleared through mitophagy. Indeed, we noticed that inhibition VCP with V8 and NMS873 activated mitophagy. However, inhibiting VCP also disturbed lysosomal pH, preventing degradation of damaged mitochondria. As a consequence, these aberrantly accumulated mitochondria lead to the demise of glioma cells by releasing excessive ROS. Mitophagy depends on the PINK1-PRKN signalling pathway. PINK recruited PRKN to mitochondria and ubiquitinated mitochondrial proteins during mitophagy (Du, Wang, Xiong, Fang, & Ji, 2021; Lu et al., 2022). However, inhibiting VCP with V8 and NMS873 promoted the mitochondrial localization of PRKN but not PINK1. While we have not clearly revealed the mechanisms yet, we did find that VCP co-localized with PRKN after V8 and NMS873 treatment and overexpression of exogenous GFP-VCP hindered V8 or NMS873-triggered PRKN recruitment to mitochondria. These studies suggested that mitochondrial VCP may directly recruited PRKN to mitochondria independent of PINK1 upon VCP inhibition. Previous studies have also demonstrated that VCP can complement PINK1 deficiency(Kim et al., 2013). Once on mitochondria, PRKN ubiquitinated proteins on mitochondria (Kim et al., 2013). Thereby, it is possible that VCP-PRKN form a positive feedback loop to promote the initiation of mitophagy upon VCP inhibition. VCP has been demonstrated to play a role in mitophagy. By promoting MFN2 degradation, VCP facilitates mitochondrial fission and subsequent mitophagy (McLelland et al., 2018). However, using VCP inhibitors, either V8 or NMS873, we found that mitophagy was activated although MFN2 was not degraded upon VCP inhibition. It is possible that these VCP inhibitors prevented the degradation of ubiquitinated proteins in mitochondria. Massive accumulated ubiquitinated proteins in mitochondria eventually recruited a bunch of mitophagy receptors, including P62 and TAX1BP1, to initiate mitophagy. Previous reports have indicated that VCP facilitates the disassembly of stress granules by mediating the degradation of ubiquitinated G3BP1(Gwon et al., 2021). VCP also participates in the degradation of damaged proteins to maintain mitochondrial function in neuron-like cells under conditions of mitochondrial stress that do not reach the threshold for mitophagic induction or cell death(Fang et al., 2015). In line with these findings, our study has demonstrated that VCP can mitigate the formation of mitochondrial aggregates. However, the precise underlying mechanisms remains to be elucidated. The CDX model of GBM has demonstrated that V8 exerts a pronounced inhibitory effect on the growth of GBM. However, due to the nature of gliomas, it is challenging for the majority of pharmaceutical agents to penetrate through the blood-brain barrier. Consequently, the question of whether V8 can achieve an effective intracerebral concentration across the blood-brain barrier remains unresolved. Following studies will investigate strategies that can effectively deliver V8 into brain to obtain the desired therapeutic concentration. Overall, our present studies suggested that VCP fulfilled a critical role in maintaining mitochondrial homeostasis: On one side, it facilitated the degradation of ubiquitinated mitochondrial proteins, preventing the formation of protein aggregates. On the other side, it kept the integrity of lysosomes, which can digest mitochondria in case damages have occurred. As such, inhibiting VCP resulted in the accumulation of damaged mitochondria which were harmful to the cells，so targeting VCP with V8 could be a potential strategy for GBM treatment. Conclusions In this study, we demonstrated that VCP is highly expressed in GBM cells and that V8, a novel inhibitor of VCP, induces insoluble protein aggregates in the cytoplasm and mitochondria in GBM cells. On the one hand, the damage to mitochondria caused by the inhibition of VCP function activated mitophagy. On the other hand, the inhibition of VCP function caused the damage to lysosomes, leading to the blockage of mitophagy in the late stage. Ultimately, the balance of mitophagy was disrupted, which inhibited the growth of GBM. Materials and methods Reagents V8 (C 24 H 29 NO 7 , purity Pharmaceutical University and was dissolved in DMSO to 0.01 M and stored at −80 °C. NMS873 (C 27 H 28 N 4 O 3 S 2 , MCE) was dissolved in DMSO to prepare a 0.01 M stock solution and stored at −80 °C. CCCP (carbonyl cyanide p-trichloromethoxyphenyl hydrazone, C 9 H 5 ClN 4 , Selleck Chemicals) was dissolved in DMSO to prepare a 0.01 M stock solution and stored at −80 °C. Congo Red (C 32 H 22 N 6 Na 2 O 6 S 2, purity ≥95.0%; MCE) was dissolved in DMSO to prepare a 0.01 M stock solution and stored at −80 °C. Sodium carboxymethyl cellulose (CMC-Na) was dissolved in water to prepare a 0.5%（g/L）solution for animal studies. TMZ (C 6 H 6 N 6 O 2 , purity≥98%, Aladdin) was dissolved in 0.5% CMC-Na. Cell culture The human brain astrocytoblastoma cell U87 was purchase from national collection of authenticated cell cultures. The human glioblastoma cells T98G was purchased from Otwo Biotech. U87 and T98G were maintained in DMEM (Dulbecco’s Modified Eagle Medium; Thermo Fisher Scientific, Gibco™), supplemented with 10% fetal bovine serum (Royacel), Penicillin-Streptomycin (Thermo Fisher Scientific, Gibco™) and cultured in a humidified environment with 5% CO 2 at 37°C. Cell viability assay U87 and T98G cells were seeded in 96-well plates and treated according to the indicated methods. About 7000 cells per well were exposed to increasing concentrations of V8 gradient from 0 to 128μM. Cell viability was measured by MTT (Solarbio Life Sciences, M8180) assay. The absorbance of each well was measured at 570 nm with a SynergyTM HT multimode reader (BioTek, Winooski, VT). The average optical intensity value of three replicates was used to determine the inhibition rate of V8 in U87 and T98G cells. Detection of Mitochondrial reactive oxygen species (MitoROS) generation