Molecular characterisation and histopathological analysis of canine distemper virus in a Malayan tiger (Panthera tigris jacksoni)

Molecular characterisation and histopathological analysis of canine distemper virus in a Malayan tiger (Panthera tigris jacksoni) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular characterisation and histopathological analysis of canine distemper virus in a Malayan tiger (Panthera tigris jacksoni) Muhammad Farris Mohd Sadali, Mariatulqabtiah Abdul Razak, Annas Salleh, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5032158/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Canine distemper virus (CDV) has a broad host range, spanning carnivorous and non-carnivorous animals, often proving fatal. The detection of CDV in a Malayan tiger in Malaysia in 2019 marks the first such case in Malayan tigers, highlighting the potential domestic animal or wildlife circulation of the virus. Our study aimed to describe histological manifestations and characterise the CDV strain in the tiger to determine its molecular epidemiology and postulate viral pathogenicity. Results Notable histopathological changes were observed primarily in the central nervous system, lung, liver, kidney, spleen, and stomach, with viral antigens localised in the lung, liver, kidney, and stomach tissues. CDV-induced cell cytopathic effects with viral quantification yielding 4.27 x 10 6 TCID 50 /mL were observed at 48 h post-inoculation in CHO-SLAM cells. Phylogenetic analysis suggested that the virus originated from the Asia-1 region. Notably, 549H and 519I mutation combinations in the hemagglutinin protein were observed, indicating adaptation to a non-canid wildlife species. Conclusion This study delved into the molecular characterisation of CDV in the Malayan tiger, with information on the dynamics of virus transmission among wildlife in the case of future outbreaks. Such results underscore the need for a prevalence study to assess the spread of the virus. This can serve as a benchmark for developing effective preventative measures to protect Malayan tigers and mitigate their risk of extinction. Canine distemper virus Malayan tiger histopathology hemagglutinin fusion Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background Canine distemper virus (CDV) is a highly contagious pathogen affecting carnivorous mammals, including domestic and wildlife populations, often leading to severe illness and, in some cases, fatal outcomes. Belonging to the Morbillivirus genus within the Paramyxoviridae family, CDV is characterised by its enveloped structure and negative-sense, single-stranded RNA genome ( 1 ). To date, the virus has been implicated in mass deaths of various carnivorous and non-carnivorous animals. Being an RNA virus, CDV exhibits high mutation rates and broad cell tropism, which contribute significantly to its ability to infect diverse host species. Mutations in surface proteins, particularly the fusion (F) and hemagglutinin (H) proteins are crucial for determining host specificity and pathogenicity. These proteins demonstrate the highest nucleotide variability and are commonly utilised for molecular identification and lineage differentiation, emphasising the H protein ( 2 , 3 ). While initially considered immune to CDV, the virus has increasingly affected felids, with mass mortality events observed in wild lion populations ( 4 ). CDV outbreaks in felids have been linked to mutations in the virus surface proteins, particularly in the H protein binding site, which is crucial for interactions with host cell receptors, namely the signalling lymphocyte activation molecule (SLAM) and nectin-4 ( 5 ). Despite the rarity of CDV infections in domestic cats ( 6 , 7 ), outbreaks in wild felids highlight the possibility of severe consequences in big cat species. Panthera tigris , listed as endangered species under the International Union for Conservation of Nature (IUCN) Red List, has less than 200 estimated population in Malaysia ( 8 ). Factors such as anthropogenic disruption, environmental disturbances and infectious diseases could lead to possible extinction of the species. In mid-2019, the first confirmed case of CDV in a Malayan tiger ( P.tigris jacksoni ) occurred in Peninsular Malaysia. The affected tiger was found roaming close to the human population and exhibited unusual behaviour, prompting its capture and CDV diagnosis through molecular testing ( 9 ). The case raised concerns about the potential threat of CDV to the endangered Malayan tiger populations and the surrounding wildlife, highlighting the need for further research into the characteristics and pathogenicity of the virus in this species. The emergence of the CDV strain has raised a significant concern regarding its capability to infect Malayan tigers in their natural habitat. While studies on CDV in other tiger species have shown virus manifestation via histological analysis and highlighted the association between surface protein mutations and pathogenicity through comprehensive molecular characterisation ( 10 , 11 ), such comprehensive analysis is lacking for the Malayan tiger infected by the virus. As the affected tiger in our study is the first reported case of CDV infection among the Malayan tiger species, our understanding of the CDV strain and its pathogenicity in this species was limited, especially its origin and strain lineage. This study aimed to address critical gaps in understanding the CDV isolate infecting the Malayan tiger, including its pathological features and in vitro infective capability. Subsequently, a comprehensive molecular characterisation of the F and H genome and amino acid sequence, was conducted to investigate the origin of the strain and the potential implications of its mutations on tiger infection. Results Histopathological findings Histopathological manifestations of CDV in the brain, lung, kidney, spleen, liver, and stomach of Awang Besul were observed under a light microscope (Fig. 1 ) for any histological abnormalities pertaining to CDV infection. The brain shows diffused oedema in leptomeninges and mild mononuclear cells infiltration, while vascular congestion with thickened alveolar septa and diffused pulmonary oedema are seen in both lungs. In addition, glomerular and peritubular congestion and cytoplasmic vacuolation of renal tubule epithelium with lymphocytic infiltration are observed together with splenic intracapsular haemorrhage and severe lymphoid necrosis with lymphocytolysis. Hepatocytes individualisation and degeneration with mononuclear cells infiltration at the area of liver necrosis are present. The stomach shows cytoplasmic viral inclusion bodies. Through IHC, positive immunostaining indicated by dark brownish deposits is observed in various tissues of Awang Besul, including the lung, liver, kidney, and stomach (Fig. 2 ). The localisation of CDV antigen in the lung tissue is noted in the alveolar epithelium besides the presence of CDV antigen in the liver parenchyma where the degeneration of hepatocytes occurred. Presence of high immunolabelling is noted on the tubular epithelium of the kidney, indicating high CDV antigen. Similarly, positive immunolabelling of cytoplasmic antigens is detected in the gastric glands of the stomach lining. Virus isolation The CDV from the infected tiger pooled tissues was isolated by inoculating of the virus into the CHO-SLAM cells and monitored for CPE daily. The manifestation of CPE in the CHO-SLAM cells was observed 48 h post-infection (Fig. 3 ). The CPE in the CHO-SLAM is represented by cell fusion and clumping, minor syncytium formation, and cell detachment aligning with the CPE characteristics of most morbillivirus ( 12 ). At 72 h post-infection, no difference in CPE manifestation is detected, despite more cell being detached due to cell death. TCID 50 assay was done on the CDV-infected CHO-SLAM to determine the viral load in the infected tiger tissues. The tiger’s pooled tissues showed a high CDV TCID 50 value of 4.27 × 10 6 TCID 50 /mL at 48 h post-CDV infection. RT-PCR analysis The optimised reverse-transcription polymerase chain reaction (RT-PCR) for verification of the CDV isolate in the infected tiger was done using the H_CDV1 primer targeting a region in the H gene of the virus, which yielded the desired amplicon of 326 bp, followed by a qualitative observation via gel electrophoresis (Fig. 4 ). The RT-PCR result done after viral isolation via cell culture confirmed the presence of the CDV antigen that has been successfully propagated in the CHO-SLAM cells. CDV sequencing and characterisation The amplicons from the PCR gel electrophoresis for each gene were amplified using the optimised PCR method and designed primers and were retrieved and sequenced. The sequences (BesulMY) obtained were assembled by aligning them against existing sequences from the GenBank using MEGA-X software to obtain the full F and H genes. The completed sequences were translated to their amino acid sequences via the Expasy translating tool. The pairwise comparison revealed that the F gene exhibited 99.20% nucleotide similarity to the HeB(07)/EU327874.1 CDV isolate from China and 98.79% amino acid similarity to the CDV_TH/2014/AZO92836 strain from Thailand. In contrast, the BesulMY H gene demonstrated 99.18% nucleotide similarity to the SD(09)3/HM448834 isolate and 99.01% amino acid similarity to the SD(09)1/ADM26778.1 strain, both originating from China. To deduce the phylogenetic evolution of the BesulMY CDV strain, a phylogenetic analysis was performed on the full-length nucleotide coding sequences of the F (Fig. 5 ) and H genes (Fig. 6 ). Overall, the BesulMY CDV isolate identified is classified within the Asia-1 strain, demonstrating a high genetic evolutionary relationship with CDV isolates in China. Notably, the BesulMY H gene formed a distinctive cluster within a novel divergent clade, suggesting a distinct clade from other Asia-1 isolates. The BesulMY CDV F amino acid sequence was subjected to comparative evaluation with Asia-1 reference isolates of close similarity from the NCBI GenBank (Fig. 7 ). We observed a high variability of the amino acid sequence in the Fsp of the isolates, while the F1 and F2 regions are considered more conserved. Furthermore, the BesulMY CDV strain lacks the potential N-glycosylation site (N-X-S/T) at amino acid residue 62–64 compared to the reference amino acids. Conversely, all 17 cysteine residues are conserved in all compared strains. The deduced amino acid sequence of the H gene against the closest CDV isolates, as well as the isolate from an African lion from the Serengeti epidemic (AOV62807.1) (Fig. 8 ). Similarly to the deduced F amino acid sequence, albeit conserved cysteine residues, the CDV isolate in this study lacks the potential N-glycosylation site N456, where a N456H mutation occurred, while the rest of the potential N-glycosylation sites are conserved, including the three sites of N-glycosylation (sites N149, N422, and N587). We also observed mutations in the key residues of the H amino acid that determine host specificity in the SLAM-binding region (Table 2 ). Amino acid substitution combinations of 519I and 549H are observed in the H amino acid of the CDV isolate when compared to other canid and non-canid species, similar to previous observation on the CDV isolate in the Serengeti African lion (AOV62807.1). Table 1 Eight CDV primer sets of F and H full-length genome sequencing and their melting temperatures. Gene region Primer Set Direction Sequence Melting temperature, T m (℃) F F_CDV1 forward 5’ ACAGGCCAACCAAGTCCAC ’3 52.1 reverse 5’ CAAGCACCACTCCTGCAAAA ’3 F_CDV2 forward 5’ AGGGTCAGGTAGGAGACAAA ’3 51.5 reverse 5’ TCTGGCTACAAATGGCTGAT ’3 F_CDV3 forward 5’ AATTTTGGAGAGTCGGGGGA ’3 49.5 reverse 5’ TCAAGGATCTGGTTAGAGGAGT ’3 F_CDV4 forward 5’ CAATTATCAATCAGAGTCCT ’3 41.8 reverse 5’ AGCCCTAAGTTTTCTTTAAT ’3 H H_CDV1 forward 5’ AAACTTAGGGCTCAGGTAGT ’3 47.3 reverse 5’ TATGACTTGGTGATGTACGG ’3 H_CDV2 forward 5’ CCATCACTGGAGTTCGATTT ’3 47.4 reverse 5’ AACAATACGGTGCTCTCATC 3 H_CDV3 forward 5’ TTATCAAACGGTGGCTGAAT ’3 47.0 reverse 5’ GTCTCCTCTACTTGCTTTGT ’3 H_CDV4 forward 5’ TCTTATGGGCGGTTGACATT ’3 47.8 reverse 5’ ATTTCTTACCACGGTCATCA ’3 Table 2 H amino acid sequence comparison between BesulMY CDV strain (XBR33696) and reference isolates from GenBank. CDV isolates Animal Amino acid sites 519 530 549 XBR33696 Malayan tiger I G H AOV62807.1 African lion I D H ADM26778.1 Fox R G H ABY86899.1 Mink R G H UPP02772.1 Civet R G H AOA33117.1 Fox R G Y ABX84030.1 Fox R G Y AST23308.1 Dog R G Y UPX09259.1 Dog R G Y Discussion This study analysed tissue samples from the first reported CDV-positive Malayan tiger, confirmed by RT-PCR. The tiger exhibited clinical signs of CDV infection, including respiratory