Environmental DNA integrity index is sensitive for species biomass estimation in freshwater | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Environmental DNA integrity index is sensitive for species biomass estimation in freshwater Qinyu GE, Zhihui Li, Yuwei Yang, Huajuan Shi, Junyi Zhang, Min Pan, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3273821/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Environmental DNA (eDNA) from aquatic vertebrates has recently been used to estimate the presence of a species. However, the estimation accuracy is affected by the degradation rate of eDNA. In this study, eDNA integrity index (eDI) was introduced to adjust eDNA concentration for carp biomass estimation. The adjusted eDNA concentration was defined as biomass index (BI). The degradation rate of eDNA was studied by simulation experiment, tank and pond experiment successively. The eDNA concentration decreasing slowly after the species was removed while eDI changed rapidly in all experiments. eDI decreased to closely zero in two days while eDNA remained detectable for more than one month. The temperature was found to have no significant effect on eDI. Although the eDNA concentration and BI were both positively correlated with carp biomass in all experiments, BI showed higher correlation (R 2 >0.95), was more sensitive to biomass changes, and accurate for carp biomass estimation. We used this method to estimate the biomass of carp in a fishpond successfully, which suggested that accurate biomass data can reflect the potential distribution of common carp in the natural environment. It offers a non-invasive, simple, rapid, and accurate method for biomass estimation. environmental DNA integrity biomass estimation degradation carp water Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Synopsis We developed an environmental DNA integrity-based method which can estimate species biomass sensitively for species distribution and resource investigations. 1. Introduction In the last decade, environmental research largely benefited from the discovery and application of environmental DNA (eDNA), which is organismal DNA collected from environmental settings(Doi &Kelly 2023 ). One of the most important applications is in aquatic ecology and resources. Recently, eDNA has been used in detecting short, species-specific DNA fragments in the water, which increases the accuracy, decreases the cost of surveys and allows the detection of rare or invasive species (Ficetola et al. 2008 , Goldberg et al. 2011 , Jerde et al. 2011 , Minamoto et al. 2012 , Valentini et al. 2009 ). Researchers have also used eDNA to document the presence of bullfrog tadpoles (Goldberg et al. 2011 ), silver and bighead carp (Jerde et al. 2011 ), and frogs as well as salamanders(Goldberg et al. 2011 ) in a range of water bodies. Information on the distribution of species is a critical component of understanding their ecology and extinction risks and is important for the conservation of populations(Barajas Barbosa et al. 2023 ). Species biomass is critical to estimate the production and material cycling of the ecosystem, it is also a fundamental biological data(Miller et al. 2023 , Smith et al. 2023 ), however, the traditional methods for biomass investigation are often lack accuracy, particularly for aquatic organism estimation such as fish(Guerra et al. 2022 ). Additionally, time-consuming and laborious are also two obvious shortcomings. Now, eDNA has often been used to document the presence/absence of aquatic species as well as the investigating biological resources(Ji et al. 2022 , Kumar et al. 2022 , Szoszkiewicz et al. 2022 ). It is assumed that aquatic vertebrates release eDNA into the water from feces secretions and tissues in proportion to their biomass(Chong et al. 2023 , Kennedy et al. 2023 ), so eDNA could be used to estimate species biomass by measuring the number of eDNA copies in a sample of water. Likewise, it has been reported that eDNA could be used to monitor the biodiversity and species concentrations in water(Cantera et al. 2022 , Coutant et al. 2023 , Takahashi et al. 2023 ). Nevertheless, the degradation rates of eDNA vary across species in different conditions, resulting in a poor correlation between the eDNA concentration and species abundance in water(Kong et al. 2023 ). In this present study, the aim is to systematically investigate the degradation patterns and influence of temperature on eDNA in freshwater environments. We proposed that eDNA integrity index can be used to adjust the eDNA concentration to estimate the biomass of fish. It is shown that the corrected estimated biomass is closer to the true value. 2. Material and Methods 2.1 Study species Carp are one of the most widely transported species in the world, being used as ornamental fish and for sport fishing and human consumption(Titus et al. 2004 , Zambrano &Hinojosa 1999 , Zambrano et al. 2001 ). Furthermore, it has threat to other species in the same ecological environment(Miller &Crowl 2006 ), so considered as invasive species(Haynes et al. 2010 ). Common carp were used for assessing the characterization of eDNA, we choose carp as the target species because carp is an ideal model organism and previous studies have investigated aqueous microbial eDNA of carp(Barnes et al. 2014a , Eichmiller et al. 2014 , Mahon et al. 2013 ). 2.2 Experiment design To facilitate the control of experimental conditions and convenient collection of experimental data, a rapid experiment was conducted firstly to simulate degradation using genomic DNA, then, two parts of the studies, including an aquarium experiment and a basin experiment, have been established. Rapid Experiment : Carp genomic DNA was fragmented in different lengths by ultrasonic with Covaris S2 (Covaris, Inc. USA). Primers for different lengths of PCR products were designed, one fragment is about 100 base pair for short amplicon, and the other is large than 500 base pair for long amplicon. The integrity index of the genomic DNA was calculated by the ratio of long amplicons to short amplicons. The comparison of short amplicons concentration with the original genomic DNA concentration was used as the detectability. The changes in the detectability and integrity index were observed and analyzed in the process of degradation. Aquarium experiments Species introduced into the new environment need a period of time to adapt before acclimatizing the environment, and the metabolism and physiology will then be stable. Five carp (10.40 ± 1.0g) were introduced into a 50 L tank before the experiment. The containers were maintained at 25℃ and under a 12-hour light : dark cycle. During the experiment, water samples were collected for the first time on the tenth day before all the fish were transferred. The water samples were collected once a day in the first four days and once every two days in the following two weeks, then once a week until the eDNA was undetectable. 200mL of the water was collected and filtered on each time point. Studies of eDNA degradation The changes tendency of eDNA detectability and the eDNA integrity index (eDI) were measured and analyzed. The concentration of eDNA was indicated with 1/Log 10 (ΔCt) which was measured by using quantitative PCR. Impact of temperature on eDNA degradation The water ecosystems are exposed to different temperatures, which might affect the degradation rate of eDNA. Water samples were collected after the carp metabolism and physiology is stable, only two times sampling during the experiment that is before and one week after the fish were transferred. The tank temperature was set to 4℃, 15℃, and 30℃ after the fish was transferred. eDNA detectability and eDI were measured and analyzed according to the previous method. Biomass estimation To assess the relationship between eDNA concentration and species abundance, two experiments were carried out in this present study. In the first experiment, three tanks were filled with 1, 5, and 10 fish, respectively, water sampling were after the carp metabolism and physiology were stable. The relationship between eDNA concentration and the species abundance was calculated, and eDI was also introduced to adjust the eDNA concentration. In the second experiment, the tank was filled with 10 fish, 2 of which were transferred every 5 days after the metabolism and physiology were stable until 2 fish remain. Water sampling was conducted before every fish transfer. Pond experiment Experiments of eDNA degradation and biomass estimation were also repeated and validated in a pond of 50 square meters. There were no carps in the pond before the experiment, and 10 carps (212 ± 8.6g) were introduced in the pond. Based on the aquarium experiments, water sampling was in one week before and one month after all the fish were transferred, the sampling frequency was once a week in the whole eDNA degradation experiment. 