MitoROS was detected with the Mitochondrial Superoxide Indicator dye MitoSOX Red (MCE) that specifically targets mitochondria in living cells. U87 and T98G cells were cultured in 6-well plates overnight and treated as described. The MitoSOX assay was performed using flow cytometry, with cells collected and analyzed in accordance with the instructions provided by the FACSCalibur flow cytometry instrument (Becton Dickinson). The data presented was the results of the average of three replicates. Colocalization of mitochondria and lysosomes U87 cells were stained with MitoTracker Green (Beyotime) and LysoTracker Red (Beyotime) according to the manufacturer’s instructions, and images were taken using the FV1000 confocal laser scanning biological microscope (Olympus, Tokyo, Japan). Western blot assay Proteins were extracted from T98G and U87, resolved on Tris-glycine acrylamide gels followed by Western blot analysis. Primary antibodies included those against ACTB/β-actin (ABclonal Technology, AC026), VCP(Proteintech, 10736-1-AP), XBP1S (Abcam, ab37152;1:2000), ATF4 (Proteintech, 10835-1-AP), P-EIF2α (Abclonal, AP0692), BiP/GRP78(Abclonal, A23453), IRE(Proteintech,27528-1-AP), K48-linkage Specific Ubiquitin (Abclonal, A3606), PINK1(Proteintech, 23274-1-AP), PRKN (Abways, CY6641), P62(Proteintech, 18420-1-AP),BNIP3(Abclonal, A5683), LC3(Proteintech, 14600-1-AP), COXIV (HUABIO, ET1701-63), TAXIBP1(Proteintech, 14424-1-AP), TUBLIN (Abclonal, A17545), Ubiquitin (Proteintech, 10201-2-AP). Mitochondria protein extraction and detection Mitochondria protein were extracted from U87 cells using the Mitochondria Isolation Kit (Beyotime, C3601) according to the manufacturer’s instructions. siRNA, plasmid extraction,transient transfection and lentivirus infection PRKN small interfering RNA (siRNA) were designed and provided by GenePharma (Shanghai, China). The following siRNA sequences were used: siRNA-PRKN sense: 5ʹ- GCCACGUGAUUUGCUUAGATT -3ʹ siRNA-PRKN antisense: 5ʹ- UCUAAGCAAAUCACGUGGCTT -3ʹ pTagRFP-mito (FP147) was from Evrogen. mRFP-GFP-LC3 (P4838) was from Miaoling Biotechnology. EndoFree Plasmid Midi Kit (CWBIO, CW2015S) was used for plasmid extraction. Plasmids were stored at -20°C. To transfect the plasmids into cells, cells were grown in 6-well plates and when they reach 70-80% confluency, fresh medium was added one hour prior to transfection. GenJet (SignaGen Laboratories, 11668019) was then used to transfect the cells with 1 μg plasmid or 400 pmol siRNA according to the manufacturer’s instructions. GFP-VCP，Sh-VCP and mAG-galectin-3 (Miaoling Biotechnology) were transfected into cells with lentivirus. Lentivirus packaging, infection, and the establishment of stable cell lines were carried out in accordance with the instructions provided by the manufacturer (Yeasen Biotech, 41102ES). Quantitative real-time PCR (RT–PCR) assay RNA was extracted using RNA extraction reagent (Vazyme BioTech, R401-01) followed by reverse transcription. About 0.8 μg of total RNA was used for first-strand cDNA synthesis with a EVO M-MLV RT Mix Kit followed by gDNA cleaning (Accurate biology, AG11728). Real-time PCR was completed on the Applied Biosystems QuantStudio 3 (A28137, ThermoFisher). SYBR Green Premix Pro TaqHS qPCR Tracking kit was purchased from Accurate biology (AG11735). The primer sets used for PCR amplification were as follows: HSPD1-sense: 5ʹ- CGTCTTGAATAGGCTAAAGG-3ʹ HSPD1-antisense: 5ʹ- TGAACGTCTTCAAGATTCAG-3ʹ HSPE1-sense: 5ʹ- TTCTAAAGGAAAGGGTGGAG-3ʹ HSPE1-antisense: 5ʹ- TCAGTCTACGTACTTTCCAAG-3ʹ LONP1-sense: 5ʹ- GAGACCAATATTCCTAAGCG -3ʹ LONP1-antisense: 5ʹ- CTTGATGATCTTTAGCTGCTC -3ʹ HSPA9-sense: 5ʹ- CAATGGGGATACCTTCTTAG -3ʹ HSPA9-antisense: 5ʹ- ATAGGGCAAATTGATGTCAG -3ʹ ATF5-sense: 5ʹ-CATGGAGTCTTCCACTTTC -3 ATF5-antisense: 5ʹ-GGAGTGACATGGCTGTAG -3 GAPDH-sense: 5ʹ- TAGTGGAAGGACTCATGACC-3ʹ GAPDH-antisense: 5ʹ-TCCACCACCCTGTTGCTGTA-3ʹ Xenograft assay All mouse experiments were in compliance with the policies of the SFDA (State Food and Drug Administration) of China on Animal Care. All animals received humane care according to the criteria outlined in the Guide for the Care and Use of Laboratory Animals prepared by the National Academy of Sciences and published by the National Institutes of Health. The null mice which were 5–6 weeks old and weighed 15–20 g were supplied by Slaccas Shanghai Laboratory Animal, China. About 5 × 10 6 U87 cells were injected into mice subcutaneously to produce tumor xenografts. The tumor-bearing mice were randomly divided into three different groups. For conventional evaluation, V8 was administered at a dose of 300 mg/kg (i.g.) once every day. TMZ was administered at a dose of 60 mg/kg (i.g.) once every two days. All mice were fed and sacrificed together after 14 days. Tumor growth was measured every day using a Vernier caliper. Tumor volume was calculated by using the formula: Volume Tumor = (Shortest diameter) 2 × (Longest diameter)/2. Tumor tissues were used for immunohistochemistry and immunofluorescence assays. Congo red (CR) staining The samples were fixed in 4% paraformaldehyde and rinse twice with PBS. The samples were stained with CR methanol solution (0.5 % CR, 80% methanol, 20% glycerol) for 10-20 minutes, and then differentiated with alkaline ethanol solution (Potassium hydroxide, 80% ethanol) for a few seconds, and rinsed with water. Finally, seal the slides with the sealing solution ( Beyotime, C0187). Immunofluorescence staining Cells were fixed with 4% paraformaldehyde for 30 min and then washed 2 times with PBST (0.5% Triton X-100 in PBS) for 10 min. Cells were blocked with 10% goat serum at room temperature for 45 min and incubated overnight with primary antibodies at 4°C. The next day, slides were washed 3 times with PBST, stained with Alexa Fluor™ 488 (Thermo Fisher Scientific, A-11008, A-11010) and Alexa Fluor™ 546 (Thermo Fisher Scientific, A-11001, A-11003) IgG antibodies at room temperature for 45min, and washed 3 