issues, seizures, and neurological symptoms ( 9 ). Histopathological findings in the tiger’s tissues were consistent with those observed in other CDV-infected hosts, including lymphocytolysis, interstitial pneumonia, oedema, tissue haemorrhage from viral disruption, and the presence of cytoplasmic inclusion bodies ( 13 ). These lesions resembled those documented in other felids infected with CDV, including lymphoid tissue depletion and hepatic necrosis ( 10 , 14 ). Previous studies also reported lymphoid tissue depletion in the lymph nodes as well as spleen and hepactocyte necrosis in other CDV-infected felids, namely lions and leopards. Pathological changes noted in commonly affected organs, such as the lungs, kidneys, and brain, have been documented, although their severity varies among different species ( 15 – 17 ). The variation in pathological changes among different CDV-infected animals is due to its multi-systemic nature and complex pathogenicity as a multi-host virus ( 10 ). Although histopathological analysis provides valuable insights into pathological manifestations of pathogens in host tissues, general histological changes proved unreliable for detecting CDV antigens ( 18 , 19 ). Inclusion bodies typically emerge in the later stages of the disease, and there is a potential of inaccurately perceiving other structures as virus-induced inclusions ( 20 ). Therefore, IHC provides significant value to pathological assays following the observed pathological lesions by confirming the presence of CDV antigens in the infected tissues through specific interactions with anti-CDV antibodies. This study confirmed CDV tissue lesions through histopathological and immunostaining methods using CDV-specific antibodies, followed by isolation of the wild-type CDV from the infected tiger. The observed high CPE at 48 h aligns with a previous study indicating distinct CPE development and high viral titres between 24 to 48 h post-infection of wild-type CDV ( 21 ). Despite previous challenges in infecting cell cultures with wild-type CDV strains as opposed to attenuated vaccine and recombinant strains ( 22 ), this study successfully induced CPE in CHO-SLAM cells following infection with CDV obtained from the tiger’s pooled tissues. The severe CPE observed at 48 h suggests robust viral replication, possibly attributed to stable SLAM receptor expression by CHO cells, facilitating virus-cell interaction and fusion. Furthermore, the high viral titre, as evidenced by the robust CPE observed indicates successful viral replication, contributing to infection severity and eventual host demise. The correlation between the elevated viral load and the observed CPE manifestation directly translates the viral replication efficiency and the resultant pathological consequences in the CDV-infected tiger. Subsequent molecular tests are crucial for precise strain identification and characterisation, providing insight into genetic composition and pathogenic mechanisms. In this study, CDV antigen verification was successfully performed on tiger tissue samples propagated in CHO-SLAM cell culture. Virus propagation was limited to a single passage to prevent nucleotide mutations introduced through cell culture adaptation ( 23 ). Successful in vitro infection facilitated the identification and analysis of the isolated CDV isolate from the infected tiger, focusing on the characteristics of the CDV F and H full genomes governing its pathogenicity. The findings of this study suggest a strong relationship between our studied isolate, which is classified into the Asia-1 lineage, and strains in China rather than Thailand, attributed to Thailand’s high CDV strain diversity ( 24 ), resulting in selective genetic spillover between countries. Selective spillover from China to Malaysia through Thailand borders could result from transmission dynamics of stable strains influenced by ecological factors. Notably, the CDV H gene formed a divergent clade from other Asia-1 isolates, suggesting a distinct Asia-1 clade in Malaysia. The observed divergence in this clade is hypothesised to result from the genetic drift of the virus and its adaptive capacity to thrive in the Malaysian environment and ecology. The study highlights the distinctive nature of the H gene, which displays the highest divergence among CDV genomes due to the protein’s crucial role in the initial virus-host interaction ( 24 ). Furthermore, the study identified specific point mutations in CDV F and H amino acids to assess CDV virulence in tigers. Generally, the F protein is a crucial component of the viral envelope, which is responsible for mediating the fusion of the viral membrane with the host cell membrane, allowing the virus to enter the cell ( 25 ). In this study, the signalling peptide (Fsp) region of the CDV F amino acid sequence exhibited the highest variability. The Fsp region is known to have the highest variations in all CDV isolates and is commonly used for strain identification when targeting the F gene region ( 26 ). In addition, changes in the N-glycosylation site and the cysteine residues may alter protein structure and affect disease induction. These alterations may affect the activation of the Fsp protein precursor through cleavage or the protein transfer to the proteolytic cleavage site ( 21 ). The N-glycosylation site, commonly found in most enveloped viruses, is crucial in enhancing virus infectivity and facilitating immune evasion within the host cells. Overall, the CDV isolate in this study lacks the potential N-glycosylation sites in both the F and H amino acid sequences compared to other CDV isolates. Reduced potential N-glycosylation sites in the F and H amino acids may diminish glycosylation activity, affecting viral biogenesis, antigenicity, and disease attenuation ( 27 ). However, Sawatsky and von Messling ( 28 ) challenged the notion by demonstrating the effect of non-glycosylated CDV H protein on the pathogenesis of CDV. Despite its reduced expression and virulence, they suggested glycosylation is not essential for maintaining virus immunosuppressive characteristics. The report conclusively demonstrated that the absence of N-glycosylation on the CDV H protein did not compromise its functional integrity. Therefore, the absence of potential N-glycosylation sites in the CDV strain in this study did not impact the virus infectivity as observed in vitro . However, future laboratory evaluations on other possible effects of reduced glycosylated sites in the CDV isolate are warranted to observe its pathogenicity in nature. In recent years, most molecular studies have focused on the H protein analysis due to its association with host recognition, resulting in pronounced genetic variability, specifically in residues 530 and 549 related to the SLAM-binding receptor region. While residue 530 was often found conserved in most species, residue 549 was often observed for its mutative capability that may be responsible for host range specificity and increased virulence. In this study, the CDV strain showed 549H residue in the H amino acid sequence, suggesting that the strain may originate and circulate among the wildlife population in Malaysia. Karki, Rajak ( 29 ) proposed that dog species tend to exhibit a 549Y mutation, while 549H was observed in most wildlife species (canid and non-canid), which showed the mutation observed in this study was associated with host species specificity. Additionally, they suggested that the Y549H mutation can occur due to selection pressure for viral adaptation from domestic species to the wildlife population. This study observed different mutations in the CDV isolate from the infected tiger but did not investigate how and when these mutations occurred. Therefore, a larger pool of CDV isolates among domestic and wildlife species in the vicinity needs to be obtained to determine the origin of the isolate and the factors causing these mutations, specifically in the Malayan tiger species. Additional mutations in other residues of the H amino acid generally do not correlate towards positive selection. However, the R519I substitution found in CDV isolates suggests potential host adaptability to non-canid species, particularly big cats in the felid family ( 2 , 30 ). This specific mutation, observed in other feline species like the Serengeti African lion, has been associated with fatal outcomes in non-canid species. The rare combination of mutations 519I and 549H substitution has been exclusively linked to 100% mortality in non-canids ( 4 , 30 ). A similar finding in this study postulated that the observed mutations influence viral entry in host cells and may contribute to the fatal outcome of the Malayan tiger. High viral replication, often correlated with increased disease severity, indicate heightened viral burden and tissue damage ( 31 ). The mutations observed in the viral protein may enhance viral replication efficiency, exacerbating the severity of CDV-induced pathology and leading to the tiger’s mortality. In light of the present findings, the extent of CDV spread in the wild Malayan tiger population needs to be addressed further and monitoring this disease should be incorporated into the current conservation strategy. Conclusion The presence of CDV in Malayan tigers was confirmed in this study, with typical histopathological changes and positive immunostaining observed. Although a reduced glycosylation site was observed in both the F and H amino acids, it did not diminish the capability of the isolate to induce disease in the Malayan tiger, leading it to its demise. Moreover, the H amino acid also showed a 549H mutation, indicating that the isolate has a distinct connection with the wildlife population, in addition to the 519I mutation, which is conserved in non-canid species. Molecular analysis revealed clustering of the virus in the Asia-1 region, closely resembling CDV isolates in China. This study provides insights into CDV pathogenesis and molecular profile in the Malayan tiger, laying the foundation for future preventative measures to safeguard the endangered Malayan tiger populations. Methods Study approval and sample background This study was conducted under the approval of the Department of Wildlife and National Parks (PERHILITAN) Peninsular Malaysia (Permit number: JPHL&TN (IP): 100 − 34/1.24 Jld 20( 11 )). Upon complaint by the public, a male Malayan tiger named Awang Besul seen roaming close to the human population, was captured by the PERHILITAN. Awang Besul was treated symptomatically at Sungkai Wildlife Conservation Centre; however, it died naturally in captivity one week post-capture and a post-mortem was conducted at the Faculty of Veterinary Medicine, Universiti Putra Malaysia. Sample processing for histopathological analysis The tissues (brain, lung, kidney, spleen, liver, and stomach) of Awang Besul were obtained from post-mortem examination of which sections of each tissue were fixed with 10% formalin before being embedded into paraffin blocks for histopathological and immunohistochemical evaluation. The tiger’s brain, lung, kidney, and spleen tissues were used for viral isolation and molecular characterisation and kept in a phosphate-buffered saline (PBS), pH 7.0 solution at -80 ℃. A total of 0.3 g of each tissue was cut, and the tissues were pooled together in 1 mL PBS before storing them at -80 ℃ until further use. CDV histopathological analysis Paraffin-fixed tissues were cut into 5 µm thick sections and stained with haematoxylin and eosin (H&E). The paraffin-embedded tissues were cut into 3 µm sections for immunohistochemistry (IHC) using an anti-CDV monoclonal primary antibody. the sections were deparaffinised in xylene, rehydrated in gradual alcohol concentrations, and microwaved at 50 W in pH 6.0 citrate buffer for 15 min for antigen retrieval. After washing with PBS 3 times at 3 min each, endogenous peroxidase activity was blocked with 3% hydrogen peroxide in PBS for 30 min before undergoing another washing step. The sections were then incubated with 1% bovine serum albumin (BSA) in PBS for 30 min to block non-specific antibody binding. The sections were incubated for 1 h at 37 ℃ with mouse anti-CDV monoclonal antibody (clone DV2-12) (Custom Monoclonal International, USA) (1:1500 dilution in PBS containing 0.1% BSA). After washing, the sections were incubated with a rabbit anti-mouse secondary antibody (Nichirei Biosciences, Japan) for 3 min at 37 ℃, washed, and incubated for 30–50 s with Liquid 3,3′-diaminobenzidine (DAB; DAKO, USA) for chromogen staining. They were then counter-stained with methylene blue (Bendosen, Malaysia), dried, and mounted with DPX (Sigma-Aldrich, USA) for qualitative immunolabelling. Brain tissues from a CDV-positive dog (courtesy of Dr. Apisit Pornthummawat, Mahidol