Escherichia coli proteins uL29 and ACP stabilize the Tn7-encoded TnsD and its DNA binding

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-03 · read from full text

This preprint studied how the Escherichia coli host factors ribosomal protein uL29 and acyl carrier protein (ACP) regulate target-site selection by the Tn7 transposase protein TnsD, which binds the attTn7 site in the glmS region. Using biochemical protein purification and electrophoretic mobility shift assays, the authors found that TnsD is prone to aggregation and that adding uL29 and ACP partially mitigates this instability while stimulating TnsD DNA binding, mediated by reciprocal electrostatic interactions with the C-terminal region of TnsD; they also mapped uL29 and ACP residues involved in the interaction. A key limitation stated in the work is that prior structural/biochemical discrepancies (including different TnsD–TnsC contacts reported for other Tn7-related elements) leave open questions about whether these mechanisms generalize across Tn7 variants. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Tn7 mobile genetic elements are known for their sophisticated target-site selection mechanisms and, in some cases, programmability. Recognition of target sites is mediated by designated transposon-encoded proteins and modulated by host factor proteins. In the case of the CRISPR-associated Tn7 elements from the type V-K, the ribosomal protein uS15 is an integral component of recruitment complex that promotes R-loop completion. Previous biochemical work also revealed that the ribosomal protein uL29 and the acyl carrier protein (ACP) influence Tn7 transposition frequency in vitro. However, how uL29 and ACP regulate the formation of the Tn7 targeting complex remains unclear. The prototypical Tn7 element encodes a heteromeric transposase (TnsAB), a AAA+ adaptor (TnsC), and two target-site selection proteins (TnsD and TnsE). TnsD targets a highly conserved site at the end of the glmSgene (attTn7). However, poor protein stability has precluded the molecular characterization of how TnsD recognizes its target site. Here, we show that ACP and uL29 interact with the C-terminal region of TnsD through reciprocal electrostatic interactions, in turn, mitigating its tendency to aggregate. Additionally, we identify the uL29 and ACP residues that mediate the interaction with TnsD and stimulate DNA binding. These results unveil unique features of the TnsD-mediated target-site selection complex.
Full text 115,775 characters · extracted from preprint-html · click to expand
Escherichia coli proteins uL29 and ACP stabilize the Tn7-encoded TnsD and its DNA binding | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Escherichia coli proteins uL29 and ACP stabilize the Tn7-encoded TnsD and its DNA binding Shani B. Leyva Camacho, Lindsay A. Matthews, Alba Guarné This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7151933/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 22 Aug, 2025 Read the published version in Mobile DNA → Version 1 posted 8 You are reading this latest preprint version Abstract Tn7 mobile genetic elements are known for their sophisticated target-site selection mechanisms and, in some cases, programmability. Recognition of target sites is mediated by designated transposon-encoded proteins and modulated by host factor proteins. In the case of the CRISPR-associated Tn7 elements from the type V-K, the ribosomal protein uS15 is an integral component of recruitment complex that promotes R-loop completion. Previous biochemical work also revealed that the ribosomal protein uL29 and the acyl carrier protein (ACP) influence Tn7 transposition frequency in vitro . However, how uL29 and ACP regulate the formation of the Tn7 targeting complex remains unclear. The prototypical Tn7 element encodes a heteromeric transposase (TnsAB), a AAA+ adaptor (TnsC), and two target-site selection proteins (TnsD and TnsE). TnsD targets a highly conserved site at the end of the glmS gene ( attTn7 ). However, poor protein stability has precluded the molecular characterization of how TnsD recognizes its target site. Here, we show that ACP and uL29 interact with the C-terminal region of TnsD through reciprocal electrostatic interactions, in turn, mitigating its tendency to aggregate. Additionally, we identify the uL29 and ACP residues that mediate the interaction with TnsD and stimulate DNA binding. These results unveil unique features of the TnsD-mediated target-site selection complex. Tn7 transposition Tn7 target-site selection host factors protein stability protein interactions DNA-binding proteins Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background DNA transposons are genetic segments capable of moving and replicating within genomes. Some transposons insert into multiple sites, while others are site-specific. The Tn7 family of transposons is characterized by its sophisticated DNA targeting mechanisms. The prototypical Tn7 element has two alternative targeting pathways that target either a highly conserved genomic site or replication structure in conjugal plasmids, ensuring the efficient vertical and horizontal spread of the element [ 1 ]. To mediate these two insertion mechanisms, Tn7 encodes five proteins: TnsA, TnsB, TnsC, TnsD/TniQ and TnsE. TnsA and TnsB form a heteromeric transposase (TnsAB), which catalyzes the transposon’s movement, excising the element from the donor DNA and joining the ends to the target DNA. However, TnsAB is not active on its own. Association with the AAA + ATPase TnsC forms the active transposition complex (TnsABC). TnsC functions as an adaptor between TnsAB and the target-site selection proteins TnsD/TniQ or TnsE. TnsD belongs to the TnsD/TniQ family of proteins and directs insertion to the so-called Tn7 attachment site ( attTn7 ), located at the 3’ end of the highly conserved glmS gene [ 2 ]. Alternatively, the interaction with TnsE directs insertions to replicative DNA structures in conjugal plasmids, promoting the dispersal of the element across species [ 3 ]. The attTn7 site includes the very last 36 bp of the glmS open reading frame [ 4 ]. Although TnsD binds to the coding sequence for the glmS gene, the insertion site lies 27 bp downstream from the binding site, providing a safe harbor for Tn7 insertions without deleterious effects on the host [ 4 ]. TnsD contains a conserved NTD (residues 1–165) characteristic of the TniQ/TnsD family that mediates the interactions with the TnsC adaptor and binds DNA without sequence specificity [ 5 , 6 ], and a variable C-terminal region that specifically targets the attTn7 site (Fig. 1 a). Deleting even ten residues from the C-terminus suppresses its specificity for the attTn7 site [ 4 ]. The structure of N-terminal domain of Tn7 TnsD (TnsD-NTD) bound to TnsC has demonstrated that this domain functions as a nucleotide-exchange factor for TnsC and promotes the DNA-dependent oligomerization of TnsC (Suppl. Figure 1a) [ 6 , 7 ]. A recent structure of the TnsABCD transposome complex from a type I-B2 CAST (CRISPR-associated transposon) unveiled an intriguing DNA binding interaction, where both the N- and C-terminal domains of TnsD interact with TnsC (Suppl. Figure 1b) [ 8 ]. This finding is at odds with previous biochemical analysis studies for the prototypical Tn7 element showing that the N-terminal domain suffices to mediate the interaction with TnsC [ 4 ]. It is possible that type I-B2 TnsD binds its att site differently than the prototypical Tn7 element, or that the structure of the type I-B2 TnsABCD tranpososome provided a fragmented view of the complex. The acyl carrier protein (ACP) and the ribosomal protein uL29 stimulate binding of TnsD from the prototypical Tn7 element to the attTn7 site [ 9 ]. Moreover, simultaneous addition of uL29 and ACP caused a three-fold increase in transposition frequency in vitro [ 9 ]. Analogously, in vivo experiments showed a 9‐fold decrease in transposition when an E. coli strain containing an internal deletion of 16 amino acids within uL29 was used [ 9 ]. In the case of the type V-K CAST, the ribosomal protein uS15 is an integral component of recruitment complex that promotes R-loop completion [ 10 ]. Therefore, it is plausible that ACP and uL29 enhance Tn7 transposition by stabilizing the interaction of TnsD with the attTn7 site. Here, we sought to elucidate the effect of ACP and uL29 on TnsD. We found that TnsD is prone to aggregation but addition of both ACP and uL29 partially mitigates its instability. This effect occurs through reciprocal electrostatic interactions with the C-terminal region of TnsD. We identified and characterized uL29 and ACP residues mediating the interaction with the TnsD: attTn7 complex. These results provide valuable information to elucidate how TnsD assembles a targeting complex at attTn7 sites. Methods TnsD extraction and purification TnsD from E. coli (Uniprot entry P13991) was subcloned from a plasmid containing all Tn7-encoded proteins (from Nancy Craig’s Lab) into the expression vector pET22b containing a C-terminal 6x Histidine tag (pAG9323). The pAG9323 plasmid was then transformed into BL21 Star (DE3) cells (Invitrogen #44–0049) supplemented with a plasmid encoding rare tRNAs (pRARE) and grown in LB medium at 37°C to OD 600 ∼0.7. Cell cultures were cold shocked using an ice/water bath and protein expression was induced by addition of 0.5 mM IPTG. Cultures were grown at 16°C overnight with an orbital agitation of 220 rpm. Cells were harvested by centrifugation at 3,990 g for 15 minutes and pellets were stored at -80°C until further use. Cell pellets were thawed on ice and resuspended in lysis buffer (20 mM Tris pH 7.5, 0.5 M NaCl, 1.4 mM β-mercaptoethanol and 10% v/v glycerol) with a protease inhibitors cocktail containing pepstatin A (0.7 µM), PMSF (1.0 mM), leupeptin (5.0 µM) and benzamidine (1.0 mM). Pellets were lysed by sonication and the protease inhibitors were added again. The sample was centrifuged at 39,200 g , 4°C, 45 minutes and the supernatant discarded. The lysis process was repeated twice to wash the cell pellet. The resulting pellets were resuspended in 20 mL of extraction buffer each (20 mM Tris pH 7.5, 1 M NaCl, 1.4 mM β-mercaptoethanol, 2 M urea, 0.5% tween-20 and 10% v/v glycerol) and protease inhibitors cocktail. Pellets were sonicated and the lysate was clarified by centrifugation (39,200 g , 4°C, 45 min). The supernatant was supplemented with 1.0 mM PMSF and incubated with 10 mL (5 mL per tube) of charged HisPur™ Ni-NTA Resin (Thermo Scientific) pre-equilibrated with extraction buffer for 30 min. Beads were washed three times with 15 mL per tube of 30 mM imidazole buffer and the protein was eluted with 300 mM imidazole. TnsD-containing elutions were diluted to a final NaCl concentration of 380 mM and supplemented with 1.0 mM PMSF. The protein was loaded into a 5 mL HiTrap Heparin HP column (Cytiva) pre-equilibrated with Heparin buffer (20 mM Tris pH 7.5, 380 mM NaCl, 1.4 mM β-mercaptoethanol and 10% v/v glycerol). After a 10 CV wash with Heparin buffer, TnsD was eluted with 1 M NaCl and purity was assessed via SDS-PAGE. Fractions were flash-frozen and stored at − 80°C. TnsD was not concentrated to prevent aggregation, but Amicon Millipore 6 ml 30,000 MWCO centrifugal concentrators were used when assessing stability in the absence/presence of host factors. DNA binding assays DNA binding of TnsD in the presence or absence of host factors (or host factors variants) was assessed using electrophoretic mobility shift assays (EMSAs). DNA substrates were prepared by annealing FAM-labeled oligonucleotides with their unlabeled complementary DNA in equimolar amounts in nuclease-free water. The DNA substrates used were the + 23 to + 58 duplex DNA of attTn7 (FAM- 5’ TTACTCAACCGTAACCGATTTTGCCAGGTTACGCGG 3’ ; 5’ CCGCGTAAC CTGGCAAAATCGGTTACGGTTGAGTAA 3’ ) and a scrambled DNA sequence (FAM- 5’ ATACTAACAATCAGAACCCGGATTAATCGAAAGCTT 3’ ; 5’ AAGCTTTCGATTAATCCG GGTTCTGATTGTTAGTAT 3’ ). Increasing concentrations of TnsD (0–80 nM), host factors (0–640 nM) or a combination of both were incubated at room temperature for 30 minutes with the duplex DNA substrates (10 nM) in EMSA-reaction buffer (20 mM Tris pH 7.5, 50 mM KCl, 1 mM DTT, 1 mg/ml BSA and 5% glycerol). The final volume of the reactions was 20 µL, from which 15 µL were resolved on 5% non-denaturing Tris-Glycine polyacrylamide gels for 1:05 hours at 4°C and a constant voltage of 80 V in EMSA-running buffer (25 mM Tris and 192 mM glycine). Gels were imaged using a Sapphire™ Biomolecular Imager (Azure Biosystems). Protein expression and purification of uL29 and ACP The plasmids encoding E. coli uL29 (Uniprot entry P0A7M6) and ACP (Uniprot entry P0A6A8) were purchased from GenScript, subcloned into the expression vector pET28a(+)-TEV containing a removable N-terminal 6x histidine tag, sequenced and archived (pAG9431: uL29; pAG9432: ACP). Protein expression and solubility in different cell lines was assayed as described earlier [ 11 ]. To produce uL29, the pAG9431 plasmid was transformed into BL21 Star (DE3) cells (Invitrogen #44–0049) containing the pRARE plasmid and grown in LB medium at 37°C with orbital agitation to an OD 600 ∼0.7. Protein expression was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM and cells were incubated at 37°C for 3 h. For ACP, the pAG9432 plasmid was transformed into BL21 (DE3) cells (Novagen #69450) and grown in LB medium at 37°C with orbital agitation to an OD 600 ∼0.7. Cell cultures were cold shocked immediately prior to protein expression induced by adding 0.5 mM IPTG and incubated at 16°C overnight. For both proteins, cells were harvested by