times with PBST. Finally, cells were counterstained with DAPI (Biosharp, BL739A). Where indicated, cells were pre-extracted as previous study(Skrott et al., 2017). Briefly, cells were treated with pre-extraction buffer (10 mM PIPES, pH 6.8, 100 mM NaCl, 1.5 mM MgCl 2 , 300 mM sucrose, 0.5% Triton-X 100, 1mM DTT, Protease Inhibitor Cocktail) for 20 minutes at 4°C before fixation, then washed by PBS and fixed with 4% formaldehyde for 20 minutes at room temperature. Immunofluorescence staining was then performed as above. Immunostaining of pre-extracted tissue sections tumor tissues were embedded in OTC. Frozen sections were cut on a cryostat and placed on adhesion slides and air-dried for 1 hours at room temperature. The dried sections were carefully covered with cold extraction buffer (50mM Tris-HCL (pH 7,5), 150mM NaCl, 1mM MgCl 2 , 5% glycerol, 1mM DTT, 1% Triton-X100, 1% IGEPAL, protease inhibitor cocktail) and incubated in 4°C for 20 minutes(Skrott et al., 2017). Sections treated with cold PBS were served as controls. Then Pre-extracted and control sections were gently washed 3 times in cold PBS and fixed in 4% paraformaldehyde for 20 minutes. After washing with PBS for 3 times, sections were then stained with indicated antibodies using the Immunohistochemistry Detection Kit (Proteintech, PK10006). Primary antibodies included those against VCP (Proteintech, 10736-1-AP), Ubiquitin (Proteintech, 10201-2-AP). Cell fractionation for Triton X-100 insoluble proteins Basically, Triton X-100 insoluble proteins were prepared as previous study (Skrott et al., 2017). Briefly, cells were washed with cold PBS and lysed in lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM MgCl 2 , 10% glycerol, 0.5% Triton-X100, protease inhibitor cocktail) for 10 minutes at 4°C with gentle agitation. The cells were then scraped into Eppendorf tubes and kept on ice with intermittent vortex for a further 10 minutes. The lysate was then centrifuged at 20,000G for 10 minutes at 4°C. The insoluble fraction and supernatant was resuspended in 1xLaemmli buffer and detected by Western Blotting. Protein purification and Isothermal Titration Calorimetry (ITC) pT7-GST-VCP (human) plasmid was purchased from Miaoling Biotechnology. The expression of GST-VCP fusion proteins were induced in BL21(DE3) E.coli. by 1 mM IPTG (Life Technologies) for 18 hours at 22°C. To purify GST-VCP proteins, bacterial pellet was resuspended in extraction buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole, 5% glycerol) and lysed by sonication. Supernatant was collected after centrifuging at 14000G for 20 minutes. Proteins were purified by GST Protein Purification Kit (Beyotime, P2260S) according to manufacturer instructions. Purified protein was used in ITC experiments which were carried out with Malvern MicroCal-PEAQ-ITC. All measurements were performed with degassed PBS buffer, pH 7.5 in the presence of 5% DMSO. Injections of 100 μl of V8 (22 μM) was titrated into 300 μl protein (0.5 μM) at 25°C. VCP ATPase activity assay About 500 nM of VCP proteins were dissolved in the assay buffer (50 mM Tris-HCl pH 7.4, 20 mM MgCl2, 0.5 mM DTT) and then treated with DMSO, V8 or NMS873 (final concentration of DMSO was 5%). After 20 minutes of incubation, the reaction was added with ATP (80 μM final concentration) followed by 1 hour incubation at room temperature. When the ATPase activity of VCP was inhibited, ATP cannot be converted to ADP. The remaining ATP was detected by ATP detection kit according to manufacturer instructions (Beyotime, S0026). Annexin V-PI staining Annexin V-FITC/PI apoptosis detection kit (A211-01/02, Vazyme Biotec, Nanjing, China) was used to assess apoptosis. Cells were treated with V8 followed by Annexin V and PI staining according to the instructions. The fluorescence intensities of Annexin V and PI were measured using a flow cytometer (BD Accuri C6 plus). Cellular thermal shift assay U87 and T98G cells were treated with indicated concentrations of V8 and then divided into four groups including DMSO, 5μM, 10μM and 15μM, each containing 3 × 10 7 cells. Cells were resuspended in PBS with added protease inhibitor and subjected to different temperatures for 3 min. After heat treatment, the cells were centrifuged at 14,000g to extract the supernatant protein, which was detected by silver staining and WB. Silver staining and HPLC/MS analysis The protein samples obtained from CETSA were separated in SDS-PAGE gels. Then the polyacrylamide gel was fixed with Fixing solution (50% methanol, 12% acetic acid, 0.05% formaldehyde) for 2h, after which it was washed three times with washing solution (35% ethanol). Following this, the gel was treated with sensitising solution (0.02% sodium thiosulphate) for 2 min, washed three times with distilled water, stained with silver staining solution (0.2% silver nitrate, 0.026% formaldehyde), and finally developed in developing solution (6% sodium carbonate, 0.05% formaldehyde, 0.0004% sodium thiosulphate). The reaction was halted with stop solution (50% methanol, 12% acetic acid). The gel was then cut into strips after silver staining, and sent for HPLC/MS analysis which was provided with Oebiotech. Mitochondrial insoluble fraction analysis Mitochondrial insoluble fractions were prepared as previously described(Sutandy et al., 2023). Briefly, cells were homogenized by passing through a 27-gauge needle syringe in buffer containing 10 mM HEPES (pH 7.4), 50 mM sucrose, 0.4 M mannitol, 10 mM KCl and 1 mM EGTA. Mitochondrial enrichment was performed with a two-step differential centrifugation at 1,000g followed by 13,000g for 15 min each at 4 °C. The mitochondria-enriched pellets were resuspended in a buffer containing 20 mM HEPES (pH 7.4), 0.4 M mannitol, 10 mM NaH 2 PO 4 and 0.5 M EGTA. An equal volume of lysis buffer containing 2% NP40 was added. The solution was centrifuged and the resulting supernatants and pellets were kept as the soluble and insoluble