University) and tissues of brain, lung, kidney from a CDV-negative Malayan tiger were subjected to the same protocol as positive and negative control, respectively. Cell culture and virus isolation The study used Chinese ovarian hamster cells expressing the human signalling lymphocytic activation molecule receptor (CHO-SLAM) for CDV host identification ( 12 ). The cells were maintained in cell media, consisted of RPMI media (Gibco, USA) 10% foetal bovine serum (FBS; Gibco, USA), 1% Penicillin-Streptomycin-Glutamine (PSG), and Geneticin™ (G418 sulfate; Gibco, USA) at 37 ℃ in 5% CO 2 . Cells at 70–80% confluency were used for subsequent assays. CDV was collected from the tiger pooled tissues. The tissues were ground with sterile sand, and homogenised in 5 ml PBS. The homogenate was centrifuged at 1,500 rpm for 5 min and filtered through a 0.22 µm filter to collect the virus. Confluent cells were rinsed with PBS twice, and 1 ml of cell media was added. A total of 100 µl of virus was inoculated into the cell culture and incubated at 37 ℃, 5% CO 2 for 45 min, then additional 4 ml of cell media was added. Cells were monitored daily for qualitative cytopathic effect (CPE). Upon confirming CPE, the culture underwent a free-thaw cycle three times to release the virus.. The media supernatant containing the virus was collected. The CHO-SLAM cells were sub-cultured in 24-well plates (BioFil, India) for viral titration using a 50% tissue culture infectious dose (TCID 50 ) assay with virus dilutions from 10 − 1 to 10 − 10 ( 32 ). The virus-inoculated cells were maintained at 37 ℃, 5% CO 2 and monitored daily for CPE. Once CPE was confirmed, the average TCID 50 evaluation (done in triplicates) was calculated using the Spearman-Kärber formula ( 33 , 34 ). Primer design, RT-PCR and genomic sequencing CDV reference sequences from the Asian region were retrieved from GenBank and aligned using Molecular Evolutionary Genetics Analysis Version 10 (MEGA-X) software to design primers specific to the CDV F and H gene coding regions (Table 1 ). The primers were designed using the Primer-Basic Local Alignment Search Tool (Primer-BLAST) tool. Their specificity to CDV was validated via the Basic Local Alignment Search Tool for nucleotides (BLASTn). CDV viral RNA was extracted from the cell culture using the Nucleospin RNA Virus Kit (Macherey-Nagel, Germany), followed by cDNA synthesis using the SensiFAST cDNA Synthesis Kit (Bioline, UK) according to the manufacturer’s protocol. Polymerase chain reaction (PCR) amplification of the cDNA was performed using the MyTaq Red Mix kit (Bioline, UK) according to the manufacturer’s protocol utilising the primers designed. The PCR cycle included initial denaturation at 95 ℃ for 1 min; 30 cycles of denaturation at 94 ℃ for 1 min, annealing following the primers’ T m for 1 min, and extension at 72 ℃ for 50 s; and a final extension at 72 ℃ for 3 min. Recombitek C3 vaccine (Boehringer Ingelheim, Germany) and nuclease-free water were used as positive and negative controls, respectively. Amplified PCR products were purified and sequenced using an ABI PRISM 3730xl Genetic Analyser (Applied Biosystems, USA). Full-length F and H genome sequences The sequences of the amplified amplicons were aligned using the MEGA-X software for each gene segment to get the full F and H genome sequence and deposited in the GenBank. Afterwards, each sequence was converted into the amino acid sequence using the Expasy translating tool ( https://web.expasy.org/translate/ ). The sequences for each protein region were compared to the sequences of their closest CDV strain relatives and the chemical composition. The cysteine residue and the N-glycosylation sites were determined using the Expasy ProtParam tool ( https://web.expasy.org/protparam/ ) and the NetNGlyc software ( https://services.healthtech.dtu.dk/services/NetNGlyc-1.0/ ). Each amino acid sequence was evaluated for the mentioned characteristics above by comparing them to reference genes from the National Centre for Biotechnology Information (NCBI) via the BioEdit sequence alignment tool ( 35 ). The complete sequence of both F and H gene were deposited in GenBank as PP894824.1 and PP894823.1. Phylogenetic analyses Phylogenetic analysis was done on F and H genomic sequences against a list of CDV sequences of various geographical locations retrieved from the NCBI GenBank. The phylogenetic analysis was done using the MEGA-X software, and the maximum likelihood (ML) tree was constructed using a substitution model with a bootstrap value of 1000 replicates calculating the topology, and branch lengths likelihood in addition to, applying the Tamura 3-parameter substitution model parameter on the CDV sequences for the highest overall likelihood score ( 36 ). Abbreviations CDV Canine distemper virus F Fusion H Hemagglutinin SLAM Signalling lymphocye activation molecule IUCN International Union for Conservation of Nature PCR Polymerase chain reaction RT-PCR Reverse transcription polymerase chain reaction Fsp Fusion signalling peptide PERHILITAN Department of Wildlife and National Parks PBS Phosphate-buffered saline H&E Hematoxylin and eosin IHC Immunohistochemistry BSA Bovine serum albumin DAB Diaminobenzidine CHO-SLAM Chinese ovarian hamster cells expressing the human signalling lymphocytic activation molecule receptor PSG Penicillin-Streptomycin-Glutamine CPE Cytopathic effect TCID 50 Titration using a 50% tissue culture infectious dose MEGA-X Molecular Evolutionary Genetics Analysis Version 10 BLAST Basic Local Alignment Search Tool NCBI National Centre for Biotechnology Information ML Maximum likelihood Declarations Ethics approval and consent to participate This study was approved by the Department of Wildlife and National Parks (PERHILITAN) Peninsular Malaysia. A permit letter to conduct this study (JPHL&TN (IP): 100-34/1.24 Jld 20(11)) was obtained from the organisation. Consent for publication Not applicable. Availability of data and materials All data analysed and used for this study are included in the result section. The full datasets will be made available from the corresponding upon reasonable request. Competing interest The authors report no potential conflict of interest. Funding This study was financially supported by the National Conservation Trust Fund (NCTF) under the Ministry of Natural Resources, Environment and Climate Change, Malaysia, with reference number KeTSA (S) 600-2/1/48/4(JLD2). Authors’ contributions Conceptualisation: FMK, MFMS, AS, TRPTA, HA, AK, KKH, RAW, LA, MG; Data curation: MFMS, FMK, AS, NIU, MAR ; Formal analysis: MFMS, FMK, AS, NIU, MAR; Funding acquisition: FMK, TRPTA, HA, AK, KKH, RAW; Investigation: MFMS, FMK,TRPTA, AS, NIU, MAR; Methodology: MFMS, FMK, AS, NIU, MAR; Project administration: FMK; Resources: FMK, TRPTA, AS, NIU, MAR; Software: MFMS; Supervision: FMK, AS, NIU, MAR Validation: FMK; Visualisation: MFMS, AS, NIU, MAR; Writing - original draft: MFMS; Writing - review and editing: MFMS, MAR, AS, NIUZ, TRPTA, HA, AK, KKH, RAW, LA, MG, FMK. Acknowledgements We would like to express our thanks to Professor Hironobu Tatsuo, Kyushu University for graciously providing the CHO-SLAM cell line. We are also grateful to Dr. Apisit Pornthummawat, Mahidol University for providing the CDV-positive dog formalin-fixed paraffin-embedded tissue control. We would also like to thank the PERHILITAN Peninsular Malaysia for the research permits given, JPHL&TN(IP):100-34/1.24 Jld 20(11). Thank you to all individuals from the Virology and Histopathology laboratories, Faculty of Veterinary Medicine, Universiti Putra Malaysia for their technical assistance. References Deem SL, Spelman LH, Yates RA, Montali RJ. Canine distemper in terrestrial carnivores: a review. J Zoo Wildl Med. 2000;31(4):441–51. Trogu T, Castelli A, Canziani S, Tolini C, Carrera M, Sozzi E et al. Detection and Molecular Characterization of Canine Distemper Virus in Wildlife from Northern Italy. Pathogens. 2022;11(12). Romanutti C, Gallo Calderón M, Keller L, Mattion N, La Torre J. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs. J Virol Methods. 2016;228:79–83. Duque-Valencia J, Sarute N, Olarte-Castillo XA, Ruíz-Sáenz J. Evolution and Interspecies Transmission of Canine Distemper Virus-An Outlook of the Diverse Evolutionary Landscapes of a Multi-Host Virus. Viruses. 2019;11(7). Beineke A, Baumgärtner W, Wohlsein P. Cross-species transmission of canine distemper virus-an update. One Health. 2015;1:49–59. Appel MJG, Summers BA. Pathogenicity of morbilliviruses for terrestrial carnivores. Vet Microbiol. 1995;44(2):187–91. Harder TC, Kenter M, Vos H, Siebelink K, Huisman W, van Amerongen G, et al. Canine distemper virus from diseased large felids: biological properties and phylogenetic relationships. J Gen Virol. 1996;77(Pt 3):397–405. Ten DCY, Jani R, Hashim NH, Saaban S, Abu Hashim AK, Abdullah MT. Panthera tigris jacksoni Population Crash and Impending Extinction due to Environmental Perturbation and Human-Wildlife Conflict. Anim (Basel). 2021;11(4). PERHILITAN. ‘Awang Besul’ The Tiger Dies 2019 [ https://harimau.my/awang-besul-the-tiger-dies/ Kadam RG, Karikalan M, Siddappa CM, Mahendran K, Srivastava G, Rajak KK et al. Molecular and pathological screening of canine distemper virus in Asiatic lions, tigers, leopards, snow leopards, clouded leopards, leopard cats, jungle cats, civet cats, fishing cat, and jaguar of different states, India. Infection, Genetics and Evolution. 2022;98:105211. Roelke-Parker ME, Munson L, Packer C, Kock R, Cleaveland S, Carpenter M, et al. A canine distemper virus epidemic in Serengeti lions (Panthera leo). Nature. 1996;379(6564):441–5. Tatsuo H, Ono N, Yanagi Y. Morbilliviruses use signaling lymphocyte activation molecules (CD150) as cellular receptors. J Virol. 2001;75(13):5842–50. Creevy KE, Evans JB, Canine. Distemper2022. https://www.msdvetmanual.com/generalized-conditions/canine-distemper/canine-distemper#:~:text=Etiology%20and%20Pathogenesis%20of%20Canine %20Distemper&text=Infection%20is%20transmitted%20mainly%20via,tissue%20of%20the%20respiratory%20tract Appel MJG, Yates RA, Foley GL, Bernstein JJ, Santinelli S, Spelman LH, et al. Canine Distemper Epizootic in Lions, Tigers, and Leopards in North America. J Vet Diagn Invest. 1994;6(3):277–88. Beineke A, Puff C, Seehusen F, Baumgärtner W. Pathogenesis and immunopathology of systemic and nervous canine distemper. Vet Immunol Immunopathol. 2009;127(1):1–18. Lempp C, Spitzbarth I, Puff C, Cana A, Kegler K, Techangamsuwan S, et al. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis. Viruses. 2014;6(7):2571–601. Summers BA, Greisen HA, Appel MJG. Canine distemper encephalomyelitis: Variation with virus strain. J Comp Pathol. 1984;94(1):65–75. Ducatelle R, Coussement W, Hoorens J. Demonstration of canine distemper viral antigen in paraffin sections, using an unlabeled antibody-enzyme method. Am J Vet Res. 1980;41(11):1860–2. Miry C, Ducatelle R, Thoonen H, Hoorens J. Immunoperoxidase study of canine distemper virus pneumonia. Res Vet Sci. 1983;34(2):145–8. Haines DM, Martin KM, Chelack BJ, Sargent RA, Outerbridge CA, Clark EG. Immunohistochemical detection of canine distemper virus in haired skin, nasal mucosa, and footpad epithelium: a method for antemortem diagnosis of infection. J Vet Diagn Invest. 1999;11(5):396–9. Romanutti C, Keller L, La Torre J, Panzera Y, Fuques E, Pérez R, et al. Virus isolation and full-length genome sequencing of a representative canine distemper virus wild type strain of the South America 2 clade. J Virol Methods. 2020;279:113857. Tan B, Wen Y-J, Wang F-X, Zhang S-Q, Wang X-D, Hu J-X, et al. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China. Virol J. 2011;8(1):520. Cherpillod P, Beck K, Zurbriggen A, Wittek R. Sequence analysis and expression of the attachment and fusion proteins of canine distemper virus wild-type strain A75/17. J Virol. 1999;73(3):2263–9. Piewbang C, Chansaenroj J, Kongmakee P, Banlunara W, Poovorawan Y, Techangamsuwan S. Genetic Adaptations, Biases, and Evolutionary Analysis of Canine Distemper Virus Asia-4 Lineage in a Fatal Outbreak of Wild-Caught Civets in Thailand. Viruses. 2020;12(4). Villanueva RA, Rouillé Y, Dubuisson J. Interactions between virus proteins and host cell membranes during the viral life cycle. Int Rev Cytol. 2005;245:171–244. Sarute N, Calderón MG, Pérez R, La Torre J, Hernández M, Francia L, et al. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification. PLoS ONE. 2013;8(5):e63595. Vigerust DJ, Shepherd VL. Virus glycosylation: role in virulence and immune interactions. Trends Microbiol. 2007;15(5):211–8. Sawatsky B, von Messling V. Canine distemper viruses expressing a hemagglutinin without N-glycans lose virulence but retain immunosuppression. J Virol. 