centrifugation at 3,990 g for 15 minutes and pellets were stored at -80°C. Both proteins were purified similarly. Cell pellets were thawed on ice, resuspended in lysis buffer (20 mM Tris pH 8.0, 0.5 M NaCl, 1.4 mM β-mercaptoethanol, 15 mM imidazole and 5% v/v glycerol) with a protease inhibitors cocktail as described above. Cells were lysed by sonication and the lysates clarified by centrifugation (39,200 g , 4°C, 45 min). The supernatant was loaded into a 5 mL HisTrap HP column (Cytiva) pre-equilibrated with lysis buffer. Impurities were eliminated washing with 36 mM imidazole and protein was eluted with 300 mM imidazole. The histidine-tag was removed with TEV protease during dialysis in 20 mM Tris pH 8.0, 150 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol. The tagless proteins were loaded again onto the 5 mL HisTrap HP column (Cytiva) pre-equilibrated with dialysis buffer. ACP eluted immediately, but uL29 required the addition of 24 mM imidazole to the buffer. All other contaminants (TEV protease, histidine tag, etc) remained tightly bound to the column. Fractions containing uL29 were pooled and loaded into a Mono S™ 5/50 GL cation exchange chromatography column (Cytiva) pre-equilibrated with MonoS buffer (20 mM Tris pH 8.0, 150 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol). uL29 was eluted with a salt gradient to 425 mM NaCl. The purified samples were concentrated using an Amicon Millipore 6 ml 5,000 MWCO centrifugal concentrator, flash-frozen in 20% glycerol, and stored at − 80°C. Fractions containing ACP were loaded into a Mono Q™ 10/100 GL anion exchange chromatography column (Cytiva) pre-equilibrated with MonoQ buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM DTT and 5% v/v glycerol). The two forms of ACP were eluted with a linear gradient to 500 mM NaCl. Apo ACP eluted at ∼350 mM NaCl and holo ACP at ∼365 mM NaCl. The two proteins were pooled separately, and the samples were concentrated using Amicon Millipore 6 ml 5,000 MWCO centrifugal concentrators, flash-frozen in 20% glycerol, and stored at − 80°C. Cloning and purification of uL29 and ACP variants The uL29 R47A/R48S/K54A (pAG9527), uL29 R47A/K54A (pAG9550) and uL29 K2A/R52A (pAG9567) variants were generated from the plasmid encoding wildtype uL29 (pAG9431) by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). pAG9432 was used to generate ACP D39R/E42A (pAG9528). All variants were verified by DNA sequencing (Génome Québec Innovation Centre) using T7 primers. All the variants were produced as described above using either BL21 Star (DE3) cells supplemented with the pRARE plasmid (uL29 R47A/R48S/K54A expressed at 16°C ON, uL29 K2A/R52A expressed at 37°C for 3 h, ACP D39R/E42A expressed at 16°C ON) or BL21 (DE3) cells (uL29 R47A/K54A expressed at 37°C for 3 h). Cells were harvested by centrifugation at 3,990 g for 15 minutes and pellets were stored at -80°C. Cell pellets were thawed on ice and resuspended in lysis buffer (20 mM Tris pH 8.0, 0.5 M NaCl, 1.4 mM β-mercaptoethanol, 15 mM imidazole and 5% v/v glycerol) supplemented with a protease inhibitors cocktail. Pellets were lysed by sonication and clarified by centrifugation (39,200 g , 4°C, 45 min). uL29 and ACP variants were purified as described above with minor differences. On the first HisTrap HP column step, contaminants were washed with 45 mM (instead of 36 mM) imidazole. For the second HisTrap HP column step, the uL29 K2A/R52A required 36 mM (rather than 24 mM) imidazole for elution. All uL29 variants were then diluted to a final NaCl concentration of 75 mM and loaded into a Mono S™ 5/50 GL cation exchange chromatography column (Cytiva) pre-equilibrated with 20 mM Tris pH 8.0, 75 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol. uL29 R47A/K54A and uL29 K2A/R52A were eluted with a linear gradient to 325 mM NaCl. For uL29 R47A/R48S/K54A , the protein flowed through the column, but contaminants did not, resulting in a pure sample. Characterization of apo- and holo-ACP The identity of the two ACP species from the ionic exchange column was confirmed by mass spectrometry. Each sample was diluted in MS buffer (20 mM Tris pH 8.0, 150 mM NaCl and 2 mM Tris(2-carboxyethyl) phosphine) to a final concentration of 0.05 mg/mL. Protein was then diluted in 0.1% formic acid, and 1 µg was injected on an Agilent C4 BEH 1.0/10 mm column and washed 5 min with 4% acetonitrile, followed by a 20 min 4–90% gradient of acetonitrile in 0.1% formic acid, with a flow rate of 20 µL/min. The samples were analyzed on a Bruker Impact II ion trap mass spectrometer equipped with a funnel ESI source. Data was acquired in positive ion profile mode, with a capillary voltage of 4500 V and dry nitrogen heated at 200°C. Spectra were analyzed using the manufacturer’s software DataAnalysis (Bruker). The total ion chromatogram was used to determine where the protein eluted, and spectra were summed over the entire elution peak. Multiply charged ion species were deconvoluted at 10,000-resolution using the maximum entropy method. A difference of approximately 340 Da between the protein peaks corresponded to the molecular weight of a phosphopantetheine group, characteristic of holo ACP. For ACP D39R/E42A , the two species were diluted to 1 mg/mL in water and desalted/concentrated using 0.6 µL C18 reversed-phase ZipTips (EMD Millipore #ZTC18S096) to avoid ion suppression (i.e. buffer containing 250 mM NaCl and 20% (v/v) glycerol). The desalted samples were mixed 1:1 with super-DHB matrix (Sigma #50862; prepared at 50 mg/mL in 50/50 solution of acetonitrile and 0.1% (v/v) trifluoroacetic acid) for spotting on ground steel targets (dried droplet method). The co-crystallized samples were analyzed in linear positive mode (intact mass) or reflector positive mode (rapid top-down sequencing / in-source decay) using an UltrafleXtreme MALDI-TOF/TOF system (Bruker Daltonics, Germany) operated by FlexControl (v3.4 software). Relative ion intensities were evaluated in FlexAnalysis (v3.4 software) by averaging four measurements of 500 shots each (i.e. 2,000 shots total per sample for TOF intact mass) or four measurements of 4,000 shots each (i.e. 16,000 shots total per sample for TOF/TOF top-down sequencing). The amino acid sequences for BSA (standard) or ACP D39R/E42A (apo or holo samples) were aligned with the in-source decay (ISD) spectra in BioTools (v3.2 software). Direct protein-protein interactions evaluation The host factors (20 or 25 µM with or without TnsD respectively) were pre incubated with or without TnsD (1 µM) on ice for 40 minutes in reaction buffer (20 mM Tris pH 7.5, 50 mM KCl, 1 mM DTT, 1 mg/ml BSA and 5% glycerol) to a final reaction volume of 10 µL. Mixtures were resolved on 5% non-denaturing Tris-Glycine polyacrylamide gels for 40 minutes (reactions without TnsD) or 50 minutes (reactions with TnsD) on an ice bath and at a constant voltage of 100 V using TG-running buffer (25 mM Tris and 192 mM glycine). Gels were stained with Coomassie Brilliant Blue (G-250, MP Biomedicals) for 20 minutes and destained overnight before imaging using a GelDoc Go imager system (BioRad). Protein Predictions The AlphaFold predictions for TnsD (AF-P13991-F1), uL29 (AF-P0A7M6-F1) and ACP (AF-P0A6A8-F1) were downloaded from the AlphaFold database ( https://alphafold.ebi.ac.uk ). Three-dimensional predictions were generated with AlphaFold multimer using the COSMIC2 platform or AlphaFold3 on the AlphaFold Server with default parameters [ 12 , 13 ]. The Uniprot entries P0A6A8 (ACP), P0A7M6 (uL29) and P13991 (TnsD) were used as input sequences. For the protein-DNA sequences, DNA sequences spanning the + 23 to + 58 ( 5’ TTACTCAACCGTAA CCGATTTTGCCAGGTTACGCGG 3’ and 5’ CCGCGTAACCTGGCAAAATCGGTTAACGGTTGAG TAA 3’ ) and the − 5 to + 64 (regions of the attTn7 site were used (Table 1) or from the − 5 to + 64 of attTn7 : 5’ TGCCCCGCTTACGCAGGGCATCCATTTA TTACTCAACCGTAACCGATTTTGCCAG GTTACGCGG CTGGTC 3’ and 5’ GACCAG CCGCGTAACCTGGCAAAATCGGTTACGGTTGAGTA A TAAATGGATGCCCTGCGTAAGCGGGGCA 3’ ). The resulting predictions were compared in PyMOL. Side-chain atoms at the ACP:uL29, ACP:TnsD, and uL29:TnsD interfaces and at distances shorter than 3.5 Å were considered when designing the uL29 and ACP variants. Images showing structures were generated with either PyMOL or ChimeraX. Results The C-terminal domain of TnsD confers binding specificity to the attTn7 site. TnsD is a multidomain protein that specifically recognizes the 3’ end of the glmS gene [ 4 ], and recruits TnsC for Tn7 transposition (Fig. 1 a). The N-terminal domain of TnsD (residues 1-318, TnsD NTD ) mediates the interaction with TnsC [ 5 ] and binds DNA in a sequence unspecific but length-dependent manner [ 6 ], suggesting that the C-terminal domain of the protein must drive DNA-binding specificity of TnsD. TnsD NTD can be easily produced recombinantly and is well-behaved in solution [ 6 ]. However, full-length TnsD is predominantly insoluble when over-produced in different cell lines even when using standard additives in the lysis buffer. We extracted full-length TnsD from the insoluble fraction of the cell lysate by adding 2 M urea and 0.5% tween-20 to the resuspension buffer and purified in the absence of denaturing agents (Fig. 1 b). In these conditions, TnsD was soluble at low concentrations but prone to aggregation. To confirm that TnsD retained its native fold, we compared its binding to FAM-labeled 36-bp DNA substrates either spanning the + 23 to + 58 region of the attTn7 site or with a random sequence. We found that TnsD readily bound to the attTn7 site fragment (Fig. 1 c, top panel, lanes 1–5) but bound only weakly to the control DNA (Fig. 1 c, top panel, lanes 1–5). In contrast, the N-terminal domain binds the two DNA sequences similarly (Fig. 1 c, bottom panel) [ 6 ]. Quantification of the electrophoretic mobility shift assays confirmed that TnsD NTD bound DNA similarly to full-length TnsD but without sequence specificity (Fig. 1 d). ACP and uL29 act cooperatively to influence DNA binding by TnsD To determine the effects of acyl carrier protein (ACP) and the ribosomal protein uL29, we produced and purified them to homogeneity (Fig. 2 a). ACP eluted as two different species from ionic exchange chromatography (Suppl. Fig. S2a). ACP is activated by the addition of a phosphopantetheine group (4′-PP) to Ser36 (Kim et al., 2006). Using mass spectrometry, we confirmed that the two species corresponded to the “inactive” (apo-ACP) and “active” (holo-ACP) forms of the protein (Suppl. Fig. S2b). To assess whether the 4′-PP is important for the effect of ACP on TnsD, we isolated the two forms of ACP and assayed independently. We first incubated TnsD with FAM-labeled 36-bp attTn7 DNA and each host factor individually or combined and resolved the species using electrophoretic mobility shift assays. We found that individual addition of the host factors did not affect the migration of the DNA-bound species, suggesting that they do not bind stably to the TnsD: attTn7 complex (Fig. 2 b, lanes 3–5). However, simultaneous addition of both host factors resulted in the formation of a slower-migrating species, indicating that either the two host factors bind coordinately to the TnsD: attTn7 complex or change the architecture of the TnsD: attTn7 complex (Fig. 2 b, lanes 6–7). The former is consistent with previous work showing that, while uL29 could bind weakly to the TnsD: attTn7 complex, the presence of ACP greatly enhanced the interaction [ 9 ]. This change in the electrophoretic mobility was induced by both apo- and holo-ACP (Fig. 2 b, compare lanes 6 and 7), suggesting that the modification does not impact formation of the complex with uL29 and TnsD on DNA. To confirm the new species was the result of the uL29 and ACP interacting with the TnsD: attTn7 complex rather than the host factors independently interacting with DNA, we incubated excess uL29 and ACP with attTn7 in the absence of TnsD and no binding was detected (Fig. 2 c, lane 2). Incubation with excess host factors did not result in additional (non-specific) DNA bound species (Fig. 2 c, lanes 6–8), suggesting that their effect was specific. Interestingly, addition of ACP and uL29 did not change the electrophoretic mobility of the TnsD NTD :DNA complexes (Fig. 2 d), indirectly suggesting that ACP and uL29 associate through the C-terminal domain of the protein. uL29 and ACP stabilize TnsD through direct protein-protein interactions. We next wanted to assay whether uL29 and ACP interacted with TnsD in the absence of DNA. To this end, we analyzed various combinations of TnsD and host factors using native polyacrylamide gel electrophoresis (Native PAGE). The ribosomal uL29 protein (pI = 9.98) is positively charged and, therefore, does not enter the gel (Fig. 3 a, lane 1). In contrast, the ACP (pI = 4.1) is negatively charged and migrates well into the gel (Fig. 3 a, lanes 2–3). Like uL29, TnsD alone does not enter the gel either but the complexes of TnsD and uL29:ACP can be resolved in this assay (Fig. 3 a, lane 4). When both ACP and uL29 were combined with TnsD, we identified the formation of two new species that migrated differently than the individual components. The fastest migrating species probably corresponds to the ACP:uL29 complex as it is observed both in the absence and presence of TnsD (Fig. 3 a, compare lanes 5 and 6). This occurred with both apo and holo ACP, although the band was better defined when uL29 was mixed with apo ACP (Fig. 3 a, compare lanes 5 and 7). The second species was only visible when TnsD was present, indicating that the three proteins interact even in the absence of DNA (Fig. 3 a, lanes 6 and 8). However, the bands for