Full text
82,744 characters
· extracted from
preprint-html
· click to expand
Disturbed engram network caused by NPTXs downregulation underlies aging-related memory deficits | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Disturbed engram network caused by NPTXs downregulation underlies aging-related memory deficits Tao Jin , Yang Yang , Yu Guo , Yi Zhang , Qiumin Le , Nan Huang , Xing Liu , Jintai Yu , Lan Ma , Feifei Wang doi: https://doi.org/10.1101/2025.05.19.654996 Tao Jin 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yang Yang 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yu Guo 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yi Zhang 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Qiumin Le 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nan Huang 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Xing Liu 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jintai Yu 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lan Ma 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Feifei Wang 1 State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Institutes of Brain Science, School of Basic Medical Sciences, Department of Neurology and National Center for Neurological Disorders, Huashan Hospital, Fudan University , Shanghai 200032, China 2 Research Unit of Addiction Memory, Chinese Academy of Medical Sciences (2021RU009) , Shanghai 200032, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: ffwang{at}fudan.edu.cn Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Engram cells storing specific memories are allocated to separate neuronal ensembles, which preferentially recruit either excitatory or inhibitory inputs to drive precise memory expression. However, how these formed neuronal ensembles maintain their stability, and whether the disturbed stability contributes to aging-related memory deficits remain elusive. Here, we show that neuronal pentraxin1 (NPTX1) facilitates Kv7.2-mediated inhibition of Fos + ensemble hyperexcitability, thereby restricting its response to excitatory inputs from medial entorhinal cortex (MEC) and promoting memory expression in the fear context. Meanwhile, NPTX2 facilitates the perisomatic inhibition of the Npas4 + ensemble by parvalbumin + (PV + ) interneurons, thus preventing fear memory overgeneralization. Pharmacological activation of Kv7.2 or chemogenetic activation of PV + interneurons repaired memory deficits caused by engram specific NPTXs depletion. Contextual fear memory precision and NPTXs expression in dentate gyrus (DG) engram cells are decreased in aged mice. Overexpression of NPTX1 in Fos + ensemble or AMPAR binding domain of NPTX2 in Npas4 + ensemble rescued memory imprecision. These findings elucidate that the coordination of NPTXs prevents engram ensembles from becoming hyperactive and provide a causal link between engram network destabilization and aging-associated memory deficits. Introduction Memories are believed to be encoded in sparse neuronal ensembles (engram cells) that are activated by specific learning experiences 1 , 2 . Neurons recruited to engrams are more stably connected than those that are not 3 . Memory accessibility and precision are shaped by the plasticity of engram network, and require the long-lasting stabilization of the recruited engram network. However, the molecular mechanisms underlying the maintenance of the dormant, but stable engram network remain unknown. In addition, memory precision progressively declines with age, and is considered as one of the predominant hallmarks of aging-associated cognitive dysfunctions 4 , 5 , while it remains to be elucidated how the disturbed engram network leads to aging-related memory deficits. Cell-adhesion molecules (CAMs) are a super family which play an irreplaceable role in synaptic plasticity through mediating the bidirectional organization of synaptic compartments 6 . NPTXs are a subfamily of CAMs primarily expressed in excitatory neurons. NPTXs consist of NPTX1, NPTX2 and their receptor NPTXR 7 . Pre-synaptic secreted NPTX1 and NPTX2 form disulfide-linked heteromultimers with post-synaptic NPTXR to promote the clustering of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) type glutamate receptors (AMPARs) 8 , 9 . Further studies identify NPTX1 functions as a pro-apoptotic protein 10 that restricts excitatory synaptic transmission 11 . In contrast, NPTX2 maintains excitatory homeostasis by adaptively enhancing circuit inhibition 12 , 13 . These findings raise the possibility that NPTX1 and NPTX2 function as the potential molecular substrates for stabilizing the excitatory and inhibitory inputs onto distinct neuronal ensembles. NPTXs are also considered as prognostic biomarkers for neurodegeneration whose expressions are decreased in Alzheimer’s disease (AD), schizophrenia or even mild cognitive impairment (MCI) patients 14 – 16 . However, the causal link between NPTXs reduction-induced engram network destabilization and aging-related memory deficits remain unclear. The tracing of neuronal circuits involved in specific memory formation is enabled by measuring the expression of selectively activated immediate early genes (IEGs). The DG engram cells within the equivalent memory contain functionally divergent Fos + and Npas4 + neuronal ensembles, which drive precise memory expression by recruiting excitatory and inhibitory (E/I) circuits 17 . The expression of NPTX1 and NPTX2 are both abundant in DG 18 . In this study, we found that the maintenance of engram network stability requires NPTX1 and NPTX2 to coordinately stabilize the excitatory inputs to the Fos + ensemble and the inhibitory inputs to the Npas4 + ensemble. Engram network hyperactivity, caused by NPTXs downregulation in DG engram ensembles contributed to aging-related contextual fear memory imprecision, including impaired memory expression in the fear context and overgeneralization in the non-fear context, which was rescued by restoring NPTXs expression in different engram ensembles. Our findings elucidate the critical role of NPTXs in stabilizing the formed engram network by controlling DG excitatory and inhibitory inputs, and establish a causal link between engram network destabilization and aging-associated memory deficits. Results NPTX1 restricts MEC excitatory inputs onto DG F -RAM ensemble Fos and Npas4- dependent robust activity marking ( F -RAM and N -RAM) reporter systems were used to label engram ensembles with mKate2 reporter by off Dox 17 . Npas4-CreER T 2 mice in which the endogenous Npas4 promoter drives the expression of CreER T 2 were generated to label Npas4 + ensembles with EGFP reporter by 4-hydroxytamoxifen (4-OHT) intraperitoneal (i.p.) injection (Figure. S1A-1D). A combination of these two activity-dependent labelling strategies (Figure. S1E) was used simultaneously to label engrams activated by contextual fear conditioning (CFC, 0.5 mA, 1 s, 3 trials). The EGFP + neurons showed substantial overlap with mKate2 + N -RAM ensemble while showed minimal colocalization with mKate2 + F -RAM ensemble (Figure. S1F-1G). These results confirm that Fos + and Npas4 + engram cells in DG labeled by F -RAM and N -RAM reporters are distinct populations. The upstream inputs of F – and N -RAM neuronal ensembles from medial septum (MS), horizontal limb of the diagonal band (HDB), perirhinal cortex (PRh), lateral entorhinal cortex (LEC), medial entorhinal cortex (MEC) and DG were detected by rabies virus (RV) tracing ( Figure 1A - 1B ). F -RAM ensemble formed more connections with MS and MEC, while N -RAM ensemble received more inputs from DG local neurons ( Figure 1C ). The majority of dsRed + neurons in MS were co-labelled with the cholinergic neuron marker choline acetyltransferase (ChAT, Figure 1D - 1E ), and DG F -RAM neurons received more excitatory inputs from MEC than N -RAM neurons ( Figure 1F-1G ). Download figure Open in new tab Figure 1. Rabies virus tracing of the upstream inputs to DG F – and N -RAM neuronal ensembles and the effects of Nptxs depletion on response to MEC excitatory inputs. (A) Diagram of virus injection and experimental scheme to trace upstream inputs of DG F -RAM and N -RAM ensembles. (B) Representative confocal images of DG starter neurons in F -RAM, N -RAM ensembles and their respective upstream inputs. Green: F -RAM or N -RAM engram cells, EGFP, Purple: dsRed, Blue: DAPI. White arrows indicate the starter neurons and DG local inputs. Scale bar: top left, 50 μm, top right, 10 μm, bottom, 100 μm. (C) The percentages of total inputs from each upstream site relative to total quantified inputs. (D) Representative confocal images of upstream MS dsRed + cells immunostaining with ChAT. Green: ChAT, Purple: dsRed, Blue: DAPI. White arrows indicate the colocalized cells. Scale bar: 10 μm. (E) The percentages of colocalized cells in MS total dsRed + cells. (F) Representative confocal images of upstream MEC dsRed + cells immunostaining with glutamate. Green: glutamate, Purple: dsRed, Blue: DAPI. White arrows indicate the colocalized cells. Scale bar: 5 μm. (G) The percentages of colocalized cells in MEC total dsRed + cells. (H) Diagram of AAV injection, experimental scheme and representative expression of ChR2 in MEC projection neurons and DG engram cells. Green: F -RAM engram cells of Nptx1 and Nptx2 cKO mice, EGFP, Purple: MEC projections, mCherry, Blue: DAPI. Scale bar: 50 μm. (I, K) Representative traces of oEPSC recorded from WT and Nptxs cKO mice. (J) The quantification of oEPSC amplitudes recorded from WT and Nptx1 cKO mice. (L) The quantification of oEPSC amplitudes recorded from WT and Nptx2 cKO mice. Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01, *** P < 0.001. NPTXs were found to be predominantly involved in E/I synaptic homeostasis rather than cholinergic signaling 9 , 19 . To test whether NPTXs modulate the stability of the synaptic transmission between MEC and DG Fos + ensemble, Nptx1 fl/fl , Nptx2 fl/fl conditional knockout ( Nptx1 cKO, Nptx2 cKO) mice were generated (Figure S2A-2B). Ribosome-associated transcripts of F -RAM and N -RAM ensembles were enriched from Nptxs cKO mice and their WT littermates (Figure S2C-2D), and qPCR against Nptx1 exon 3 and Nptx2 exon 2 was performed to confirm the knockout efficiency in F- or N- RAM ensembles. Nptx2 expression was unaffected when Nptx1 was depleted and vice versa (Figure S2E-2L). Immunostaining of NPTX1 and NPTX2 further confirmed the knockout efficiency in DG engram ensembles (Figure S3). AAV-CaMKIIα-ChR2-mCherry was then injected into MEC of Nptx1 cKO, Nptx2 cKO mice and their WT littermates, and the virus mixture of AAV-F-RAM-Cre with Cre recombinase-dependent AAV-DIO-H2B-EGFP was injected into DG to knock out Nptxs in Fos + ensemble. Opto-evoked excitatory post-synaptic currents (oEPSCs) from MEC were recorded on EGFP - ( F -RAM - ) and EGFP + ( F -RAM + ) cells ( Figure 1H ). The amplitude of oEPSCs on EGFP + cells was larger in the Nptx1 cKO group ( Figure 1I-1J ), whereas this effect was not found in the Nptx2 cKO mice ( Figure 1K - 1L ). These data indicate that NPTX1 plays an important role in dampening the excitatory synaptic transmission between MEC and DG Fos + ensemble. NPTX1 facilitates I M current and membrane expression of Kv7.2 in DG F -RAM ensemble Action potential (AP) recordings were performed to examine whether neuronal excitability of the engram ensembles was changed after Nptxs knockout ( Figure 2A-2C ). F -RAM engram cells lacking Nptx1, but not Nptx2, exhibited upward shift of the neuronal spiking curve after step-increment current injections, lower resting membrane potential (RMP) and rheobase ( Figure 2D - 2K ), indicating increased excitability of F -RAM engram cells after Nptx1 knockout. KCNQ2 (Kv7.2) pairs with the KCNQ3 (Kv7.3) subunit to form KCNQ2/3 heterotetramers, which are the primary molecular substrate of M-current ( I M ) involved in regulating neuronal excitability 20 , 21 . Application of the KCNQ2/3-selective blocker XE991 resulted in a reduction of I M amplitude on DG F -RAM engram cells ( Figure 2L - 2M ). Nptx1 depletion exerted the similar inhibitory effect of XE991 on I M amplitude ( Figure 2N - 2O ). Co-immunoprecipitation (Co-IP) of the DG lysate confirmed the interaction between NPTX1 and Kv7.2 ( Figure 2P ). Immunostaining analysis further revealed that Nptx1 ablation decreased Kv7.2 membrane expression in F -RAM engram cells ( Figure 2Q - 2R ), which was not observed in Nptx2 cKO group ( Figure 2S - 2T ). Taken together, these results indicate that NPTX1 restrains the excitatory synaptic transmission between MEC and DG Fos + ensemble by facilitating Kv7.2 membrane expression-mediated inhibition of neuronal hyperexcitability. Download figure Open in new tab Figure 2. The effects of Nptx1 or Nptx2 depletion on engram excitability and membrane expression of Kv7.2. (A) Diagram of AAV injection. (B) Experimental scheme to label F -RAM, N -RAM engram ensembles. EPS: Electrophysiology, IHC: Immunohistochemistry. (C) Representative expression of F -RAM engram cells in DG of Nptx1 and Nptx2 cKO mice. Green: F -RAM engram cells of Nptx1 and Nptx2 cKO mice, EGFP, Blue: DAPI. Scale bar: 20 μm. (D, H) Representative AP traces induced by depolarizing current injections (100 pA) recorded from WT and Nptxs cKO mice. (E) The input-output curves of AP spikes versus injected currents of WT and Nptx1 cKO mice. (F) The RMP of WT and Nptx1 cKO mice. (G) The rheobase of WT and Nptx1 cKO mice. (I) The input-output curves of AP spikes versus injected currents of WT and Nptx2 cKO mice. (J) The RMP of WT and Nptx2 cKO mice. (K) The rheobase of WT and Nptx2 cKO mice. (L) Representative traces of I M current recorded before and after application of XE991. (M) The normalized I M current recorded at –30 mV before and after application of XE991. (N) Representative traces of I M current recorded from WT and Nptx1 cKO mice. (O) The average I M current amplitudes recorded at –30 mV from WT and Nptx1 cKO mice. (P) Immunoblotting of NPTX1 co-immunoprecipitates with Kv7.2 in DG. (Q, S) Representative confocal images of engram cells colocalizing with Kv7.2. Green: F -RAM engram cells, EGFP, Purple: Kv7.2, Blue: DAPI. Dashed white lines outline cell membrane. Scale bar: 5 μm. (R) The quantification of membrane Kv7.2 fluorescence intensity of WT and Nptx1 cKO neurons. (T) The quantification of Kv7.2 fluorescence intensity of WT and Nptx2 cKO neurons. Data are presented as mean ± S.E.M; ** P < 0.01, *** P < 0.001. NPTX2 in N -RAM ensemble facilitates the perisomatic inhibition by PV + interneurons in DG Rabies tracing confirmed N -RAM ensemble received more inputs from DG local neurons ( Figure 1C ), leading us to wonder whether NPTX2 was specifically involved in Npas4 + engram-DG local neuron synaptic connection. Immunostaining showed that parvalbumin + (PV + ) and somatostatin + (SST + ) interneurons, two major subtypes of GABAergic interneurons in DG 22 that separately target perisomatic compartments and distal apical dendrites of granule cells 23 were both recruited by DG Fos + and Npas4 + engram cells after CFC. However, Npas4 + engram cells received more PV + but not SST + inputs in DG ( Figure 3A - 3B , Figure S4A-4B). Download figure Open in new tab Figure 3. The effects of Nptx2 depletion on the functional connection between DG local PV + interneurons and N -RAM ensemble. (A) Representative confocal images of DG local dsRed + cells immunostaining with PV. Green: EGFP, Purple: dsRed, Yellow: PV, Blue: DAPI. White arrows indicate the dsRed + PV + colocalized cells. Scale bar: 5 μm. (B) The percentages of colocalized cells in DG total PV + cells. (C) Diagram of AAV injection and experimental scheme to label N -RAM engram ensembles. (D) Diagram of representative expression of engram cells and PV + interneurons. Green: N -RAM engram cells of Nptx1 and Nptx2 cKO mice, EYFP, Purple: PV + interneurons, mCherry, Blue: DAPI. Scale bar: 10 μm. (E, G) Representative traces of opto-evoked AMPA-EPSC and NMDA-EPSC recorded from WT and Nptxs cKO mice. (F) The average A/N ratio recorded from WT and Nptx1 cKO mice. (H) The average A/N ratio recorded from WT and Nptx2 cKO mice. (I, J) The average AMPA-EPSC and NMDA-EPSC amplitudes recorded from WT and Nptx2 cKO mice. (K) Representative confocal images of GluA4 colocalizing with PV + interneurons. Green: N -RAM engram cells, Purple: PV + interneurons, Yellow: GluA4. Scale bar: 10 μm. (L) The quantification of GluA4 membrane expression on PV + interneurons in WT and Nptx2 cKO mice. (M) Diagram of AAV injection and experimental scheme to label N -RAM engram ensemble. (N) Diagram of photostimulation and whole-cell patch clamp recordings (left) and representative expression of N -RAM engram cells and PV + interneurons (right). Green: N -RAM engram cells, EGFP, Purple: PV + interneurons, mCherry, Blue: DAPI. Scale bar: 20 μm. (O, Q) Representative traces of opto-evoked PPR and oIPSC recorded from Scramble and Nptx2 shRNA neurons. (P, R) The quantification of PPR and oIPSC amplitudes recorded from Scramble and Nptx2 shRNA neurons. Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01, *** P < 0.001. To test the involvement of NPTX2 in the synaptic transmission between N -RAM ensemble and DG interneurons, the viral mixture of AAV-N-RAM-Cre, AAV-DIO-ChR2-EYFP, AAV-PV/SST-Flp and Flp recombinase-dependent AAV-fDIO-mCherry was injected into DG of Nptx1 cKO, Nptx2 cKO mice and WT littermates. The specificity of AAV-SST-Flp and AAV-PV-Flp was confirmed by immunostaining with anti-SST and anti-PV antibodies (Figure S4C-4D, Figure S5A). Opto-evoked paired-pulse ratio (PPR) and AMPAR/N-methyl-D-aspartate receptor (NMDAR) (A/N) ratio were recorded on SST + or PV + interneurons according to mCherry expression, morphology and location ( Figure 3C - 3D , Figure S4E-4F). Nptxs depletion in N -RAM ensemble reduced pre-synaptic glutamate release (Figure S4G-4H, S4K-4L, Figure S5B-5E,), consistent with previous studies that NPTXs family promotes pre-synaptic glutamate release 19 , 24 . Nptx2 knockout in N -RAM ensemble exerted no effect on A/N ratio of SST + interneurons (Figure S4I-4J, S4M-4N), whereas Nptx2, but not Nptx1 depletion in N -RAM ensemble significantly decreased AMPAR-mediated EPSC and A/N ratio on PV + interneurons ( Figure 3E - 3J ). Previous studies found that NPTX2 binds AMPAR subunit GluA4 on PV + interneurons to regulate network excitatory/inhibitory balance 12 , 25 . Immunostaining confirmed that Nptx2 depletion in N -RAM ensemble decreased the expression of GluA4 on PV + interneurons ( Figure 3K - 3L ). To examine whether NPTX2-dependent plasticity applies to GABAergic CCK + cells, the viral mixture of AAV-N-RAM-Cre, AAV-DIO-ChR2-EYFP