1L of water sample was collected and filtered each time in the pond experiment. To assess the influence of temperature, two experiments were carried out in March and August of the year 2021. Sampling was before and 7 days after the fish transfer. For further verification, a fish pond of farmers with 1000 m 2 was involved in this study for biomass estimation. There were two periods of water sampling during the whole experiment. The first water sampling was conducted during the fish fry culture period and the second sampling was during the harvest period. The weight of fish fry and adult fish was provided by the farmer. Three repeats of sampling were conducted each time. The relationship between eDNA concentration and species abundance was studied according to the previous strategy. The fish production of several other fishpond was also estimated by BI. 2.3 Experiment methods Sampling and eDNA extraction Water samples were filtered through a 0.22 µm pore filter immediately after it was collected. The filter membrane was then submitted to the FastPure Microbiome DNA isolation Kit for eDNA extraction. The eDNA was extracted according to the manual instruction with some modifications. Briefly, the filter membrane was broken in the presence of lysis buffer, then mixed with protease K for protein digestion, and then it was submitted to the purification column for eDNA enrichment. The eDNA solution was submitted to Nanodrop ND1000 and Qubit 3.0 Fluorometer (ThermoFisher, USA) for quality control, the obtained eDNA was detected immediately or stored at -20℃ for a short time. PCR and gel electrophoresis For the rapid experiment, the genomic DNA was fragmented, the fragment was separated by agarose gel (1%) electrophoresis. The short and long fragment of extracted eDNA was amplified by PCR by using Premix Taq™ (TaKaRa, Dalian, China) according to the instructions for validation. Real-time quantitative PCR The detectability and integrity of eDNA were measured by using real-time quantitative PCR. The quantification of eDNA was performed using SYBR Premix Ex Taq™ with a 7500 Real-Time PCR system (Applied Biosystems). The primers for long and short fragment eDNA of carp were synthesized by Sangon Biotech Ltd (Shanghai, China) and the sequences were listed in Table 1 . These primers are specific to carp and amplify the fragment of the mitochondrion gene. Table 1 DNA sequences of the primers Name DNA sequences (5’—3’) Amplicon length LF GCCTAAAAGCATCGGTCTTG 660 bp LR TGAGCCTGCACTCTGAAATG SF TTACATAGTGCCCCCTTTGG 87 bp SR TTCGGGGTTTGACAAGGATA Each reaction in a volume of 10µl contained 2µL eDNA solution, 5 pmol of each primer, 5µL SYBR Premix Ex Taq™, and 1µL sterile water. The process of amplification uses two temperature level thermal cycles. The thermal cycle parameter was as follows: 1min at 95℃ and 40 cycles of 10 s at 95℃ and 40 s at 60℃. Quantitative real-time PCR was performed in triplicate and the PCR products were sent to sequencing to confirm the specificity of the primer set described above. 2.4 Statistical analyses We evaluated the effect of temperature on the concentration of eDNA using a one-way analysis of variance (ANOVA, a = 0.05). In the aquarium and pond experiments, we evaluated the relationship between eDNA concentration and biomass of carp per 1-L water sample using a Type II regression and evaluated the relationship between the number of carp and biomass using a Type I regression. ANOVA was performed using GraphPad (version 9.0, Dotmatics., La Jolla, USA). The remaining statistical analyses were conducted in R ver. 4.3.0. 3. Results 3.1 Study of eDNA degradation 1) Simulation experiments The detectability of eDNA in the water ecosystem is the determinant of its further applications. We used the fragmented genomic DNA to simulate DNA degradation and investigate the relationship between DNA integrity and detectability. The DNA bands separated on the gel could be seen clearly (Fig. 1 A), and most of the fragments could be detected. As shown in Fig. 1 B, there was the rapid decline in DNA integrity (red line), but no significant impact on DNA detectability (blue line). However, the species might be transferred or died if the DNA were largely degraded. It is reasonably inferred that the bias in species distribution and biomass estimation is largely impacted by eDNA degradation. 2) Tank experiment Water samples were collected after the carp was introduced and the metabolism and physiology are stable, the fish were transferred ten days from the first sampling and then sampled according to the time point designed until no eDNA could be detectability. Figure 2 A showed the changes in eDNA integrity and detectability. During the eDNA monitoring experiment over two months, an increase of the eDNA concentration was observed in the first three days, and then it remained relatively stable until the fish removal. After the fish removal, there was a dramatic decrease in the concentration of eDNA during the first 5 days, and then it decreased slowly, the eDNA could be detected even two months thereafter, it showed almost negative results until 52 days after the fish removal (blue line in Fig. 2 A). Unlike eDNA detectability, a significant decrease in eDI (eDNA integrity index) was found just after the fish was removed, it dropped close to zero in only two days (red line in Fig. 2 A). It is suggested that eDI is more sensitive to the presence/absence of species and it might be a more accurate calibrator to estimate the biomass. 3) Pond experiment To further validate the detectability and eDI results obtained, a similar experiment was carried out in a 100 m 2 pond. As shown in Fig. 2 B, similar trends were presented in eDNA detectability and eDI. The value of eDI was very low just one week after the fish was removed, and eDNA was also detectable one month later until the experiment terminated. 3.2 Effect of temperature on the integrity of eDNA One of the most important factors in the water ecosystem is temperature. The water temperature varies across seasons; thus, we investigated the influence of different temperatures on eDI in tanks and ponds in this study. The results are shown in Fig. 3 , eDNA degraded slowly at low temperatures and quickly at high temperatures. There was no significant difference in the eDI of the tank experiment between different temperatures (Fig. 3 A); the same result was found in the eDI of the pond experiment between March and August (Fig. 3 B). Similar to the previous study, whatever the temperature or seasons, the eDI was sharply decreased after the fish removal. It was shown eDI is close correlation to living organisms. 3.3 Estimation of biomass with eDI Based on the study of eDNA degradation in tanks and ponds, we assessed the relationship between abundance and eDNA concentration. In this study, eDNA concentration was denoted with 1/Log10 (ΔCt) by using quantitative PCR results. We also defined the adjusted eDNA d with eDI as biomass index (BI), which is calculated using eDNA multiply by eDI. Firscalibratetly, three tanks with one, five, and ten fish were studied respectively. eDNA concentration and eDI were measured and their correlation with fish abundance was shown in Fig. 4 A. A positive correlation was observed between biomass with either eDNA concentration (R2 = 0.8315) or BI (R2 = 0.9790), while a higher correlation was obtained on BI. To further assess the contribution of BI to biomass estimation, another experiment was carried out. We used one tank with ten fish, and removed two fish every 5 days, the last two fish remain until the end of the experiment. Water sampling was right before each fish removal. eDNA concentration was detected by using quantitative PCR and BI was calculated, Fig. 4 B showed the correlation results of fish number and eDNA concentration. The blue line indicated a weak correlation between eDNA concentration and fish number (R2 = 0.4349); while a strong positive correlation was found when the eDNA concentration was adjusted by eDI (R2 = 0.9549). 3.4 Estimation of fish production by BI In the validation experiment, about 50kg/500m 2 of fish fry were put into the fishpond in March of 2021, and about 500kg/500m 2 of adult fish were harvested in October. Results showed that the fishpond eDNA concentration was increased during harvested period, and it was worth noting that BI of this fishpond increased more remarkably. As shown in Fig. 5 A, the correlation between eDNA and fish biomass was 0.7104, and a higher correlation (R 2 = 0.9241) was obtained between BI and fish biomass. A linear formula was fit by BI that is BI = 0.00024*biomass (kg) + 0.3770. The fish production predicted by BI showed high accurate in several other fishpond (Fig. 5 B), no significant differences found between predicted and actual output. Discussion In this present study, we developed a method for estimating fish biomass based on adjusted eDNA concentration in water samples. It was found that eDNA in the water ecosystem could be detected for a long time so long as the species ever existed, while undegraded eDNA (denoted by eDI) only remains for several days in a water environment. eDI, the eDNA integrity index, is more sensitive to species changes and more suitable for biomass estimation. We measured the DNA concentration changes after fish were removed until was undetectable in different experimental conditions. The influence of temperatures on eDNA concentration was also revealed. eDI was introduced in our study which was derived from cell-free DNA in human plasma and body fluid (Lamminaho et al. 2021 , Qian et al. 2022 ). It is for the first time that eDI was introduced to environmental research which might be valuable for developing expanded eDNA application. A higher positive correlation was exhibited between adjusted eDNA and fish biomass in the fish pond experiment, the estimated results were close to fish production. It provides a more sensitive method to estimate species abundance(Carvalho et al. 2022 , Pont et al. 2023 , Sassoubre et al. 2016 ). It is mainly due to the introduction of eDI which could be used to adjust the eDNA concentration for biomass estimation. eDNA had already been studied for the degradation and estimation of biomass. eDNA degradation experiments have involved the removal of target organisms from controlled environments followed by monitoring the persistence of target eDNA over time(Thomsen et al. 2012a ). Some previous reports showed that eDNA could remain only a few days or even a few hours after the species were removed, while other inconsistent results revealed eDNA could exist for a long time up to one month(Barnes et al. 2014b , Moushomi et al. 2019 , Troth