the complexes are diffuse, suggesting that the complex is not stable under these conditions. We next tested whether uL29 and ACP improved the behavior of TnsD in solution. TnsD is highly unstable even at low concentrations and readily precipitates while being concentrated using centrifugal devices. This behavior provided a mechanism to assess if ACP and uL29 stabilized TnsD. We mixed TnsD (280 nM) with host factors in a 1:5:5 molar ratio (TnsD:uL29:apoACP) and incubated for 30 minutes on ice. A TnsD sample at the same concentration without host factors was used as a control. Both samples were concentrated using a centrifugal concentrator with a molecular weight cutoff of 30 kDa to allow unbound uL29 (7.4 kDa) and ACP (8.8 kDa) to flow through the membrane. TnsD remained in solution at higher concentrations in the presence of the host factors (Fig. 3 b compare lanes 2–4 to 5–7), indicating that the host factors alleviate TnsD’s tendency to aggregate. Both ACP and uL29 were retained in the concentrated fraction though uL29 was only visible when the gel was silver stained (Fig. 3 b, inset), suggesting that the TnsD:uL29:apoACP complex is likely labile in the absence of DNA. Encouraged by these results, we used AlphaFold (AF) to predict the putative interfaces mediating the TnsD:uL29:ACP interaction. We generated AF predictions for the interaction of TnsD with uL29 and ACP on their own and in the presence of DNA (Suppl. Figure 3). Both predictions return similar results for the individual domains of TnsD and interfaces for the TnsD:uL29:ACP interaction (Suppl. Figure 3a and 3d). The relative orientation between TnsD domains is predicted with higher confidence when DNA is present (Suppl. Figure 3b-c and 3e-f). However, this prediction places the DNA duplex with incorrect polarity and does not support previously published data describing how TnsD interacts with the attTn7 site [ 14 ]. Inclusion of the TnsC heptamer in the prediction corrects the DNA polarity while maintaining identical interactions between TnsD, ACP and uL29 (Suppl. Figure 3g-i). In all predictions, ACP and uL29 interact with the C-terminal domain of TnsD (Fig. 3 c and Suppl. Figure 3). This domain of TnsD (residues 389–506) has a positively charged patch defined by Arg397, Arg401, Arg405, Lys408, Arg409 and Arg450 that cradle helix a2 of ACP (Fig. 3 c-d and Fig. 4 a). Reciprocally, ACP helix a2 is at the core of its very acidic central region (14 acidic and no positive residues between residues 30–60) and is often called the “recognition helix” for universal enzyme interactions [ 15 , 16 ]. Adjacent to this positively-charged region of TnsD, there is a negatively-charged patch defined by residues Asp411, Glu453, Glu456, Asp457, Glu495, Glu496 that interact with helices a2 and a3 of uL29 through electrostatic interactions with Arg29, Arg47, and Lys54 (Fig. 3 d and 5 a). The interaction is further stabilized through van der Waals interactions between the C-terminal end of helix a2 in uL29 and the terminal helix bundle of TnsD. AlphaFold returned similar predictions for the TnsD:ACP and TnsD:uL29 interactions, indicating that the interactions with ACP and uL29 are primarily driven by reciprocal electrostatic interactions. The “recognition helix” of ACP mediates the interaction with uL29 and TnsD While AlphaFold does not precisely predict interactions at the residue level, we engineered point mutations in ACP at positions in which side chains where at a distance from uL29 and TnsD and in an orientation compatible with hydrogen-bond formation. Since ACP does not interact with TnsD in the absence of uL29, we focused on residues that could bridge the interaction between the two proteins. Based on the AlphaFold predictions, residues Asp39 and Glu42 from ACP bridge the interaction with TnsD and uL29. Asp39 connects Arg450 (TnsD) and Arg48 (uL29), while Glu42 bridges Lys 44 and Arg48 in uL29 to Tyr451 in TnsD (Fig. 4 a). Therefore, we generated the ACP D39R/E42A variant to probe the interaction (Fig. 4 a). This variant expressed well and was purified similarly to wild-type ACP. The presence of apo- and holo- ACP D39R/E42A was confirmed using Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF/TOF) mass spectrometry (Suppl. Fig. S4). Using native PAGE, we found that apo- and holo- ACP D39R/E42A no longer interacted with uL29 (Fig. 4 b, lanes 7 and 9). We then used electrophoretic mobility shift assays to see if this variant also abrogated the interaction with TnsD. We found that neither apo- nor holo- ACP D39R/E42A were able to interact with the TnsD: attTn7 complex (Fig. 4 c-d, lanes 4–8). These results indicate that ACP “recognition helix” (helix a2) is important for the interactions with uL29 and TnsD. However, they do not rule out if the effect is direct (i.e. the helix mediates the interaction with both proteins) or indirect in which disruption of one interaction also abolishes the other one. uL29 anchors ACP to TnsD The interface of uL29 and TnsD (893 Å 2 ) is more extensive than that with ACP (337 Å 2 ) and involves different surfaces of the protein, providing an opportunity to check the contributions of the different interfaces to complex formation. We designed uL29 variants that could disrupt the interactions with ACP and TnsD independently. Based on the AlphaFold prediction, the uL29 R47A/R48S/K54A variant should abrogate the interaction with both TnsD and ACP, whereas the uL29 K2A/R52A and uL29 R47A/K54A variants would disrupt the interactions with either ACP or TnsD, respectively (Fig. 5 a). We then tested whether the three variants could form a complex with ACP (Fig. 5 b-d) and bind to the TnsD: attTn7 complex (Fig. 5 e-g). As expected, the uL29 R47A/R48S/K54A variant, designed to disrupt the interactions with both TnsD and ACP, did not interact with ACP (Fig. 5 b, lanes 6 and 8), and did not change the migration of the TnsD: attTn7 complex (Fig. 5 e, lanes 4–8). In good agreement with the Alphafold prediction, the uL29 K2A/R52A variant did not interact with ACP as judged by native PAGE (Fig. 5 c, lanes 6 and 8). However, native PAGE showed a diffuse band where the uL29:ACP:TnsD would migrate suggesting that uL29 and ACP might interact simultaneously with TnsD even if they do not form a stable complex with each other (Fig. 5 c, lanes 7–8). Accordingly, the uL29 K2A/R52A variant changed the migration of the TnsD: attTn7 complex, albeit less effectively than wild type uL29 (Fig. 5 f, lanes 4–8), indicating that the interaction between both host factors is necessary to form a stable uL29:ACP:TnsD: attTn7 complex. We only detected an interaction with the TnsD: attTn7 complex when both host factors were present (Fig. 2 b, lanes 6–7) but it has been previously published that uL29 –but not ACP– can interact weakly with the TnsD: attTn7 complex on its own, although the presence of ACP greatly enhanced uL29 binding to the TnsD: attTn7 complex [ 9 ]. These results support the idea that the uL29:ACP:TnsD: attTn7 complex is stabilized by the simultaneous binding of both host factors but binding of uL29 may not necessitate ACP. Lastly, we tested the uL29 R47A/K54A variant. This variant was designed to disrupt the uL29:TnsD interface without disrupting the uL29:ACP interface. However, uL29 R47A/K54A did not interact with ACP nor TnsD (Fig. 5 d, lanes 6 and 8) and did not change the migration of the TnsD: attTn7 complex (Fig. 5 g, lanes 4–8). These results recapitulated the behaviour of the uL29 R47A/R48S/K54A variant, indicating that either Arg47 or Lys54 (most likely Arg47 based on their location) is also important for the interaction with ACP or that disrupting the uL29:TnsD interface precludes binding to ACP. The uL29:TnsD interface occludes a surface area of ~ 900 Å 2 , while the ACP:TnsD interface is significantly smaller (630 Å 2 ). Therefore, it is plausible that uL29 anchors the interaction to TnsD while ACP further stabilizes the complex. Discussion All Tn7 elements encode at least one target-site selection protein from the TniQ/TnsD family. In the prototypical element, TnsD is composed of a conserved N-terminal domain characteristic of the TniQ/TnsD family, and a variable C-terminal region responsible for recognizing the attTn7 site [ 6 ]. While the TniQ domain of the protein has been characterized, the poor solubility and aggregation propensity of the full-length protein has precluded the mechanistic understanding. Previous studies revealed that uL29 and ACP can enhance Tn7 transposition efficiency in vitro [ 9 ]. We now show that uL29 and ACP coordinately stabilize TnsD and interact through the C-terminal domain of the protein. We also find that both host factors are necessary for the interaction, but they have independent roles with uL29 anchoring the interaction and ACP stabilizing the complex. Recent structural studies have revealed that the ribosomal protein uS15 is an integral component of the V-K CAST target-site selection complex [ 10 ]. The uS15 protein interacts with the tracrRNA rooftop loop and stabilizes the crRNA in a conformation that supports TniQ recruitment [ 10 ]. In contrast, ACP and uL29 stabilize TnsD through direct protein-protein interactions and their binding does not preclude the interaction with the attTn7 site. It is possible that uL29 and ACP indirectly help remodel the attTn7 site but based in the AlphaFold3 prediction of the complex, they do not interact directly with DNA (Fig. 6 a and Suppl. Fig. S2a-c). In the structure of the TnsD-mediated targeting complex from the type I-B2 CAST element [ 8 ], the C-terminal region of TnsD packs the DNA against the N-terminal domain and imposes a sharp bend by intercalating Arg445 into the CC/GG step at position + 32 (Fig. 6 b). This is quite different from the AlphaFold prediction of the uL29:ACP:TnsD: attTn7 complex and the structure of the TnsC:TnsD:DNA complex from the prototypical Tn7 element (Fig. 6 ) [ 6 ], where the DNA bending is imposed by the N-terminal domain of TnsD as it recruits the TnsC ring. However, TnsD from the type I-B2 CAST system recognizes a different attachment site than TnsD from prototypical Tn7 element, and the structure was determined in the absence of host factors. Therefore, the recognition mode could be different for the two systems. AlphaFold predictions have become a useful tool to interpret data from biochemical and biophysical techniques, however they should be interpreted with caution. The AlphaFold models calculated including different components of the target-site selection complex consistently predict similar interactions between uL29, ACP, and TnsD (Suppl. Figure 2). However, when DNA is included in the predictions, the attTn7 site is modeled with opposite polarity (Fig. 6 a). Including TnsC into the prediction corrects the issue and keeps uL29:ACP:TnsD in a similar orientation (Fig. 6 a). However, the resulting model fails to explain the DNA-binding specificity of TnsD [ 4 ]. Mutations at positions + 31, +33, + 43, +45, + 51 and + 54 of attTn7 reduce significantly TnsD binding [ 4 ]. Accordingly, mutations at these positions also blocked transposition in vivo [ 4 ]. In the AlphaFold model, the C-terminal domain of TnsD (residues 389–508) interacts with uL29:ACP and footprints the + 20 to + 33 region of the attTn7 site with the preceding linker (residues 381–388) and intervening folded domain (residues 317–380) extending the footprint to position + 48 of the attTn7 (Fig. 6 a). Understanding how the Tn7 TnsD-mediated target-site selection complex protects the region of the attTn7 site beyond position + 48 will necessitate further structural validation. Conclusions This work, together with that from others, expands the roles of host factors in Tn7 transposition. We show that TnsD from prototypical Tn7 is prone to aggregation, but it is partially mitigated by the interaction with Escherichia coli host factors, uL29 and ACP. Other Tn7-like elements use host factors to stabilize the RNA conformation in the targeting complex [ 10 , 17 ], or facilitate the integration step by bending DNA [ 18 ]. Understanding if all Tn7 elements use host factors to optimize the targeting and insertion events or only some have exploited this resource awaits future proteomics and structural characterization. Declarations Ethics approval and consent to participate Not applicable. Consent for publication All authors approve of the final version of the manuscript and give consent for publication. Availability of Data and Materials No datasets were generated or analyzed during the current study. Plasmids generated in the study will be made available upon request. Competing Interests The authors declare no competing interests. Funding This work was funded by the Canadian Institutes of Health Research (PJT-155941 and PJT-189946, to A.G.) and a Canada Research Chair Tier 1 (A.G.) Authors’ contributions Conceptualization: A.G.; Investigation, S.L.C., and L.A.M.; Formal Analysis: S.L.C., L.A.M., and A.G.; Visualization: S.L.C., and A.G.; Writing – Original Draft: S.L.C.; Writing – Review & Editing: A.G. with contributions from all authors; Supervision: A.G. Acknowledgements We are grateful to Shreya S. Krishnan and members of the Guarné laboratory for helpful discussions, and Dr. Angelos Pistofidis for advice on ACP activation. References Peters, J.E. and N.L. Craig, Tn7: smarter than we thought. Nat Rev Mol Cell Biol, 2001. 2 (11): p. 806-14. Waddell, C.S. and N.L. Craig, Tn7 transposition: two transposition pathways directed by five Tn7-encoded genes. Genes Dev, 1988. 2 (2): p. 137-49. Peters, J.E. and N.L. Craig, Tn7 recognizes transposition target structures associated with DNA replication using the DNA-binding protein TnsE. Genes Dev, 2001. 