fractions, respectively. Proteins were resolved with SDS–PAGE in 1× Laemmli buffer and visualized with InstantBlue Coomassie stain. Docking analysis Since human and murine VCPs are highly conserved in sequence and structure, the VCP structural model (PDB ID 1R7R) was employed for the purpose of studying V8 interactions. Molecular docking was performed using AutoDock Vina 1.5.6 software to explore protein-ligand interactions. Pymol and Discovery Studio 2019 software2.22 was used to visualization of 2D maps and 3D analysis of interactions between V8 and key residues of VCP. 2.22. Colony formation assay A total of 1,000 cells were inoculated in a 6-well plate and culture in a humidified environment with 5% CO 2 at 37°C to form colonies. The colonies were then fixed with 4% paraformaldehyde for 30–60 minutes and washed once with PBS. Subsequently, crystal violet staining solution was added to each well, and the cells were stained for 10–20 minutes. Finally, the cells were washed with PBS, dried, and photographed with a digital camera. Database and Glioma Tissue Microarray Gene Expression Profiling Interactive Analysis (GEPIA) database (http://gepia.Cancer-pku.cn/index.html) was used to analyze the differential expression of VCP mRNA in GBM and normal tissues, and the relationship between VCP expression and Overall Survival in patients with GBM. The clinical and RNA-seq expression data from the mRNAseq_325 dataset in the CGGA database (http://www.cgga.org.cn/) for follow-up analysis. Commercial GBM Tissue Microarray was purchase from Bioaitech (N783701), which consisted of 34 samples, one case with two points, containing 32 cases of astrocytoma (including 6 cases of grade Ⅰ, 2 cases of grade Ⅰ-Ⅱ, 4 cases of grade Ⅱ, 3 cases of grade Ⅱ-III, 8 cases of grade III, 3 cases of grade III-Ⅳ, and 6 cases of grade Ⅳ), 5 cases of matched paraneoplastic brain tissue, and 2 cases of normal brain tissue. The H-score was used to evaluate the results of immunohistochemical staining of tissue microarrays, taking into account both the proportion of positive cells and the intensity of staining signal. The formula for calculating the H-score was as follows: H-score = Σ (Pi * i), where Pi represents the proportion of positive cells of a given intensity, and i is the intensity of staining, which is typically taken to be 0, 1, 2 or 3. Transmission electron microscopy U87 cells were harvested, washed twice with PBS and fixed in ice-cold Electron Microscope Fixing Agent (SPI Supplies, 111–30-8). The cells were washed three times after centrifugation, and a 1% agarose solution was prepared by heating and dissolving in advance to encapsulate the cells. Cell samples were dehydrated at room temperature after fixation with 1% osmic acid (Ted Pella Inc, 18456) for 2 hours at room temperature protected from light. Osmotic embedding and polymerization were performed using acetone and 812 embedding medium (SPI, 90529-77-4), and embedded blocks were ultrathin sectioned (RMC, PT-PC) and stained. Finally, they were observed under a transmission electron microscope (HITACHI, HT7800) and images were collected for analysis. Statistical analysis Data are presented as the mean± SD from triplicate independent experiments unless otherwise indicated. Data were analyzed by Student’s t-test for comparison between two groups, or analysis of variance (ANOVA) for comparison between more than two groups. P values < 0.05 were considered significant. Reference Aits, S., Kricker, J., Liu, B., Ellegaard, A. M., Hämälistö, S., Tvingsholm, S., . . . Jäättelä, M. (2015). Sensitive detection of lysosomal membrane permeabilization by lysosomal galectin puncta assay. Autophagy, 11 (8), 1408-1424. doi:10.1080/15548627.2015.1063871Aldape, K., Zadeh, G., Mansouri, S., Reifenberger, G., & von Deimling, A. (2015). Glioblastoma: pathology, molecular mechanisms and markers. Acta Neuropathol, 129 (6), 829-848. doi:10.1007/s00401-015-1432-1Arhzaouy, K., Papadopoulos, C., Schulze, N., Pittman, S. K., Meyer, H., & Weihl, C. C. (2019). VCP maintains lysosomal homeostasis and TFEB activity in differentiated skeletal muscle. Autophagy, 15 (6), 1082-1099. doi:10.1080/15548627.2019.1569933Asai, T., Tomita, Y., Nakatsuka, S., Hoshida, Y., Myoui, A., Yoshikawa, H., & Aozasa, K. (2002). VCP (p97) regulates NFkappaB signaling pathway, which is important for metastasis of osteosarcoma cell line. Jpn J Cancer Res, 93 (3), 296-304. doi:10.1111/j.1349-7006.2002.tb02172.xAshrafi, G., & Schwarz, T. L. (2013). The pathways of mitophagy for quality control and clearance of mitochondria. Cell Death Differ, 20 (1), 31-42. doi:10.1038/cdd.2012.81Ballar, P., & Fang, S. (2008). Regulation of ER-associated degradation via p97/VCP-interacting motif. Biochem Soc Trans, 36 (Pt 5), 818-822. doi:10.1042/bst0360818Bao, Y. P., Sarkar, S., Uyama, E., & Rubinsztein, D. C. (2004). Congo red, doxycycline, and HSP70 overexpression reduce aggregate formation and cell death in cell models of oculopharyngeal muscular dystrophy. J Med Genet, 41 (1), 47-51. doi:10.1136/jmg.2003.014548Chu, S., Xie, X., Payan, C., & Stochaj, U. (2023). Valosin containing protein (VCP): initiator, modifier, and potential drug target for neurodegenerative diseases. Mol Neurodegener, 18 (1), 52. doi:10.1186/s13024-023-00639-yDu, Y., Wang, J., Xiong, J., Fang, N., & Ji, W. K. (2021). VPS13D interacts with VCP/p97 and negatively regulates endoplasmic reticulum-mitochondria interactions. Mol Biol Cell, 32 (16), 1474-1486. doi:10.1091/mbc.E21-03-0097Fabian, D., Guillermo Prieto Eibl, M. D. P., Alnahhas, I., Sebastian, N., Giglio, P., Puduvalli, V., . . . Palmer, J. D. (2019). Treatment of Glioblastoma (GBM) with the Addition of Tumor-Treating Fields (TTF): A Review. Cancers (Basel), 11 (2). doi:10.3390/cancers11020174Fang, L., Hemion, C., Pinho Ferreira Bento, A. C., Bippes, C. C., Flammer, J., & Neutzner, A. (2015). Mitochondrial function in neuronal cells depends on p97/VCP/Cdc48-mediated