with AAV-vGAT2-Flp -dependent expression of AAV-CCK-fDIO-mCherry was injected into DG of WT and Nptx2 cKO mice to label the GABAergic CCK + cells (Figure S6A-6C). Opto-evoked PPR and A/N ratio were recorded on mCherry + interneurons, and no differences were detected after Nptx2 depletion in N -RAM ensemble (Figure S6D-6G). These data suggest that NPTX2-dependent interneuron plasticity was specific to PV + interneurons. The disturbed PV + interneuron plasticity caused by Nptx2 depletion led us to speculate whether the inhibitory inputs received by N -RAM ensemble was also affected. A viral mixture of AAV-fDIO-ChR2-mCherry , AAV-N-RAM-Cre and AAV-Flex-EGFP-Nptx2 shRNA (Nptx2 sh) was injected into DG of PV-Flpe mice, and opto-evoked inhibitory post-synaptic currents (oIPSCs) and PPR were recorded on N -RAM cells ( Figure 3M-3N ). The increased PPR in the Nptx2 shRNA group indicates the reduction of pre-synaptic γ-aminobutyric acid (GABA) release from PV + interneurons ( Figure 3O - 3P ), leading to the reduced inhibition Npas4 + engram cell received ( Figure 3Q - 3R ). Taken together, these data indicate that NPTX2 facilitates the inhibitory synaptic transmission between DG Npas4 + engram cells and PV + interneurons by the AMPAR-dependent mechanism. NPTX1 in DG F os + ensemble and NPTX2 in DG Npas4 + ensemble facilitate the precise expression of contextual fear memory To investigate the involvement of NPTXs-dependent maintenance of engram network stability on behavioral outputs, the viral mixture of AAV-F-RAM-Cre or AAV-N-RAM-Cre combined with AAV-DIO-EYFP was injected into DG of young Nptx1 cKO, Nptx2 cKO mice and their respective WT littermates. Mice were tested on day 3 in context A and context C after fear conditioning ( Figure 4A - 4C , 4H-4J). The freezing level during conditioning was not different between Nptx1 cKO, Nptx2 cKO mice and their WT littermates (Figure S7A-7D). Interestingly, Nptx1 depletion in F -RAM ensemble decreased freezing in context A ( Figure 4D - 4E ), whereas Nptx2 depletion in F -RAM neuronal ensemble caused no differences in freezing level in both contexts ( Figure 4F-4G ). Nptx1 knockout in DG N -RAM ensemble did not affect the freezing level in either context ( Figure 4K - 4L ), whereas Nptx2 knock out in DG N -RAM ensemble increased the freezing level in the non-fear context C on day 3, indicating overgeneralization of contextual fear memory ( Figure 4M - 4N ). Download figure Open in new tab Figure 4. The effects of Nptxs depletion in F -RAM and N -RAM ensembles on the expression of contextual fear memory. (A, H, O) Diagram of AAV injection. (B, I, P) Experimental scheme of CFC and memory retrieval. (C, J, Q) Representative expression of F – and N -RAM engram cells in DG. Green: F -RAM or N -RAM ensemble, EYFP, Blue: DAPI. Scale bar: 100 μm. (D, E) The freezing percentage and discrimination index of WT and Nptx1 cKO mice tested in context A and context C at day 3 ( F -RAM). (F, G) The freezing percentage and discrimination index of WT and Nptx2 cKO mice tested in context A and context C at day 3 ( F -RAM). (K, L) The freezing percentage and discrimination index of WT and Nptx1 cKO mice tested in context A and context C at day 3 ( N -RAM). (M, N) The freezing percentage and discrimination index of WT and Nptx2 cKO mice tested in context A and context C at day 3 ( N -RAM). (R, S) The freezing percentage and discrimination index of WT and Nptx1 cKO mice tested in context A and context C at day 3 ( F -RAM). (T, U) The freezing percentage and discrimination index of WT and Nptx2 cKO mice tested in context A and context C at day 3 ( N -RAM). Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01. In addition, when mice were exposed to a novel context (context N) quite different with context A or context C, Nptx1 or Nptx2 was knocked out in randomly labeled F -or N -RAM neurons ( Figure 4O - 4Q ), and no differences in freezing were found between Nptxs cKO and WT controls (Figure S7E-7F, Figure 4R - 4U ), indicating the fear context-specific effect of Nptxs . Moreover, Nptxs depletion in both ensembles had no effect on mice’s locomotion, anxiety or depression levels (Figure S8-S10). Taken together, these data suggest that the precise expression of contextual fear memory, including high freezing level in the fear context but low freezing level in the non-fear context requires the coordination of NPTX1 and NPTX2 functioning in distinct ensembles. Pharmacological activation of Kv7.2 or chemogenetic activation of PV + interneurons ameliorates memory deficits induced by NPTXs depletion in DG engrams The Kv7.2 activator retigabine, a clinically used anticonvulsant 26 , was i.p. injected 30 min before mice were tested in the fear context A and non-fear context C ( Figure 5A-5C ). Retigabine had no effect on the freezing level of WT mice in either context, whereas it restored the reduced freezing level in context A when NPTX1 was depleted in F -RAM ensemble but not in N -RAM ensemble ( Figure 5D - 5G , Figure S11A-11B). To rescue memory overgeneralization induced by Nptx2 knockout in N -RAM ensemble, the designer receptors exclusively activated by designer drugs (DREADDs) were used to activate PV + interneurons. The viral mixture of AAV-N-RAM-Cre , AAV-Flex-EGFP-Nptx2 shRNA and AAV-fDIO-hM3Dq-mCherry was injected into the DG of PV-Flpe mice and clozapine N-oxide (CNO) was administrated by i.p. injection 30 min before the mice were tested in context A and context C ( Figure 5H - 5J ). Chemogenetic activation of local DG PV + interneurons had no effect on the freezing level of control group infected with Scramble shRNA , while it reduced the freezing level of mice in context C when Nptx2 was knocked down in N -RAM ensemble instead of F -RAM ensemble ( Figure 5K - 5N , Figure S11C-11D). Download figure Open in new tab Figure 5. The effects of activating Kv7.2 or DG PV + interneurons on memory deficits induced by Nptxs depletion in DG engram ensembles. (A, H) Diagram of AAV injection. (B, I) Experimental scheme of memory retrieval test. (C) Representative images of F – and N -RAM engram cells in DG. Green: F -RAM and N -RAM ensembles, EYFP, Blue: DAPI. Scale bar: 100 μm. (D, E) The freezing percentage and discrimination index of WT-Vehicle, WT-Retigabine, Nptx1 cKO-Vehicle and Nptx1 cKO-Retigabine mice ( F -RAM). (F, G) The freezing percentage and discrimination index of WT-Vehicle, WT-Retigabine, Nptx1 cKO-Vehicle and Nptx1 cKO-Retigabine mice ( N -RAM). (J) Representative images of F – and N -RAM engram cells in DG. Green: F -RAM and N -RAM ensembles, EGFP, Purple: PV + interneurons, mCherry, Blue: DAPI. Scale bar: 100 μm. (K, L) The freezing percentage and discrimination index of Scramble -mCherry, Scramble -hM3Dq, Nptx2 sh -mCherry and Nptx2 sh -hM3Dq groups ( F -RAM). (M, N) The freezing percentage and discrimination index of Scramble -mCherry, Scramble -hM3Dq, Nptx2 sh -mCherry and Nptx2 sh -hM3Dq groups ( N -RAM). Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01. Downregulation of Nptxs in DG engrams in aged mice Maladaptive changes in the expression of functional synaptic protein leading to neuronal network destabilization and cognitive impairment, are central hallmarks associated with physiological brain aging 27 . NPTXs are considered as biomarkers of synaptic dysfunction and cognitive impairment 7 , 16 . To investigate whether Nptxs expression in DG changes during physiological aging, young (3m) and aged (18m) mice were sacrificed 15 min, 30 min, 60 min and 120 min after CFC or under homecage (HC) condition, smFISH was used to assess their mRNA expression ( Figure 6A - 6D , S12A-12D). Download figure Open in new tab Figure 6. Nptxs expression in DG engram cells and contextual fear memory in young and aged mice. (A, B) Representative confocal images of Nptx1 colocalizing with Fos under HC condition and 30 min after CFC in DG of young and aged mice. Green: Nptx1 , Purple: Fos , Blue: DAPI. White arrows indicate the colocalized cells. Scale bar: top, 30 μm, bottom, 10 μm. (C, D) Representative confocal images of Nptx2 colocalizing with Npas4 under HC condition and 30 min after CFC in DG of young and aged mice. Green: Nptx2 , Purple: Npas4 , Blue: DAPI. White arrows indicate the colocalized cells. Scale bar: top, 30 μm, bottom, 10 μm. (E) The fluorescence intensity of overall Nptx1 mRNA in DG. (F) The fluorescence intensity of Nptx1 mRNA in Fos + ensemble at HC, 15 min, 30 min, 60 min and 120 min after CFC. (G) The Nptx2 + cell counts in DG. (H) The fluorescence intensity of Nptx2 mRNA in Npas4 + ensemble at HC, 15 min, 30 min, 60 min and 120 min after CFC. (I, J) Experimental scheme of CFC to test memory expression. (K, M) The freezing percentages of young and aged mice. (L, N) The discrimination indexes of young and aged mice. Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01, *** P < 0.001. Fos + and Npas4 + cell numbers after CFC were decreased in the DG of aged mice, especially at 30 and 60 min, indicating decreased activation of neurons during learning in aged mice (Fig S12E-12F). Nptx1 was expressed in all DG granule cells, although the overall Nptx1 + fluorescence intensity was not significantly decreased in aged mice ( Figure 6E ), the specific expression of Nptx1 in Fos + and Npas4 + engram cells were reduced ( Figure 6F , Figure S12G). NPTX2 was also seen as a neuronal IEG protein 14 , both Nptx2 + cell numbers and the average fluorescence intensity of Nptx2 mRNA in Fos + and Npas4 + engram cells were decreased in aged mice ( Figure 6G - 6H , Figure S12H). These findings indicate the downregulation of Nptx1 and Nptx2 in Fos + and Npas4 + engram cells in aged mice. The expression of contextual fear memory in young and aged mice were further assessed. When exposed to strong fear conditioning (0.5 mA, 1 s, 3 trials), aged mice froze more in the non-fear context C, suggesting memory overgeneralization ( Figure 6I , 6K-6L). However, when exposed to mild fear conditioning (0.3 mA, 1 s, 1 trial), aged mice froze less in the fear context A ( Figure 6J , 6M-6N), suggesting memory retrieval impairment. These results demonstrate that aging impairs the precise expression of contextual fear memory. NPTXs overexpression in DG engrams rescued memory deficits in aged mice Consistent with the decreased number of Fos + and Npas4 + cells in DG after CFC, the number of cells labelled by the F – and N -RAM systems were both reduced in DG of aged mice (Figure S12I-12J). Ribosome-associated transcripts of F -RAM and N -RAM ensembles activated in the home cage or by CFC were analyzed (Figure S13A). Gene ontology (GO) analysis revealed clusters of differentially expressed genes (DEGs) related to synaptic plasticity and cell communication between F -RAM and N -RAM ensembles, which were more significant after CFC (Figure S13B). In addition, a minority of DEGs overlapped between F – and N -RAM ensembles during aging (Figure S13C-13D). DEGs in F -RAM during aging were preferentially enriched in pathways regulating neuronal excitability, including membrane potential and potassium ion import, whereas DEGs in N -RAM during aging were preferentially enriched in AMPAR-mediated glutamatergic transmission and others (Figure S13E), suggesting different pathways involved in engram network plasticity during aging between F – and N -RAM ensembles. Decreased Kv7.2 membranes expression on c-Fos + engram cells ( Figure 7A - 7B ) and NPTX1-Kv7.2 interaction in DG ( Figure 7C - 7D , S14A) were observed in aged mice. AAV-DIO-Nptx1-EYFP was constructed to overexpress NPTX1 in a Cre-dependent way (Figure S14B). Aged mice were subjected to the mild fear conditioning protocol (0.3 mA, 1 s, one shock). Overexpression of NPTX1 in F -RAM ensemble, but not in N -RAM ensemble increased the freezing level of aged mice in the fear context A ( Figure 7E - 7K , Figure S14C-14D). Decreased GluA4 expression on PV + interneurons and PV + fluorescence intensity surrounding Npas4 + engram cells were observed in aged mice ( Figure 7L - 7O ), which are consistent with the phenotype of Nptx2 depletion in young mice ( Figure 3 ). Aged mice overexpressing the AMPAR binding domain of NPTX2 (NPTX2-PTX) 18 in N -RAM ensemble, but not in F -RAM ensemble rescued overgeneralization in context C during retrieval ( Figure 7P - 7V , Figure S14E-14F). However, overexpression of NPTX1 and NPTX2-PTX in young mice had no effect on freezing levels when tested in either context A or context C (Figure S15). These data confirm that DG engram network hyperactivity caused by NPTXs downregulation underlies aging-associated memory imprecision, and that re-stabilization of NPTX1-dependent MEC- Fos + engram excitatory circuit and NPTX2-dependent DG PV + interneuron- Npas4 + engram inhibitory circuit is able to repair memory deficits in aged mice. Download figure Open in new tab Figure 7. Overexpression of NPTXs in DG engram ensembles rescued memory imprecision in aged mice. (A) Representative confocal images of c-Fos + cells colocalizing with Kv7.2. Green: c-Fos + engram cells, Purple: Kv7.2, Blue: DAPI. Dashed white lines outline cell membrane. Scale bar: 5 μm. (B) The average membrane Kv7.2 fluorescence intensity of c-Fos + neurons in young and aged mice. (C) Immunoblotting of NPTX1 co-immunoprecipitates with Kv7.2 in DG of young and aged mice. (D) The quantification of IP-Kv7.2 in young and aged mice. (E, P) Diagram of AAV injection. (F, Q) Experimental scheme of memory retrieval test. (G, R) Representative expression of NPTX1 or NPTX2-PTX in F -or N -RAM engram cells in DG. Green: F -RAM or N -RAM ensemble, EYFP or EGFP, Blue: DAPI. Scale bar: 100 μm. (H, I) The freezing percentage and discrimination index of EYFP and Nptx1 aged groups ( F -RAM). (J, K) The freezing percentage and discrimination index of EYFP and Nptx1 aged groups ( N -RAM). (L) Representative confocal images of GluA4 colocalizing with PV + interneurons. Green: PV + interneurons, Purple: GluA4. Scale bar: 10 μm. (M) The quantification of GluA4 membrane expression on PV + interneurons in young and aged mice. (N) Representative confocal images of PV neurites around Npas4 + engram cells. Green: Npas4 + engram cells, Purple: PV, Blue: DAPI. Dashed white lines outline PV neurites. Scale bar: 5 μm. (O) The average fluorescence intensity of PV neurites around Npas4 + neurons in young and aged mice. (S, T) The freezing percentage and discrimination index of EGFP and Nptx2-PTX aged groups ( F -RAM). (U, V) The freezing percentage and discrimination index of EGFP and Nptx2-PTX aged groups ( N -RAM). Data are presented as mean ± S.E.M; * P < 0.05, ** P < 0.01, *** P < 0.001. Discussion Contextual learning activates distinct Fos + and Npas4 + engram ensembles, recruiting enhanced excitatory and inhibitory circuits respectively to modulate memory-guided adaptive behaviors. However, fundamental questions still remain: how the recruited engram network maintains its stability and whether aging-related memory imprecision associates with engram network destabilization. Our study identified NPTXs as the molecular substrates that prevent network hyperactivity and maintain memory precision. Although the NPTXs expression are not specific to Fos + and Npas4 + engram cells, the functional specificity of NPTXs should be placed into specific engram circuits to be manifested, and the maintenance of circuit stability depends on the stable expression of NPTX1 and NPTX2 specifically. Molecules and circuits, they are interdependent, both are essential for ensuring precise behavioral outputs. NPTX1 plays a critical role in stabilizing the excitatory synaptic connection between MEC and DG Fos + engram cells via facilitating Kv7.2 membrane expression-dependent inhibition of neuronal hyperexcitability to promote memory retrieval. Our data demonstrate that NPTX1 interacts with a specific potassium channel Kv7.2 in vivo , although it might not be a direct interaction and probably requires other auxiliary proteins such as syntaxin 28 , we provide a possible explanation for NPTX1 to regulate neuronal excitability beyond its classical role in glutamate signaling. Our behavioral output caused by Nptx1 depletion in F -RAM ensemble was inconsistent with the results of Sun et al 17 that chemogenetic activation of F -RAM ensemble or optogenetic inhibition of MEC-DG circuit promoted or inhibited memory generalization. That’s probably because chemogenetic or optogenetic manipulation was transient, while Nptx1 depletion somehow mimics the persistent activation, leading to engram hyperexcitability and decreased the signal-to-noise ratio (SNR) of MEC- Fos + ensemble excitatory transmission during memory retrieval. Besides, a number of studies support the view that MEC inputs onto DG regulate memory retrieval 29 , 30 . NPTX2 stabilizes the inhibitory synaptic connection between DG local PV + interneurons and N -RAM ensemble to suppress memory overgeneralization, consistent with Sun et al ’s report that N -RAM ensemble contributed to memory discrimination 17 . Their finding confirmed the involvement of CCK + interneurons, while our finding illustrated the importance of NPTX2 in mediating PV + interneurons plasticity. We speculate that N -RAM ensemble-dependent mediation of memory discrimination may require the coordination of both CCK + and PV + GABAergic interneurons as they have been found to exert complementary roles in recruiting perisomatic inhibition 31 , 32 while NPTX2 specifically regulates the functional connection between PV + interneurons and Npas4 + engram cells. NPTX2 was found as a downstream protein of NPAS4 33 , 34 , which explained the coincidence of the weakened perisomatic inhibition caused by Nptx2 knockout with the finding of Npas4 depletion by Elizabeth A et al ’s 35 . As a neuronal IEG, Npas4 upregulates perisomatic inhibitory synapses when activated, 34 , 36 to scale down the level of network activity in response to neuronal excitation, but the specific mechanism remains to be elucidated. Our study provide the downstream molecular mechanism for Npas4 activation-dependent mediation of memory precision. The specificity of NPTX2 functions in Npas4 + ensemble but not in Fos + ensemble to regulate memory discrimination can also be supported by the study by Ee-Lynn et al that knockdown of Nptx2 in Fos + ensemble had no effect on the perisomatic inhibition received from PV + interneurons 37 . Memory precision changes dynamically across the lifespan, young individuals only form gist-like memories and slowly develop into precise episodic memories as the brain matures, then the ability to retrieve specific information declines with age. Understanding the maladaptive changes in the engram network