15 (6): p. 737-47. Mitra, R., et al., Characterization of the TnsD-attTn7 complex that promotes site-specific insertion of Tn7. Mob DNA, 2010. 1 (1): p. 18. Choi, K.Y., J.M. Spencer, and N.L. Craig, The Tn7 transposition regulator TnsC interacts with the transposase subunit TnsB and target selector TnsD. Proc Natl Acad Sci U S A, 2014. 111 (28): p. E2858-65. Shen, Y., et al., Assembly of the Tn7 targeting complex by a regulated stepwise process. Mol Cell, 2024. 84 (12): p. 2368-2381 e6. Shen, Y., et al., Structural basis for DNA targeting by the Tn7 transposon. Nat Struct Mol Biol, 2022. 29 (2): p. 143-151. Wang, S., et al., Structure of TnsABCD transpososome reveals mechanisms of targeted DNA transposition. Cell, 2024. 187 (24): p. 6865-6881 e16. Sharpe, P.L. and N.L. Craig, Host proteins can stimulate Tn7 transposition: a novel role for the ribosomal protein L29 and the acyl carrier protein. EMBO J, 1998. 17 (19): p. 5822-31. Schmitz, M., et al., Structural basis for the assembly of the type V CRISPR-associated transposon complex. Cell, 2022. 185 (26): p. 4999-5010 e17. Rashev, M., J.A. Surtees, and A. Guarne, Large-scale production of recombinant Saw1 in Escherichia coli. Protein Expr Purif, 2017. 133 : p. 75-80. Abramson, J., et al., Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature, 2024. 630 (8016): p. 493-500. Evans, R., et al., Protein complex prediction with AlphaFold-Multimer. bioRxiv, 2021. Waddell, C.S. and N.L. Craig, Tn7 transposition: recognition of the attTn7 target sequence. Proc Natl Acad Sci U S A, 1989. 86 (11): p. 3958-62. Gong, H., et al., Neutralization of acidic residues in helix II stabilizes the folded conformation of acyl carrier protein and variably alters its function with different enzymes. J Biol Chem, 2007. 282 (7): p. 4494-4503. Zhang, Y.M., et al., The application of computational methods to explore the diversity and structure of bacterial fatty acid synthase. J Lipid Res, 2003. 44 (1): p. 1-10. Park, J.U., et al., Structures of the holo CRISPR RNA-guided transposon integration complex. Nature, 2023. 613 (7945): p. 775-782. Walker, M.W.G., et al., Transposon mutagenesis libraries reveal novel molecular requirements during CRISPR RNA-guided DNA integration. bioRxiv, 2023. Additional Declarations No competing interests reported. Supplementary Files 20250612LeyvaetalSUPPL.pdf Cite Share Download PDF Status: Published Journal Publication published 22 Aug, 2025 Read the published version in Mobile DNA → Version 1 posted Editorial decision: Accepted 08 Aug, 2025 Reviews received at journal 08 Aug, 2025 Reviews received at journal 31 Jul, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers agreed at journal 29 Jul, 2025 Reviewers invited by journal 29 Jul, 2025 Submission checks completed at journal 29 Jul, 2025 First submitted to journal 28 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7151933","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":492817657,"identity":"7f8fbf92-e3cd-4126-b248-88c8e6b23d27","order_by":0,"name":"Shani B. Leyva Camacho","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"Shani","middleName":"B. Leyva","lastName":"Camacho","suffix":""},{"id":492817658,"identity":"979294a5-eb93-4606-bf77-1f17c6ba9593","order_by":1,"name":"Lindsay A. Matthews","email":"","orcid":"","institution":"McGill University","correspondingAuthor":false,"prefix":"","firstName":"Lindsay","middleName":"A.","lastName":"Matthews","suffix":""},{"id":492817659,"identity":"ea4a32db-4408-4304-b91d-8de717591aac","order_by":2,"name":"Alba Guarné","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYDACdh44k/EBkODhYyekhRmhhdkApIWNmQQtbBJgkpAW/mbegx8Yfh2WN5/dfKzqRk2tDFAL44cfeLRIHOZLlmDsO2w4586xtNs5x46DHMYs2YPPmsM8BhKMPYcZZ0jkmN3ObTgG0sLGwINHh/xhHuMfQC32MyTyvxXDtDD+waPF4DCPmQTDj8OJQFvYmHMbasBamPHZYniYL80isSE9eYZEmrF0zrEDQC2MzdIyeLTIHe89fOPDH2vbGRLJDz/n1NTZ87M3H/z4Bp/3QSCxDc48DMSMDYQ0AAHCt3VEqB4Fo2AUjIKRBgCb8kM06mjMzQAAAABJRU5ErkJggg==","orcid":"","institution":"McGill University","correspondingAuthor":true,"prefix":"","firstName":"Alba","middleName":"","lastName":"Guarné","suffix":""}],"badges":[],"createdAt":"2025-07-17 19:38:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7151933/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7151933/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13100-025-00369-6","type":"published","date":"2025-08-22T16:29:26+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":88097365,"identity":"6c9efcd5-6836-4b37-afd0-56b21dcc7c11","added_by":"auto","created_at":"2025-08-01 11:04:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1954611,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe C-terminal domain of TnsD mediates DNA-binding specificity\u003c/strong\u003e. (a) Domain architecture of TnsD from the prototypical Tn7 element. (b) Coomassie-stained SDS-polyacrylamide gels showing the solubilized TnsD fraction from the cell lysate, the purification steps on Ni-affinity beads (unbound fraction, washes with 30 mM imidazole, elution with 300 mM imidazole), and subsequent purification over a heparin column. (c) Representative electrophoretic mobility shift assays (EMSAs) with increasing concentrations of protein showing DNA binding specificity of TnsD (top) or TnsD\u003csup\u003eNTD\u003c/sup\u003e (bottom) towards the region +23 to +58 of\u003cem\u003e attTn7\u003c/em\u003e (10 nM, lanes 1-5) or a control dsDNA (10 nM, lanes 6-10). (d) DNA-binding quantification at a protein concentration of 40 nM. Error bars indicate standard deviation (n=3).\u003c/p\u003e","description":"","filename":"Figure1R1.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/f7e3db5a5ed92088924b92a5.png"},{"id":88096178,"identity":"b719e874-1ed2-4187-800c-0fed6bbc5497","added_by":"auto","created_at":"2025-08-01 10:56:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2498147,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eACP and uL29 bind to the TnsD:\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eattTn7\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e complex. \u003c/strong\u003e(a) Coomassie-stained SDS-polyacrylamide gel showing purified uL29, holo- and apo-ACP. (b) EMSA showing how the binding of TnsD (20 nM) to the region +23 to +58 of\u003cem\u003e attTn7 \u003c/em\u003e(10nM) is affected by the presence of apo ACP (lane 3), holo ACP (lane 4), uL29 (lane 5) or both host factors combined (lanes 6-7). (c) EMSA of TnsD (40 nM, lane 3) bound to \u003cem\u003eattTn7\u003c/em\u003e (10 nM) with increasing concentrations of equimolar mixtures of uL29:apo-ACP (20-320 nM, lanes 4-8). (d) EMSA showing how the binding of TnsD\u003csup\u003eNTD\u003c/sup\u003e (20 nM) to the region +23 to +58 of\u003cem\u003e attTn7 \u003c/em\u003e(10nM) is not affected by the presence of host factors as in (b).\u003c/p\u003e","description":"","filename":"Figure2R.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/ed41b4b0dbe5db310fa204dc.png"},{"id":88096180,"identity":"cc7d1c62-e362-4c31-a267-80c95d318ebb","added_by":"auto","created_at":"2025-08-01 10:56:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6058025,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003euL29 and ACP interact with the C-terminal domain of TnsD\u003c/strong\u003e. (a) Coomassie-stained native polyacrylamide gel of uL29 (lane 1), apo-ACP (lane 2), holo-ACP (lane 3), and TnsD (lane 4) on their own or mixed (lanes 5-8) to monitor complex formation. (b) Coomassie-stained SDS-polyacrylamide gel showing the amount of soluble TnsD before (diluted), during (intermediate) and after (concentrated) concentration with a 30 kDa MWCO concentrator on its own (left) or when supplemented with excess apo-ACP and uL29. Both host factors are enriched in the concentrated fraction but uL29 is only visible when the gel is silver-stained (inset). Molecular weight markers are indicated in kDa. (c) AlphaFold2 prediction showing that the interaction between TnsD, uL29 and ACP occurs through the extreme C-terminal region of TnsD (see also Figure S3). (d) Detail of the TnsD:uL29:ACP interaction showing that it is primarily mediated by electrostatic interactions. On the left panel, the C-terminal region of TnsD (residues 389-508) is shown as an electrostatic surface (red indicates negatively charge and blue positively charged) with ACP (purple) and uL29 (pink) shown as cartoon representations. Reciprocally, on the right panel ACP and uL29 are shown as electrostatic surfaces, with TnsD shown as a cartoon (light blue).\u003c/p\u003e","description":"","filename":"Figure3revised.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/e099dc362391f047baa9f86e.png"},{"id":88096183,"identity":"5070e8a1-81b4-49f7-af64-0362943f8a68","added_by":"auto","created_at":"2025-08-01 10:56:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4491619,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHelix a2 in ACP mediates the interaction with uL29 and TnsD. \u003c/strong\u003e(a) Detail view of the AlphaFold model of showing helix a2 from ACP (purple) cradled by Arg397, Arg401 and Arg405 from TnsD (light blue) on one side of the helix, and Arg450, Tyr451 and Lys408 from TnsD, and Lys44 and Arg48 from uL29 (light pink) on the other side. Side chains are shown as color-coded sticks and labeled. (b) Coomassie-stained native gel showing the interaction between uL29 and the different ACP variants as indicated. All proteins were used at 25 mM. (c-d) EMSA showing how the binding of TnsD (40 nM) to the region +23 to +58 of\u003cem\u003e attTn7 \u003c/em\u003e(10 nM) is affected by the presence of apo-ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e (c) or holo- ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e (d). Host factors were added as equimolar uL29:ACP mixtures (20-320 nM).\u003c/p\u003e","description":"","filename":"Figure4R.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/7f7cadbfbff2e25b45e13602.png"},{"id":88096185,"identity":"355f049c-1608-4578-b01f-7d94130c6644","added_by":"auto","created_at":"2025-08-01 10:56:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9581561,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteractions of uL29 with TnsD and ACP\u003c/strong\u003e. (a) Orthogonal views of the residues at the uL29:ACP:TnsD interface. TnsD (blue) and ACP (purple) are shown as semitransparent surfaces and uL29 (pink) is shown as a cartoon representation. Side chains of residues potentially mediating the uL29:ACP:TnsD, uL29:ACP and uL29:TnsD are shown as color coded sticks and labeled. (b) Native polyacrylamide gel comparing the interactions of uL29 (25 mM) and uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e (25 mM) with apo- and holo-ACP (both at 25 mM). (c) Native polyacrylamide gel comparing the interactions of uL29 (25 mM) and uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e (25 mM) with apo-ACP (25 mM) and TnsD (1 mM). (d) Native polyacrylamide gel comparing the interactions of uL29 (25 mM) and uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e (25 mM) with apo-ACP (25 mM) and TnsD (1 mM). Note that uL29 alone migrates out of the gel due to its positive surface charge. For (c-d), uL29, uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e and uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e on their own migrate out of the gel due to their pI, whereas uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e is retained at the well due to the pI change caused by the triple mutation. (e-g) EMSA of TnsD incubated with the region +23 to +58 of \u003cem\u003eattTn7\u003c/em\u003e (10 nM) in the presence of increasing concentrations of equimolar mixtures of apo ACP and uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e (e), uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e (f), and uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e (g).\u003c/p\u003e","description":"","filename":"Figure5R.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/8e40dc133dd0881ab383ab89.png"},{"id":88097370,"identity":"41ea4462-6a01-44ab-85bb-e7170a80274d","added_by":"auto","created_at":"2025-08-01 11:04:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2870198,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteractions of TnsD with the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eattTn7\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e site.\u003c/strong\u003e (a) Alphafold prediction of the Tn7 TnsD:ACP:uL29 complex bound to the +23 to +58 fragment of \u003cem\u003eattTn7 \u003c/em\u003esite (left). TnsD (dark and light blue), ACP (purple), and uL29 (light pink) are shown as ribbon diagrams and labelled. DNA is color-coded based on high (orange) and low (yellow) protection upon binding as determined by Mitra \u003cem\u003eet al.\u003c/em\u003e[4]. Alphafold prediction of the Tn7 TnsD-mediated targeting complex (right), where TnsC has been omitted for clarity (see also Suppl. Fig. 3g-i). (b) Detail of the interaction between Tn7 TnsD\u003csup\u003eNTD\u003c/sup\u003e and DNA in the cryo-EM reconstruction of TnsD\u003csup\u003eNTD\u003c/sup\u003e:TnsC:DNA complex (left)[6], and in the cryo-EM reconstruction of the TnsD-targeting complex from a I-B2 CAST element[8].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/31a0cc9d8355cb407bb75af3.png"},{"id":89847265,"identity":"a4dd4d4b-3f1d-4889-aaa3-35d5684215b2","added_by":"auto","created_at":"2025-08-25 16:42:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":26374885,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/711c1128-4957-4eec-a7eb-96425d04fe6c.pdf"},{"id":88096177,"identity":"ad5ed31d-49b5-415c-823d-f9574b98bc29","added_by":"auto","created_at":"2025-08-01 10:56:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":4377097,"visible":true,"origin":"","legend":"","description":"","filename":"20250612LeyvaetalSUPPL.