quality control. Front Cell Neurosci, 9 , 16. doi:10.3389/fncel.2015.00016Ferrari, V., Cristofani, R., Tedesco, B., Crippa, V., Chierichetti, M., Casarotto, E., . . . Poletti, A. (2022). Valosin Containing Protein (VCP): A Multistep Regulator of Autophagy. Int J Mol Sci, 23 (4). doi:10.3390/ijms23041939Ganji, R., Paulo, J. A., Xi, Y., Kline, I., Zhu, J., Clemen, C. S., . . . Raman, M. (2023). The p97-UBXD8 complex regulates ER-Mitochondria contact sites by altering membrane lipid saturation and composition. Nat Commun, 14 (1), 638. doi:10.1038/s41467-023-36298-2Guo, X., Sun, X., Hu, D., Wang, Y. J., Fujioka, H., Vyas, R., . . . Qi, X. (2016). VCP recruitment to mitochondria causes mitophagy impairment and neurodegeneration in models of Huntington’s disease. Nat Commun, 7 , 12646. doi:10.1038/ncomms12646Gwon, Y., Maxwell, B. A., Kolaitis, R. M., Zhang, P., Kim, H. J., & Taylor, J. P. (2021). Ubiquitination of G3BP1 mediates stress granule disassembly in a context-specific manner. Science, 372 (6549), eabf6548. doi:10.1126/science.abf6548Iannibelli, E., Gibertini, S., Cheli, M., Blasevich, F., Cavaliere, A., Riolo, G., . . . Maggi, L. (2023). VCP-related myopathy: a case series and a review of literature. Acta Myol, 42 (1), 2-13. doi:10.36185/2532-1900-244Ishii, W., Matsuda, M., Nakamura, N., Katsumata, S., Toriumi, H., Suzuki, A., & Ikeda, S. (2003). Phenol Congo red staining enhances the diagnostic value of abdominal fat aspiration biopsy in reactive AA amyloidosis secondary to rheumatoid arthritis. Intern Med, 42 (5), 400-405. doi:10.2169/internalmedicine.42.400Jia, J., Claude-Taupin, A., Gu, Y., Choi, S. W., Peters, R., Bissa, B., . . . Deretic, V. (2020). Galectin-3 Coordinates a Cellular System for Lysosomal Repair and Removal. Dev Cell, 52 (1), 69-87.e68. doi:10.1016/j.devcel.2019.10.025Jin, S. M., & Youle, R. J. (2013). The accumulation of misfolded proteins in the mitochondrial matrix is sensed by PINK1 to induce PARK2/Parkin-mediated mitophagy of polarized mitochondria. Autophagy, 9 (11), 1750-1757. doi:10.4161/auto.26122Kilgas, S., & Ramadan, K. (2023). Inhibitors of the ATPase p97/VCP: From basic research to clinical applications. Cell Chem Biol, 30 (1), 3-21. doi:10.1016/j.chembiol.2022.12.007Kim, N. C., Tresse, E., Kolaitis, R. M., Molliex, A., Thomas, R. E., Alami, N. H., . . . Taylor, J. P. (2013). VCP is essential for mitochondrial quality control by PINK1/Parkin and this function is impaired by VCP mutations. Neuron, 78 (1), 65-80. doi:10.1016/j.neuron.2013.02.029Lan, B., Chai, S., Wang, P., & Wang, K. (2017). VCP/p97/Cdc48, A Linking of Protein Homeostasis and Cancer Therapy. Curr Mol Med, 17 (9), 608-618. doi:10.2174/1566524018666180308111238Lazarou, M., Sliter, D. A., Kane, L. A., Sarraf, S. A., Wang, C., Burman, J. L., . . . Youle, R. J. (2015). The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature, 524 (7565), 309-314. doi:10.1038/nature14893Leinonen, H., Cheng, C., Pitkänen, M., Sander, C. L., Zhang, J., Saeid, S., . . . Palczewski, K. (2021). A p97/Valosin-Containing Protein Inhibitor Drug CB-5083 Has a Potent but Reversible Off-Target Effect on Phosphodiesterase-6. J Pharmacol Exp Ther, 378 (1), 31-41. doi:10.1124/jpet.120.000486Lu, G., Tan, H. W. S., Schmauck-Medina, T., Wang, L., Chen, J., Cho, Y. L., . . . Shen, H. M. (2022). WIPI2 positively regulates mitophagy by promoting mitochondrial recruitment of VCP. Autophagy, 18 (12), 2865-2879. doi:10.1080/15548627.2022.2052461McLelland, G. L., Goiran, T., Yi, W., Dorval, G., Chen, C. X., Lauinger, N. D., . . . Fon, E. A. (2018). Mfn2 ubiquitination by PINK1/parkin gates the p97-dependent release of ER from mitochondria to drive mitophagy. Elife, 7 . doi:10.7554/eLife.32866Mengus, C., Neutzner, M., Bento, A., Bippes, C. C., Kohler, C., Decembrini, S., . . . Neutzner, A. (2022). VCP/p97 cofactor UBXN1/SAKS1 regulates mitophagy by modulating MFN2 removal from mitochondria. Autophagy, 18 (1), 171-190. doi:10.1080/15548627.2021.1922982Nishida, H., & Ishihama, Y. (2022). One-Step Isolation of Protein C-Terminal Peptides from V8 Protease-Digested Proteins by Metal Oxide-Based Ligand-Exchange Chromatography. Anal Chem, 94 (2), 944-951. doi:10.1021/acs.analchem.1c03722Onishi, M., Yamano, K., Sato, M., Matsuda, N., & Okamoto, K. (2021). Molecular mechanisms and physiological functions of mitophagy. Embo j, 40 (3), e104705. doi:10.15252/embj.2020104705Park, J., Cho, J., & Song, E. J. (2020). Ubiquitin-proteasome system (UPS) as a target for anticancer treatment. Arch Pharm Res, 43 (11), 1144-1161. doi:10.1007/s12272-020-01281-8Pohl, C., & Dikic, I. (2019). Cellular quality control by the ubiquitin-proteasome system and autophagy. Science, 366 (6467), 818-822. doi:10.1126/science.aax3769Skrott, Z., Mistrik, M., Andersen, K. K., Friis, S., Majera, D., Gursky, J., . . . Bartek, J. (2017). Alcohol-abuse drug disulfiram targets cancer via p97 segregase adaptor NPL4. Nature, 552 (7684), 194-199. doi:10.1038/nature25016Su, K. H., & Dai, C. (2016). Metabolic control of the proteotoxic stress response: implications in diabetes mellitus and neurodegenerative disorders. Cell Mol Life Sci, 73 (22), 4231-4248. doi:10.1007/s00018-016-2291-1Sutandy, F. X. R., Gößner, I., Tascher, G., & Münch, C. (2023). A cytosolic surveillance mechanism activates the mitochondrial UPR. Nature, 618 (7966), 849-854. doi:10.1038/s41586-023-06142-0Tang, W. K., Odzorig, T., Jin, W., & Xia, D. (2019). Structural Basis of p97 Inhibition by the Site-Selective Anticancer Compound CB-5083. Mol Pharmacol, 95 (3), 286-293. doi:10.1124/mol.118.114256Tu, Y., Tan, L., Tao, H., Li, Y., & Liu, H. (2023). CETSA and thermal proteome profiling strategies for target identification and drug discovery of natural products. Phytomedicine, 116 , 154862. doi:10.1016/j.phymed.2023.154862Vlachostergios, P. J., Voutsadakis, I. A., & Papandreou, C. N. (2013). The role of ubiquitin-proteasome system in glioma survival and growth. Growth Factors, 