stability during aging may provide insights to combat aging-induced cognitive deficits. NPTXs are classic synaptic proteins that may also be prognostic biomarkers in cognitive and mental disorders, such as AD and schizophrenia 14 , 15 . Nptx2 was also seen as a neuronal IEG. Our smFISH results showed that the total number of Nptx2 + cells and the expression of Nptx2 in engram cells were both downregulated in DG during aging, whereas the overall downregulation of Nptx1 was not observed in aged mice, indicating that NPTX2 was more sensitive to aging. That is to say, along with aging, Nptx2 downregulation-induced disruption of local perisomatic inhibition of DG engram occurs before Nptx1 downregulation-induced disruption of MEC-DG engram excitatory long-range projection, which probably explains why generalization always occurs before amnesia in aged individuals. The findings of Ramsaran et al showed that extracellular perineuronal nets-dependent functional maturation of PV + interneurons promotes sparse engram formation and memory precision during brain development 38 . Our study elucidated that engram network hyperactivity, caused by NPTXs downregulation contributes to aging-related memory imprecision and provided potential synaptic and molecular strategies to mitigate different phenotypes of aging-related memory imprecision, such as amnesia and overgeneralization respectively. Data availability The F – and N -RAM engram cells RNA-seq data have been submitted to NCBI Gene Expression Omnibus (GEO) under accession number PRJNA1067898. Code availability Custom codes will be provided upon request. Author contributions F.W., L.M. and T.J. designed the research. T.J. and Y.Y. conducted the AAV vector construction, virus injection, immunostaining, Co-IP, smFISH, Ribo Tag purification and the behavioral experiments. T.J. carried out the electrophysiology recordings. N.H., Y.G., Y.Z and Q.L. contributed to the bioinformatics analysis. T.J., Y.Y. J.Y, and X.L. analyzed the data and T.J. carried out the statistical analysis and drafted the manuscript. L.M. and F.W. supervised the project and revised the paper. Competing interests The authors declare no competing financial interests. Methods Animals All animals used in this study were listed as follows: adult C57BL/6J male mice (3 m) from the SLAC Laboratory Animal Company (Shanghai, China), aged C57BL/6J male mice (16-18 m) from the Aniphe Biolaboratory Inc. (Nanjing, China) and PV-Flpe (021191) mice from the Jackson Laboratory (CA, USA). CRISPR-Cas9 mediated construction of Nptx1 fl/fl , Nptx2 fl/fl conditional knockout ( Nptx1 cKO, Nptx2 cKO) mice targeting exon 3 and exon 2 respectively were generated by the Biocytogen Co. (Beijing, China) and Npas4-CreER T 2 mice were generated by Shanghai Model Organisms center, Inc (Shanghai, China). Npas4-CreER T 2 and PV-Flpe mice were bred to C57BL/6J mice for more than six generations, Nptx1 fl/fl , Nptx2 fl/fl mice and their respective wild-type (WT) littermates were obtained from self-crossing of Nptx1 fl/+ , Nptx2 fl/+ (heterozygous) mice. Genotypes were determined by polymerase chain reaction (PCR) of mouse toe DNA samples. The primers for genotyping PCR were as follows: 5’ – GCTGTAGGGATGCTTGTCTCTGGTG – 3’ and 5’ – AGAAAAGCTGACCCAAGGTCTCTGC – 3’ for Nptx1 5’ loxP, 5’ – ATTAGCTGCCAGATCTTAGCCCCCT – 3’ and 5’ – GTGTGTGTCCCTGGTGGTGAAGTTT – 3’ for Nptx1 3’ loxP, 5’ – GAATGGCTCGAGGCAGGTCCAGTTT – 3’ and 5’ – CGTTACTAAACCCCAGACAGCTCCG – 3’ for Nptx2 5’ loxP, 5’ – AGTTCTGCCTCTGTTCATCTTGCCA – 3’ and 5’ – TTCACCTGACCCTTCTGTTCACGAC – 3’ for Nptx2 3’ loxP, 5’ – AGAGCCTGAGCGAAAAGACC – 3’, 5’ – CTGCTCACCTCCAGCAAAGA – 3’ and 5’ – CGCGCGCCTGAAGATATAGA – 3’ for Npas4-CreER T 2 . Male offsprings at 8-12 weeks of age were used in following experiments, which were randomly assigned to groups. All mice were housed on a 12 hr light/dark cycle (light on from 8 a.m. to 8 p.m.) with access to food and water ad libitum . All experiment procedures were strictly in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and were approved by Animal Care and Use Committee of the animal facility at Fudan University. Viral vectors AAV-Fos-RAM-d2tTA-TRE-mKate2 and AAV-Npas4-RAM-d2tTA-TRE-mKate2 plasmids were kind gifts from Prof. Yingxi Lin (The University of Texas Southwestern Medical Center, Texas, USA). To generate AAV-Fos-RAM-d2tTA-TRE-Cre and AAV-Npas4-RAM-d2tTA-TRE-Cre plasmids, mKate2 in AAV-Fos-RAM-d2tTA-TRE-mKate2 and AAV-Npas4-RAM-d2tTA-TRE-mKate2 plasmids was replaced with the Cre sequence obtained by PCR from pAAV-Cre-GFP (Addgene: 68544). pAAV-CMV-bGlobin-Flex-EGFP-MIR30-Scramble-shRNA , pAAV-CMV-bGlobin-Flex-EGFP-MIR30-Nptx2-shRNA and pAAV-CMV-DIO-Nptx2-PTX-P2A-EGFP were used in our previous paper 18 . To generate pAAV-Ef1α-DIO-Nptx1-T2A-EYFP , the coding sequence for mouse Nptx1 with T2A was generated by Azenta US, Inc. (Suzhou, China) and was subcloned into pAAV-Ef1α-DIO-EYFP (Addgene: 27056). Adeno-associated viruses (AAVs) described above were packaged by OBiO Technology Co., Ltd (Shanghai, China) into serotype 9. AAV 9 -Ef1α-Flex-NBL10 (69971) and AAV 9 -Ef1α-DIO-ChR2-EYFP (S0199-9-H50) were purchased from Taitool Bioscience Co., Ltd. (Shanghai, China). AAV 9 -Ef1α-DIO-H2B-EGFP (PT-0258), AAV 9 -Ef1α-DIO-EYFP (PT-0012), AAV 9 -CaMKIIα-ChR2-mCherry (PT-0297), AAV 9 -VGAT2-Flp (PT-2501, vector backbone from BrainVTA) , AAV 9 -CCK-fDIO-mCherry (PT-8508, vector backbone from Addgene: 114471) , AAV 8 -Ef1α-DIO-TVA-H2B-EGFP (PT-0021), AAV 8 -Ef1α-DIO-RVG (PT-0023) and RV-ENVA-ΔG-dsRed (R01002) were purchased from BrainVTA Co., Ltd. (Wuhan, China). AAV 9 -PV-Flp (BC-0430, vector backbone from Addgene: 22914), AAV 9 -SST-Flp (BC-0429, vector backbone from Addgene: 22913) , AAV 9 -Ef1α-fDIO-ChR2-mCherry (BC-0113), AAV 9 -Ef1α-fDIO-mCherry (BC-0193) and AAV 9 -Ef1α-fDIO-hM3Dq-mCherry (BC-0495) were purchased from Brain Case Co., Ltd. (Shenzhen, China). Stereotaxic surgery Mice were anesthetized with 2% isoflurane and placed in a stereotaxic instrument (RWD Life Science, Shenzhen, China). Microinjections were performed using 33-gauge needles connected to a 10 μl microsyringe (Hamilton, Bonaduz, Switzerland), which were under the control of a UMP3 ultra micropump (World Precision Instruments, Florida, USA). The coordinates relative to bregma were listed as follows: anterior-posterior (AP) – 1.9 mm; medial-lateral (ML) ± 1.1 mm; dorsal-ventral (DV) – 2.1 mm for DG and AP – 4.7 mm; ML ± 3.2 mm; DV – 4.5 mm for MEC. The needle was slowly lowered to the target site and remained for at least 3 min after injection. The injection volume per site was 0.3 μl in DG and 0.4 μl in MEC. The final titer of all the AAVs used for infections were at least 1 × 10 12 V.G./ml except for AAV-SST-Flp, AAV-PV-Flp, AAV-VGAT2-Flp, AAV-Fos-RAM-d2tTA-TRE-Cre and AAV-Npas4-RAM-d2tTA-TRE-Cre, which were 1:1000 diluted. For rabies infections, the final titer used was 1 × 10 8 IFU/ml. After surgery, all mice were given at least 3 weeks to recover before behavioral experiments or electrophysiological recordings, and the efficiency of virus infection was verified by immunostaining. Only the mice with virus infection in correct places were chosen for further analysis. Engram labeling To label engram cells, Fos-RAM-d2tTA-TRE (F-RAM) and Npas4-RAM-d2tTA-TRE (N-RAM) systems, which gene expression was under the control of the tetracycline responsive element (TRE), were used respectively through AAVs infusion. All mice were kept on doxycycline (Dox, Huamaike Bio, 360304) containing food (40 mg/kg) one day before virus injection. 48 hr (day –2) before engram labeling, mice were fed with regular food instead of Dox diet. Then contextual fear conditioning or novel context exposure (context N) was performed on day 0 to label Fos + or Npas4 + engram cells in DG, after labeling, mice were put on Dox containing food again immediately. Mice were given at least 3 days to allow sufficient protein expression before subsequent experiments. Rabies input tracing To study the respective monosynaptic inputs of Fos + and Npas4 + ensembles in DG, Rabies trans-synaptic tracing experiment was performed. Mice were infected with AAV 9 -Fos-RAM-d2tTA-TRE-Cre or AAV 9 -Npas4-RAM-d2tTA-TRE-Cre, AAV helper ( AAV 8 -Ef1α-DIO-TVA-H2B-EGFP and AAV 8 -Ef1α-DIO-RVG ). On day 3 after engram labeling, Rabies virus ( RV-ENVA-ΔG-dsRed ) was injected into DG at the same coordinates, then mice were housed in the BSL2 facility for 1 week to allow rabies spread and dsRed expression before perfusion (day 10). For rabies tracing analysis, consecutive brain slices from AP + 2.8 mm to AP – 5.0 mm (40 μm thickness) selected from every fifth slice were collected. DsRed + cells were manually counted by an experimenter who was blind to the experimental condition. The percentage of rabies-labelled inputs was calculated as follows, dsRed + cells in each brain region / total dsRed + cells per mouse. Contextual fear conditioning (CFC) Before CFC was performed, mice were handled daily in a holding room for 3 days. For experiments with Dox-dependent ensembles labeling, on the third handling day, the Dox diet was replaced with regular food (off-Dox) and CFC assay was typically carried out 48 hours after the last handling session. CFC was performed in the conditioning chamber (Med-Associates, St. Albans, VT, USA) and the procedure was