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7151933/v1/877712bb6338229d19140369.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Escherichia coli proteins uL29 and ACP stabilize the Tn7-encoded TnsD and its DNA binding","fulltext":[{"header":"Background","content":"\u003cp\u003eDNA transposons are genetic segments capable of moving and replicating within genomes. Some transposons insert into multiple sites, while others are site-specific. The Tn7 family of transposons is characterized by its sophisticated DNA targeting mechanisms. The prototypical Tn7 element has two alternative targeting pathways that target either a highly conserved genomic site or replication structure in conjugal plasmids, ensuring the efficient vertical and horizontal spread of the element [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. To mediate these two insertion mechanisms, Tn7 encodes five proteins: TnsA, TnsB, TnsC, TnsD/TniQ and TnsE. TnsA and TnsB form a heteromeric transposase (TnsAB), which catalyzes the transposon’s movement, excising the element from the donor DNA and joining the ends to the target DNA. However, TnsAB is not active on its own. Association with the AAA + ATPase TnsC forms the active transposition complex (TnsABC). TnsC functions as an adaptor between TnsAB and the target-site selection proteins TnsD/TniQ or TnsE. TnsD belongs to the TnsD/TniQ family of proteins and directs insertion to the so-called Tn7 attachment site (\u003cem\u003eattTn7\u003c/em\u003e), located at the 3’ end of the highly conserved \u003cem\u003eglmS\u003c/em\u003e gene [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Alternatively, the interaction with TnsE directs insertions to replicative DNA structures in conjugal plasmids, promoting the dispersal of the element across species [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe \u003cem\u003eattTn7\u003c/em\u003e site includes the very last 36 bp of the \u003cem\u003eglmS\u003c/em\u003e open reading frame [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although TnsD binds to the coding sequence for the \u003cem\u003eglmS\u003c/em\u003e gene, the insertion site lies 27 bp downstream from the binding site, providing a safe harbor for Tn7 insertions without deleterious effects on the host [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. TnsD contains a conserved NTD (residues 1–165) characteristic of the TniQ/TnsD family that mediates the interactions with the TnsC adaptor and binds DNA without sequence specificity [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], and a variable C-terminal region that specifically targets the \u003cem\u003eattTn7\u003c/em\u003e site (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Deleting even ten residues from the C-terminus suppresses its specificity for the \u003cem\u003eattTn7\u003c/em\u003e site [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe structure of N-terminal domain of Tn7 TnsD (TnsD-NTD) bound to TnsC has demonstrated that this domain functions as a nucleotide-exchange factor for TnsC and promotes the DNA-dependent oligomerization of TnsC (Suppl. Figure\u0026nbsp;1a) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. A recent structure of the TnsABCD transposome complex from a type I-B2 CAST (CRISPR-associated transposon) unveiled an intriguing DNA binding interaction, where both the N- and C-terminal domains of TnsD interact with TnsC (Suppl. Figure\u0026nbsp;1b) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. This finding is at odds with previous biochemical analysis studies for the prototypical Tn7 element showing that the N-terminal domain suffices to mediate the interaction with TnsC [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. It is possible that type I-B2 TnsD binds its \u003cem\u003eatt\u003c/em\u003e site differently than the prototypical Tn7 element, or that the structure of the type I-B2 TnsABCD tranpososome provided a fragmented view of the complex. The acyl carrier protein (ACP) and the ribosomal protein uL29 stimulate binding of TnsD from the prototypical Tn7 element to the \u003cem\u003eattTn7\u003c/em\u003e site [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Moreover, simultaneous addition of uL29 and ACP caused a three-fold increase in transposition frequency \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Analogously, \u003cem\u003ein vivo\u003c/em\u003e experiments showed a 9‐fold decrease in transposition when an \u003cem\u003eE. coli\u003c/em\u003e strain containing an internal deletion of 16 amino acids within uL29 was used [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In the case of the type V-K CAST, the ribosomal protein uS15 is an integral component of recruitment complex that promotes R-loop completion [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, it is plausible that ACP and uL29 enhance Tn7 transposition by stabilizing the interaction of TnsD with the \u003cem\u003eattTn7\u003c/em\u003e site.\u003c/p\u003e\u003cp\u003eHere, we sought to elucidate the effect of ACP and uL29 on TnsD. We found that TnsD is prone to aggregation but addition of both ACP and uL29 partially mitigates its instability. This effect occurs through reciprocal electrostatic interactions with the C-terminal region of TnsD. We identified and characterized uL29 and ACP residues mediating the interaction with the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex. These results provide valuable information to elucidate how TnsD assembles a targeting complex at \u003cem\u003eattTn7\u003c/em\u003e sites.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cb\u003eTnsD extraction and purification\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTnsD from \u003cem\u003eE. coli\u003c/em\u003e (Uniprot entry P13991) was subcloned from a plasmid containing all Tn7-encoded proteins (from Nancy Craig’s Lab) into the expression vector pET22b containing a C-terminal 6x Histidine tag (pAG9323). The pAG9323 plasmid was then transformed into BL21 Star (DE3) cells (Invitrogen #44–0049) supplemented with a plasmid encoding rare tRNAs (pRARE) and grown in LB medium at 37°C to OD\u003csub\u003e600\u003c/sub\u003e ∼0.7. Cell cultures were cold shocked using an ice/water bath and protein expression was induced by addition of 0.5 mM IPTG. Cultures were grown at 16°C overnight with an orbital agitation of 220 rpm. Cells were harvested by centrifugation at 3,990 \u003cem\u003eg\u003c/em\u003e for 15 minutes and pellets were stored at -80°C until further use.\u003c/p\u003e\u003cp\u003eCell pellets were thawed on ice and resuspended in lysis buffer (20 mM Tris pH 7.5, 0.5 M NaCl, 1.4 mM β-mercaptoethanol and 10% v/v glycerol) with a protease inhibitors cocktail containing pepstatin A (0.7 µM), PMSF (1.0 mM), leupeptin (5.0 µM) and benzamidine (1.0 mM). Pellets were lysed by sonication and the protease inhibitors were added again. The sample was centrifuged at 39,200 \u003cem\u003eg\u003c/em\u003e, 4°C, 45 minutes and the supernatant discarded. The lysis process was repeated twice to wash the cell pellet. The resulting pellets were resuspended in 20 mL of extraction buffer each (20 mM Tris pH 7.5, 1 M NaCl, 1.4 mM β-mercaptoethanol, 2 M urea, 0.5% tween-20 and 10% v/v glycerol) and protease inhibitors cocktail. Pellets were sonicated and the lysate was clarified by centrifugation (39,200 \u003cem\u003eg\u003c/em\u003e, 4°C, 45 min). The supernatant was supplemented with 1.0 mM PMSF and incubated with 10 mL (5 mL per tube) of charged HisPur™ Ni-NTA Resin (Thermo Scientific) pre-equilibrated with extraction buffer for 30 min. Beads were washed three times with 15 mL per tube of 30 mM imidazole buffer and the protein was eluted with 300 mM imidazole. TnsD-containing elutions were diluted to a final NaCl concentration of 380 mM and supplemented with 1.0 mM PMSF. The protein was loaded into a 5 mL HiTrap Heparin HP column (Cytiva) pre-equilibrated with Heparin buffer (20 mM Tris pH 7.5, 380 mM NaCl, 1.4 mM β-mercaptoethanol and 10% v/v glycerol). After a 10 CV wash with Heparin buffer, TnsD was eluted with 1 M NaCl and purity was assessed via SDS-PAGE. Fractions were flash-frozen and stored at − 80°C. TnsD was not concentrated to prevent aggregation, but Amicon Millipore 6 ml 30,000 MWCO centrifugal concentrators were used when assessing stability in the absence/presence of host factors.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA binding assays\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDNA binding of TnsD in the presence or absence of host factors (or host factors variants) was assessed using electrophoretic mobility shift assays (EMSAs). DNA substrates were prepared by annealing FAM-labeled oligonucleotides with their unlabeled complementary DNA in equimolar amounts in nuclease-free water. The DNA substrates used were the + 23 to + 58 duplex DNA of \u003cem\u003eattTn7\u003c/em\u003e (FAM-\u003csup\u003e5’\u003c/sup\u003eTTACTCAACCGTAACCGATTTTGCCAGGTTACGCGG\u003csup\u003e3’\u003c/sup\u003e; \u003csup\u003e5’\u003c/sup\u003eCCGCGTAAC CTGGCAAAATCGGTTACGGTTGAGTAA\u003csup\u003e3’\u003c/sup\u003e) and a scrambled DNA sequence (FAM-\u003csup\u003e5’\u003c/sup\u003eATACTAACAATCAGAACCCGGATTAATCGAAAGCTT\u003csup\u003e3’\u003c/sup\u003e; \u003csup\u003e5’\u003c/sup\u003eAAGCTTTCGATTAATCCG GGTTCTGATTGTTAGTAT\u003csup\u003e3’\u003c/sup\u003e). Increasing concentrations of TnsD (0–80 nM), host factors (0–640 nM) or a combination of both were incubated at room temperature for 30 minutes with the duplex DNA substrates (10 nM) in EMSA-reaction buffer (20 mM Tris pH 7.5, 50 mM KCl, 1 mM DTT, 1 mg/ml BSA and 5% glycerol). The final volume of the reactions was 20 µL, from which 15 µL were resolved on 5% non-denaturing Tris-Glycine polyacrylamide gels for 1:05 hours at 4°C and a constant voltage of 80 V in EMSA-running buffer (25 mM Tris and 192 mM glycine). Gels were imaged using a Sapphire™ Biomolecular Imager (Azure Biosystems).\u003c/p\u003e\u003cp\u003e\u003cb\u003eProtein expression and purification of uL29 and ACP\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe plasmids encoding \u003cem\u003eE. coli\u003c/em\u003e uL29 (Uniprot entry P0A7M6) and ACP (Uniprot entry P0A6A8) were purchased from GenScript, subcloned into the expression vector pET28a(+)-TEV containing a removable N-terminal 6x histidine tag, sequenced and archived (pAG9431: uL29; pAG9432: ACP). Protein expression and solubility in different cell lines was assayed as described earlier [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo produce uL29, the pAG9431 plasmid was transformed into BL21 Star (DE3) cells (Invitrogen #44–0049) containing the pRARE plasmid and grown in LB medium at 37°C with orbital agitation to an OD\u003csub\u003e600\u003c/sub\u003e ∼0.7. Protein expression was induced by addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM and cells were incubated at 37°C for 3 h. For ACP, the pAG9432 plasmid was transformed into BL21 (DE3) cells (Novagen #69450) and grown in LB medium at 37°C with orbital agitation to an OD\u003csub\u003e600\u003c/sub\u003e ∼0.7. Cell cultures were cold shocked immediately prior to protein expression induced by adding 0.5 mM IPTG and incubated at 16°C overnight. For both proteins, cells were harvested by centrifugation at 3,990 \u003cem\u003eg\u003c/em\u003e for 15 minutes and pellets were stored at -80°C.\u003c/p\u003e\u003cp\u003eBoth proteins were purified similarly. Cell pellets were thawed on ice, resuspended in lysis buffer (20 mM Tris pH 8.0, 0.5 M NaCl, 1.4 mM β-mercaptoethanol, 15 mM imidazole and 5% v/v glycerol) with a protease inhibitors cocktail as described above. Cells were lysed by sonication and the lysates clarified by centrifugation (39,200 \u003cem\u003eg\u003c/em\u003e, 4°C, 45 min). The supernatant was loaded into a 5 mL HisTrap HP column (Cytiva) pre-equilibrated with lysis buffer. Impurities were eliminated washing with 36 mM imidazole and protein was eluted with 300 mM imidazole. The histidine-tag was removed with TEV protease during dialysis in 20 mM Tris pH 8.0, 150 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol. The tagless proteins were loaded again onto the 5 mL HisTrap HP column (Cytiva) pre-equilibrated with dialysis buffer. ACP eluted immediately, but uL29 required the addition of 24 mM imidazole to the buffer. All other contaminants (TEV protease, histidine tag, etc) remained tightly bound to the column.\u003c/p\u003e\u003cp\u003eFractions containing uL29 were pooled and loaded into a Mono S™ 5/50 GL cation exchange chromatography column (Cytiva) pre-equilibrated with MonoS buffer (20 mM Tris pH 8.0, 150 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol). uL29 was eluted with a salt gradient to 425 mM NaCl. The purified samples were concentrated using an Amicon Millipore 6 ml 5,000 MWCO centrifugal concentrator, flash-frozen in 20% glycerol, and stored at − 80°C.\u003c/p\u003e\u003cp\u003eFractions containing ACP were loaded into a Mono Q™ 10/100 GL anion exchange chromatography column (Cytiva) pre-equilibrated with MonoQ buffer (20 mM Tris pH 8.0, 150 mM NaCl, 5 mM DTT and 5% v/v glycerol). The two forms of ACP were eluted with a linear gradient to 500 mM NaCl. Apo ACP eluted at ∼350 mM NaCl and holo ACP at ∼365 mM NaCl. The two proteins were pooled separately, and the samples were concentrated using Amicon Millipore 6 ml 5,000 MWCO centrifugal concentrators, flash-frozen in 20% glycerol, and stored at − 80°C.