et al. 2021 ). In this study, it was proved eDNA could be detected more than one month after the fish was removed only by using a short amplicon. It could be inferred that different lengths of amplicon might be used in their studies, and short amplicon is less affected by eDNA degradation, while long amplicon is largely affected by degradation(Dejean et al. 2011 , Goldberg et al. 2013 , Thomsen et al. 2012b ). It is therefore suggested the detection result is not accurate enough if only short or long amplicons are used for PCR, we used both short and long amplicons in this study and proposed eDI, a more sensitive index for eDNA degradation. It will benefit the application of eDNA in the water ecosystem. Admittedly, we studied the degradation mainly in indoor environments and small water ecosystems, and only the effect of temperature was involved. More environmental factors such as pH, conductivity, and microbial community composition may influence eDNA degradation, thus deeper and more detailed studies are necessary(Jo et al. 2017 , McCartin et al. 2022 ). Furthermore, it's worth noting that the selection of amplicon length for different species needs to be considered. In this present study, the degradation of eDNA was studied, The changes of eDI as well as eDNA concentration along with time were measured after the species were removed and the environmental conditions are generally controllable. There may be deviations between this study and results from the complex water ecological environment and water sampling might be one of the most important factors. There is little effect of sampling location when in small bodies of water such as tanks and small ponds, while immense influence on rivers and lakes. Furthermore, sampling and eDNA extraction methods are also important to the detection results, many methods from previous studies were referred to and involved in this study(Amberg et al. 2015 , Eichmiller et al. 2016 , Pfleger et al. 2016 , Ulibarri et al. 2017 , Zhang et al. 2020 ). In summary, we proposed an eDI-based biomass estimation method and obtained accurate results for cultured fishes. This method provided an easier, faster, and more accurate approach in estimating the species biomass in natural environments compared with traditional methods, such as mark, recapture, and unadjusted eDNA. In addition, it could be used to monitor seasonal eDNA concentration change to predict important microhabitats for reproduction, feeding, and refuge of a target species. The estimation data might be used to aid management plans for the conservation of populations, communities, and ecosystems. To decrease the bias of this method, future experiments should focus on collecting more field data and more comparison with other estimation methods. Declarations Acknowledgments The authors thank Rui Li for assistance in sample collection, eDNA extraction, and eDNA detections. Ethical Approval and consent to participate Not applicable Consent to Publish The manuscript is approved by all authors for publication. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Funding This work was supported by National Key Research and Development Program of China (Grant numbers: 2022YFF0710800) and the Natural Science Foundation of Jiangsu Province (Grant numbers: BK20201148 and BK20211166). Authors Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Qinyu Ge, Zhihui Li, Yuwei Yang, Huajuan Shi, Junyi Zhang, Min Pan, Beili Sun and Yunfei Bai. The first draft of the manuscript was written by Qinyu Ge and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Availability of data and materials All data generated or analyzed during this study are included in this published article. References Amberg JJ, McCalla SG, Monroe E, Lance R, Baerwaldt K, Gaikowski MP (2015): Improving efficiency and reliability of environmental DNA analysis for silver carp. J Great Lakes Res 41, 367-373 Barajas Barbosa MP, Craven D, Weigelt P, Denelle P, Otto R, Diaz S, Price J, Fernandez-Palacios JM, Kreft H (2023): Assembly of functional diversity in an oceanic island flora. Nature Barnes MA, Turner CR, Jerde CL, Renshaw MA, Chadderton WL, Lodge DM (2014a): Environmental Conditions Influence eDNA Persistence in Aquatic Systems. Environ Sci Technol 48, 1819-1827 Barnes MA, Turner CR, Jerde CL, Renshaw MA, Chadderton WL, Lodge DM (2014b): Environmental conditions influence eDNA persistence in aquatic systems. Environ Sci Technol 48, 1819-27 Cantera I, Coutant O, Jezequel C, Decotte JB, Dejean T, Iribar A, Vigouroux R, Valentini A, Murienne J, Brosse S (2022): Low level of anthropization linked to harsh vertebrate biodiversity declines in Amazonia. Nat Commun 13, 3290 Carvalho CS, De Oliveira ME, Rodriguez-Castro KG, Saranholi BH, Galetti PM (2022): Efficiency of eDNA and iDNA in assessing vertebrate diversity and its abundance. Mol Ecol Resour 22, 1262-1273 Chong JWR, Khoo KS, Chew KW, Ting HY, Show PL (2023): Trends in digital image processing of isolated microalgae by incorporating classification algorithm. Biotechnol Adv 63, 108095 Coutant O, Jezequel C, Mokany K, Cantera I, Covain R, Valentini A, Dejean T, Brosse S, Murienne J (2023): Environmental DNA reveals a mismatch between diversity facets of Amazonian fishes in response to contrasting geographical, environmental and anthropogenic effects. Glob Chang Biol 29, 1741-1758 Dejean T, Valentini A, Duparc A, Pellier-Cuit S, Pompanon F, Taberlet P, Miaud C (2011): Persistence of Environmental DNA in Freshwater Ecosystems. Plos One 6 Doi H, Kelly RP (2023): Ethical considerations for human sequences in environmental DNA. Nat Ecol Evol Eichmiller JJ, Bajer PG, Sorensen PW (2014): The Relationship between the Distribution of Common Carp and Their Environmental DNA in a Small Lake. Plos One 9 Eichmiller JJ, Miller LM, Sorensen PW (2016): Optimizing techniques to capture and extract environmental DNA for detection and quantification of fish. Mol Ecol Resour 16, 56-68 Ficetola GF, Miaud C, Pompanon F, Taberlet P (2008): Species detection using environmental DNA from water samples. Biol Lett 4, 423-5 Goldberg CS, Pilliod DS, Arkle RS, Waits LP (2011): Molecular detection of vertebrates in stream water: a demonstration using Rocky Mountain tailed frogs and Idaho giant salamanders. PLoS One 6, e22746 Goldberg CS, Sepulveda A, Ray A, Baumgardt J, Waits LP (2013): Environmental DNA as a new method for early detection of New Zealand mudsnails (Potamopyrgus antipodarum). Freshw Sci 32, 792-800 Guerra CA et al. (2022): Global hotspots for soil nature conservation. Nature 610, 693-698 Haynes GD, Gilligan DM, Grewe P, Moran C, Nicholas FW (2010): Population genetics of invasive common carp Cyprinus carpio L. in coastal drainages in eastern Australia. J Fish Biol 77, 1150-1157 Jerde CL, Mahon AR, Chadderton WL, Lodge DM (2011): "Sight-unseen" detection of rare aquatic species using environmental DNA. Conserv Lett 4, 150-157 Ji F, Han D, Yan L, Yan S, Zha J, Shen J (2022): Assessment of benthic invertebrate diversity and river ecological status along an urbanized gradient using environmental DNA metabarcoding and a traditional survey method. Sci Total Environ 806, 150587 Jo T, Murakami H, Masuda R, Sakata MK, Yamamoto S, Minamoto T (2017): Rapid degradation of longer DNA fragments enables the improved estimation of distribution and biomass using environmental DNA. Mol Ecol Resour 17, e25-e33 Kennedy KM et al. (2023): Questioning the fetal microbiome illustrates pitfalls of low-biomass microbial studies. Nature 613, 639-649 Kong L, Zheng R, Feng Y, Du W, Xie C, Gu Y, Liu S (2023): Anammox bacteria adapt to long-term light irradiation in photogranules. Water Res 241, 120144 Kumar MS, Slud EV, Hehnly C, Zhang L, Broach J, Irizarry RA, Schiff SJ, Paulson JN (2022): Differential richness inference for 16S rRNA marker gene surveys. Genome Biol 23, 166 Lamminaho M, Kujala J, Peltonen H, Tengstrom M, Kosma VM, Mannermaa A (2021): High Cell-Free DNA Integrity Is Associated with Poor Breast Cancer Survival. Cancers (Basel) 13 Mahon AR, Jerde CL, Galaska M, Bergner JL, Chadderton WL, Lodge DM, Hunter ME, Nico LG (2013): Validation of eDNA Surveillance Sensitivity for Detection of Asian Carps in Controlled and Field Experiments. Plos One 8 McCartin LJ, Vohsen SA, Ambrose SW, Layden M, McFadden CS, Cordes EE, McDermott JM, Herrera S (2022): Temperature Controls eDNA Persistence across Physicochemical Conditions in Seawater. Environ Sci Technol 56, 8629-8639 Miller MGR, Reimer JD, Sommer B, Cook KM, Pandolfi JM, Obuchi M, Beger M (2023): Temperate functional niche availability not resident-invader competition shapes tropicalisation in reef fishes. Nat Commun 14, 2181 Miller SA, Crowl TA (2006): Effects of common carp (Cyprinus carpio) on macrophytes and invertebrate communities in a shallow lake. Freshwater Biol 51, 85-94 Minamoto T, Yamanaka H, Takahara T, Honjo MN, Kawabata Z (2012): Surveillance of fish species composition using environmental DNA. Limnology 13, 193-197 Moushomi R, Wilgar G, Carvalho G, Creer S, Seymour M (2019): Environmental DNA size sorting and degradation experiment indicates the state of Daphnia magna mitochondrial and nuclear eDNA is subcellular. Sci Rep 9, 12500 Pfleger MO, Rider SJ, Johnston CE, Janosik AM (2016): Saving the doomed: Using eDNA to aid in detection of rare sturgeon for conservation (Acipenseridae). Glob Ecol Conserv 8, 99-107 Pont D, Meulenbroek P, Bammer V, Dejean T, Eros T, Jean P, Lenhardt M, Nagel C, Pekarik L, Schabuss M, Stoeckle BC, Stoica E, Zornig H, Weigand A, Valentini A (2023): Quantitative monitoring of diverse fish communities on a large scale combining eDNA metabarcoding and qPCR. Mol Ecol Resour 23, 396-409 Qian B, Li K, Lou X, Guo Y, Wang Y, Wu L, Zhang D (2022): Plasma Cell-Free DNA as a Novel Biomarker for the Diagnosis