composed of conditioning and test sessions. On the conditioning day (day 0), mice were firstly transported into the holding room and allowed to habituate for at least 30 minutes, then transported into the behavioral room and placed into context A, a square plexiglass observational chamber with stainless steel bars connected to a shock generator on the floor for conditioning. Two individual conditioning protocols were used in our study, for mice that conditioned to the 360 s protocol, three foot shocks (0.5 mA, 1 s each) at 180 s, 240 s and 300 s were given and mice were taken out 60 s after termination of the third foot shock, for mice that conditioned to the180 s protocol, one single foot shock (0.3 mA, 1 s) at 120 s was given and mice were taken out 60 s after termination of the foot shock. The test session was carried out on day 3. Mice were put back into fear context A for 180 s, and were placed into a non-fear context (context C, a triangular chamber with white, smooth plastic floor and black cover) for 180 s 6 hr later. For immunohistochemistry, mice were tested for memory expression in only one context, either context A or C, and sacrificed 1 hr later. The freezing percentage was automatically analyzed by software (Med-Associates) with freezing defined as absence of movement for at least 1 s. The discrimination index (DI) was calculated as follows, (the freezing percentage in context A – the freezing percentage in context C) / (the freezing percentage in context A + the freezing percentage in context C). Open field test (OFT) Spontaneous locomotor activity was carried out as we previously reported 39 , in short, mice were placed in the center of an open arena (40 × 40 cm 2 ) at the beginning of the test, and were allowed to freely explore the arena for 20 min. Distance travelled in the arena and time in center zone were quantified using a TopScan automated detection system (CleverSys, Reston, VA, USA). O-maze test The O-maze was 70 cm in diameter and 70 cm high off the ground, and consisted of two open arms (7 cm wide) without walls, two closed arms that were enclosed by vertical walls. Mice were gently placed into the open arms, and their behavior was recorded for 6 min via a TopScan automated detection system (CleverSys, Reston, VA, USA) located above the maze. Tail suspension test (TST) Mice were suspended 20 cm above a solid surface by the use of adhesive tape applied to the tail, and their behavior was recorded for 6 min. Immobility time was defined as absence of struggling for at least 1 s and latency to immobility was defined as the time from the beginning of TST to mice’s first absence of struggling for at least 1 s, which were manually analyzed by an experimenter who was blind to the experimental condition. Drug injections Clozapine N-oxide (CNO, Sigma, C0832) was dissolved in saline, which was intraperitoneal injected (i.p.) at a concentration of 1 mg/kg 30 min before memory retrieval. The KCNQ2/3 activator, retigabine (Supelco, 90221) was diluted in 5% DMSO (Sigma, 276855) and administered i.p. at 1 mg/kg 30 min before memory retrieval with 5% DMSO as control. 4-Hydroxytamoxifen (4-OHT, Sigma, H6278) was dissolved in ethanol at 20 mg/ml and stored at –20℃. The ethanol was evaporated at 95℃ and corn oil (Thermo Fisher, C40543) was added to give a final concentration of 10 mg/ml, which was i.p. injected 2 hr before memory conditioning with corn oil as control. Whole-cell patch-clamp recording in brain slices Mice were subjected to electrophysiology on day 3 following CFC. Living acute brain slices (300 μm) preparation for analyzing engram synaptic connections and engram intrinsic excitability were performed as previously described 40 only with minor modifications. Briefly, mice’s brains were cut on a vibratome (Thermo Scientific, MA, USA) in carbogenated (95% O 2 , 5% CO 2 ) ice-cold cutting solution containing (in mM): 93 NMDG, 2.5 KCl, 1.25 NaH 2 PO 4 , 30 NaHCO 3 , 20 HEPES, 25 glucose, 2 thiourea, 5 Na-ascorbate, 3 Na-pyruvate, 0.5 CaCl 2 and 10 MgCl 2 , 300-310 mOsm, pH adjusted to 7.3 with HCl. After initial recovery at 32 °C for 10 min, slices were transferred to carbogenated HEPES holding ACSF (in mM: 92 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 30 NaHCO 3 , 20 HEPES, 25 glucose, 2 thiourea, 5 Na-ascorbate, 3 Na-pyruvate, 2 CaCl 2 and 2 MgCl 2 , 300-310 mOsm, pH 7.4) and incubated for over 45 min before recording. Whole-cell patch-clamp recordings were performed in carbogenated recording ACSF (in mM: 119 NaCl, 2.5 KCl, 1.25 NaH 2 PO 4 , 24 NaHCO 3 , 12.5 glucose, 2 CaCl 2 and 2 MgCl 2 (300-310 mOsm, pH 7.3-7.4) at a rate of 1.5 mL / min (30∼32°C) with an EPC-10 amplifier and Pulse v8.78 software (HEKA Elektronik, Lambrecht/Pfalz, Germany). Recording neurons were identified visually by location, morphology, size and fluorescence and recordings were performed using borosilicate glass pipettes (5-7 MΩ tip resistance). To record A/N ratios, neurons were voltage-clamped at –70 mV to record AMPAR mediated EPSCs and at +40 mV to record dual-component EPSCs containing NMDA receptor (NMDAR) EPSCs. To calculate the A/N ratios, the peak current of the AMPA EPSC at –70 mV was compared with the value of the NMDA EPSC after stimulation start time 50 ms at +40 mV. Intracellular solution used was (in mM): 127.5 cesium methanesulfonate, 7.5 CsCl, 10 HEPES, 2.5 MgCl 2 , 4 Mg-ATP, 0.4 Na 3 -GTP, 10 sodium phosphocreatine, 0.6 EGTA (290-300 mOsm, pH 7.2). To record light-evoked EPSCs (oEPSC), A TTL-driven light-emitting diode (Lumen Dynamics) was used to generate photostimulation consisting of a single wide-field blue flash (470 nm, 1 ms duration) for photostimulation of ChR2-expressing terminals. The laser intensity was measured at the focal plane of the slice when delivered through the 40× water-immersion objective lens (Nikon, Japan). Slices containing MEC ChR2-expressing terminals were chosen for oEPSC recording in the presence of 1 μM Tetrodotoxin (TTX, Tocris, 1078), 100 μM 4-aminopyridine (4-AP, Sigma, 275875) and 100 μM picrotoxin (PTX, Tocris, 1128), neurons were voltage-clamped at –70 mV and the stimulus intensity was 0.1 mW at 470 nm. To record paired-pulse ratio (PPR) and AMPA/NMDA (A/N) EPSC ratio, DG slices containing ChR2-expressing neurons were chosen to perform patch-clamp recordings in the presence of 100 μM PTX and the stimulus intensity was 0.1 mW at 470 nm. The AMPA receptor (AMPAR) mediated EPSCs were evoked by paired photostimulation of 50 ms interval for 10 consecutive traces, and PPR was determined as the peak amplitude ratio of the second to the first EPSC. To record light-evoked IPSCs (oIPSC) and PPR, neurons were clamped at +10 mV in the presence of 1 μM TTX, 100 μM 4-AP, 20 μM CNQX (Sigma, C127) and 50 μM D-AP5 (Tocris, 0106) and the stimulus duration and intensity was 1 ms, 0.2 mW at 470 nm. The recording protocols and intracellular solution used were the same as above. To record Action Potentials (AP), current-clamp was used and membrane potentials were measured in response to intracellular injection of step currents (1000 ms duration, magnitudes ranging from – 150 to 250 pA in steps of 10 pA) with the addition of 20 μM CNQX, 50 μM D-AP5 and 100 μM PTX into ACSF. Intracellular solution used was (in mM): 135 potassium-gluconate, 4 KCl, 2 NaCl, 10 HEPES, 4 EGTA, 4 Mg-ATP, 0.3 Na3-GTP, 10 sodium phosphocreatine (280-290 mOsm, pH 7.3). To record and isolate M-current ( I M ), intracellular solution used was the same as above, 0.2 mM CdCl 2 (Sigma, 202908), 1 μM TTX, 10 μM ZD7288 (Tocris, 1000), and 4 mM 4-AP to block voltage-dependent Cav, Nav, HCN and Kv1 channels, 20 μM CNQX, 50 μM D-AP5 and 100 μM picrotoxin to block synaptic activity were added into ACSF. To isolate M-current, the following protocol the same as previously reported 41 with minor modifications was applied to the recording cells: (1) a 1 s step from the holding potential (–70 mV) to –10 mV was applied to activate I M while inactivating most other voltage-gated currents, (2) a 1 s step from –60 mV to –10 mV with 10 mV increments to elicit I M tail current, and (3) a 1 s step to –10 mV, before returning to –70 mV. The signals were acquired at 10 kHz and filtered at 2 kHz. The series resistance was < 30 MΩ. Data were analyzed with Mini Analysis Program (Synaptosoft, Fort Lee, NJ, USA) or pCLAMP10.7 (Molecular Devices, San Jose, CA, USA) by an experimenter who was blind to the experimental condition. Ribosome-Associated Messenger RNA Purification/ RiboTag DG from mice injected AAV 9 -F/N-RAM-Cre and AAV 9 -Flex-NBL10, Cre-dependent expression of N terminus of ribosomal subunit protein Rpl10a (NBL10) 42 following fear conditioning (Day 3) was quickly isolated and used for enrichment of ribosome-associated transcripts as described previously 18 . The brain tissue (DG) was homogenized in supplemented hybridization buffer (HB-S) containing dithiothreitol (DTT, Sigma, D9760), cycloheximide (CHX, Cayman, 14126), heparin (Tocris, 2812), protease inhibitors (Roche, 04693116001), and RNase inhibitor (Vazyme, R301). The supernatant was incubated with anti-hemagglutinin (HA) antibody (Sigma, H6908) and Dynabeads Protein G (Invitrogen, 10003D) for 12 hours. Purified messenger RNA (mRNA) was eluted from the Dynabeads using TRIzol TM LS (Invitrogen, 10296010). An Agilent RNA 6000 Pico Kit (Agilent, 