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCloning and purification of uL29 and ACP variants\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e (pAG9527), uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e (pAG9550) and uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e (pAG9567) variants were generated from the plasmid encoding wildtype uL29 (pAG9431) by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs). pAG9432 was used to generate ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e (pAG9528). All variants were verified by DNA sequencing (Génome Québec Innovation Centre) using T7 primers.\u003c/p\u003e\u003cp\u003eAll the variants were produced as described above using either BL21 Star (DE3) cells supplemented with the pRARE plasmid (uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e expressed at 16°C ON, uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e expressed at 37°C for 3 h, ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e expressed at 16°C ON) or BL21 (DE3) cells (uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e expressed at 37°C for 3 h). Cells were harvested by centrifugation at 3,990 \u003cem\u003eg\u003c/em\u003e for 15 minutes and pellets were stored at -80°C. Cell pellets were thawed on ice and resuspended in lysis buffer (20 mM Tris pH 8.0, 0.5 M NaCl, 1.4 mM β-mercaptoethanol, 15 mM imidazole and 5% v/v glycerol) supplemented with a protease inhibitors cocktail. Pellets were lysed by sonication and clarified by centrifugation (39,200 \u003cem\u003eg\u003c/em\u003e, 4°C, 45 min).\u003c/p\u003e\u003cp\u003euL29 and ACP variants were purified as described above with minor differences. On the first HisTrap HP column step, contaminants were washed with 45 mM (instead of 36 mM) imidazole. For the second HisTrap HP column step, the uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e required 36 mM (rather than 24 mM) imidazole for elution. All uL29 variants were then diluted to a final NaCl concentration of 75 mM and loaded into a Mono S™ 5/50 GL cation exchange chromatography column (Cytiva) pre-equilibrated with 20 mM Tris pH 8.0, 75 mM NaCl, 1.4 mM β-mercaptoethanol and 5% v/v glycerol. uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e and uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e were eluted with a linear gradient to 325 mM NaCl. For uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e, the protein flowed through the column, but contaminants did not, resulting in a pure sample.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCharacterization of apo- and holo-ACP\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe identity of the two ACP species from the ionic exchange column was confirmed by mass spectrometry. Each sample was diluted in MS buffer (20 mM Tris pH 8.0, 150 mM NaCl and 2 mM Tris(2-carboxyethyl) phosphine) to a final concentration of 0.05 mg/mL. Protein was then diluted in 0.1% formic acid, and 1 µg was injected on an Agilent C4 BEH 1.0/10 mm column and washed 5 min with 4% acetonitrile, followed by a 20 min 4–90% gradient of acetonitrile in 0.1% formic acid, with a flow rate of 20 µL/min. The samples were analyzed on a Bruker Impact II ion trap mass spectrometer equipped with a funnel ESI source. Data was acquired in positive ion profile mode, with a capillary voltage of 4500 V and dry nitrogen heated at 200°C. Spectra were analyzed using the manufacturer’s software DataAnalysis (Bruker). The total ion chromatogram was used to determine where the protein eluted, and spectra were summed over the entire elution peak. Multiply charged ion species were deconvoluted at 10,000-resolution using the maximum entropy method. A difference of approximately 340 Da between the protein peaks corresponded to the molecular weight of a phosphopantetheine group, characteristic of holo ACP.\u003c/p\u003e\u003cp\u003eFor ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e, the two species were diluted to 1 mg/mL in water and desalted/concentrated using 0.6 µL C18 reversed-phase ZipTips (EMD Millipore #ZTC18S096) to avoid ion suppression (i.e. buffer containing 250 mM NaCl and 20% (v/v) glycerol). The desalted samples were mixed 1:1 with super-DHB matrix (Sigma #50862; prepared at 50 mg/mL in 50/50 solution of acetonitrile and 0.1% (v/v) trifluoroacetic acid) for spotting on ground steel targets (dried droplet method). The co-crystallized samples were analyzed in linear positive mode (intact mass) or reflector positive mode (rapid top-down sequencing / in-source decay) using an UltrafleXtreme MALDI-TOF/TOF system (Bruker Daltonics, Germany) operated by FlexControl (v3.4 software). Relative ion intensities were evaluated in FlexAnalysis (v3.4 software) by averaging four measurements of 500 shots each (i.e. 2,000 shots total per sample for TOF intact mass) or four measurements of 4,000 shots each (i.e. 16,000 shots total per sample for TOF/TOF top-down sequencing). The amino acid sequences for BSA (standard) or ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e (apo or holo samples) were aligned with the in-source decay (ISD) spectra in BioTools (v3.2 software).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDirect protein-protein interactions evaluation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe host factors (20 or 25 µM with or without TnsD respectively) were pre incubated with or without TnsD (1 µM) on ice for 40 minutes in reaction buffer (20 mM Tris pH 7.5, 50 mM KCl, 1 mM DTT, 1 mg/ml BSA and 5% glycerol) to a final reaction volume of 10 µL. Mixtures were resolved on 5% non-denaturing Tris-Glycine polyacrylamide gels for 40 minutes (reactions without TnsD) or 50 minutes (reactions with TnsD) on an ice bath and at a constant voltage of 100 V using TG-running buffer (25 mM Tris and 192 mM glycine). Gels were stained with Coomassie Brilliant Blue (G-250, MP Biomedicals) for 20 minutes and destained overnight before imaging using a GelDoc Go imager system (BioRad).\u003c/p\u003e\u003cp\u003e\u003cb\u003eProtein Predictions\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe AlphaFold predictions for TnsD (AF-P13991-F1), uL29 (AF-P0A7M6-F1) and ACP (AF-P0A6A8-F1) were downloaded from the AlphaFold database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://alphafold.ebi.ac.uk\u003c/span\u003e\u003cspan address=\"https://alphafold.ebi.ac.uk\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Three-dimensional predictions were generated with AlphaFold multimer using the COSMIC2 platform or AlphaFold3 on the AlphaFold Server with default parameters [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The Uniprot entries P0A6A8 (ACP), P0A7M6 (uL29) and P13991 (TnsD) were used as input sequences. For the protein-DNA sequences, DNA sequences spanning the + 23 to + 58 (\u003csup\u003e5’\u003c/sup\u003eTTACTCAACCGTAA CCGATTTTGCCAGGTTACGCGG\u003csup\u003e3’\u003c/sup\u003e and \u003csup\u003e5’\u003c/sup\u003eCCGCGTAACCTGGCAAAATCGGTTAACGGTTGAG TAA\u003csup\u003e3’\u003c/sup\u003e) and the − 5 to + 64 (regions of the \u003cem\u003eattTn7\u003c/em\u003e site were used (Table\u0026nbsp;1) or from the − 5 to + 64 of \u003cem\u003eattTn7\u003c/em\u003e: \u003csup\u003e5’\u003c/sup\u003eTGCCCCGCTTACGCAGGGCATCCATTTA\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTTACTCAACCGTAACCGATTTTGCCAG GTTACGCGG\u003c/span\u003eCTGGTC\u003csup\u003e3’\u003c/sup\u003e and \u003csup\u003e5’\u003c/sup\u003eGACCAG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCCGCGTAACCTGGCAAAATCGGTTACGGTTGAGTA A\u003c/span\u003eTAAATGGATGCCCTGCGTAAGCGGGGCA\u003csup\u003e3’\u003c/sup\u003e). The resulting predictions were compared in PyMOL. Side-chain atoms at the ACP:uL29, ACP:TnsD, and uL29:TnsD interfaces and at distances shorter than 3.5 Å were considered when designing the uL29 and ACP variants. Images showing structures were generated with either PyMOL or ChimeraX.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eThe C-terminal domain of TnsD confers binding specificity to the\u003c/b\u003e \u003cb\u003eattTn7\u003c/b\u003e \u003cb\u003esite.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTnsD is a multidomain protein that specifically recognizes the 3\u0026rsquo; end of the \u003cem\u003eglmS\u003c/em\u003e gene [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and recruits TnsC for Tn7 transposition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The N-terminal domain of TnsD (residues 1-318, TnsD\u003csup\u003eNTD\u003c/sup\u003e) mediates the interaction with TnsC [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and binds DNA in a sequence unspecific but length-dependent manner [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], suggesting that the C-terminal domain of the protein must drive DNA-binding specificity of TnsD.\u003c/p\u003e\u003cp\u003eTnsD\u003csup\u003eNTD\u003c/sup\u003e can be easily produced recombinantly and is well-behaved in solution [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, full-length TnsD is predominantly insoluble when over-produced in different cell lines even when using standard additives in the lysis buffer. We extracted full-length TnsD from the insoluble fraction of the cell lysate by adding 2 M urea and 0.5% tween-20 to the resuspension buffer and purified in the absence of denaturing agents (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In these conditions, TnsD was soluble at low concentrations but prone to aggregation. To confirm that TnsD retained its native fold, we compared its binding to FAM-labeled 36-bp DNA substrates either spanning the +\u0026thinsp;23 to +\u0026thinsp;58 region of the \u003cem\u003eattTn7\u003c/em\u003e site or with a random sequence. We found that TnsD readily bound to the \u003cem\u003eattTn7\u003c/em\u003e site fragment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, top panel, lanes 1\u0026ndash;5) but bound only weakly to the control DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, top panel, lanes 1\u0026ndash;5). In contrast, the N-terminal domain binds the two DNA sequences similarly (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, bottom panel) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Quantification of the electrophoretic mobility shift assays confirmed that TnsD\u003csup\u003eNTD\u003c/sup\u003e bound DNA similarly to full-length TnsD but without sequence specificity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed).\u003c/p\u003e\u003cp\u003e\u003cb\u003eACP and uL29 act cooperatively to influence DNA binding by TnsD\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo determine the effects of acyl carrier protein (ACP) and the ribosomal protein uL29, we produced and purified them to homogeneity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). ACP eluted as two different species from ionic exchange chromatography (Suppl. Fig. S2a). ACP is activated by the addition of a phosphopantetheine group (4\u0026prime;-PP) to Ser36 (Kim et al., 2006). Using mass spectrometry, we confirmed that the two species corresponded to the \u0026ldquo;inactive\u0026rdquo; (apo-ACP) and \u0026ldquo;active\u0026rdquo; (holo-ACP) forms of the protein (Suppl. Fig. S2b). To assess whether the 4\u0026prime;-PP is important for the effect of ACP on TnsD, we isolated the two forms of ACP and assayed independently.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe first incubated TnsD with FAM-labeled 36-bp \u003cem\u003eattTn7\u003c/em\u003e DNA and each host factor individually or combined and resolved the species using electrophoretic mobility shift assays. We found that individual addition of the host factors did not affect the migration of the DNA-bound species, suggesting that they do not bind stably to the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, lanes 3\u0026ndash;5). However, simultaneous addition of both host factors resulted in the formation of a slower-migrating species, indicating that either the two host factors bind coordinately to the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex or change the architecture of the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, lanes 6\u0026ndash;7). The former is consistent with previous work showing that, while uL29 could bind weakly to the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex, the presence of ACP greatly enhanced the interaction [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This change in the electrophoretic mobility was induced by both apo- and holo-ACP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, compare lanes 6 and 7), suggesting that the modification does not impact formation of the complex with uL29 and TnsD on DNA. To confirm the new species was the result of the uL29 and ACP interacting with the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex rather than the host factors independently interacting with DNA, we incubated excess uL29 and ACP with \u003cem\u003eattTn7\u003c/em\u003e in the absence of TnsD and no binding was detected (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, lane 2). Incubation with excess host factors did not result in additional (non-specific) DNA bound species (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, lanes 6\u0026ndash;8), suggesting that their effect was specific. Interestingly, addition of ACP and uL29 did not change the electrophoretic mobility of the TnsD\u003csup\u003eNTD\u003c/sup\u003e:DNA complexes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed), indirectly suggesting that ACP and uL29 associate through the C-terminal domain of the protein.\u003c/p\u003e\u003cp\u003e\u003cb\u003euL29 and ACP stabilize TnsD through direct protein-protein interactions.