2010;84(6):2753–61. Karki M, Rajak KK, Singh RP. Canine morbillivirus (CDV): a review on current status, emergence and the diagnostics. VirusDisease. 2022;33(3):309–21. Nikolin VM, Olarte-Castillo XA, Osterrieder N, Hofer H, Dubovi E, Mazzoni CJ, et al. Canine distemper virus in the Serengeti ecosystem: molecular adaptation to different carnivore species. Mol Ecol. 2017;26(7):2111–30. Murugesan A, Manoharan M. Chapter 16 - Dengue Virus. In: Ennaji MM, editor. Emerging and Reemerging Viral Pathogens. Academic; 2020. pp. 281–359. Muench HR. A simple method of estimating 50 per cent end points. Am J Hyg. 1938;27:493–7. Spearman CI. The method of ‘right and wrong cases’ (‘constant stimuli’) without Gauss’s formulae. Br J Psychol. 1908;2:227–47. Kärber G. Beitrag zur kollektiven behandlung pharmakologiseher reihenversuche. Arch Exp Path Pharmaco. 1931(162):480–4. Alzohairy A, BioEdit. An important software for molecular biology. GERF Bull Biosci. 2011;2:60–1. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–9. Supplementary File Supplementary Figure 1 is not available with this version. Supplementary Figure 1; Uncropped gel electrophoresis picture of CDV antigen RT-PCR verification in the infected tiger (BesulMY) Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5032158","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":351401414,"identity":"aadcb135-37d8-47ed-9be9-270f54f704bb","order_by":0,"name":"Muhammad Farris Mohd Sadali","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Farris Mohd","lastName":"Sadali","suffix":""},{"id":351401416,"identity":"d8aa85d7-03e7-4044-adc1-eca14d003ce6","order_by":1,"name":"Mariatulqabtiah Abdul Razak","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Mariatulqabtiah","middleName":"Abdul","lastName":"Razak","suffix":""},{"id":351401417,"identity":"fe3a8cbd-61b9-4510-a0c9-876529fd5545","order_by":2,"name":"Annas Salleh","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Annas","middleName":"","lastName":"Salleh","suffix":""},{"id":351401418,"identity":"917f403b-2581-483d-9f8e-d6ba463f054a","order_by":3,"name":"Nurul Izzati Uda Zahli","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Nurul","middleName":"Izzati Uda","lastName":"Zahli","suffix":""},{"id":351401419,"identity":"58cd0ff6-2c23-41f9-87ee-a4b3f2046279","order_by":4,"name":"Tengku Rinalfi Putra Tengku Azizan","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Tengku","middleName":"Rinalfi Putra Tengku","lastName":"Azizan","suffix":""},{"id":351401420,"identity":"f14d2015-253b-4eca-a9b4-8bcc1947bd1f","order_by":5,"name":"Hafandi Ahmad","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Hafandi","middleName":"","lastName":"Ahmad","suffix":""},{"id":351401421,"identity":"37ca8a00-ec01-4436-bf72-e32ddf5f49b9","order_by":6,"name":"Mohd Arifin Kaderi","email":"","orcid":"","institution":"Kulliyyah of Allied Health Sciences, International Islamic University Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Mohd","middleName":"Arifin","lastName":"Kaderi","suffix":""},{"id":351401422,"identity":"7e1ebea6-46b8-4cee-92b3-6d12347f9144","order_by":7,"name":"Kuan Hua Khor","email":"","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":false,"prefix":"","firstName":"Kuan","middleName":"Hua","lastName":"Khor","suffix":""},{"id":351401423,"identity":"f83282aa-7372-4bf8-b8a7-082c22589d38","order_by":8,"name":"Ridhwan Abdul Wahab","email":"","orcid":"","institution":"MAHSA University","correspondingAuthor":false,"prefix":"","firstName":"Ridhwan","middleName":"Abdul","lastName":"Wahab","suffix":""},{"id":351401424,"identity":"5f7b3be6-99fb-49bb-8dc0-040ee49a086e","order_by":9,"name":"Lutfi Abdullah","email":"","orcid":"","institution":"National Parks Peninsular Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Lutfi","middleName":"","lastName":"Abdullah","suffix":""},{"id":351401425,"identity":"28e91bdd-f868-460f-a233-e629bce443f4","order_by":10,"name":"Millawati Gani","email":"","orcid":"","institution":"National Parks Peninsular Malaysia","correspondingAuthor":false,"prefix":"","firstName":"Millawati","middleName":"","lastName":"Gani","suffix":""},{"id":351401426,"identity":"8ecbc649-7c67-4820-8342-fa2cfe875b0c","order_by":11,"name":"Farina Mustaffa-Kamal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwklEQVRIiWNgGAWjYBAC9gYGhgMMDDYQHg8xWngOgLWkkagFCA6TooX97MPDBTXnE7eLHWB88LaNIdrgACEtPOkGh2ccu524c3YCs+HcNobcDYS02AO9cZiH7XbihtsJbNK8xGjh4X8G1PLvHEgL+2/itEgAbeFtOwC2hZlILUBbePuSjXfOTmyWnHNOIncmYYelMX/m+WYnu106+eCHN2U2uX2EtMCBAQNjA5CSYFAgQQsUyDcQq2UUjIJRMApGCgAATnND/I+qpIQAAAAASUVORK5CYII=","orcid":"","institution":"Universiti Putra Malaysia, UPM Serdang","correspondingAuthor":true,"prefix":"","firstName":"Farina","middleName":"","lastName":"Mustaffa-Kamal","suffix":""}],"badges":[],"createdAt":"2024-09-04 13:51:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5032158/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5032158/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":67194893,"identity":"d3231a9f-4e6d-4913-b78d-6009ad0dbc7d","added_by":"auto","created_at":"2024-10-22 09:02:24","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1036207,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistological observation on CDV lesions in the tiger’s tissues:\u003c/strong\u003e a) Brain showing diffused oedema in the leptomeninges and mild mononuclear cells infiltration (arrows, H\u0026amp;E 200X) b) Lung showing vascular congestion with thickened alveolar septa and diffused pulmonary oedema, H\u0026amp;E 200X; c) Kidney showing glomerular and peritubular congestion and cytoplasmic vacuolation of renal tubule epithelium with lymphocytic infiltration, H\u0026amp;E 200X; d) Spleen showing intracapsular haemorrhage, severe lymphoid necrosis with lymphocytolysis, H\u0026amp;E 200X; e) Liver showing hepatocytes individualisation and degeneration with mononuclear cells infiltration at the area of necrosis, H\u0026amp;E 200X; and f) Stomach showing cytoplasmic viral inclusion bodies (inset) and macrophage (arrow; H\u0026amp;E 400X).\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/01f12ad022f4d1f33ccdbe28.jpg"},{"id":67194894,"identity":"a489feb6-eb9f-4d7d-b780-70e8b633fed2","added_by":"auto","created_at":"2024-10-22 09:02:24","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1903422,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemical detection of CDV antigen in the tiger’s tissues:\u003c/strong\u003e a) Lung showing positive CDV antigen immunolabelling in the alveolar epithelium, 200X; b) Liver showing strong immunolabelling of cytoplasmic CDV antigen thoroughly in degenerate hepatocytes, 200X; c) Kidney section with dense accumulation of intracellular viral antigens in the tubular walls, 200X; d) Positive immunolabelling was observed in the gastric mucosa of the stomach lining, 200X.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/3bb598e8dd2b6edc8c16f8e7.jpg"},{"id":67196382,"identity":"fe7922b1-d175-4a10-b1c9-66f6a040c17b","added_by":"auto","created_at":"2024-10-22 09:10:24","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3666649,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCDV BesulMY infection in the CHO-SLAM cell culture observed for cytopathic effect 48 h after infection: \u003c/strong\u003ea) Normal CHO-SLAM cell culture, 100X and b) CHO-SLAM cell culture infected with the CDV isolate from the infected tiger showing cell clumping and detachment, 100X.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/7276ecb2bae7d2aa109b382a.jpg"},{"id":67197266,"identity":"5f9673d8-f1ef-4503-84e5-ff2310a9d353","added_by":"auto","created_at":"2024-10-22 09:18:24","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":172740,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGel electrophoresis(cropped) showing result for CDV antigen RT-PCR verification in the infected tiger (BesulMY)\u003c/strong\u003e shows the desired amplicon (326 bp) related to CDV based on a 100-bp DNA ladder (Vivantis Technologies, Malaysia) and compared with against a positive control (+ve; Recombitek C3 vaccine; Boehringer Ingelheim; Germany) and negative control (-ve; nuclease-free water).Full-length gel is presented in Supplementary Figure 1.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/71e2d4c5329ed627686adc72.jpg"},{"id":67196381,"identity":"2fcfd355-6642-42cd-8bcc-be464cf4147a","added_by":"auto","created_at":"2024-10-22 09:10:24","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":881944,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of the full-length \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene of CDV isolates based on nucleotide sequence alignment. \u003c/strong\u003eThe phylogenetic tree was constructed using the MEGA-X software. The evolutionary history was inferred using the Maximum Likelihood method with 1000 bootstrap. Bootstrap values of \u0026gt;50% where the associated taxa are clustered together, are shown on the branch points. The complete \u003cem\u003eF\u003c/em\u003e gene coding sequence of BesulMY CDV strain (PP894824) is indicated by the symbol (▼).\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/0432d72928a798db65f12c4f.jpg"},{"id":67194900,"identity":"f8288c73-0c57-45fc-a275-142ae35253c0","added_by":"auto","created_at":"2024-10-22 09:02:24","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":920391,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic tree of the full-length \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eH\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene of CDV isolates based on nucleotide sequence alignment.\u003c/strong\u003e The phylogenetic tree was constructed using the MEGA-X software. The evolutionary history was inferred using the maximum likelihood method with 1000 bootstraps. Bootstrap values of \u0026gt;50% where the associated taxa clustered together, are shown on the branch points. The complete \u003cem\u003eH\u003c/em\u003e gene coding sequence of the BesulMY CDV strain (PP894823) is indicated by the symbol (▼).\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/29a85a31d791dd326e26b542.jpg"},{"id":67194898,"identity":"ce0ef687-f9b5-49bd-b31b-47987e678e16","added_by":"auto","created_at":"2024-10-22 09:02:24","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1653135,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eF amino acid sequence alignment divided by their respective regions (Fsp, F1, and F2).\u003c/strong\u003e The green region represents potential N-glycosylation sites and the blue region represents cysteine residues, while ▼ signifies cleavage sites. The BesulMY CDV strain (XBR33697) has the highest F protein amino acid similarity to AZO92836.1/dog/CDV_TH/2014/Thai/2014 strain at 98.79%. The alignment showed the highest amino acid variability in the Fsp region among all isolates. The CDV isolate studied showed a lack of potential N-glycosylation site in this region.\u003c/p\u003e","description":"","filename":"Fig.7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/c4703a17871a1c12eaf45b84.jpg"},{"id":67194901,"identity":"e41fbc5f-897a-4d50-bc8b-941f66253cd4","added_by":"auto","created_at":"2024-10-22 09:02:24","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":2791201,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eH amino acid sequence alignment highlights residues of interest for viral mutation regarding to host specification.\u003c/strong\u003e The green region represents potential N-glycosylation sites, and the blue represents cysteine residues. The BesulMY CDV strain (XBR33696) has the highest H protein amino acid similarity to ADM26778.1/fox/SD(09)1/Chi/2010 strain at 99.01%. The CDV isolate from the Malayan tiger exhibits the 549H mutation, while the 530G are conserved in all isolates. Mutation at the 519 amino acid position is also observed, where the CDV isolate harbours a 519I mutation.