5067-1513) and an Agilent 2100 bioanalyzer were used to evaluate the quality of purified mRNA. Purified mRNA samples with RNA integrity number < 7 were discarded. Sequence Processing and Data Analysis The library was prepared with VAHTSTM mRNA-seq V3 Library Prep Kit for Illumina (Vazyme, NR611) and sequenced on a HiSeq 4000 (Illumina) by Novogene Technology Co., Ltd (Beijing, China). Raw reads were cleaned with FASTX-toolkit to remove adapter contamination and low-quality reads (quality score < 28). The clipped reads were aligned to mouse reference sequence (GRCm38/mm10) using HISAT2 43 . Cuffdiff-generated FPKM count matrix was used for subsequent analysis. Significance was drawn with ANOVA and clustered using Shannon entropy-based method 44 . Genes with more than one and half fold expression changes, and were significantly different ( P < 0.05) were selected for further analysis. Single molecule fluorescent in situ hybridization (smFISH) Fixed-frozen brain tissues were sliced into 10 μm coronal sections and baked at 60°C for 30 min. Then slices were incubated with hydrogen peroxide (H 2 O 2 ) for 10 min at room temperature (RT), targets retrieval and protease III incubation were performed using RNAscope® 2.5 Universal Pretreatment Reagents (Advanced Cell Diagnostics, 322000, 322381). SmFISH probes for all genes examined: Nptx1 (505421), Nptx2 (316901), Fos (316921), Npas4 (423431), Sirt1 (418341) and Atg7 (561261) were hybridized for 2 hr. After Hybridization, RNAscope® Multiplex Fluorescent Detection Kit v2 (Advanced Cell Diagnostics, 323110) were used to amplify signals. Images were acquired by using the Nikon A1 confocal microscope (Tokyo, Japan). Regions of interest (ROI) were circled and the intensity within the regions was analyzed by Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD, USA). For cell counting analysis, consecutive brain slices from AP – 1.2 mm to AP – 2.0 mm (10 μm thickness) selected from every tenth slice, 8 slices per mouse were collected, number of mice were included in the statistical table. Immunohistochemistry (IHC) Mice were perfused transcardially with ice cold saline followed by 4% paraformaldehyde (PFA, dissolved in 0.1 M PBS). The brains were removed and fixed in 4% PFA overnight. Then the brains were subjected to dehydrate in 30% sucrose solutions at 4°C for 72 hr before being sliced into 30 or 40 μm coronal sections (selected from every fifth slice). Slices were incubated with primary antibodies in blocking solution containing 0.3% Triton X-100 overnight at 4°C. Slices were washed with 0.1 M PBS, and then incubated with secondary antibody at RT for 1.5 hr. After being washed in PBS, slices were mounted in anti-quenching mounting medium (Southern Biotech, 0100). Primary antibodies used were: anti-NPTX1 (1:400, Alomone Labs, ANR-191), anti-NPTX2 (1:500, Proteintech, 10889-1-AP), anti-Fos (1:500, Synaptic Systems, 226017), anti-Parvalbumin (PV, 1:100, Thermo Fisher, PA1-933), anti-PV (1:500, Oasis, OB-PGP005-01), anti-GluA4 (1:500, Merck, AB1508), anti-Somatostatin (SST, 1:200, Oasis, OB-PRB111-01), anti-Choline Acetyltransferase (ChAT, 1:100, Merck, AB143), anti-Glutamate (1:500, Merck, AB133), anti-GAD67 (1:500, Merck, MAB5406), anti-cholecystokinin (CCK, 1:1000, Merck, C2581) and anti-KCNQ2 (1:100, Alomone Labs, APC-050). Secondary antibodies used were: goat anti-rat 488 (1:1000, Jackson Immuno Research, 112-545-167), goat anti-rabbit 488 (1:1000, Jackson Immuno Research, 111-545-144), donkey anti-guinea pig 488 (1:1000, Jackson Immuno Research, 706-545-148), goat anti-rabbit Cy3 (1:1000, Jackson Immuno Research, 111-165-144), donkey anti-rat Cy3 (1:1000, Jackson Immuno Research, 712-165-153) and donkey anti-rat 647 (1:500, Jackson Immuno Research, 712-605-150). Kv7.2 and GluA4 membrane expression analysis were adapted from one of the latest researches from our lab 45 . Images were acquired using a Nikon-A1 confocal microscope (Tokyo, Japan) with a 20× objective lens or a 60× objective oil lens. Data were analyzed blindly to the group using Image-Pro Plus 6.0 and ImageJ (Fiji). For cell counting analysis, consecutive brain slices from AP – 1.2 mm to AP – 2.0 mm (40 μm thickness) selected from every fifth slice, 4 slices per mouse were collected, number of mice were included in the statistical table. Reverse transcription-quantitative PCR (RT-qPCR) Reverse transcription was completed using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, R212). The cDNA was subjected to qPCR using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711) and Eppendorf Mastercycler PCR System. The primers for qPCR were as follows: 5’ – ACCTCCCTACACCAACGGAT – 3’ and 5’ – GGCAGGCTCTTCTTCACCTT – 3’ for Nptx1 , 5’ – GCCAAGGTGAAGAAGAGCCT – 3’ and 5’ – AGCATAAGAGAAGGGTGTGCC – 3’ for Nptx1 of exon 3, 5’ – GACTTCCGAGAGGTGCTCCA – 3’ and 5’ – GGTGAGCCGAGGTCTCATTA – 3’ for Nptx2 of exon 2, 5’ – TGGCCTTCCGTGTTCCTAC – 3’ and 5’ – GAGTTGCTGTTGAAGTCGCA – 3’ for Gapdh , which were synthesized by Azenta US, Inc.. The mRNA expression of Nptx1 and Nptx2 was normalized to the internal control Gapdh . Co-immunoprecipitation (Co-IP) and Western blotting The DG tissues of adult C57BL/6J male mice were rapidly extracted and homogenized in radio immunoprecipitation assay (RIPA) buffer containing protease and phosphatase inhibitors for 30 min. The protein lysate concentration was determined using bicinchoninic acid kit. Protein samples were incubated with 3 µg anti-NPTX1 (Santa Cruz Biotechnology, sc-374199) or anti-IgG (Cell Signaling Technology, 5415S) for 4 h at 4°C. Pierce Protein A/G magnetic beads (88803, Thermo Scientific) were added to each sample and the mixture was rotated at 4°C overnight. The attached protein lysis was then eluted and used for further protein blotting assay. Before Western blotting assay, 50 µg protein samples were boiled for 6 min at 85°C, and were separated by SDS-polyacrylamide gel electrophoresis (PAGE) under 120 V for 1.5 h. Proteins were then transferred to the polyvinylidene fluoride (PVDF) membrane at 100 mV for 100 min. The membrane was firstly washed with Tris-buffered saline with Tween 20 (TBST), followed by blocking in 5% skimmed milk for 2 hours. The membrane was then incubated with the following primary antibodies anti-NPTX1 (1:100, Santa Cruz Biotechnology, sc-374199) and anti-KCNQ2 (1:500, Abcam, ab22897) at 4°C overnight. On the next day, the membrane was washed with TBST and incubated with IRDye 700DX-or 800DX-conjugated anti-rabbit or anti-mouse IgG (1:50000, Rockland Immunochemicals Inc.) for 2 h at room temperature. Protein bands were visualized using Odyssey (LI-COR Biosciences). The immunoblots were analyzed with Image J. Statistics All data were presented as mean ± SEM. Sample sizes were based on our previous research 18 , 39 , 46 . Statistical analyses were performed by SPSS 20.0 software (IBM, Armonk, NY, USA) or R software (version 4.1.2). The normality test of the data sets was performed by the Shapiro-Wilk test or the Kolmogorov-Smirnov test if n > 50, homogeneity of variance test of the data sets was performed by the Levene’s test. Two-tailed unpaired t test was used for comparing two independent groups. Multiple group comparisons were assessed using One-way analysis of variance (ANOVA), Two-way ANOVA or Two-way repeated measures (RM) ANOVA, followed by the Bonferroni’s post-hoc test when significant main effects or interactions were detected. Mann-Whitney U test or Kruskal-Wallis H test was used when normality was violated. Bonferroni’s corrections were applied to assess statistical significance.* P < 0.05, ** P < 0.01, and *** P < 0.001. Acknowledgement This work was supported by grants from the STI2030-Major Projects (2021ZD0203500 to FFW and LM, 2021ZD0202100 to XL), the Natural Science Foundation of China (32222033 to FFW, 31930046 and 82021002 to LM, 32171041 to XL, 31970543 and 32270660 to QML), the CAMS Innovation Fund for Medical Sciences (2021-I2M-5-009 to LM and XL). We thank Prof. Yingxi Lin (The University of Texas Southwestern Medical Center, Texas, USA) for providing the AAV-Fos-RAM-d2tTA-TRE-mKate2 and AAV-Npas4-RAM-d2tTA-TRE-mKate2 plasmids. Funder Information Declared STI2030-Major Projects , 2021ZD0203500 , 2021ZD0202100 Natural Science Foundation of China , 32222033 , 31930046 , 82021002 , 32171041 , 31970543 , 32270660 CAMS Innovation Fund for Medical Sciences , 2021-I2M-5-009 Footnotes The human data in Figure 6 did not provide appropriate relevance to the mechanism study, which was removed in the revised paper. References 1. ↵ Josselyn , S. A. & Tonegawa , S . Memory engrams: Recalling the past and imagining the future . Science 367 ( 2020 ). 2. ↵ Tonegawa , S. , Morrissey , M. D. & Kitamura , T . The role of engram cells in the systems consolidation of memory . Nature Reviews Neuroscience 19 , 485 – 498 ( 2018 ). OpenUrl CrossRef PubMed 3. ↵ Castello-Waldow , T. P. et al. Hippocampal neurons with stable excitatory connectivity become part of neuronal representations . Plos Biol 18 ( 2020 ). 