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWe next wanted to assay whether uL29 and ACP interacted with TnsD in the absence of DNA. To this end, we analyzed various combinations of TnsD and host factors using native polyacrylamide gel electrophoresis (Native PAGE). The ribosomal uL29 protein (pI\u0026thinsp;=\u0026thinsp;9.98) is positively charged and, therefore, does not enter the gel (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, lane 1). In contrast, the ACP (pI\u0026thinsp;=\u0026thinsp;4.1) is negatively charged and migrates well into the gel (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, lanes 2\u0026ndash;3). Like uL29, TnsD alone does not enter the gel either but the complexes of TnsD and uL29:ACP can be resolved in this assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, lane 4). When both ACP and uL29 were combined with TnsD, we identified the formation of two new species that migrated differently than the individual components. The fastest migrating species probably corresponds to the ACP:uL29 complex as it is observed both in the absence and presence of TnsD (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, compare lanes 5 and 6). This occurred with both apo and holo ACP, although the band was better defined when uL29 was mixed with apo ACP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, compare lanes 5 and 7). The second species was only visible when TnsD was present, indicating that the three proteins interact even in the absence of DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, lanes 6 and 8). However, the bands for the complexes are diffuse, suggesting that the complex is not stable under these conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWe next tested whether uL29 and ACP improved the behavior of TnsD in solution. TnsD is highly unstable even at low concentrations and readily precipitates while being concentrated using centrifugal devices. This behavior provided a mechanism to assess if ACP and uL29 stabilized TnsD. We mixed TnsD (280 nM) with host factors in a 1:5:5 molar ratio (TnsD:uL29:apoACP) and incubated for 30 minutes on ice. A TnsD sample at the same concentration without host factors was used as a control. Both samples were concentrated using a centrifugal concentrator with a molecular weight cutoff of 30 kDa to allow unbound uL29 (7.4 kDa) and ACP (8.8 kDa) to flow through the membrane. TnsD remained in solution at higher concentrations in the presence of the host factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb compare lanes 2\u0026ndash;4 to 5\u0026ndash;7), indicating that the host factors alleviate TnsD\u0026rsquo;s tendency to aggregate. Both ACP and uL29 were retained in the concentrated fraction though uL29 was only visible when the gel was silver stained (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb, inset), suggesting that the TnsD:uL29:apoACP complex is likely labile in the absence of DNA.\u003c/p\u003e\u003cp\u003eEncouraged by these results, we used AlphaFold (AF) to predict the putative interfaces mediating the TnsD:uL29:ACP interaction. We generated AF predictions for the interaction of TnsD with uL29 and ACP on their own and in the presence of DNA (Suppl. Figure\u0026nbsp;3). Both predictions return similar results for the individual domains of TnsD and interfaces for the TnsD:uL29:ACP interaction (Suppl. Figure\u0026nbsp;3a and 3d). The relative orientation between TnsD domains is predicted with higher confidence when DNA is present (Suppl. Figure\u0026nbsp;3b-c and 3e-f). However, this prediction places the DNA duplex with incorrect polarity and does not support previously published data describing how TnsD interacts with the \u003cem\u003eattTn7\u003c/em\u003e site [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Inclusion of the TnsC heptamer in the prediction corrects the DNA polarity while maintaining identical interactions between TnsD, ACP and uL29 (Suppl. Figure\u0026nbsp;3g-i).\u003c/p\u003e\u003cp\u003eIn all predictions, ACP and uL29 interact with the C-terminal domain of TnsD (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec and Suppl. Figure\u0026nbsp;3). This domain of TnsD (residues 389\u0026ndash;506) has a positively charged patch defined by Arg397, Arg401, Arg405, Lys408, Arg409 and Arg450 that cradle helix a2 of ACP (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec-d and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Reciprocally, ACP helix a2 is at the core of its very acidic central region (14 acidic and no positive residues between residues 30\u0026ndash;60) and is often called the \u0026ldquo;recognition helix\u0026rdquo; for universal enzyme interactions [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Adjacent to this positively-charged region of TnsD, there is a negatively-charged patch defined by residues Asp411, Glu453, Glu456, Asp457, Glu495, Glu496 that interact with helices a2 and a3 of uL29 through electrostatic interactions with Arg29, Arg47, and Lys54 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The interaction is further stabilized through van der Waals interactions between the C-terminal end of helix a2 in uL29 and the terminal helix bundle of TnsD. AlphaFold returned similar predictions for the TnsD:ACP and TnsD:uL29 interactions, indicating that the interactions with ACP and uL29 are primarily driven by reciprocal electrostatic interactions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe \u0026ldquo;recognition helix\u0026rdquo; of ACP mediates the interaction with uL29 and TnsD\u003c/b\u003e\u003c/p\u003e\u003cp\u003eWhile AlphaFold does not precisely predict interactions at the residue level, we engineered point mutations in ACP at positions in which side chains where at a distance from uL29 and TnsD and in an orientation compatible with hydrogen-bond formation. Since ACP does not interact with TnsD in the absence of uL29, we focused on residues that could bridge the interaction between the two proteins. Based on the AlphaFold predictions, residues Asp39 and Glu42 from ACP bridge the interaction with TnsD and uL29. Asp39 connects Arg450 (TnsD) and Arg48 (uL29), while Glu42 bridges Lys 44 and Arg48 in uL29 to Tyr451 in TnsD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Therefore, we generated the ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e variant to probe the interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). This variant expressed well and was purified similarly to wild-type ACP. The presence of apo- and holo- ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e was confirmed using Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF/TOF) mass spectrometry (Suppl. Fig. S4).\u003c/p\u003e\u003cp\u003eUsing native PAGE, we found that apo- and holo- ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e no longer interacted with uL29 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, lanes 7 and 9). We then used electrophoretic mobility shift assays to see if this variant also abrogated the interaction with TnsD. We found that neither apo- nor holo- ACP\u003csup\u003eD39R/E42A\u003c/sup\u003e were able to interact with the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec-d, lanes 4\u0026ndash;8). These results indicate that ACP \u0026ldquo;recognition helix\u0026rdquo; (helix a2) is important for the interactions with uL29 and TnsD. However, they do not rule out if the effect is direct (i.e. the helix mediates the interaction with both proteins) or indirect in which disruption of one interaction also abolishes the other one.\u003c/p\u003e\u003cp\u003e\u003cb\u003euL29 anchors ACP to TnsD\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe interface of uL29 and TnsD (893 \u0026Aring;\u003csup\u003e2\u003c/sup\u003e) is more extensive than that with ACP (337 \u0026Aring;\u003csup\u003e2\u003c/sup\u003e) and involves different surfaces of the protein, providing an opportunity to check the contributions of the different interfaces to complex formation. We designed uL29 variants that could disrupt the interactions with ACP and TnsD independently. Based on the AlphaFold prediction, the uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e variant should abrogate the interaction with both TnsD and ACP, whereas the uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e and uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e variants would disrupt the interactions with either ACP or TnsD, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). We then tested whether the three variants could form a complex with ACP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb-d) and bind to the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee-g). As expected, the uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e variant, designed to disrupt the interactions with both TnsD and ACP, did not interact with ACP (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, lanes 6 and 8), and did not change the migration of the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee, lanes 4\u0026ndash;8).\u003c/p\u003e\u003cp\u003eIn good agreement with the Alphafold prediction, the uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e variant did not interact with ACP as judged by native PAGE (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, lanes 6 and 8). However, native PAGE showed a diffuse band where the uL29:ACP:TnsD would migrate suggesting that uL29 and ACP might interact simultaneously with TnsD even if they do not form a stable complex with each other (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec, lanes 7\u0026ndash;8). Accordingly, the uL29\u003csup\u003eK2A/R52A\u003c/sup\u003e variant changed the migration of the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex, albeit less effectively than wild type uL29 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef, lanes 4\u0026ndash;8), indicating that the interaction between both host factors is necessary to form a stable uL29:ACP:TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex. We only detected an interaction with the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex when both host factors were present (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, lanes 6\u0026ndash;7) but it has been previously published that uL29 \u0026ndash;but not ACP\u0026ndash; can interact weakly with the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex on its own, although the presence of ACP greatly enhanced uL29 binding to the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. These results support the idea that the uL29:ACP:TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex is stabilized by the simultaneous binding of both host factors but binding of uL29 may not necessitate ACP.\u003c/p\u003e\u003cp\u003eLastly, we tested the uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e variant. This variant was designed to disrupt the uL29:TnsD interface without disrupting the uL29:ACP interface. However, uL29\u003csup\u003eR47A/K54A\u003c/sup\u003e did not interact with ACP nor TnsD (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed, lanes 6 and 8) and did not change the migration of the TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg, lanes 4\u0026ndash;8). These results recapitulated the behaviour of the uL29\u003csup\u003eR47A/R48S/K54A\u003c/sup\u003e variant, indicating that either Arg47 or Lys54 (most likely Arg47 based on their location) is also important for the interaction with ACP or that disrupting the uL29:TnsD interface precludes binding to ACP. The uL29:TnsD interface occludes a surface area of ~\u0026thinsp;900 \u0026Aring;\u003csup\u003e2\u003c/sup\u003e, while the ACP:TnsD interface is significantly smaller (630 \u0026Aring;\u003csup\u003e2\u003c/sup\u003e). Therefore, it is plausible that uL29 anchors the interaction to TnsD while ACP further stabilizes the complex.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAll Tn7 elements encode at least one target-site selection protein from the TniQ/TnsD family. In the prototypical element, TnsD is composed of a conserved N-terminal domain characteristic of the TniQ/TnsD family, and a variable C-terminal region responsible for recognizing the \u003cem\u003eattTn7\u003c/em\u003e site [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. While the TniQ domain of the protein has been characterized, the poor solubility and aggregation propensity of the full-length protein has precluded the mechanistic understanding. Previous studies revealed that uL29 and ACP can enhance Tn7 transposition efficiency \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. We now show that uL29 and ACP coordinately stabilize TnsD and interact through the C-terminal domain of the protein. We also find that both host factors are necessary for the interaction, but they have independent roles with uL29 anchoring the interaction and ACP stabilizing the complex.