and Monitoring of Atherosclerosis. Cells 11 Sassoubre LM, Yamahara KM, Gardner LD, Block BA, Boehm AB (2016): Quantification of Environmental DNA (eDNA) Shedding and Decay Rates for Three Marine Fish. Environ Sci Technol 50, 10456-10464 Smith JG, Free CM, Lopazanski C, Brun J, Anderson CR, Carr MH, Claudet J, Dugan JE, Eurich JG, Francis TB, Hamilton SL, Mouillot D, Raimondi PT, Starr RM, Ziegler SL, Nickols KJ, Caselle JE (2023): A marine protected area network does not confer community structure resilience to a marine heatwave across coastal ecosystems. Glob Chang Biol Szoszkiewicz K, Budka A, Lacka A, Pietruczuk K (2022): Determining macrophyte species richness and dark diversity sources - A novel approach to improve the biodiversity estimation based on species traits. Sci Total Environ 816, 151496 Takahashi M, Sacco M, Kestel JH, Nester G, Campbell MA, van der Heyde M, Heydenrych MJ, Juszkiewicz DJ, Nevill P, Dawkins KL, Bessey C, Fernandes K, Miller H, Power M, Mousavi-Derazmahalleh M, Newton JP, White NE, Richards ZT, Allentoft ME (2023): Aquatic environmental DNA: A review of the macro-organismal biomonitoring revolution. Sci Total Environ 873, 162322 Thomsen PF, Kielgast J, Iversen LL, Moller PR, Rasmussen M, Willerslev E (2012a): Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples. Plos One 7 Thomsen PF, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MTP, Orlando L, Willerslev E (2012b): Monitoring endangered freshwater biodiversity using environmental DNA. Mol Ecol 21, 2565-2573 Titus JE, Grise D, Sullivan G, Stephens MD (2004): Monitoring submersed vegetation in a mesotrophic lake: correlation of two spatio-temporal scales of change. Aquat Bot 79, 33-50 Troth CR, Sweet MJ, Nightingale J, Burian A (2021): Seasonality, DNA degradation and spatial heterogeneity as drivers of eDNA detection dynamics. Sci Total Environ 768, 144466 Ulibarri RM, Bonar SA, Rees C, Amberg J, Ladell B, Jackson C (2017): Comparing Efficiency of American Fisheries Society Standard Snorkeling Techniques to Environmental DNA Sampling Techniques. N Am J Fish Manage 37, 644-651 Valentini A, Pompanon F, Taberlet P (2009): DNA barcoding for ecologists. Trends Ecol Evol 24, 110-7 Zambrano L, Hinojosa D (1999): Direct and indirect effects of carp (Cyprinus carpio L.) on macrophyte and benthic communities in experimental shallow ponds in central Mexico. Hydrobiologia 408, 131-138 Zambrano L, Scheffer M, Martinez-Ramos M (2001): Catastrophic response of lakes to benthivorous fish introduction. Oikos 94, 344-350 Zhang S, Lu Q, Wang YY, Wang XM, Zhao JD, Yao M (2020): Assessment of fish communities using environmental DNA: Effect of spatial sampling design in lentic systems of different sizes. Mol Ecol Resour 20, 242-255 Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 17 Sep, 2023 Reviewers invited by journal 06 Sep, 2023 Editor assigned by journal 28 Aug, 2023 First submitted to journal 22 Aug, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3273821","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":231281215,"identity":"ebac74c9-bd0d-4aa2-8d45-e9cb7a785977","order_by":0,"name":"Qinyu GE","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYJCCA0AsB2GykaDFmDQtIJDYQLQWeffmjYcL2w6nz2/vMWD4UHaYgX92A34thmeOFRye2XY4d8OZMwaMM84dZpC4c4CAlhk5Bod5QVokcgyYgQwGA4kEAlrmvwFrSZcHMpj/EqNFXoIHrCWB4QaPATMjMVoMeNIKDvOcSzfccCat4GDPuXQeiRuEbGk/vPkzT5m1PJCx8cGPMms5/hmEbDnAYMDACI2OA0DMg189yJYGoBaGPwTVjYJRMApGwUgGAJUxRXdEej3aAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1708-1949","institution":"Southeast University","correspondingAuthor":true,"prefix":"","firstName":"Qinyu","middleName":"","lastName":"GE","suffix":""},{"id":231281216,"identity":"36e8e16a-7f8e-4ac8-b249-5cbbbb0b7265","order_by":1,"name":"Zhihui Li","email":"","orcid":"","institution":"Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Zhihui","middleName":"","lastName":"Li","suffix":""},{"id":231281217,"identity":"a6f15431-a228-4aba-ad81-107088baf034","order_by":2,"name":"Yuwei Yang","email":"","orcid":"","institution":"Southeast University - Sipailou Campus: Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Yuwei","middleName":"","lastName":"Yang","suffix":""},{"id":231281218,"identity":"16fd0e44-b5f4-4dc7-a808-3cb5d6ad9b69","order_by":3,"name":"Huajuan Shi","email":"","orcid":"","institution":"Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Huajuan","middleName":"","lastName":"Shi","suffix":""},{"id":231281219,"identity":"2b15dfb1-f728-4a7c-890c-80a67ae85367","order_by":4,"name":"Junyi Zhang","email":"","orcid":"","institution":"Wuxi Environmental Monitoring Center","correspondingAuthor":false,"prefix":"","firstName":"Junyi","middleName":"","lastName":"Zhang","suffix":""},{"id":231281220,"identity":"d12f27f6-9c0a-4744-ae41-168dda908a5d","order_by":5,"name":"Min Pan","email":"","orcid":"","institution":"Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Pan","suffix":""},{"id":231281221,"identity":"6b1e8c51-8d94-44a2-a2b5-0962fb1f4033","order_by":6,"name":"Beili Sun","email":"","orcid":"","institution":"Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Beili","middleName":"","lastName":"Sun","suffix":""},{"id":231281222,"identity":"b39c575e-c436-49f4-aab4-eead7883a55e","order_by":7,"name":"Yunfei Bai","email":"","orcid":"","institution":"Southeast University","correspondingAuthor":false,"prefix":"","firstName":"Yunfei","middleName":"","lastName":"Bai","suffix":""}],"badges":[],"createdAt":"2023-08-18 04:10:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3273821/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3273821/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":43020244,"identity":"1a46aa75-fd57-4b09-bc09-41731bd8994c","added_by":"auto","created_at":"2023-09-12 16:06:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":206926,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe detectability and integrity of genomic DNA\u003c/strong\u003e. A: different fragments of genomic DNA separated on 1% agarose gel; B: Detectability and integrity changing trends of genomic DNA.\u003c/p\u003e","description":"","filename":"floatimage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/65f0af5e1eddf7a1568bd37a.jpg"},{"id":43020651,"identity":"45ed8992-0ba6-4166-ab99-7663d40e9d38","added_by":"auto","created_at":"2023-09-12 16:14:58","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":304276,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe detectability and integrity of eDNA.\u003c/strong\u003eA: The detectability and integrity of tank eDNA. The small window showed the decreasing rate comparison of detectability and eDI just after the fish was removed. B: The detectability and integrity of pond eDNA.\u003c/p\u003e","description":"","filename":"floatimage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/156a76dfd510d38995faa7ed.jpg"},{"id":43020246,"identity":"40c570ed-7947-4b7c-98bc-bac3364dacfe","added_by":"auto","created_at":"2023-09-12 16:06:58","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":206213,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInfluence of environmental temperature on eDI\u003c/strong\u003e. A: eDI showed in 4℃, 15℃, and 30℃ of tank water temperature after the fish were removed; B: eDI showed in different seasons in ponds before and after the fish were removed.\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/48a00d019041df8f6915dc60.jpg"},{"id":43020649,"identity":"62611df7-f29f-4ea2-b41c-56cbde8dc0ca","added_by":"auto","created_at":"2023-09-12 16:14:58","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":287842,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation between eDNA and fish abundance. \u003c/strong\u003eA: Correlations between eDNA concentration and different numbers of fish in different tanks; B: Correlations between eDNA concentration and different numbers of fish in the same tank.\u003c/p\u003e","description":"","filename":"floatimage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/17f642dd6f58d3fac750b46b.jpg"},{"id":43020650,"identity":"6070b41d-727e-4a3e-a531-ad588fc254cc","added_by":"auto","created_at":"2023-09-12 16:14:58","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":309473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstimation of fish production by BI\u003c/strong\u003e. A: The correlation index between BI and fish production was 0.9241. However, when using eDNA concentration that was not adjusted, only a correlation index of 0.7104 was obtained; B: Fish production predicted by BI in several other pond.\u003c/p\u003e","description":"","filename":"floatimage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/f3448a9d72a7d8f9267cf682.jpg"},{"id":43020652,"identity":"1c30f6d3-d360-4a9d-9ed7-7f33d0e02176","added_by":"auto","created_at":"2023-09-12 16:15:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":559192,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3273821/v1/8e09d9d4-12d2-4b33-8332-3ea43b7a7394.pdf"}],"financialInterests":"","formattedTitle":"Environmental DNA integrity index is sensitive for species biomass estimation in freshwater","fulltext":[{"header":"Synopsis","content":"\u003cp\u003eWe developed an environmental DNA integrity-based method which can estimate species biomass sensitively for species distribution and resource investigations.