\u003c/p\u003e","description":"","filename":"Fig.8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/8f405a9bb0ed1d8262176f81.jpg"},{"id":79154300,"identity":"125ac9e1-8891-433c-9f5c-62a966090db9","added_by":"auto","created_at":"2025-03-25 05:39:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":14180772,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5032158/v1/dde871b8-59dd-4046-8263-d06502827d1a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular characterisation and histopathological analysis of canine distemper virus in a Malayan tiger (Panthera tigris jacksoni)","fulltext":[{"header":"Background","content":"\u003cp\u003eCanine distemper virus (CDV) is a highly contagious pathogen affecting carnivorous mammals, including domestic and wildlife populations, often leading to severe illness and, in some cases, fatal outcomes. Belonging to the \u003cem\u003eMorbillivirus\u003c/em\u003e genus within the \u003cem\u003eParamyxoviridae\u003c/em\u003e family, CDV is characterised by its enveloped structure and negative-sense, single-stranded RNA genome (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). To date, the virus has been implicated in mass deaths of various carnivorous and non-carnivorous animals. Being an RNA virus, CDV exhibits high mutation rates and broad cell tropism, which contribute significantly to its ability to infect diverse host species. Mutations in surface proteins, particularly the fusion (F) and hemagglutinin (H) proteins are crucial for determining host specificity and pathogenicity. These proteins demonstrate the highest nucleotide variability and are commonly utilised for molecular identification and lineage differentiation, emphasising the H protein (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWhile initially considered immune to CDV, the virus has increasingly affected felids, with mass mortality events observed in wild lion populations (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). CDV outbreaks in felids have been linked to mutations in the virus surface proteins, particularly in the H protein binding site, which is crucial for interactions with host cell receptors, namely the signalling lymphocyte activation molecule (SLAM) and nectin-4 (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). Despite the rarity of CDV infections in domestic cats (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e), outbreaks in wild felids highlight the possibility of severe consequences in big cat species.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePanthera tigris\u003c/em\u003e, listed as endangered species under the International Union for Conservation of Nature (IUCN) Red List, has less than 200 estimated population in Malaysia (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Factors such as anthropogenic disruption, environmental disturbances and infectious diseases could lead to possible extinction of the species. In mid-2019, the first confirmed case of CDV in a Malayan tiger (\u003cem\u003eP.tigris jacksoni\u003c/em\u003e) occurred in Peninsular Malaysia. The affected tiger was found roaming close to the human population and exhibited unusual behaviour, prompting its capture and CDV diagnosis through molecular testing (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The case raised concerns about the potential threat of CDV to the endangered Malayan tiger populations and the surrounding wildlife, highlighting the need for further research into the characteristics and pathogenicity of the virus in this species.\u003c/p\u003e \u003cp\u003eThe emergence of the CDV strain has raised a significant concern regarding its capability to infect Malayan tigers in their natural habitat. While studies on CDV in other tiger species have shown virus manifestation via histological analysis and highlighted the association between surface protein mutations and pathogenicity through comprehensive molecular characterisation (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e), such comprehensive analysis is lacking for the Malayan tiger infected by the virus. As the affected tiger in our study is the first reported case of CDV infection among the Malayan tiger species, our understanding of the CDV strain and its pathogenicity in this species was limited, especially its origin and strain lineage.\u003c/p\u003e \u003cp\u003eThis study aimed to address critical gaps in understanding the CDV isolate infecting the Malayan tiger, including its pathological features and \u003cem\u003ein vitro\u003c/em\u003e infective capability. Subsequently, a comprehensive molecular characterisation of the F and H genome and amino acid sequence, was conducted to investigate the origin of the strain and the potential implications of its mutations on tiger infection.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological findings\u003c/h2\u003e \u003cp\u003eHistopathological manifestations of CDV in the brain, lung, kidney, spleen, liver, and stomach of Awang Besul were observed under a light microscope (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) for any histological abnormalities pertaining to CDV infection. The brain shows diffused oedema in leptomeninges and mild mononuclear cells infiltration, while vascular congestion with thickened alveolar septa and diffused pulmonary oedema are seen in both lungs. In addition, glomerular and peritubular congestion and cytoplasmic vacuolation of renal tubule epithelium with lymphocytic infiltration are observed together with splenic intracapsular haemorrhage and severe lymphoid necrosis with lymphocytolysis. Hepatocytes individualisation and degeneration with mononuclear cells infiltration at the area of liver necrosis are present. The stomach shows cytoplasmic viral inclusion bodies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThrough IHC, positive immunostaining indicated by dark brownish deposits is observed in various tissues of Awang Besul, including the lung, liver, kidney, and stomach (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The localisation of CDV antigen in the lung tissue is noted in the alveolar epithelium besides the presence of CDV antigen in the liver parenchyma where the degeneration of hepatocytes occurred. Presence of high immunolabelling is noted on the tubular epithelium of the kidney, indicating high CDV antigen. Similarly, positive immunolabelling of cytoplasmic antigens is detected in the gastric glands of the stomach lining.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eVirus isolation\u003c/h2\u003e \u003cp\u003eThe CDV from the infected tiger pooled tissues was isolated by inoculating of the virus into the CHO-SLAM cells and monitored for CPE daily. The manifestation of CPE in the CHO-SLAM cells was observed 48 h post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The CPE in the CHO-SLAM is represented by cell fusion and clumping, minor syncytium formation, and cell detachment aligning with the CPE characteristics of most morbillivirus (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). At 72 h post-infection, no difference in CPE manifestation is detected, despite more cell being detached due to cell death. TCID\u003csub\u003e50\u003c/sub\u003e assay was done on the CDV-infected CHO-SLAM to determine the viral load in the infected tiger tissues. The tiger\u0026rsquo;s pooled tissues showed a high CDV TCID\u003csub\u003e50\u003c/sub\u003e value of 4.27 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL at 48 h post-CDV infection.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eRT-PCR analysis\u003c/h2\u003e \u003cp\u003eThe optimised reverse-transcription polymerase chain reaction (RT-PCR) for verification of the CDV isolate in the infected tiger was done using the H_CDV1 primer targeting a region in the \u003cem\u003eH\u003c/em\u003e gene of the virus, which yielded the desired amplicon of 326 bp, followed by a qualitative observation via gel electrophoresis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The RT-PCR result done after viral isolation via cell culture confirmed the presence of the CDV antigen that has been successfully propagated in the CHO-SLAM cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003eCDV sequencing and characterisation\u003c/h2\u003e \u003cp\u003eThe amplicons from the PCR gel electrophoresis for each gene were amplified using the optimised PCR method and designed primers and were retrieved and sequenced. The sequences (BesulMY) obtained were assembled by aligning them against existing sequences from the GenBank using MEGA-X software to obtain the full \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e genes. The completed sequences were translated to their amino acid sequences via the Expasy translating tool. The pairwise comparison revealed that the \u003cem\u003eF\u003c/em\u003e gene exhibited 99.20% nucleotide similarity to the HeB(07)/EU327874.1 CDV isolate from China and 98.79% amino acid similarity to the CDV_TH/2014/AZO92836 strain from Thailand. In contrast, the BesulMY \u003cem\u003eH\u003c/em\u003e gene demonstrated 99.18% nucleotide similarity to the SD(09)3/HM448834 isolate and 99.01% amino acid similarity to the SD(09)1/ADM26778.1 strain, both originating from China.\u003c/p\u003e \u003cp\u003eTo deduce the phylogenetic evolution of the BesulMY CDV strain, a phylogenetic analysis was performed on the full-length nucleotide coding sequences of the \u003cem\u003eF\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) and \u003cem\u003eH\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Overall, the BesulMY CDV isolate identified is classified within the Asia-1 strain, demonstrating a high genetic evolutionary relationship with CDV isolates in China. Notably, the BesulMY \u003cem\u003eH\u003c/em\u003e gene formed a distinctive cluster within a novel divergent clade, suggesting a distinct clade from other Asia-1 isolates.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe BesulMY CDV F amino acid sequence was subjected to comparative evaluation with Asia-1 reference isolates of close similarity from the NCBI GenBank (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). We observed a high variability of the amino acid sequence in the Fsp of the isolates, while the F1 and F2 regions are considered more conserved. Furthermore, the BesulMY CDV strain lacks the potential N-glycosylation site (N-X-S/T) at amino acid residue 62\u0026ndash;64 compared to the reference amino acids. Conversely, all 17 cysteine residues are conserved in all compared strains. The deduced amino acid sequence of the \u003cem\u003eH\u003c/em\u003e gene against the closest CDV isolates, as well as the isolate from an African lion from the Serengeti epidemic (AOV62807.1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Similarly to the deduced F amino acid sequence, albeit conserved cysteine residues, the CDV isolate in this study lacks the potential N-glycosylation site N456, where a N456H mutation occurred, while the rest of the potential N-glycosylation sites are conserved, including the three sites of N-glycosylation (sites N149, N422, and N587).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also observed mutations in the key residues of the H amino acid that determine host specificity in the SLAM-binding region (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Amino acid substitution combinations of 519I and 549H are observed in the H amino acid of the CDV isolate when compared to other canid and non-canid species, similar to previous observation on the CDV isolate in the Serengeti African lion (AOV62807.1).\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEight CDV primer sets of \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e full-length genome sequencing and their melting temperatures.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Set\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDirection\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMelting temperature, T\u003csub\u003em\u003c/sub\u003e (℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003e\u003cem\u003eF\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF_CDV1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eACAGGCCAACCAAGTCCAC\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e52.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eCAAGCACCACTCCTGCAAAA\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF_CDV2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eAGGGTCAGGTAGGAGACAAA\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e51.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eTCTGGCTACAAATGGCTGAT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF_CDV3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eAATTTTGGAGAGTCGGGGGA\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e49.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eTCAAGGATCTGGTTAGAGGAGT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF_CDV4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eCAATTATCAATCAGAGTCCT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e41.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eAGCCCTAAGTTTTCTTTAAT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003e\u003cem\u003eH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH_CDV1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eAAACTTAGGGCTCAGGTAGT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e47.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eTATGACTTGGTGATGTACGG\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH_CDV2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eCCATCACTGGAGTTCGATTT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e47.