\u003c/p\u003e\u003cp\u003eRecent structural studies have revealed that the ribosomal protein uS15 is an integral component of the V-K CAST target-site selection complex [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The uS15 protein interacts with the tracrRNA rooftop loop and stabilizes the crRNA in a conformation that supports TniQ recruitment [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In contrast, ACP and uL29 stabilize TnsD through direct protein-protein interactions and their binding does not preclude the interaction with the \u003cem\u003eattTn7\u003c/em\u003e site. It is possible that uL29 and ACP indirectly help remodel the \u003cem\u003eattTn7\u003c/em\u003e site but based in the AlphaFold3 prediction of the complex, they do not interact directly with DNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea and Suppl. Fig. S2a-c). In the structure of the TnsD-mediated targeting complex from the type I-B2 CAST element [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], the C-terminal region of TnsD packs the DNA against the N-terminal domain and imposes a sharp bend by intercalating Arg445 into the CC/GG step at position\u0026thinsp;+\u0026thinsp;32 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). This is quite different from the AlphaFold prediction of the uL29:ACP:TnsD:\u003cem\u003eattTn7\u003c/em\u003e complex and the structure of the TnsC:TnsD:DNA complex from the prototypical Tn7 element (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], where the DNA bending is imposed by the N-terminal domain of TnsD as it recruits the TnsC ring. However, TnsD from the type I-B2 CAST system recognizes a different attachment site than TnsD from prototypical Tn7 element, and the structure was determined in the absence of host factors. Therefore, the recognition mode could be different for the two systems.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAlphaFold predictions have become a useful tool to interpret data from biochemical and biophysical techniques, however they should be interpreted with caution. The AlphaFold models calculated including different components of the target-site selection complex consistently predict similar interactions between uL29, ACP, and TnsD (Suppl. Figure\u0026nbsp;2). However, when DNA is included in the predictions, the \u003cem\u003eattTn7\u003c/em\u003e site is modeled with opposite polarity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Including TnsC into the prediction corrects the issue and keeps uL29:ACP:TnsD in a similar orientation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). However, the resulting model fails to explain the DNA-binding specificity of TnsD [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Mutations at positions\u0026thinsp;+\u0026thinsp;31, +33, +\u0026thinsp;43, +45, +\u0026thinsp;51 and +\u0026thinsp;54 of \u003cem\u003eattTn7\u003c/em\u003e reduce significantly TnsD binding [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Accordingly, mutations at these positions also blocked transposition \u003cem\u003ein vivo\u003c/em\u003e [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In the AlphaFold model, the C-terminal domain of TnsD (residues 389\u0026ndash;508) interacts with uL29:ACP and footprints the +\u0026thinsp;20 to +\u0026thinsp;33 region of the \u003cem\u003eattTn7\u003c/em\u003e site with the preceding linker (residues 381\u0026ndash;388) and intervening folded domain (residues 317\u0026ndash;380) extending the footprint to position\u0026thinsp;+\u0026thinsp;48 of the \u003cem\u003eattTn7\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). Understanding how the Tn7 TnsD-mediated target-site selection complex protects the region of the \u003cem\u003eattTn7\u003c/em\u003e site beyond position\u0026thinsp;+\u0026thinsp;48 will necessitate further structural validation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis work, together with that from others, expands the roles of host factors in Tn7 transposition. We show that TnsD from prototypical Tn7 is prone to aggregation, but it is partially mitigated by the interaction with \u003cem\u003eEscherichia coli\u003c/em\u003e host factors, uL29 and ACP. Other Tn7-like elements use host factors to stabilize the RNA conformation in the targeting complex [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], or facilitate the integration step by bending DNA [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Understanding if all Tn7 elements use host factors to optimize the targeting and insertion events or only some have exploited this resource awaits future proteomics and structural characterization.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors approve of the final version of the manuscript and give consent for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of Data and Materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analyzed during the current study. Plasmids generated in the study will be made available upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the Canadian Institutes of Health Research (PJT-155941 and PJT-189946, to A.G.) and a Canada Research Chair Tier 1 (A.G.)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors’ contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: A.G.; Investigation, S.L.C., and L.A.M.; Formal Analysis: S.L.C., L.A.M., and A.G.; Visualization: S.L.C., and A.G.; Writing – Original Draft: S.L.C.; Writing – Review \u0026amp; Editing: A.G. with contributions from all authors; Supervision: A.G.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Shreya S. Krishnan and members of the Guarné laboratory for helpful discussions, and Dr. Angelos Pistofidis for advice on ACP activation.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003ePeters, J.E. and N.L. Craig, \u003cem\u003eTn7: smarter than we thought.\u003c/em\u003e Nat Rev Mol Cell Biol, 2001. \u003cstrong\u003e2\u003c/strong\u003e(11): p. 806-14.\u003c/li\u003e\n \u003cli\u003eWaddell, C.S. and N.L. Craig, \u003cem\u003eTn7 transposition: two transposition pathways directed by five Tn7-encoded genes.\u003c/em\u003e Genes Dev, 1988. \u003cstrong\u003e2\u003c/strong\u003e(2): p. 137-49.\u003c/li\u003e\n \u003cli\u003ePeters, J.E. and N.L. Craig, \u003cem\u003eTn7 recognizes transposition target structures associated with DNA replication using the DNA-binding protein TnsE.\u003c/em\u003e Genes Dev, 2001. \u003cstrong\u003e15\u003c/strong\u003e(6): p. 737-47.\u003c/li\u003e\n \u003cli\u003eMitra, R., et al., \u003cem\u003eCharacterization of the TnsD-attTn7 complex that promotes site-specific insertion of Tn7.\u003c/em\u003e Mob DNA, 2010. \u003cstrong\u003e1\u003c/strong\u003e(1): p. 18.\u003c/li\u003e\n \u003cli\u003eChoi, K.Y., J.M. Spencer, and N.L. Craig, \u003cem\u003eThe Tn7 transposition regulator TnsC interacts with the transposase subunit TnsB and target selector TnsD.\u003c/em\u003e Proc Natl Acad Sci U S A, 2014. \u003cstrong\u003e111\u003c/strong\u003e(28): p. E2858-65.\u003c/li\u003e\n \u003cli\u003eShen, Y., et al., \u003cem\u003eAssembly of the Tn7 targeting complex by a regulated stepwise process.\u003c/em\u003e Mol Cell, 2024. \u003cstrong\u003e84\u003c/strong\u003e(12): p. 2368-2381 e6.\u003c/li\u003e\n \u003cli\u003eShen, Y., et al., \u003cem\u003eStructural basis for DNA targeting by the Tn7 transposon.\u003c/em\u003e Nat Struct Mol Biol, 2022. \u003cstrong\u003e29\u003c/strong\u003e(2): p. 143-151.\u003c/li\u003e\n \u003cli\u003eWang, S., et al., \u003cem\u003eStructure of TnsABCD transpososome reveals mechanisms of targeted DNA transposition.\u003c/em\u003e Cell, 2024. \u003cstrong\u003e187\u003c/strong\u003e(24): p. 6865-6881 e16.\u003c/li\u003e\n \u003cli\u003eSharpe, P.L. and N.L. Craig, \u003cem\u003eHost proteins can stimulate Tn7 transposition: a novel role for the ribosomal protein L29 and the acyl carrier protein.\u003c/em\u003e EMBO J, 1998. \u003cstrong\u003e17\u003c/strong\u003e(19): p. 5822-31.\u003c/li\u003e\n \u003cli\u003eSchmitz, M., et al., \u003cem\u003eStructural basis for the assembly of the type V CRISPR-associated transposon complex.\u003c/em\u003e Cell, 2022. \u003cstrong\u003e185\u003c/strong\u003e(26): p. 4999-5010 e17.\u003c/li\u003e\n \u003cli\u003eRashev, M., J.A. Surtees, and A. Guarne, \u003cem\u003eLarge-scale production of recombinant Saw1 in Escherichia coli.\u003c/em\u003e Protein Expr Purif, 2017. \u003cstrong\u003e133\u003c/strong\u003e: p. 75-80.\u003c/li\u003e\n \u003cli\u003eAbramson, J., et al., \u003cem\u003eAccurate structure prediction of biomolecular interactions with AlphaFold 3.\u003c/em\u003e Nature, 2024. \u003cstrong\u003e630\u003c/strong\u003e(8016): p. 493-500.\u003c/li\u003e\n \u003cli\u003eEvans, R., et al., \u003cem\u003eProtein complex prediction with AlphaFold-Multimer.\u003c/em\u003e bioRxiv, 2021.\u003c/li\u003e\n \u003cli\u003eWaddell, C.S. and N.L. Craig, \u003cem\u003eTn7 transposition: recognition of the attTn7 target sequence.\u003c/em\u003e Proc Natl Acad Sci U S A, 1989. \u003cstrong\u003e86\u003c/strong\u003e(11): p. 3958-62.\u003c/li\u003e\n \u003cli\u003eGong, H., et al., \u003cem\u003eNeutralization of acidic residues in helix II stabilizes the folded conformation of acyl carrier protein and variably alters its function with different enzymes.\u003c/em\u003e J Biol Chem, 2007. \u003cstrong\u003e282\u003c/strong\u003e(7): p. 4494-4503.\u003c/li\u003e\n \u003cli\u003eZhang, Y.M., et al., \u003cem\u003eThe application of computational methods to explore the diversity and structure of bacterial fatty acid synthase.\u003c/em\u003e J Lipid Res, 2003. \u003cstrong\u003e44\u003c/strong\u003e(1): p. 1-10.\u003c/li\u003e\n \u003cli\u003ePark, J.U., et al., \u003cem\u003eStructures of the holo CRISPR RNA-guided transposon integration complex.\u003c/em\u003e Nature, 2023. \u003cstrong\u003e613\u003c/strong\u003e(7945): p. 775-782.\u003c/li\u003e\n \u003cli\u003eWalker, M.W.G., et al., \u003cem\u003eTransposon mutagenesis libraries reveal novel molecular requirements during CRISPR RNA-guided DNA integration.\u003c/em\u003e bioRxiv, 2023.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"mobile-dna","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mdna","sideBox":"Learn more about [Mobile DNA](http://mobilednajournal.biomedcentral.com/)","snPcode":"13100","submissionUrl":"https://submission.nature.com/new-submission/13100/3","title":"Mobile DNA","twitterHandle":"@MobDNAjournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tn7 transposition, Tn7 target-site selection, host factors, protein stability, protein interactions, DNA-binding proteins","lastPublishedDoi":"10.21203/rs.3.rs-7151933/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7151933/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTn7 mobile genetic elements are known for their sophisticated target-site selection mechanisms and, in some cases, programmability. Recognition of target sites is mediated by designated transposon-encoded proteins and modulated by host factor proteins. In the case of the CRISPR-associated Tn7 elements from the type V-K, the ribosomal protein uS15 is an integral component of recruitment complex that promotes R-loop completion. Previous biochemical work also revealed that the ribosomal protein uL29 and the acyl carrier protein (ACP) influence Tn7 transposition frequency \u003cem\u003ein vitro\u003c/em\u003e. However, how uL29 and ACP regulate the formation of the Tn7 targeting complex remains unclear. The prototypical Tn7 element encodes a heteromeric transposase (TnsAB), a AAA+ adaptor (TnsC), and two target-site selection proteins (TnsD and TnsE). TnsD targets a highly conserved site at the end of the \u003cem\u003eglmS\u003c/em\u003egene (\u003cem\u003eattTn7\u003c/em\u003e). However, poor protein stability has precluded the molecular characterization of how TnsD recognizes its target site. Here, we show that ACP and uL29 interact with the C-terminal region of TnsD through reciprocal electrostatic interactions, in turn, mitigating its tendency to aggregate. Additionally, we identify the uL29 and ACP residues that mediate the interaction with TnsD and stimulate DNA binding. These results unveil unique features of the TnsD-mediated target-site selection complex.\u003c/p\u003e","manuscriptTitle":"Escherichia coli proteins uL29 and ACP stabilize the Tn7-encoded TnsD and its DNA binding","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-01 10:56:02","doi":"10.21203/rs.3.rs-7151933/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accepted","date":"2025-08-08T20:39:23+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-08T18:36:29+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-31T08:17:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"5021338050425413307649977745490478634","date":"2025-07-29T21:53:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"19129915211711636641697965211024124559","date":"2025-07-29T16:06:23+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-29T10:13:30+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-29T09:06:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mobile DNA","date":"2025-07-28T13:36:20+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"mobile-dna","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mdna","sideBox":"Learn more about [Mobile DNA](http://mobilednajournal.biomedcentral.com/)","snPcode":"13100","submissionUrl":"https://submission.nature.com/new-submission/13100/3","title":"Mobile DNA","twitterHandle":"@MobDNAjournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4fc8e455-951b-435d-9350-95bd6fc0a3bc","owner":[],"postedDate":"August 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-25T16:35:20+00:00","versionOfRecord":{"articleIdentity":"rs-7151933","link":"https://doi.org/10.1186/s13100-025-00369-6","journal":{"identity":"mobile-dna","isVorOnly":false,"title":"Mobile DNA"},"publishedOn":"2025-08-22 16:29:26","publishedOnDateReadable":"August 22nd, 2025"},"versionCreatedAt":"2025-08-01 10:56:02","video":"","vorDoi":"10.1186/s13100-025-00369-6","vorDoiUrl":"https://doi.org/10.1186/s13100-025-00369-6","workflowStages":[]},"version":"v1","identity":"rs-7151933","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7151933","identity":"rs-7151933","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00