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eIn the last decade, environmental research largely benefited from the discovery and application of environmental DNA (eDNA), which is organismal DNA collected from environmental settings(Doi \u0026amp;Kelly \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). One of the most important applications is in aquatic ecology and resources. Recently, eDNA has been used in detecting short, species-specific DNA fragments in the water, which increases the accuracy, decreases the cost of surveys and allows the detection of rare or invasive species (Ficetola et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, Goldberg et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Jerde et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Minamoto et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2012\u003c/span\u003e, Valentini et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Researchers have also used eDNA to document the presence of bullfrog tadpoles (Goldberg et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), silver and bighead carp (Jerde et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), and frogs as well as salamanders(Goldberg et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) in a range of water bodies.\u003c/p\u003e \u003cp\u003eInformation on the distribution of species is a critical component of understanding their ecology and extinction risks and is important for the conservation of populations(Barajas Barbosa et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Species biomass is critical to estimate the production and material cycling of the ecosystem, it is also a fundamental biological data(Miller et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Smith et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), however, the traditional methods for biomass investigation are often lack accuracy, particularly for aquatic organism estimation such as fish(Guerra et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Additionally, time-consuming and laborious are also two obvious shortcomings. Now, eDNA has often been used to document the presence/absence of aquatic species as well as the investigating biological resources(Ji et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Kumar et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Szoszkiewicz et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIt is assumed that aquatic vertebrates release eDNA into the water from feces secretions and tissues in proportion to their biomass(Chong et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Kennedy et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), so eDNA could be used to estimate species biomass by measuring the number of eDNA copies in a sample of water. Likewise, it has been reported that eDNA could be used to monitor the biodiversity and species concentrations in water(Cantera et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Coutant et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Takahashi et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Nevertheless, the degradation rates of eDNA vary across species in different conditions, resulting in a poor correlation between the eDNA concentration and species abundance in water(Kong et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this present study, the aim is to systematically investigate the degradation patterns and influence of temperature on eDNA in freshwater environments. We proposed that eDNA integrity index can be used to adjust the eDNA concentration to estimate the biomass of fish. It is shown that the corrected estimated biomass is closer to the true value.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Study species\u003c/h2\u003e \u003cp\u003eCarp are one of the most widely transported species in the world, being used as ornamental fish and for sport fishing and human consumption(Titus et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Zambrano \u0026amp;Hinojosa \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e1999\u003c/span\u003e, Zambrano et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Furthermore, it has threat to other species in the same ecological environment(Miller \u0026amp;Crowl \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), so considered as invasive species(Haynes et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Common carp were used for assessing the characterization of eDNA, we choose carp as the target species because carp is an ideal model organism and previous studies have investigated aqueous microbial eDNA of carp(Barnes et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2014a\u003c/span\u003e, Eichmiller et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e, Mahon et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experiment design\u003c/h2\u003e \u003cp\u003eTo facilitate the control of experimental conditions and convenient collection of experimental data, a rapid experiment was conducted firstly to simulate degradation using genomic DNA, then, two parts of the studies, including an aquarium experiment and a basin experiment, have been established.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRapid Experiment\u003c/b\u003e:\u003c/p\u003e \u003cp\u003eCarp genomic DNA was fragmented in different lengths by ultrasonic with Covaris S2 (Covaris, Inc. USA). Primers for different lengths of PCR products were designed, one fragment is about 100 base pair for short amplicon, and the other is large than 500 base pair for long amplicon. The integrity index of the genomic DNA was calculated by the ratio of long amplicons to short amplicons. The comparison of short amplicons concentration with the original genomic DNA concentration was used as the detectability. The changes in the detectability and integrity index were observed and analyzed in the process of degradation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAquarium experiments\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSpecies introduced into the new environment need a period of time to adapt before acclimatizing the environment, and the metabolism and physiology will then be stable. Five carp (10.40\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0g) were introduced into a 50 L tank before the experiment. The containers were maintained at 25℃ and under a 12-hour light : dark cycle. During the experiment, water samples were collected for the first time on the tenth day before all the fish were transferred. The water samples were collected once a day in the first four days and once every two days in the following two weeks, then once a week until the eDNA was undetectable. 200mL of the water was collected and filtered on each time point.\u003c/p\u003e \u003cp\u003e \u003cem\u003eStudies of eDNA degradation\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe changes tendency of eDNA detectability and the eDNA integrity index (eDI) were measured and analyzed. The concentration of eDNA was indicated with 1/Log\u003csub\u003e10\u003c/sub\u003e(ΔCt) which was measured by using quantitative PCR.\u003c/p\u003e \u003cp\u003e \u003cem\u003eImpact of temperature on eDNA degradation\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe water ecosystems are exposed to different temperatures, which might affect the degradation rate of eDNA. Water samples were collected after the carp metabolism and physiology is stable, only two times sampling during the experiment that is before and one week after the fish were transferred. The tank temperature was set to 4℃, 15℃, and 30℃ after the fish was transferred. eDNA detectability and eDI were measured and analyzed according to the previous method.\u003c/p\u003e \u003cp\u003e \u003cem\u003eBiomass estimation\u003c/em\u003e \u003c/p\u003e \u003cp\u003eTo assess the relationship between eDNA concentration and species abundance, two experiments were carried out in this present study. In the first experiment, three tanks were filled with 1, 5, and 10 fish, respectively, water sampling were after the carp metabolism and physiology were stable. The relationship between eDNA concentration and the species abundance was calculated, and eDI was also introduced to adjust the eDNA concentration. In the second experiment, the tank was filled with 10 fish, 2 of which were transferred every 5 days after the metabolism and physiology were stable until 2 fish remain. Water sampling was conducted before every fish transfer.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePond experiment\u003c/b\u003e \u003c/p\u003e \u003cp\u003eExperiments of eDNA degradation and biomass estimation were also repeated and validated in a pond of 50 square meters. There were no carps in the pond before the experiment, and 10 carps (212\u0026thinsp;\u0026plusmn;\u0026thinsp;8.6g) were introduced in the pond. Based on the aquarium experiments, water sampling was in one week before and one month after all the fish were transferred, the sampling frequency was once a week in the whole eDNA degradation experiment. 1L of water sample was collected and filtered each time in the pond experiment. To assess the influence of temperature, two experiments were carried out in March and August of the year 2021. Sampling was before and 7 days after the fish transfer.\u003c/p\u003e \u003cp\u003eFor further verification, a fish pond of farmers with 1000 m\u003csup\u003e2\u003c/sup\u003e was involved in this study for biomass estimation. There were two periods of water sampling during the whole experiment. The first water sampling was conducted during the fish fry culture period and the second sampling was during the harvest period. The weight of fish fry and adult fish was provided by the farmer. Three repeats of sampling were conducted each time. The relationship between eDNA concentration and species abundance was studied according to the previous strategy. The fish production of several other fishpond was also estimated by BI.