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eAACAATACGGTGCTCTCATC\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH_CDV3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eTTATCAAACGGTGGCTGAAT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e47.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eGTCTCCTCTACTTGCTTTGT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eH_CDV4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eforward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eTCTTATGGGCGGTTGACATT\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e47.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ereverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003csup\u003e5\u0026rsquo;\u003c/sup\u003eATTTCTTACCACGGTCATCA\u003csup\u003e\u0026rsquo;3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eH amino acid sequence comparison between BesulMY CDV strain (XBR33696) and reference isolates from GenBank.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCDV isolates\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAnimal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eAmino acid sites\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e519\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e530\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e549\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXBR33696\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMalayan tiger\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAOV62807.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAfrican lion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eADM26778.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFox\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eABY86899.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMink\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUPP02772.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCivet\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eH\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAOA33117.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFox\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eABX84030.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFox\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAST23308.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUPX09259.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eY\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study analysed tissue samples from the first reported CDV-positive Malayan tiger, confirmed by RT-PCR. The tiger exhibited clinical signs of CDV infection, including respiratory issues, seizures, and neurological symptoms (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Histopathological findings in the tiger\u0026rsquo;s tissues were consistent with those observed in other CDV-infected hosts, including lymphocytolysis, interstitial pneumonia, oedema, tissue haemorrhage from viral disruption, and the presence of cytoplasmic inclusion bodies (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). These lesions resembled those documented in other felids infected with CDV, including lymphoid tissue depletion and hepatic necrosis (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Previous studies also reported lymphoid tissue depletion in the lymph nodes as well as spleen and hepactocyte necrosis in other CDV-infected felids, namely lions and leopards. Pathological changes noted in commonly affected organs, such as the lungs, kidneys, and brain, have been documented, although their severity varies among different species (\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). The variation in pathological changes among different CDV-infected animals is due to its multi-systemic nature and complex pathogenicity as a multi-host virus (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAlthough histopathological analysis provides valuable insights into pathological manifestations of pathogens in host tissues, general histological changes proved unreliable for detecting CDV antigens (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Inclusion bodies typically emerge in the later stages of the disease, and there is a potential of inaccurately perceiving other structures as virus-induced inclusions (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Therefore, IHC provides significant value to pathological assays following the observed pathological lesions by confirming the presence of CDV antigens in the infected tissues through specific interactions with anti-CDV antibodies. This study confirmed CDV tissue lesions through histopathological and immunostaining methods using CDV-specific antibodies, followed by isolation of the wild-type CDV from the infected tiger. The observed high CPE at 48 h aligns with a previous study indicating distinct CPE development and high viral titres between 24 to 48 h post-infection of wild-type CDV (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite previous challenges in infecting cell cultures with wild-type CDV strains as opposed to attenuated vaccine and recombinant strains (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e), this study successfully induced CPE in CHO-SLAM cells following infection with CDV obtained from the tiger\u0026rsquo;s pooled tissues. The severe CPE observed at 48 h suggests robust viral replication, possibly attributed to stable SLAM receptor expression by CHO cells, facilitating virus-cell interaction and fusion. Furthermore, the high viral titre, as evidenced by the robust CPE observed indicates successful viral replication, contributing to infection severity and eventual host demise. The correlation between the elevated viral load and the observed CPE manifestation directly translates the viral replication efficiency and the resultant pathological consequences in the CDV-infected tiger.\u003c/p\u003e \u003cp\u003eSubsequent molecular tests are crucial for precise strain identification and characterisation, providing insight into genetic composition and pathogenic mechanisms. In this study, CDV antigen verification was successfully performed on tiger tissue samples propagated in CHO-SLAM cell culture. Virus propagation was limited to a single passage to prevent nucleotide mutations introduced through cell culture adaptation (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Successful in vitro infection facilitated the identification and analysis of the isolated CDV isolate from the infected tiger, focusing on the characteristics of the CDV F and H full genomes governing its pathogenicity.\u003c/p\u003e \u003cp\u003eThe findings of this study suggest a strong relationship between our studied isolate, which is classified into the Asia-1 lineage, and strains in China rather than Thailand, attributed to Thailand\u0026rsquo;s high CDV strain diversity (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e), resulting in selective genetic spillover between countries. Selective spillover from China to Malaysia through Thailand borders could result from transmission dynamics of stable strains influenced by ecological factors. Notably, the CDV \u003cem\u003eH\u003c/em\u003e gene formed a divergent clade from other Asia-1 isolates, suggesting a distinct Asia-1 clade in Malaysia. The observed divergence in this clade is hypothesised to result from the genetic drift of the virus and its adaptive capacity to thrive in the Malaysian environment and ecology. The study highlights the distinctive nature of the H gene, which displays the highest divergence among CDV genomes due to the protein\u0026rsquo;s crucial role in the initial virus-host interaction (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, the study identified specific point mutations in CDV F and H amino acids to assess CDV virulence in tigers. Generally, the F protein is a crucial component of the viral envelope, which is responsible for mediating the fusion of the viral membrane with the host cell membrane, allowing the virus to enter the cell (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). In this study, the signalling peptide (Fsp) region of the CDV F amino acid sequence exhibited the highest variability. The Fsp region is known to have the highest variations in all CDV isolates and is commonly used for strain identification when targeting the \u003cem\u003eF\u003c/em\u003e gene region (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). In addition, changes in the N-glycosylation site and the cysteine residues may alter protein structure and affect disease induction. These alterations may affect the activation of the Fsp protein precursor through cleavage or the protein transfer to the proteolytic cleavage site (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe N-glycosylation site, commonly found in most enveloped viruses, is crucial in enhancing virus infectivity and facilitating immune evasion within the host cells. Overall, the CDV isolate in this study lacks the potential N-glycosylation sites in both the F and H amino acid sequences compared to other CDV isolates. Reduced potential N-glycosylation sites in the F and H amino acids may diminish glycosylation activity, affecting viral biogenesis, antigenicity, and disease attenuation (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). However, Sawatsky and von Messling (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e) challenged the notion by demonstrating the effect of non-glycosylated CDV H protein on the pathogenesis of CDV. Despite its reduced expression and virulence, they suggested glycosylation is not essential for maintaining virus immunosuppressive characteristics. The report conclusively demonstrated that the absence of N-glycosylation on the CDV H protein did not compromise its functional integrity. Therefore, the absence of potential N-glycosylation sites in the CDV strain in this study did not impact the virus infectivity as observed \u003cem\u003ein vitro\u003c/em\u003e. However, future laboratory evaluations on other possible effects of reduced glycosylated sites in the CDV isolate are warranted to observe its pathogenicity in nature.\u003c/p\u003e \u003cp\u003eIn recent years, most molecular studies have focused on the H protein analysis due to its association with host recognition, resulting in pronounced genetic variability, specifically in residues 530 and 549 related to the SLAM-binding receptor region. While residue 530 was often found conserved in most species, residue 549 was often observed for its mutative capability that may be responsible for host range specificity and increased virulence. In this study, the CDV strain showed 549H residue in the H amino acid sequence, suggesting that the strain may originate and circulate among the wildlife population in Malaysia. Karki, Rajak (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e) proposed that dog species tend to exhibit a 549Y mutation, while 549H was observed in most wildlife species (canid and non-canid), which showed the mutation observed in this study was associated with host species specificity. Additionally, they suggested that the Y549H mutation can occur due to selection pressure for viral adaptation from domestic species to the wildlife population. This study observed different mutations in the CDV isolate from the infected tiger but did not investigate how and when these mutations occurred. Therefore, a larger pool of CDV isolates among domestic and wildlife species in the vicinity needs to be obtained to determine the origin of the isolate and the factors causing these mutations, specifically in the Malayan tiger species.\u003c/p\u003e \u003cp\u003eAdditional mutations in other residues of the H amino acid generally do not correlate towards positive selection. However, the R519I substitution found in CDV isolates suggests potential host adaptability to non-canid species, particularly big cats in the felid family (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). This specific mutation, observed in other feline species like the Serengeti African lion, has been associated with fatal outcomes in non-canid species. The rare combination of mutations 519I and 549H substitution has been exclusively linked to 100% mortality in non-canids (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). A similar finding in this study postulated that the observed mutations influence viral entry in host cells and may contribute to the fatal outcome of the Malayan tiger. High viral replication, often correlated with increased disease severity, indicate heightened viral burden and tissue damage (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). The mutations observed in the viral protein may enhance viral replication efficiency, exacerbating the severity of CDV-induced pathology and leading to the tiger\u0026rsquo;s mortality. In light of the present findings, the extent of CDV spread in the wild Malayan tiger population needs to be addressed further and monitoring this disease should be incorporated into the current conservation strategy.