31 (3), 106-113. doi:10.3109/08977194.2013.799156Vriend, J., & Klonisch, T. (2023). Genes of the Ubiquitin Proteasome System Qualify as Differential Markers in Malignant Glioma of Astrocytic and Oligodendroglial Origin. Cell Mol Neurobiol, 43 (4), 1425-1452. doi:10.1007/s10571-022-01261-0Wall, J. M., Basu, A., Zunica, E. R. M., Dubuisson, O. S., Pergola, K., Broussard, J. P., . . . Johnson, A. E. (2021). CRISPR/Cas9-engineered Drosophila knock-in models to study VCP diseases. Dis Model Mech, 14 (7). doi:10.1242/dmm.048603Wang, F., Qi, Q., Qin, B., Wang, Y., Huang, Y., Li, Q., . . . Zhang, H. (2023). Targeting VCP potentiates immune checkpoint therapy for colorectal cancer. Cell Rep, 42 (11), 113318. doi:10.1016/j.celrep.2023.113318Yamaguchi, O., & Otsu, K. (2010). Novel in vivo tool to evaluate autophagic activity in the heart. Circ J, 74 (1), 49-50. doi:10.1253/circj.cj-09-0907Yamamoto, S., Tomita, Y., Hoshida, Y., Iizuka, N., Monden, M., Yamamoto, S., . . . Aozasa, K. (2004). Expression level of valosin-containing protein (p97) is correlated with progression and prognosis of non-small-cell lung carcinoma. Ann Surg Oncol, 11 (7), 697-704. doi:10.1245/aso.2004.10.018Yamashita, S. I., & Kanki, T. (2018). Detection of Hypoxia-Induced and Iron Depletion-Induced Mitophagy in Mammalian Cells. Methods Mol Biol, 1759 , 141-149. doi:10.1007/7651_2017_19Zhao, Z., Wu, M., Zhang, X., Jin, Q., Wang, Y., Zou, C., . . . Shen, J. (2020). CB-5083, an inhibitor of P97, suppresses osteosarcoma growth and stem cell properties by altering protein homeostasis. Am J Transl Res, 12 (6), 2956-2967. Zhong, Y., Zhang, Y., Wang, P., Gao, H., Xu, C., & Li, H. (2016). V8 induces apoptosis and the endoplasmic reticulum stress response in human multiple myeloma RPMI 8226 cells via the PERK-eIF2α-ATF4 signaling pathway. Oncol Lett, 12 (4), 2702-2709. doi:10.3892/ol.2016.5005 Fig. legend Fig. 1 VCP was the main target protein of V8 in GBM. (A and B) The growth inhibition effect of V8 on U87 (A) and T98G (B) was assessed by MTT assay at 24 h and 48h. (C) The IC50 values of V8 in U87 and T98G at 24 h and 48 h. (D) The rate of apoptotic cells in U87 and T98G with V8 treatment. Apoptosis was detected in U87 and T98G treated with 20 μM V8 for 24 h. (E) the flowchart of identifying V8-interacting proteins in GBM cells. (F) CETSA was performed and proteins were separated and detected by silver staining in SDS-PAGE gel. Thermal stabilized proteins by increasing concentration of V8 were indicated by arrow. (G) WB-CETSA confirms VCP thermal stabilization by increasing concentration of V8 in U87 and T98G. U87 and T98G were treated with 5, 10, 15 μM V8 for 2 h. Stabilized VCP were detected by western blot. (H) ITC was performed to analyze the binding of V8 and VCP in vitro. (I) Molecular docking of V8 and VCP was analyzed by Autodock software. (J) The ATPase activity of VCP was quantified after the binding of VCP withV8 or NMS873 in vitro. (K) V8 induced ER stress. U87 and T98G cells were treated with 0, 10, 15, 20 μM V8 for 24 h, and the expression of ER stress-related proteins was determined by WB. β-actin served as the loading control. (L and M) The growth inhibitory effect of V8 on knockdown U87 cells (ShVCP) (L) or VCP overexpressing (OE) (M) was assessed by MTT assay at 24 hours. (N) VCP overexpression alleviated V8-induced ER stress. VCP-overexpressing U87 was treated with V8 for 24 h. Expression of ER stress-related proteins was determined by WB; β-actin served as the loading control. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 2 VCP was highly expressed in GBM and promotes GBM growth. (A and B) Cell proliferation rates were examined in VCP overexpressing (A) and knockdown (B) U87 by MTT assay. (C) Colony formation assay was used to detect the proliferative capacity of VCP overexpressing and knockdown U87. (D) Ki67 staining in VCP overexpressing or knockdown U87 cells. (E and F) VCP was enriched in high-grade gliomas. GEPIA and CGGA RNA-seq datasets were analyzed to investigate the expression level of VCP in GBM. (G and H) VCP was higher expressed in wild type gliomas than in IDH mutation and 1p/19q co-deletion gliomas. The expression level of VCP in GBM was analyzed in CGGA RNA-seq dataset. (I) the overall survival rate of patients with VCP high-expression (n=338) and low-expression (n=337) gliomas. (J) Immunohistochemistry (IHC) staining of VCP in human GBM tissue microarray. (K and L) quantification of VCP expression in different grades of glioma, normal brain tissue and paraneoplastic brain tissue in the human GBM tissue microarray. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 3 Dysfunction of VCP triggered formation of protein aggregates. (A) The formation of VCP aggregates in T98G cells treated with V8 for 2, 5, 8, 12, 24 h was observed using confocal microscopy.(B) the distribution of VCP and ubiquitinated proteins in soluble and insoluble fraction in U87 and T98G treated with V8 for 0.5, 1, 1.5 h was analyzed by WB. (C and D) Immunofluorescence was performed to analyze the immobilization of VCP and ubiquitinated proteins in Triton X-100 pre-extracted T98G cells. (E) The colocalization of VCP and HSP70 in U87 cells treated with DMSO and V8, respectively. (F) The distribution of ubiquitinated proteins in the insoluble fraction of VCP-overexpressing U87 treated with V8 for 2 h and 3 h. (G) The distribution of VCP in the soluble and insoluble fraction of VCP-overexpressing U87 treated with V8 for 2 h and 3 h. (H) The protein aggregates in T98G and U87 treated with V8 was stained with CR. (I) VCP-overexpressing U87 treated with V8 was stained with CR to detect protein aggregates. (J) The effect of CR on insoluble ubiquitinated proteins in U87 cells treated with V8 and NMS873 was analyzed by WB. (K and L) Immunofluorescence was performed to analyze the effect of CR on the immobilization of ubiquitinated proteins (K) and VCP (L) after Triton X-100 pre-extraction.Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 4 mitochondrial aggregates was induced by VCP inhibition. (A and B) The localization of VCP (A) and ubiquitinated proteins (B) in mitochondria was observed in U87. U87 cells were transfected with pTagRFP-mito and then treated with V8. (C) The effect of CR on the localization of ubiquitination on mitochondria in U87 treated with indicated chemicals. (D) Gel images of mitochondrial insoluble and soluble proteins upon V8 and NMS873 treatments for 2 h in GBM cells. (E and F) Gel images of mitochondrial insoluble and soluble proteins in control and VCP-overexpressing U87 treated with V8. (G and H) the effects of CR on mitochondrial insoluble and soluble proteins in U87 cells. (I and J) mt-UPR was triggered by VCP inhibition. Quantitative RT-PCR was performed to detect mRNA expression associated with mt-UPR in U87 treated with V8 (E) or NMS873 (D) for 12 h. (K) Mitosox was measured after V8 or NMS873 treatment by flow cytometry. (L) VCP-overexpression reduced the level of mitosox induced by V8 or NMS873. (M) The effect of CR on mitosox after V8 treatment. (N) Detection of mitochondrial ultrastructure by TEM. Black arrow: normal mitochondria. yellow arrow: damaged mitochondria (mitochondria with swelling, broken cristae and vacuolation). Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 5 VCP Dysfunction-induced mitochondrial aggregates initiated mitophagy (A) U87 was treated with CCCP, V8, and NMS873 for 3, 8, 12, 24 h, mitophagy-related proteins on mitochondria were quantified by WB. The indicated protein expression levels were quantified and normalized to COXⅣ. (B-F) The localization of PRKN(B), P62 (C), LC3 (D), BNIP3 (E), and TAXIBP1(F) on mitochondria. U87 were transfected with pTagRFP-mito plasmid and then treated with CCCP, V8, and NMS873 for 8h. (G) The translocation of mitophagy-related proteins onto mitochondria. PRKN was knocked down by siRNA in U87 and then treated with V8, or NMS873 for 8 h. Mitochondrial proteins were extracted and analyzed by WB. The indicated protein expression levels were quantified and normalized to COXⅣ. (H) VCP overexpression inhibited the translocation of mitophagy-related proteins onto mitochondria. The indicated protein expression levels were quantified and normalized to COXⅣ. The above mitochondrial protein samples derive from the same experiment. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 6 Mitophagy flux was blocked upon VCP inhibition. (A) The colocalization of mitochondria and LAMP2 was observed after V8 treatment. U87 were transfected with pTagRFP-mito plasmid and then treated with V8 for 12 h. (B) The colocalization of Lysotraker and Mitotraker in U87 treated with CCCP, V8, and NMS873 for 12 h was observed by confocal microscopy. (C and D) mitophagy flux was tracked by mito-Keima. mito-Keima-U87 were treated with V8 (C) and NMS873 (D) for 12 h with or without CCCP, the fluorescent dots of mito-Keima were observed by fluorescence microscopy. The relative ratio of red to green fluorescence intensity per cell was quantified. (E) Mitochondrial ultrastructure was observed by TEM in U87. Black arrow: normal autolysosome, yellow arrow: aberrantly accumulated mitochondria in autolysosome. The results of Figures 6G and 4N were obtained from the same experiment batch. (F and G) Analysing mitophagy flux with LC3-mRFP-GFP reporter. U87 was transfected with LC3-mRFP-GFP plasmid and then treated with V8 or NMS873 for 12 h, the fluorescent dots of LC3 were observed. The relative ratio of green to red fluorescence intensity per cell was quantified. (H) Lysosenor was used to detect the pH of lysosome in U87 treated with V8 or NMS873 for 24 h, and the fluorescence intensity of lysosenor was quantified by flow cytometry. (I) VCP inhibition disrupted lysosome. mAG-galectin-3-U87 was treated with V8 and NMS873 for 24 h, the fluorescent dots of mAG-galectin-3 were observed by confocal microscopy. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Fig. 7 V8 inhibited GBM growth in vivo. (A-D) The effects of V8 on U87 xenograft in vivo . Mice with U87 cell xenograft were treated with vehicle, V8, or TMZ for 14 days. Mice were sacrificed and tumor volumes (B), tumor weights (C) and body weight (D) were measured. N=6, Two of mices in the TMZ group were cured of their transplanted tumours in the late stage of treatment. (E and F) Immunohistochemical staining documenting non-extractable VCP (E) and ubiquitinated proteins (F) in U87 xenografts from mice treated by V8. Mean density of VCP and UB was quantified by ImageJ. (G-J) Localization of VCP, PRKN, P62 and LC3 on mitochondria in tumor tissues. Tumor tissue was stained with VCP, PRKN, P62, LC3 and VDACI antibodies. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD Figure S1. the expression of VCP in human GBM. (A-C) The co-relation between VCP expression and GBM patients’ age, sex, and the status of 1p/19q codeletion. (D-E) Overall survival probability of GBM patients with high and low VCP expression. The analysis were based on GEPIA dataset (D) and CGGA dataset (E). (F-G) The co-relation of VCP expression and Overall survival probability in Grade III (F) and Grade IV (G) GBM patients. The analysis were based on CGGA dataset. Figure S2. Formation of insoluble protein aggregates induced by VCP dysfunction mediated the anti-GBM effects of V8. (A) The formation of VCP aggregates in U87 cells treated with V8 (15 μm) for 2, 5, 8, 12, 24 h. (B) The formation of VCP aggregates in T98G cells treated with 5, 10, 15 μm V8 respectively. (C) the soluble and insoluble VCP and Ubiquitinated proteins in U87 treated with NMS873 for 0.5, 1, 1.5 h. (D) The colocalization of VCP and HSP90 in U87 cells treated with V8 (15 μm) for 24 h. (E and F) the level of Ubiquitinated proteins in VCP overexpressing (OE) or knockdown cells (ShVCP) after treatment with V8 (15μm). (G) CR (30 μm) ameliorated the growth inhibition effect of V8 in U87 and T98G cells. (H) the effect of CR on the immobilization of Ubiquitinated proteins in U87 cells treated with V8 (15 μm). Immunofluorescence staining was performed in Triton X-100 pre-extracted cells. (I) V8-induced ER stress was inhibited by CR. (J) Inhibiting protein Ubiquitination with MLN7243 did not impact VCP immobilization caused by V8 and NMS873. Immunofluorescence staining was performed in Triton X-100 pre-extracted cells. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Figure S3. Dysfunction of VCP induced formation of mitochondria insoluble ubiquitinated aggregates. (A) NMS873 promoted the translocation of VCP onto mitochondria. U87 were transfected with pTagRFP-mito and then treated with NMS873 (15 μm) for 8h. The localization of mitochondria and VCP was observed in U87 by confocal microscope. the fluorescence intensity was quantified to measure the ratio of mitochondria-located VCP. (B) T98G and U87 was treated with V8 and NMS873 for 2h, mitochondrial insoluble and soluble ubiquitinated protein are detected by WB. (C and D) mitochondrial insoluble and soluble ubiquitinated proteins in control and VCP- overexpressing U87 cells after V8 (D) and NMS873 (E) treatment were detected by WB. (E and F) the effects of CR on mitochondrial insoluble and soluble ubiquitinated protein in U87 cells treated with V8 (E) and NMS873 (F). Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Figure S4. Dysfunction of VCP induced Mitophagy though increasing mitochondrial aggregates. (A) The quantitative results of figure 5A. (B and D) The localization of PRKN and LC3 on mitochondria with V8 treatment. T98G were transfected with pTagRFP-mito plasmid and then treated with V8 (15 μm) for 8h. the fluorescence intensity was quantified to measure the ratio of mitochondria-located PRKN (C) and LC3 (D). (C) The localization of PINK1 on mitochondria in U87 cells with CCCP, V8, and NMS873 treatment. U87 cells were transfected with pTagRFP-mito plasmid and then treated with CCCP (10 μm), V8 (15 μm), NMS873 (5 μm) for 8h. the fluorescence intensity was quantified to measure the ratio of mitochondria-located PINK1. (E) The colocalization of LC3 and VCP in U87 cells. U87 were transfected with LC3-GFP and the treated with V8 (15 μm) for 8h. Ratio of co-localized of LC3 and VCP to LC3 fluorescence intensity was determined by quantifying the intensity of green and red fluorescence. (F) The colocalization of VCP and PRKN in U87 cells treated with V8 (15 μm) for 8 h. (G) knock down of PRKN in U87 with siRNA. cells were treated with V8 (15 μm), NMS873 (5 μm) for 8h, PRKN proteins on cytoplasm are quantified by WB. relative expression levels of PRKN were quantifiedand normalized to TUBULIN. (H) The effects of CR on mitochondrial BNIP3, and Ubiquitinated proteins after V8 treatment. The expression levels of indicated protein were quantified and normalized to COXⅣ. (I) the effects of V8 on mitochondrial VCP, BNIP3, and P62 in control and shVCP cells. The relative expression levels of indicated protein were quantified and normalized to COXⅣ. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Figure S5. VCP inhibition recruited mitophagy receptors without MFN2 degradation. (A and B) The localization of MFN2 (A) and VCP (B) on mitochondria after V8 treatment with or without CCCP. T98G was transfected with pTagRFP-mito plasmid and then treated with 15 μM V8 with or without 10 μM CCCP. The fluorescence intensity of mitochondria, MFN2 and VCP was quantified and used to determine the ratio of mitochondria-localized MFN2 and VCP. (C-E) The translocation of mitophagy receptor BNIP3 (C), and P62 (D), as well as LC3 (E) onto mitochondria after V8 treatment with or without CCCP. U87 was were transfected with pTagRFP-mito plasmid and then treated with 15 μM V8 with or without 10 μM CCCP. (F) CR staining in tumour tissue treated with vehicle and V8. Bar, SD. *P < 0.05 or **P 0.05). Data represent the mean ± SD of 3 independent experiments Supplementary Material File (fig1.pdf) Download 13.37 MB File (fig2.pdf) Download 32.36 MB File (fig3.pdf) Download 49.57 MB File (fig4.pdf) Download 11.22 MB File (fig5.pdf) Download 32.87 MB File (fig7.pdf) Download 13.60 MB File (tables1.xlsx) Download 25.18 KB Information & Authors Information Version history V1 Version 1 21 February 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords apoptosis autophagy cancer and carcinogenesis cancer pharmacology mitochondria Authors Affiliations xuejun cao 0009-0001-5645-789X China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Yishen Li China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Bin Guo China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Yan Liu Baogang Hospital of Inner Mongolia View all articles by this author Baoshuai Wang China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Hao Wang China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Jingbo Lu China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Libin Wei China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Yuan Gao China Pharmaceutical University View all articles by this author Tao Wu [email protected] China Pharmaceutical University School of Basic Medicine and Clinical Pharmacy View all articles by this author Yongjian Guo 0009-0009-8774-6713 China Pharmaceutical University View all articles by this author Metrics & Citations Metrics Article Usage 319 views 64 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation xuejun cao, Yishen Li, Bin Guo, et al. VCP inhibitor suppresses glioblastoma development through inducing the formation of aggregates and disrupting mitochondrial homeostasis. Authorea . 21 February 2025. DOI: https://doi.org/10.22541/au.174013895.54282743/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text {"doi":"10.22541/au.174013895.54282743/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ff67dab3ff3300f',t:'MTc3OTM5NzAxOQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();