4. ↵ Luo , L. & Craik , F. I. Aging and memory: a cognitive approach . Can J Psychiatry 53 , 346 – 353 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 5. ↵ Fan , X. , Wheatley , E. G. & Villeda , S. A . Mechanisms of Hippocampal Aging and the Potential for Rejuvenation . Annu Rev Neurosci 40 , 251 – 272 ( 2017 ). OpenUrl CrossRef PubMed 6. ↵ Sudhof , T. C . Towards an Understanding of Synapse Formation . Neuron 100 , 276 – 293 ( 2018 ). OpenUrl CrossRef PubMed 7. ↵ Gomez de San Jose , N. , et al. Neuronal pentraxins as biomarkers of synaptic activity: from physiological functions to pathological changes in neurodegeneration . J Neural Transm (Vienna ) 129 , 207 – 230 ( 2022 ). OpenUrl CrossRef PubMed 8. ↵ Cho , R. W. et al. mGluR1/5-dependent long-term depression requires the regulated ectodomain cleavage of neuronal pentraxin NPR by TACE . Neuron 57 , 858 – 871 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 9. ↵ Xu , D. et al. Narp and NP1 form heterocomplexes that function in developmental and activity-dependent synaptic plasticity . Neuron 39 , 513 – 528 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 10. ↵ Abad , M. A. , Enguita , M. , DeGregorio-Rocasolano , N. , Ferrer , I. & Trullas , R . Neuronal pentraxin 1 contributes to the neuronal damage evoked by amyloid-beta and is overexpressed in dystrophic neurites in Alzheimer’s brain . J Neurosci 26 , 12735 – 12747 ( 2006 ). OpenUrl Abstract / FREE Full Text 11. ↵ Figueiro-Silva , J. et al. Neuronal pentraxin 1 negatively regulates excitatory synapse density and synaptic plasticity . J Neurosci 35 , 5504 – 5521 ( 2015 ). OpenUrl Abstract / FREE Full Text 12. ↵ Chang , M. C. et al. Narp regulates homeostatic scaling of excitatory synapses on parvalbumin-expressing interneurons . Nat Neurosci 13 , 1090 – 1097 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 13. ↵ Gu , Y. et al. Obligatory Role for the Immediate Early Gene NARP in Critical Period Plasticity . Neuron 79 , 335 – 346 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 14. ↵ Xiao , M. F. et al. A biomarker-authenticated model of schizophrenia implicating NPTX2 loss of function . Sci Adv 7 , eabf6935 ( 2021 ). OpenUrl CrossRef PubMed 15. ↵ Mravinacová , S. et al. CSF protein ratios with enhanced potential to reflect Alzheimer’s disease pathology and neurodegeneration . Mol Neurodegener 19 ( 2024 ). 16. ↵ Soldan , A. et al. NPTX2 in Cerebrospinal Fluid Predicts the Progression From Normal Cognition to Mild Cognitive Impairment . Ann Neurol 94 , 620 – 631 ( 2023 ). OpenUrl CrossRef PubMed 17. ↵ Sun , X. et al. Functionally Distinct Neuronal Ensembles within the Memory Engram . Cell 181 , 410 – 423 e417 ( 2020 ). OpenUrl CrossRef PubMed 18. ↵ Wang , Z. et al. Retrieval-Driven Hippocampal NPTX2 Plasticity Facilitates the Extinction of Cocaine-Associated Context Memory . Biol Psychiatry 87 , 979 – 991 ( 2020 ). OpenUrl CrossRef PubMed 19. ↵ Mariga , A. et al. Definition of a Bidirectional Activity-Dependent Pathway Involving BDNF and Narp . Cell Rep 13 , 1747 – 1756 ( 2015 ). OpenUrl CrossRef PubMed 20. ↵ Delmas , P. & Brown , D. A . Pathways modulating neural KCNQ/M (Kv7) potassium channels . Nat Rev Neurosci 6 , 850 – 862 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 21. ↵ Li , S. B. et al. Hyperexcitable arousal circuits drive sleep instability during aging . Science 375 , eabh3021 ( 2022 ). OpenUrl CrossRef PubMed 22. ↵ Topolnik , L. & Tamboli , S . The role of inhibitory circuits in hippocampal memory processing . Nat Rev Neurosci 23 , 476 – 492 ( 2022 ). OpenUrl CrossRef PubMed 23. ↵ Royer , S. et al. Control of timing, rate and bursts of hippocampal place cells by dendritic and somatic inhibition . Nat Neurosci 15 , 769 – 775 ( 2012 ). OpenUrl CrossRef PubMed 24. ↵ Cummings , D. M. et al. Neuronal and Peripheral Pentraxins Modify Glutamate Release and may Interact in Blood-Brain Barrier Failure . Cereb Cortex 27 , 3437 – 3448 ( 2017 ). OpenUrl CrossRef PubMed 25. ↵ Pelkey , K. A. et al. Pentraxins Coordinate Excitatory Synapse Maturation and Circuit Integration of Parvalbumin Interneurons . Neuron 90 , 661 ( 2016 ). 26. ↵ Blackburn-Munro , G. , Dalby-Brown , W. , Mirza , N. R. , Mikkelsen , J. D. & Blackburn-Munro , R. E . Retigabine: chemical synthesis to clinical application . CNS Drug Rev 11 , 1 – 20 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 27. ↵ Bieri , G. , Schroer , A. B. & Villeda , S. A . Blood-to-brain communication in aging and rejuvenation . Nat Neurosci 26 , 379 – 393 ( 2023 ). OpenUrl CrossRef PubMed 28. ↵ Regev , N. et al. Selective interaction of syntaxin 1A with KCNQ2: possible implications for specific modulation of presynaptic activity . PLoS One 4 , e6586 ( 2009 ). OpenUrl CrossRef PubMed 29. ↵ Luna , V. M. et al. Adult-born hippocampal neurons bidirectionally modulate entorhinal inputs into the dentate gyrus . Science 364 , 578 – 583 ( 2019 ). OpenUrl Abstract / FREE Full Text 30. ↵ Qin , H. et al. A Visual-Cue-Dependent Memory Circuit for Place Navigation . Neuron 99 , 47 – 55 e44 ( 2018 ). OpenUrl CrossRef PubMed 31. ↵ Bartos , M. & Elgueta , C . Functional characteristics of parvalbumin– and cholecystokinin-expressing basket cells . J Physiol 590 , 669 – 681 ( 2012 ). OpenUrl CrossRef PubMed 32. ↵ Klausberger , T. et al. Complementary roles of cholecystokinin– and parvalbumin-expressing GABAergic neurons in hippocampal network oscillations . J Neurosci 25 , 9782 – 9793 ( 2005 ). OpenUrl Abstract / FREE Full Text 33. ↵ Sun , X. & Lin , Y . Npas4: Linking Neuronal Activity to Memory . Trends Neurosci 39 , 264 – 275 ( 2016 ). OpenUrl CrossRef PubMed 34. ↵ Spiegel , I. et al. Npas4 regulates excitatory-inhibitory balance within neural circuits through cell-type-specific gene programs . Cell 157 , 1216 – 1229 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 35. ↵ Pollina , E. A. et al. A NPAS4-NuA4 complex couples synaptic activity to DNA repair . Nature 614 , 732 – 741 ( 2023 ). OpenUrl CrossRef PubMed 36. ↵ Bloodgood , B. L. , Sharma , N. , Browne , H. A. , Trepman , A. Z. & Greenberg , M. E . The activity-dependent transcription factor NPAS4 regulates domain-specific inhibition . Nature 503 , 121 – 125 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 37. ↵ Yap , E. L. et al. Bidirectional perisomatic inhibitory plasticity of a Fos neuronal network . Nature 590 , 115 – 121 ( 2021 ). OpenUrl CrossRef PubMed 38. ↵ Ramsaran , A. I. et al. A shift in the mechanisms controlling hippocampal engram formation during brain maturation . Science 380 , 543 – 551 ( 2023 ). OpenUrl CrossRef PubMed 39. ↵ Jin , T. et al. Dorsal hippocampus– and ACC-projecting medial septum neurons differentially contribute to the recollection of episodic-like memory . FASEB J 34 , 11741 – 11753 ( 2020 ). OpenUrl CrossRef PubMed 40. ↵ Ting , J. T. , Daigle , T. L. , Chen , Q. & Feng , G . Acute brain slice methods for adult and aging animals: application of targeted patch clamp analysis and optogenetics . Methods Mol Biol 1183 , 221 – 242 ( 2014 ). OpenUrl CrossRef PubMed 41. ↵ Lopez , J. P. et al. Ketamine exerts its sustained antidepressant effects via cell-type-specific regulation of Kcnq2 . Neuron 110 , 2283 – 2298 e2289 ( 2022 ). OpenUrl CrossRef PubMed 42. ↵ Ekstrand , M. I. et al. Molecular profiling of neurons based on connectivity . Cell 157 , 1230 – 1242 ( 2014 ). OpenUrl CrossRef PubMed 43. ↵ Kim , D. , Paggi , J. M. , Park , C. , Bennett , C. & Salzberg , S. L . Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype . Nat Biotechnol 37 , 907 – 915 ( 2019 ). OpenUrl CrossRef PubMed 44. ↵ Ghosh , S. & Chan , C. K . Analysis of RNA-Seq Data Using TopHat and Cufflinks . Methods Mol Biol 1374 , 339 – 361 ( 2016 ). OpenUrl CrossRef PubMed 45. ↵ He , G. et al. Persistent increase of accumbens cocaine ensemble excitability induced by IRK downregulation after withdrawal mediates the incubation of cocaine craving . Mol Psychiatry 28 , 448 – 462 ( 2023 ). OpenUrl CrossRef PubMed 46. ↵ Zhou , Y. et al. A ventral CA1 to nucleus accumbens core engram circuit mediates conditioned place preference for cocaine . Nat Neurosci 22 , 1986 – 1999 ( 2019 ). OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted June 30, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Disturbed engram network caused by NPTXs downregulation underlies aging-related memory deficits Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Disturbed engram network caused by NPTXs downregulation underlies aging-related memory deficits Tao Jin , Yang Yang , Yu Guo , Yi Zhang , Qiumin Le , Nan Huang , Xing Liu , Jintai Yu , Lan Ma , Feifei Wang bioRxiv 2025.05.19.654996; doi: https://doi.org/10.1101/2025.05.19.654996 Share This Article: Copy Citation Tools Disturbed engram network caused by NPTXs downregulation underlies aging-related memory deficits Tao Jin , Yang Yang , Yu Guo , Yi Zhang , Qiumin Le , Nan Huang , Xing Liu , Jintai Yu , Lan Ma , Feifei Wang bioRxiv 2025.05.19.654996; doi: https://doi.org/10.1101/2025.05.19.654996 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7642) Biochemistry (17715) Bioengineering (13907) Bioinformatics (42003) Biophysics (21470) Cancer Biology (18624) Cell Biology (25533) Clinical Trials (138) Developmental Biology (13390) Ecology (19935) Epidemiology (2067) Evolutionary Biology (24356) Genetics (15617) Genomics (22529) Immunology (17753) Microbiology (40432) Molecular Biology (17200) Neuroscience (88681) Paleontology (667) Pathology (2840) Pharmacology and Toxicology (4828) Physiology (7653) Plant Biology (15171) Scientific Communication and Education (2046) Synthetic Biology (4304) Systems Biology (9826) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.