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe presence of CDV in Malayan tigers was confirmed in this study, with typical histopathological changes and positive immunostaining observed. Although a reduced glycosylation site was observed in both the F and H amino acids, it did not diminish the capability of the isolate to induce disease in the Malayan tiger, leading it to its demise. Moreover, the H amino acid also showed a 549H mutation, indicating that the isolate has a distinct connection with the wildlife population, in addition to the 519I mutation, which is conserved in non-canid species. Molecular analysis revealed clustering of the virus in the Asia-1 region, closely resembling CDV isolates in China. This study provides insights into CDV pathogenesis and molecular profile in the Malayan tiger, laying the foundation for future preventative measures to safeguard the endangered Malayan tiger populations.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStudy approval and sample background\u003c/h2\u003e \u003cp\u003eThis study was conducted under the approval of the Department of Wildlife and National Parks (PERHILITAN) Peninsular Malaysia (Permit number: JPHL\u0026amp;TN (IP): 100\u0026thinsp;\u0026minus;\u0026thinsp;34/1.24 Jld 20(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e)). Upon complaint by the public, a male Malayan tiger named Awang Besul seen roaming close to the human population, was captured by the PERHILITAN. Awang Besul was treated symptomatically at Sungkai Wildlife Conservation Centre; however, it died naturally in captivity one week post-capture and a post-mortem was conducted at the Faculty of Veterinary Medicine, Universiti Putra Malaysia.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSample processing for histopathological analysis\u003c/h2\u003e \u003cp\u003eThe tissues (brain, lung, kidney, spleen, liver, and stomach) of Awang Besul were obtained from post-mortem examination of which sections of each tissue were fixed with 10% formalin before being embedded into paraffin blocks for histopathological and immunohistochemical evaluation. The tiger\u0026rsquo;s brain, lung, kidney, and spleen tissues were used for viral isolation and molecular characterisation and kept in a phosphate-buffered saline (PBS), pH 7.0 solution at -80 ℃. A total of 0.3 g of each tissue was cut, and the tissues were pooled together in 1 mL PBS before storing them at -80 ℃ until further use.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCDV histopathological analysis\u003c/h2\u003e \u003cp\u003eParaffin-fixed tissues were cut into 5 \u0026micro;m thick sections and stained with haematoxylin and eosin (H\u0026amp;E). The paraffin-embedded tissues were cut into 3 \u0026micro;m sections for immunohistochemistry (IHC) using an anti-CDV monoclonal primary antibody. the sections were deparaffinised in xylene, rehydrated in gradual alcohol concentrations, and microwaved at 50 W in pH 6.0 citrate buffer for 15 min for antigen retrieval. After washing with PBS 3 times at 3 min each, endogenous peroxidase activity was blocked with 3% hydrogen peroxide in PBS for 30 min before undergoing another washing step. The sections were then incubated with 1% bovine serum albumin (BSA) in PBS for 30 min to block non-specific antibody binding.\u003c/p\u003e \u003cp\u003eThe sections were incubated for 1 h at 37 ℃ with mouse anti-CDV monoclonal antibody (clone DV2-12) (Custom Monoclonal International, USA) (1:1500 dilution in PBS containing 0.1% BSA). After washing, the sections were incubated with a rabbit anti-mouse secondary antibody (Nichirei Biosciences, Japan) for 3 min at 37 ℃, washed, and incubated for 30\u0026ndash;50 s with Liquid 3,3\u0026prime;-diaminobenzidine (DAB; DAKO, USA) for chromogen staining. They were then counter-stained with methylene blue (Bendosen, Malaysia), dried, and mounted with DPX (Sigma-Aldrich, USA) for qualitative immunolabelling. Brain tissues from a CDV-positive dog (courtesy of Dr. Apisit Pornthummawat, Mahidol University) and tissues of brain, lung, kidney from a CDV-negative Malayan tiger were subjected to the same protocol as positive and negative control, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and virus isolation\u003c/h2\u003e \u003cp\u003eThe study used Chinese ovarian hamster cells expressing the human signalling lymphocytic activation molecule receptor (CHO-SLAM) for CDV host identification (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The cells were maintained in cell media, consisted of RPMI media (Gibco, USA) 10% foetal bovine serum (FBS; Gibco, USA), 1% Penicillin-Streptomycin-Glutamine (PSG), and Geneticin\u0026trade; (G418 sulfate; Gibco, USA) at 37 ℃ in 5% CO\u003csub\u003e2\u003c/sub\u003e. Cells at 70\u0026ndash;80% confluency were used for subsequent assays. CDV was collected from the tiger pooled tissues. The tissues were ground with sterile sand, and homogenised in 5 ml PBS. The homogenate was centrifuged at 1,500 rpm for 5 min and filtered through a 0.22 \u0026micro;m filter to collect the virus. Confluent cells were rinsed with PBS twice, and 1 ml of cell media was added. A total of 100 \u0026micro;l of virus was inoculated into the cell culture and incubated at 37 ℃, 5% CO\u003csub\u003e2\u003c/sub\u003e for 45 min, then additional 4 ml of cell media was added. Cells were monitored daily for qualitative cytopathic effect (CPE). Upon confirming CPE, the culture underwent a free-thaw cycle three times to release the virus.. The media supernatant containing the virus was collected.\u003c/p\u003e \u003cp\u003eThe CHO-SLAM cells were sub-cultured in 24-well plates (BioFil, India) for viral titration using a 50% tissue culture infectious dose (TCID\u003csub\u003e50\u003c/sub\u003e) assay with virus dilutions from 10\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 10\u003csup\u003e\u0026minus;\u0026thinsp;10\u003c/sup\u003e (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). The virus-inoculated cells were maintained at 37 ℃, 5% CO\u003csub\u003e2\u003c/sub\u003e and monitored daily for CPE. Once CPE was confirmed, the average TCID\u003csub\u003e50\u003c/sub\u003e evaluation (done in triplicates) was calculated using the Spearman-K\u0026auml;rber formula (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePrimer design, RT-PCR and genomic sequencing\u003c/h2\u003e \u003cp\u003eCDV reference sequences from the Asian region were retrieved from GenBank and aligned using Molecular Evolutionary Genetics Analysis Version 10 (MEGA-X) software to design primers specific to the CDV \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e gene coding regions (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The primers were designed using the Primer-Basic Local Alignment Search Tool (Primer-BLAST) tool. Their specificity to CDV was validated via the Basic Local Alignment Search Tool for nucleotides (BLASTn).\u003c/p\u003e \u003cp\u003eCDV viral RNA was extracted from the cell culture using the Nucleospin RNA Virus Kit (Macherey-Nagel, Germany), followed by cDNA synthesis using the SensiFAST cDNA Synthesis Kit (Bioline, UK) according to the manufacturer\u0026rsquo;s protocol. Polymerase chain reaction (PCR) amplification of the cDNA was performed using the MyTaq Red Mix kit (Bioline, UK) according to the manufacturer\u0026rsquo;s protocol utilising the primers designed. The PCR cycle included initial denaturation at 95 ℃ for 1 min; 30 cycles of denaturation at 94 ℃ for 1 min, annealing following the primers\u0026rsquo; T\u003csub\u003em\u003c/sub\u003e for 1 min, and extension at 72 ℃ for 50 s; and a final extension at 72 ℃ for 3 min. Recombitek C3 vaccine (Boehringer Ingelheim, Germany) and nuclease-free water were used as positive and negative controls, respectively. Amplified PCR products were purified and sequenced using an ABI PRISM 3730xl Genetic Analyser (Applied Biosystems, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eFull-length F and H genome sequences\u003c/h2\u003e \u003cp\u003eThe sequences of the amplified amplicons were aligned using the MEGA-X software for each gene segment to get the full \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e genome sequence and deposited in the GenBank. Afterwards, each sequence was converted into the amino acid sequence using the Expasy translating tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/translate/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/translate/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The sequences for each protein region were compared to the sequences of their closest CDV strain relatives and the chemical composition. The cysteine residue and the N-glycosylation sites were determined using the Expasy ProtParam tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam/\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the NetNGlyc software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://services.healthtech.dtu.dk/services/NetNGlyc-1.0/\u003c/span\u003e\u003cspan address=\"https://services.healthtech.dtu.dk/services/NetNGlyc-1.0/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Each amino acid sequence was evaluated for the mentioned characteristics above by comparing them to reference genes from the National Centre for Biotechnology Information (NCBI) via the BioEdit sequence alignment tool (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). The complete sequence of both \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e gene were deposited in GenBank as PP894824.1 and PP894823.1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analyses\u003c/h2\u003e \u003cp\u003ePhylogenetic analysis was done on \u003cem\u003eF\u003c/em\u003e and \u003cem\u003eH\u003c/em\u003e genomic sequences against a list of CDV sequences of various geographical locations retrieved from the NCBI GenBank. The phylogenetic analysis was done using the MEGA-X software, and the maximum likelihood (ML) tree was constructed using a substitution model with a bootstrap value of 1000 replicates calculating the topology, and branch lengths likelihood in addition to, applying the Tamura 3-parameter substitution model parameter on the CDV sequences for the highest overall likelihood score (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCDV Canine distemper virus\u003c/p\u003e \u003cp\u003e \u003cem\u003eF\u003c/em\u003e Fusion\u003c/p\u003e \u003cp\u003e \u003cem\u003eH\u003c/em\u003e Hemagglutinin\u003c/p\u003e \u003cp\u003eSLAM Signalling lymphocye activation molecule\u003c/p\u003e \u003cp\u003eIUCN International Union for Conservation of Nature\u003c/p\u003e \u003cp\u003ePCR Polymerase chain reaction\u003c/p\u003e \u003cp\u003eRT-PCR Reverse transcription polymerase chain reaction\u003c/p\u003e \u003cp\u003eFsp Fusion signalling peptide\u003c/p\u003e \u003cp\u003ePERHILITAN Department of Wildlife and National Parks\u003c/p\u003e \u003cp\u003ePBS Phosphate-buffered saline\u003c/p\u003e \u003cp\u003eH\u0026amp;E Hematoxylin and eosin\u003c/p\u003e \u003cp\u003eIHC Immunohistochemistry\u003c/p\u003e \u003cp\u003eBSA Bovine serum albumin\u003c/p\u003e \u003cp\u003eDAB Diaminobenzidine\u003c/p\u003e \u003cp\u003eCHO-SLAM Chinese ovarian hamster cells expressing the human signalling lymphocytic activation molecule receptor\u003c/p\u003e \u003cp\u003ePSG Penicillin-Streptomycin-Glutamine\u003c/p\u003e \u003cp\u003eCPE Cytopathic effect\u003c/p\u003e \u003cp\u003eTCID\u003csub\u003e50\u003c/sub\u003e Titration using a 50% tissue culture infectious dose\u003c/p\u003e \u003cp\u003eMEGA-X Molecular Evolutionary Genetics Analysis Version 10\u003c/p\u003e \u003cp\u003eBLAST Basic Local Alignment Search Tool\u003c/p\u003e \u003cp\u003eNCBI National Centre for Biotechnology Information\u003c/p\u003e \u003cp\u003eML Maximum likelihood\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Department of Wildlife and National Parks (PERHILITAN) Peninsular Malaysia. A permit letter to conduct this study (JPHL\u0026amp;TN (IP): 100-34/1.24 Jld 20(11)) was obtained from the organisation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data analysed and used for this study are included in the result section. The full datasets will be made available from the corresponding upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors report no potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by the National Conservation Trust Fund (NCTF) under the Ministry of Natural Resources, Environment and Climate Change, Malaysia, with reference number KeTSA (S) 600-2/1/48/4(JLD2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualisation: FMK, MFMS, AS, TRPTA, HA, AK, KKH, RAW, LA, MG; Data curation: MFMS, FMK, AS, NIU, MAR ; Formal analysis: MFMS, FMK, AS, NIU, MAR; Funding acquisition: FMK, TRPTA, HA, AK, KKH, RAW; Investigation: MFMS, FMK,TRPTA, AS, NIU, MAR; Methodology: MFMS, FMK, AS, NIU, MAR; Project administration: FMK; Resources: FMK, TRPTA, AS, NIU, MAR; Software: MFMS; Supervision: FMK, AS, NIU, MAR Validation: FMK; Visualisation: MFMS, AS, NIU, MAR; Writing - original draft: MFMS; Writing - review and editing: MFMS, MAR, AS, NIUZ, TRPTA, HA, AK, KKH, RAW, LA, MG, FMK.