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Experiment methods\u003c/h2\u003e \u003cp\u003e \u003cem\u003eSampling and eDNA extraction\u003c/em\u003e \u003c/p\u003e \u003cp\u003eWater samples were filtered through a 0.22 \u0026micro;m pore filter immediately after it was collected. The filter membrane was then submitted to the FastPure Microbiome DNA isolation Kit for eDNA extraction. The eDNA was extracted according to the manual instruction with some modifications. Briefly, the filter membrane was broken in the presence of lysis buffer, then mixed with protease K for protein digestion, and then it was submitted to the purification column for eDNA enrichment. The eDNA solution was submitted to Nanodrop ND1000 and Qubit 3.0 Fluorometer (ThermoFisher, USA) for quality control, the obtained eDNA was detected immediately or stored at -20℃ for a short time.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePCR and gel electrophoresis\u003c/em\u003e \u003c/p\u003e \u003cp\u003eFor the rapid experiment, the genomic DNA was fragmented, the fragment was separated by agarose gel (1%) electrophoresis. The short and long fragment of extracted eDNA was amplified by PCR by using Premix Taq\u0026trade; (TaKaRa, Dalian, China) according to the instructions for validation.\u003c/p\u003e \u003cp\u003e \u003cem\u003eReal-time quantitative PCR\u003c/em\u003e \u003c/p\u003e \u003cp\u003eThe detectability and integrity of eDNA were measured by using real-time quantitative PCR. The quantification of eDNA was performed using SYBR Premix Ex Taq\u0026trade; with a 7500 Real-Time PCR system (Applied Biosystems). The primers for long and short fragment eDNA of carp were synthesized by Sangon Biotech Ltd (Shanghai, China) and the sequences were listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. These primers are specific to carp and amplify the fragment of the mitochondrion gene.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDNA sequences of the primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDNA sequences (5\u0026rsquo;\u0026mdash;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAmplicon length\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTAAAAGCATCGGTCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e660 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAGCCTGCACTCTGAAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTACATAGTGCCCCCTTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e87 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCGGGGTTTGACAAGGATA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eEach reaction in a volume of 10\u0026micro;l contained 2\u0026micro;L eDNA solution, 5 pmol of each primer, 5\u0026micro;L SYBR Premix Ex Taq\u0026trade;, and 1\u0026micro;L sterile water. The process of amplification uses two temperature level thermal cycles. The thermal cycle parameter was as follows: 1min at 95℃ and 40 cycles of 10 s at 95℃ and 40 s at 60℃. Quantitative real-time PCR was performed in triplicate and the PCR products were sent to sequencing to confirm the specificity of the primer set described above.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Statistical analyses\u003c/h2\u003e \u003cp\u003eWe evaluated the effect of temperature on the concentration of eDNA using a one-way analysis of variance (ANOVA, a\u0026thinsp;=\u0026thinsp;0.05). In the aquarium and pond experiments, we evaluated the relationship between eDNA concentration and biomass of carp per 1-L water sample using a Type II regression and evaluated the relationship between the number of carp and biomass using a Type I regression. ANOVA was performed using GraphPad (version 9.0, Dotmatics., La Jolla, USA). The remaining statistical analyses were conducted in R ver. 4.3.0.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Study of eDNA degradation\u003c/h2\u003e \u003c/div\u003e\n\u003ch3\u003e1) Simulation experiments\u003c/h3\u003e\n\u003cp\u003eThe detectability of eDNA in the water ecosystem is the determinant of its further applications. We used the fragmented genomic DNA to simulate DNA degradation and investigate the relationship between DNA integrity and detectability. The DNA bands separated on the gel could be seen clearly (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), and most of the fragments could be detected. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, there was the rapid decline in DNA integrity (red line), but no significant impact on DNA detectability (blue line). However, the species might be transferred or died if the DNA were largely degraded. It is reasonably inferred that the bias in species distribution and biomass estimation is largely impacted by eDNA degradation.\u003c/p\u003e\n\u003ch3\u003e2) Tank experiment\u003c/h3\u003e\n\u003cp\u003eWater samples were collected after the carp was introduced and the metabolism and physiology are stable, the fish were transferred ten days from the first sampling and then sampled according to the time point designed until no eDNA could be detectability. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA showed the changes in eDNA integrity and detectability. During the eDNA monitoring experiment over two months, an increase of the eDNA concentration was observed in the first three days, and then it remained relatively stable until the fish removal. After the fish removal, there was a dramatic decrease in the concentration of eDNA during the first 5 days, and then it decreased slowly, the eDNA could be detected even two months thereafter, it showed almost negative results until 52 days after the fish removal (blue line in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Unlike eDNA detectability, a significant decrease in eDI (eDNA integrity index) was found just after the fish was removed, it dropped close to zero in only two days (red line in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). It is suggested that eDI is more sensitive to the presence/absence of species and it might be a more accurate calibrator to estimate the biomass.\u003c/p\u003e\n\u003ch3\u003e3) Pond experiment\u003c/h3\u003e\n\u003cp\u003eTo further validate the detectability and eDI results obtained, a similar experiment was carried out in a 100 m\u003csup\u003e2\u003c/sup\u003e pond. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, similar trends were presented in eDNA detectability and eDI. The value of eDI was very low just one week after the fish was removed, and eDNA was also detectable one month later until the experiment terminated.\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Effect of temperature on the integrity of eDNA\u003c/h2\u003e \u003cp\u003eOne of the most important factors in the water ecosystem is temperature. The water temperature varies across seasons; thus, we investigated the influence of different temperatures on eDI in tanks and ponds in this study. The results are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003e, eDNA degraded slowly at low temperatures and quickly at high temperatures. There was no significant difference in the eDI of the tank experiment between different temperatures (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA); the same result was found in the eDI of the pond experiment between March and August (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Similar to the previous study, whatever the temperature or seasons, the eDI was sharply decreased after the fish removal. It was shown eDI is close correlation to living organisms.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Estimation of biomass with eDI\u003c/h2\u003e \u003cp\u003eBased on the study of eDNA degradation in tanks and ponds, we assessed the relationship between abundance and eDNA concentration. In this study, eDNA concentration was denoted with 1/Log10 (ΔCt) by using quantitative PCR results. We also defined the adjusted eDNA d with eDI as biomass index (BI), which is calculated using eDNA multiply by eDI. Firscalibratetly, three tanks with one, five, and ten fish were studied respectively. eDNA concentration and eDI were measured and their correlation with fish abundance was shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA. A positive correlation was observed between biomass with either eDNA concentration (R2 = 0.8315) or BI (R2 = 0.9790), while a higher correlation was obtained on BI. To further assess the contribution of BI to biomass estimation, another experiment was carried out. We used one tank with ten fish, and removed two fish every 5 days, the last two fish remain until the end of the experiment. Water sampling was right before each fish removal. eDNA concentration was detected by using quantitative PCR and BI was calculated, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB showed the correlation results of fish number and eDNA concentration. The blue line indicated a weak correlation between eDNA concentration and fish number (R2 = 0.4349); while a strong positive correlation was found when the eDNA concentration was adjusted by eDI (R2 = 0.9549).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Estimation of fish production by BI\u003c/h2\u003e \u003cp\u003eIn the validation experiment, about 50kg/500m\u003csup\u003e2\u003c/sup\u003e of fish fry were put into the fishpond in March of 2021, and about 500kg/500m\u003csup\u003e2\u003c/sup\u003e of adult fish were harvested in October. Results showed that the fishpond eDNA concentration was increased during harvested period, and it was worth noting that BI of this fishpond increased more remarkably. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, the correlation between eDNA and fish biomass was 0.7104, and a higher correlation (R\u003csup\u003e2\u003c/sup\u003e = 0.9241) was obtained between BI and fish biomass. A linear formula was fit by BI that is BI = 0.00024*biomass (kg) + 0.3770. The fish production predicted by BI showed high accurate in several other fishpond (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), no significant differences found between predicted and actual output.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this present study, we developed a method for estimating fish biomass based on adjusted eDNA concentration in water samples. It was found that eDNA in the water ecosystem could be detected for a long time so long as the species ever existed, while undegraded eDNA (denoted by eDI) only remains for several days in a water environment. eDI, the eDNA integrity index, is more sensitive to species changes and more suitable for biomass estimation.\u003c/p\u003e\u003cp\u003eWe measured the DNA concentration changes after fish were removed until was undetectable in different experimental conditions. The influence of temperatures on eDNA concentration was also revealed. eDI was introduced in our study which was derived from cell-free DNA in human plasma and body fluid (Lamminaho et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Qian et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). It is for the first time that eDI was introduced to environmental research which might be valuable for developing expanded eDNA application.\u003c/p\u003e\u003cp\u003eA higher positive correlation was exhibited between adjusted eDNA and fish biomass in the fish pond experiment, the estimated results were close to fish production. It provides a more sensitive method to estimate species abundance(Carvalho et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e, Pont et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Sassoubre et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). It is mainly due to the introduction of eDI which could be used to adjust the eDNA concentration for biomass estimation.\u003c/p\u003e\u003cp\u003eeDNA had already been studied for the degradation and estimation of biomass. eDNA degradation experiments have involved the removal of target organisms from controlled environments followed by monitoring the persistence of target eDNA over time(Thomsen et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2012a\u003c/span\u003e). Some previous reports showed that eDNA could remain only a few days or even a few hours after the species were removed, while other inconsistent results revealed eDNA could exist for a long time up to one month(Barnes et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2014b\u003c/span\u003e, Moushomi et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Troth et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In this study, it was proved eDNA could be detected more than one month after the fish was removed only by using a short amplicon. It could be inferred that different lengths of amplicon might be used in their studies, and short amplicon is less affected by eDNA degradation, while long amplicon is largely affected by degradation(Dejean et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Goldberg et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e, Thomsen et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2012b\u003c/span\u003e). It is therefore suggested the detection result is not accurate enough if only short or long amplicons are used for PCR, we used both short and long amplicons in this study and proposed eDI, a more sensitive index for eDNA degradation. It will benefit the application of eDNA in the water ecosystem. Admittedly, we studied the degradation mainly in indoor environments and small water ecosystems, and only the effect of temperature was involved. More environmental factors such as pH, conductivity, and microbial community composition may influence eDNA degradation, thus deeper and more detailed studies are necessary(Jo et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, McCartin et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Furthermore, it's worth noting that the selection of amplicon length for different species needs to be considered.\u003c/p\u003e\u003cp\u003eIn this present study, the degradation of eDNA was studied, The changes of eDI as well as eDNA concentration along with time were measured after the species were removed and the environmental conditions are generally controllable. There may be deviations between this study and results from the complex water ecological environment and water sampling might be one of the most important factors. There is little effect of sampling location when in small bodies of water such as tanks and small ponds, while immense influence on rivers and lakes. Furthermore, sampling and eDNA extraction methods are also important to the detection results, many methods from previous studies were referred to and involved in this study(Amberg et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Eichmiller et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Pfleger et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Ulibarri et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Zhang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn summary, we proposed an eDI-based biomass estimation method and obtained accurate results for cultured fishes. This method provided an easier, faster, and more accurate approach in estimating the species biomass in natural environments compared with traditional methods, such as mark, recapture, and unadjusted eDNA. In addition, it could be used to monitor seasonal eDNA concentration change to predict important microhabitats for reproduction, feeding, and refuge of a target species. The estimation data might be used to aid management plans for the conservation of populations, communities, and ecosystems. To decrease the bias of this method, future experiments should focus on collecting more field data and more comparison with other estimation methods.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank Rui Li for assistance in sample collection, eDNA extraction, and eDNA detections.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe manuscript is approved by all authors for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Key Research and Development Program of China (Grant numbers: 2022YFF0710800) and the Natural Science Foundation of Jiangsu Province (Grant numbers: BK20201148 and BK20211166).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Qinyu Ge, Zhihui Li, Yuwei Yang, Huajuan Shi, Junyi Zhang, Min Pan, Beili Sun and Yunfei Bai. The first draft of the manuscript was written by Qinyu Ge and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAmberg JJ, McCalla SG, Monroe E, Lance R, Baerwaldt K, Gaikowski MP (2015): Improving efficiency and reliability of environmental DNA analysis for silver carp. J Great Lakes Res 41, 367-373\u003c/li\u003e\n\u003cli\u003eBarajas Barbosa MP, Craven D, Weigelt P, Denelle P, Otto R, Diaz S, Price J, Fernandez-Palacios JM, Kreft H (2023): Assembly of functional diversity in an oceanic island flora. Nature\u003c/li\u003e\n\u003cli\u003eBarnes MA, Turner CR, Jerde CL, Renshaw MA, Chadderton WL, Lodge DM (2014a): Environmental Conditions Influence eDNA Persistence in Aquatic Systems. Environ Sci Technol 48, 1819-1827\u003c/li\u003e\n\u003cli\u003eBarnes MA, Turner CR, Jerde CL, Renshaw MA, Chadderton WL, Lodge DM (2014b): Environmental conditions influence eDNA persistence in aquatic systems. Environ Sci Technol 48, 1819-27\u003c/li\u003e\n\u003cli\u003eCantera I, Coutant O, Jezequel C, Decotte JB, Dejean T, Iribar A, Vigouroux R, Valentini A, Murienne J, Brosse S (2022): Low level of anthropization linked to harsh vertebrate biodiversity declines in Amazonia. Nat Commun 13, 3290\u003c/li\u003e\n\u003cli\u003eCarvalho CS, De Oliveira ME, Rodriguez-Castro KG, Saranholi BH, Galetti PM (2022): Efficiency of eDNA and iDNA in assessing vertebrate diversity and its abundance. Mol Ecol Resour 22, 1262-1273\u003c/li\u003e\n\u003cli\u003eChong JWR, Khoo KS, Chew KW, Ting HY, Show PL (2023): Trends in digital image processing of isolated microalgae by incorporating classification algorithm. Biotechnol Adv 63, 108095\u003c/li\u003e\n\u003cli\u003eCoutant O, Jezequel C, Mokany K, Cantera I, Covain R, Valentini A, Dejean T, Brosse S, Murienne J (2023): Environmental DNA reveals a mismatch between diversity facets of Amazonian fishes in response to contrasting geographical, environmental and anthropogenic effects. Glob Chang Biol 29, 1741-1758\u003c/li\u003e\n\u003cli\u003eDejean T, Valentini A, Duparc A, Pellier-Cuit S, Pompanon F, Taberlet P, Miaud C (2011): Persistence of Environmental DNA in Freshwater Ecosystems. Plos One 6\u003c/li\u003e\n\u003cli\u003eDoi H, Kelly RP (2023): Ethical considerations for human sequences in environmental DNA. Nat Ecol Evol\u003c/li\u003e\n\u003cli\u003eEichmiller JJ, Bajer PG, Sorensen PW (2014): The Relationship between the Distribution of Common Carp and Their Environmental DNA in a Small Lake. Plos One 9\u003c/li\u003e\n\u003cli\u003eEichmiller JJ, Miller LM, Sorensen PW (2016): Optimizing techniques to capture and extract environmental DNA for detection and quantification of fish. Mol Ecol Resour 16, 56-68\u003c/li\u003e\n\u003cli\u003eFicetola GF, Miaud C, Pompanon F, Taberlet P (2008): Species detection using environmental DNA from water samples. Biol Lett 4, 423-5\u003c/li\u003e\n\u003cli\u003eGoldberg CS, Pilliod DS, Arkle RS, Waits LP (2011): Molecular detection of vertebrates in stream water: a demonstration using Rocky Mountain tailed frogs and Idaho giant salamanders. PLoS One 6, e22746\u003c/li\u003e\n\u003cli\u003eGoldberg CS, Sepulveda A, Ray A, Baumgardt J, Waits LP (2013): Environmental DNA as a new method for early detection of New Zealand mudsnails (Potamopyrgus antipodarum). Freshw Sci 32, 792-800\u003c/li\u003e\n\u003cli\u003eGuerra CA et al. (2022): Global hotspots for soil nature conservation. Nature 610, 693-698\u003c/li\u003e\n\u003cli\u003eHaynes GD, Gilligan DM, Grewe P, Moran C, Nicholas FW (2010): Population genetics of invasive common