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to express our thanks to Professor Hironobu Tatsuo, Kyushu University for graciously providing the CHO-SLAM cell line. We are also grateful to Dr. Apisit Pornthummawat, Mahidol University for providing the CDV-positive dog formalin-fixed paraffin-embedded tissue control. We would also like to thank the PERHILITAN Peninsular Malaysia for the research permits given, JPHL\u0026amp;TN(IP):100-34/1.24 Jld 20(11). Thank you to all individuals from the Virology and Histopathology laboratories, Faculty of Veterinary Medicine, Universiti Putra Malaysia for their technical assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDeem SL, Spelman LH, Yates RA, Montali RJ. Canine distemper in terrestrial carnivores: a review. J Zoo Wildl Med. 2000;31(4):441\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrogu T, Castelli A, Canziani S, Tolini C, Carrera M, Sozzi E et al. Detection and Molecular Characterization of Canine Distemper Virus in Wildlife from Northern Italy. Pathogens. 2022;11(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRomanutti C, Gallo Calder\u0026oacute;n M, Keller L, Mattion N, La Torre J. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs. J Virol Methods. 2016;228:79\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDuque-Valencia J, Sarute N, Olarte-Castillo XA, Ru\u0026iacute;z-S\u0026aacute;enz J. Evolution and Interspecies Transmission of Canine Distemper Virus-An Outlook of the Diverse Evolutionary Landscapes of a Multi-Host Virus. Viruses. 2019;11(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeineke A, Baumg\u0026auml;rtner W, Wohlsein P. Cross-species transmission of canine distemper virus-an update. One Health. 2015;1:49\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAppel MJG, Summers BA. Pathogenicity of morbilliviruses for terrestrial carnivores. Vet Microbiol. 1995;44(2):187\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarder TC, Kenter M, Vos H, Siebelink K, Huisman W, van Amerongen G, et al. Canine distemper virus from diseased large felids: biological properties and phylogenetic relationships. J Gen Virol. 1996;77(Pt 3):397\u0026ndash;405.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTen DCY, Jani R, Hashim NH, Saaban S, Abu Hashim AK, Abdullah MT. Panthera tigris jacksoni Population Crash and Impending Extinction due to Environmental Perturbation and Human-Wildlife Conflict. Anim (Basel). 2021;11(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePERHILITAN. \u0026lsquo;Awang Besul\u0026rsquo; The Tiger Dies 2019 [ \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://harimau.my/awang-besul-the-tiger-dies/\u003c/span\u003e\u003cspan address=\"https://harimau.my/awang-besul-the-tiger-dies/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKadam RG, Karikalan M, Siddappa CM, Mahendran K, Srivastava G, Rajak KK et al. Molecular and pathological screening of canine distemper virus in Asiatic lions, tigers, leopards, snow leopards, clouded leopards, leopard cats, jungle cats, civet cats, fishing cat, and jaguar of different states, India. Infection, Genetics and Evolution. 2022;98:105211.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoelke-Parker ME, Munson L, Packer C, Kock R, Cleaveland S, Carpenter M, et al. A canine distemper virus epidemic in Serengeti lions (Panthera leo). Nature. 1996;379(6564):441\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTatsuo H, Ono N, Yanagi Y. Morbilliviruses use signaling lymphocyte activation molecules (CD150) as cellular receptors. J Virol. 2001;75(13):5842\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCreevy KE, Evans JB, Canine. Distemper2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.msdvetmanual.com/generalized-conditions/canine-distemper/canine-distemper#:~:text=Etiology%20and%20Pathogenesis%20of%20Canine %20Distemper\u0026amp;text=Infection%20is%20transmitted%20mainly%20via,tissue%20of%20the%20respiratory%20tract\u003c/span\u003e\u003cspan address=\"https://www.msdvetmanual.com/generalized-conditions/canine-distemper/canine-distemper#:~:text=Etiology%20and%20Pathogenesis%20of%20Canine%20Distemper\u0026amp;text=Infection%20is%20transmitted%20mainly%20via,tissue%20of%20the%20respiratory%20tract\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAppel MJG, Yates RA, Foley GL, Bernstein JJ, Santinelli S, Spelman LH, et al. Canine Distemper Epizootic in Lions, Tigers, and Leopards in North America. J Vet Diagn Invest. 1994;6(3):277\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeineke A, Puff C, Seehusen F, Baumg\u0026auml;rtner W. Pathogenesis and immunopathology of systemic and nervous canine distemper. Vet Immunol Immunopathol. 2009;127(1):1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLempp C, Spitzbarth I, Puff C, Cana A, Kegler K, Techangamsuwan S, et al. New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis. Viruses. 2014;6(7):2571\u0026ndash;601.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSummers BA, Greisen HA, Appel MJG. Canine distemper encephalomyelitis: Variation with virus strain. J Comp Pathol. 1984;94(1):65\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDucatelle R, Coussement W, Hoorens J. Demonstration of canine distemper viral antigen in paraffin sections, using an unlabeled antibody-enzyme method. Am J Vet Res. 1980;41(11):1860\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiry C, Ducatelle R, Thoonen H, Hoorens J. Immunoperoxidase study of canine distemper virus pneumonia. Res Vet Sci. 1983;34(2):145\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaines DM, Martin KM, Chelack BJ, Sargent RA, Outerbridge CA, Clark EG. Immunohistochemical detection of canine distemper virus in haired skin, nasal mucosa, and footpad epithelium: a method for antemortem diagnosis of infection. J Vet Diagn Invest. 1999;11(5):396\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRomanutti C, Keller L, La Torre J, Panzera Y, Fuques E, P\u0026eacute;rez R, et al. Virus isolation and full-length genome sequencing of a representative canine distemper virus wild type strain of the South America 2 clade. J Virol Methods. 2020;279:113857.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan B, Wen Y-J, Wang F-X, Zhang S-Q, Wang X-D, Hu J-X, et al. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China. Virol J. 2011;8(1):520.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCherpillod P, Beck K, Zurbriggen A, Wittek R. Sequence analysis and expression of the attachment and fusion proteins of canine distemper virus wild-type strain A75/17. J Virol. 1999;73(3):2263\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiewbang C, Chansaenroj J, Kongmakee P, Banlunara W, Poovorawan Y, Techangamsuwan S. Genetic Adaptations, Biases, and Evolutionary Analysis of Canine Distemper Virus Asia-4 Lineage in a Fatal Outbreak of Wild-Caught Civets in Thailand. Viruses. 2020;12(4).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillanueva RA, Rouill\u0026eacute; Y, Dubuisson J. Interactions between virus proteins and host cell membranes during the viral life cycle. Int Rev Cytol. 2005;245:171\u0026ndash;244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarute N, Calder\u0026oacute;n MG, P\u0026eacute;rez R, La Torre J, Hern\u0026aacute;ndez M, Francia L, et al. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification. PLoS ONE. 2013;8(5):e63595.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVigerust DJ, Shepherd VL. Virus glycosylation: role in virulence and immune interactions. Trends Microbiol. 2007;15(5):211\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSawatsky B, von Messling V. Canine distemper viruses expressing a hemagglutinin without N-glycans lose virulence but retain immunosuppression. J Virol. 2010;84(6):2753\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarki M, Rajak KK, Singh RP. Canine morbillivirus (CDV): a review on current status, emergence and the diagnostics. VirusDisease. 2022;33(3):309\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNikolin VM, Olarte-Castillo XA, Osterrieder N, Hofer H, Dubovi E, Mazzoni CJ, et al. Canine distemper virus in the Serengeti ecosystem: molecular adaptation to different carnivore species. Mol Ecol. 2017;26(7):2111\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurugesan A, Manoharan M. Chapter 16 - Dengue Virus. In: Ennaji MM, editor. Emerging and Reemerging Viral Pathogens. Academic; 2020. pp. 281\u0026ndash;359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuench HR. A simple method of estimating 50 per cent end points. Am J Hyg. 1938;27:493\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpearman CI. The method of \u0026lsquo;right and wrong cases\u0026rsquo; (\u0026lsquo;constant stimuli\u0026rsquo;) without Gauss\u0026rsquo;s formulae. Br J Psychol. 1908;2:227\u0026ndash;47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026auml;rber G. Beitrag zur kollektiven behandlung pharmakologiseher reihenversuche. Arch Exp Path Pharmaco. 1931(162):480\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlzohairy A, BioEdit. An important software for molecular biology. GERF Bull Biosci. 2011;2:60\u0026ndash;1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Supplementary File","content":"\u003cp\u003eSupplementary Figure 1 is not available with this version.\u003c/p\u003e\n\u003cp\u003eSupplementary Figure 1; Uncropped gel electrophoresis picture of CDV antigen RT-PCR verification in the infected tiger (BesulMY) \u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Canine distemper virus, Malayan tiger, histopathology, hemagglutinin, fusion","lastPublishedDoi":"10.21203/rs.3.rs-5032158/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5032158/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCanine distemper virus (CDV) has a broad host range, spanning carnivorous and non-carnivorous animals, often proving fatal. The detection of CDV in a Malayan tiger in Malaysia in 2019 marks the first such case in Malayan tigers, highlighting the potential domestic animal or wildlife circulation of the virus. Our study aimed to describe histological manifestations and characterise the CDV strain in the tiger to determine its molecular epidemiology and postulate viral pathogenicity.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eNotable histopathological changes were observed primarily in the central nervous system, lung, liver, kidney, spleen, and stomach, with viral antigens localised in the lung, liver, kidney, and stomach tissues. CDV-induced cell cytopathic effects with viral quantification yielding 4.27 x 10\u003csup\u003e6\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/mL were observed at 48 h post-inoculation in CHO-SLAM cells. Phylogenetic analysis suggested that the virus originated from the Asia-1 region. Notably, 549H and 519I mutation combinations in the hemagglutinin protein were observed, indicating adaptation to a non-canid wildlife species.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThis study delved into the molecular characterisation of CDV in the Malayan tiger, with information on the dynamics of virus transmission among wildlife in the case of future outbreaks. Such results underscore the need for a prevalence study to assess the spread of the virus. This can serve as a benchmark for developing effective preventative measures to protect Malayan tigers and mitigate their risk of extinction.\u003c/p\u003e","manuscriptTitle":"Molecular characterisation and histopathological analysis of canine distemper virus in a Malayan tiger (Panthera tigris jacksoni)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-22 09:02:19","doi":"10.21203/rs.3.rs-5032158/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"059d8266-f921-4ebe-b577-6b326e443bb5","owner":[],"postedDate":"October 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-25T05:23:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-22 09:02:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5032158","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5032158","identity":"rs-5032158","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}