carp Cyprinus carpio L. in coastal drainages in eastern Australia. J Fish Biol 77, 1150-1157\u003c/li\u003e\n\u003cli\u003eJerde CL, Mahon AR, Chadderton WL, Lodge DM (2011): \u0026quot;Sight-unseen\u0026quot; detection of rare aquatic species using environmental DNA. Conserv Lett 4, 150-157\u003c/li\u003e\n\u003cli\u003eJi F, Han D, Yan L, Yan S, Zha J, Shen J (2022): Assessment of benthic invertebrate diversity and river ecological status along an urbanized gradient using environmental DNA metabarcoding and a traditional survey method. Sci Total Environ 806, 150587\u003c/li\u003e\n\u003cli\u003eJo T, Murakami H, Masuda R, Sakata MK, Yamamoto S, Minamoto T (2017): Rapid degradation of longer DNA fragments enables the improved estimation of distribution and biomass using environmental DNA. Mol Ecol Resour 17, e25-e33\u003c/li\u003e\n\u003cli\u003eKennedy KM et al. (2023): Questioning the fetal microbiome illustrates pitfalls of low-biomass microbial studies. Nature 613, 639-649\u003c/li\u003e\n\u003cli\u003eKong L, Zheng R, Feng Y, Du W, Xie C, Gu Y, Liu S (2023): Anammox bacteria adapt to long-term light irradiation in photogranules. Water Res 241, 120144\u003c/li\u003e\n\u003cli\u003eKumar MS, Slud EV, Hehnly C, Zhang L, Broach J, Irizarry RA, Schiff SJ, Paulson JN (2022): Differential richness inference for 16S rRNA marker gene surveys. Genome Biol 23, 166\u003c/li\u003e\n\u003cli\u003eLamminaho M, Kujala J, Peltonen H, Tengstrom M, Kosma VM, Mannermaa A (2021): High Cell-Free DNA Integrity Is Associated with Poor Breast Cancer Survival. Cancers (Basel) 13\u003c/li\u003e\n\u003cli\u003eMahon AR, Jerde CL, Galaska M, Bergner JL, Chadderton WL, Lodge DM, Hunter ME, Nico LG (2013): Validation of eDNA Surveillance Sensitivity for Detection of Asian Carps in Controlled and Field Experiments. Plos One 8\u003c/li\u003e\n\u003cli\u003eMcCartin LJ, Vohsen SA, Ambrose SW, Layden M, McFadden CS, Cordes EE, McDermott JM, Herrera S (2022): Temperature Controls eDNA Persistence across Physicochemical Conditions in Seawater. Environ Sci Technol 56, 8629-8639\u003c/li\u003e\n\u003cli\u003eMiller MGR, Reimer JD, Sommer B, Cook KM, Pandolfi JM, Obuchi M, Beger M (2023): Temperate functional niche availability not resident-invader competition shapes tropicalisation in reef fishes. Nat Commun 14, 2181\u003c/li\u003e\n\u003cli\u003eMiller SA, Crowl TA (2006): Effects of common carp (Cyprinus carpio) on macrophytes and invertebrate communities in a shallow lake. Freshwater Biol 51, 85-94\u003c/li\u003e\n\u003cli\u003eMinamoto T, Yamanaka H, Takahara T, Honjo MN, Kawabata Z (2012): Surveillance of fish species composition using environmental DNA. Limnology 13, 193-197\u003c/li\u003e\n\u003cli\u003eMoushomi R, Wilgar G, Carvalho G, Creer S, Seymour M (2019): Environmental DNA size sorting and degradation experiment indicates the state of Daphnia magna mitochondrial and nuclear eDNA is subcellular. Sci Rep 9, 12500\u003c/li\u003e\n\u003cli\u003ePfleger MO, Rider SJ, Johnston CE, Janosik AM (2016): Saving the doomed: Using eDNA to aid in detection of rare sturgeon for conservation (Acipenseridae). Glob Ecol Conserv 8, 99-107\u003c/li\u003e\n\u003cli\u003ePont D, Meulenbroek P, Bammer V, Dejean T, Eros T, Jean P, Lenhardt M, Nagel C, Pekarik L, Schabuss M, Stoeckle BC, Stoica E, Zornig H, Weigand A, Valentini A (2023): Quantitative monitoring of diverse fish communities on a large scale combining eDNA metabarcoding and qPCR. Mol Ecol Resour 23, 396-409\u003c/li\u003e\n\u003cli\u003eQian B, Li K, Lou X, Guo Y, Wang Y, Wu L, Zhang D (2022): Plasma Cell-Free DNA as a Novel Biomarker for the Diagnosis and Monitoring of Atherosclerosis. Cells 11\u003c/li\u003e\n\u003cli\u003eSassoubre LM, Yamahara KM, Gardner LD, Block BA, Boehm AB (2016): Quantification of Environmental DNA (eDNA) Shedding and Decay Rates for Three Marine Fish. Environ Sci Technol 50, 10456-10464\u003c/li\u003e\n\u003cli\u003eSmith JG, Free CM, Lopazanski C, Brun J, Anderson CR, Carr MH, Claudet J, Dugan JE, Eurich JG, Francis TB, Hamilton SL, Mouillot D, Raimondi PT, Starr RM, Ziegler SL, Nickols KJ, Caselle JE (2023): A marine protected area network does not confer community structure resilience to a marine heatwave across coastal ecosystems. Glob Chang Biol\u003c/li\u003e\n\u003cli\u003eSzoszkiewicz K, Budka A, Lacka A, Pietruczuk K (2022): Determining macrophyte species richness and dark diversity sources - A novel approach to improve the biodiversity estimation based on species traits. Sci Total Environ 816, 151496\u003c/li\u003e\n\u003cli\u003eTakahashi M, Sacco M, Kestel JH, Nester G, Campbell MA, van der Heyde M, Heydenrych MJ, Juszkiewicz DJ, Nevill P, Dawkins KL, Bessey C, Fernandes K, Miller H, Power M, Mousavi-Derazmahalleh M, Newton JP, White NE, Richards ZT, Allentoft ME (2023): Aquatic environmental DNA: A review of the macro-organismal biomonitoring revolution. Sci Total Environ 873, 162322\u003c/li\u003e\n\u003cli\u003eThomsen PF, Kielgast J, Iversen LL, Moller PR, Rasmussen M, Willerslev E (2012a): Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples. Plos One 7\u003c/li\u003e\n\u003cli\u003eThomsen PF, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MTP, Orlando L, Willerslev E (2012b): Monitoring endangered freshwater biodiversity using environmental DNA. Mol Ecol 21, 2565-2573\u003c/li\u003e\n\u003cli\u003eTitus JE, Grise D, Sullivan G, Stephens MD (2004): Monitoring submersed vegetation in a mesotrophic lake: correlation of two spatio-temporal scales of change. Aquat Bot 79, 33-50\u003c/li\u003e\n\u003cli\u003eTroth CR, Sweet MJ, Nightingale J, Burian A (2021): Seasonality, DNA degradation and spatial heterogeneity as drivers of eDNA detection dynamics. Sci Total Environ 768, 144466\u003c/li\u003e\n\u003cli\u003eUlibarri RM, Bonar SA, Rees C, Amberg J, Ladell B, Jackson C (2017): Comparing Efficiency of American Fisheries Society Standard Snorkeling Techniques to Environmental DNA Sampling Techniques. N Am J Fish Manage 37, 644-651\u003c/li\u003e\n\u003cli\u003eValentini A, Pompanon F, Taberlet P (2009): DNA barcoding for ecologists. Trends Ecol Evol 24, 110-7\u003c/li\u003e\n\u003cli\u003eZambrano L, Hinojosa D (1999): Direct and indirect effects of carp (Cyprinus carpio L.) on macrophyte and benthic communities in experimental shallow ponds in central Mexico. Hydrobiologia 408, 131-138\u003c/li\u003e\n\u003cli\u003eZambrano L, Scheffer M, Martinez-Ramos M (2001): Catastrophic response of lakes to benthivorous fish introduction. Oikos 94, 344-350\u003c/li\u003e\n\u003cli\u003eZhang S, Lu Q, Wang YY, Wang XM, Zhao JD, Yao M (2020): Assessment of fish communities using environmental DNA: Effect of spatial sampling design in lentic systems of different sizes. Mol Ecol Resour 20, 242-255\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"environmental DNA, integrity, biomass estimation, degradation, carp, water","lastPublishedDoi":"10.21203/rs.3.rs-3273821/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3273821/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEnvironmental DNA (eDNA) from aquatic vertebrates has recently been used to estimate the presence of a species. However, the estimation accuracy is affected by the degradation rate of eDNA. In this study, eDNA integrity index (eDI) was introduced to adjust eDNA concentration for carp biomass estimation. The adjusted eDNA concentration was defined as biomass index (BI). The degradation rate of eDNA was studied by simulation experiment, tank and pond experiment successively. The eDNA concentration decreasing slowly after the species was removed while eDI changed rapidly in all experiments. eDI decreased to closely zero in two days while eDNA remained detectable for more than one month. The temperature was found to have no significant effect on eDI. Although the eDNA concentration and BI were both positively correlated with carp biomass in all experiments, BI showed higher correlation (R\u003csup\u003e2\u003c/sup\u003e\u0026gt;0.95), was more sensitive to biomass changes, and accurate for carp biomass estimation. We used this method to estimate the biomass of carp in a fishpond successfully, which suggested that accurate biomass data can reflect the potential distribution of common carp in the natural environment. It offers a non-invasive, simple, rapid, and accurate method for biomass estimation.\u003c/p\u003e","manuscriptTitle":"Environmental DNA integrity index is sensitive for species biomass estimation in freshwater","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-09-12 16:06:53","doi":"10.21203/rs.3.rs-3273821/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2023-09-17T17:01:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-09-06T10:03:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-08-28T04:21:02+00:00","index":"","fulltext":""},{"type":"submitted","content":"Environmental Science and Pollution Research","date":"2023-08-22T21:06:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"environmental-science-and-pollution-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"espr","sideBox":"Learn more about [Environmental Science and Pollution Research](https://www.springer.com/journal/11356)","snPcode":"11356","submissionUrl":"https://submission.nature.com/new-submission/11356/3","title":"Environmental Science and Pollution Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e978f7c7-00e4-494d-92dc-c97bfd59ef8e","owner":[],"postedDate":"September 12th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-04-18T09:22:36+00:00","versionOfRecord":[],"versionCreatedAt":"2023-09-12 16:06:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3273821","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3273821","identity":"rs-3273821","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.