A Titin Knock-in model for Hereditary Myopathy with Early Respiratory Failure | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A Titin Knock-in model for Hereditary Myopathy with Early Respiratory Failure Viviana Cetrangolo, Swethaa Natraj Gayathri, Matteo Marcello, and 12 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8840201/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Titin, the largest muscle protein, plays a key role in the architecture of sarcomeres in both the heart and skeletal muscles. Due to its crucial role, variants in this gene have a critical impact on human health. Titinopathies include severe cardiomyopathies and dominant and recessive skeletal muscle diseases, associated with several pathogenic variants. Among these, titin A150/FN3-119 domain variants are associated with hereditary myopathy with early respiratory failure (HMERF), a life-threatening disorder characterized by respiratory failure and proximodistal muscle weakness. Although murine and fish models have been developed for a wide range of titinopathies, an HMERF model is lacking. Here, we generated and characterized an HMERF knock-in model using Oryzias latipes (medaka fish). Upon the generation of this model, which carries the most common HMERF missense variant (p.C31712R), we found that the mutants had impaired muscle structure, with homozygous larvae exhibiting a more severe phenotype than their heterozygous siblings. Focusing our study on the homozygous larvae, we performed RNA sequencing (RNA-seq) analysis, revealing significant dysregulation of genes with key roles in muscle filament organization and autophagy pathway. This suggests exacerbated muscle damage and dysfunction. These results were corroborated by locomotor analyses and mechanical studies, which revealed that homozygous larvae exhibit limited movement and reduced muscle fiber capability to generate force and shortening at high speed. These results demonstrate that structural abnormalities directly correlate with the impaired function in HMERF mutants. Taken together, the altered muscle structure, impaired locomotor behavior, and dysregulated gene expression underscore the complex pathological mechanisms underlying HMERF disease. Beyond elucidating HMERF-disease mechanisms, our work highlights the value of genome editing in medaka fish, a powerful and versatile model system to dissect the molecular basis of human muscle diseases. Titin Hereditary myopathy with early respiratory failure (HMERF) knock-in model medaka fish Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Titin (TTN) is one of the largest proteins known, composed of more than 35,000 amino acids in human, reaching a length of over 1 µm and spanning a half-sarcomere from the Z-disk to the M-band. It has a key role in the architecture of the sarcomeres in striated heart and skeletal muscles. Acting as a molecular spring, titin protein contributes to the passive tension of the muscle and regulates sarcomere length. It also acts as scaffold protein, helping the myofibrillar assembly during myogenesis and as a mechanosensor, regulating transcription and various signaling pathways [3, 31]. The titin filament contains 132 fibronectin-3 (FN3) domains and more than 169 immunoglobulin-like domains interspaced with several unique sequence (US) regions, a PEVK (Proline, Glutamate, Valine, Lysine- rich) region in the I-band and a pseudokinase domain TK (titin kinase) in the M-band (Fig. 1a) [1, 12, 13]. The Titin gene is 300 kb long with 364 exons (363 coding) and a predicted maximal full-length transcript of more than 100 kb [22]. Because of its key functions, titin variants have an enormous impact on human health. Pathogenic variants in the TTN human gene have been associated with several cardiomyopathies and a wide range of dominant and recessive skeletal muscle diseases with or without cardiac involvement [24]. Among these, an autosomal dominant disease, the Hereditary Myopathy with Early Respiratory Failure (HMERF, OMIM#603689) is caused by missense variants within exon 344, encoding the FN3 domain FN3-119 (also called A150 domain) in the A-band region (Fig. 1b) [18, 19, 29]. Typical pathological features of HMERF patients are early respiratory failure, proximodistal muscle weakness and muscle histopathology showing cytoplasmatic bodies (CB) with subsarcolemmal localization, myofibrillar disintegration and rimmed vacuoles (RV) [19, 29]. The most common causative variant c.95134T>C p.(C31712R) shows a fully penetrant autosomal dominant inheritance. While clinical, phenotypical, and genetic pictures are nowadays well established, the molecular pathological mechanism of HMERF-causing mutations has not yet been identified. The conspicuous number of variants located in the FN3-119 domain indicates a mutational hotspot in this region, suggesting a mechanism related to a highly specific function of this domain. Therefore, it seems necessary to elucidate the molecular and pathogenetic mechanisms underlying variations in this specific mutational hotspot domain to develop therapies for HMERF patients. Several animal models have been developed for Titin variants associated with titinopathies in general. Vertebrate models, including zebrafish and mice, have been reported for muscular dystrophies and cardiomyopathies [16]. In addition, another teleost fish model, the medaka fish ( Oryzias latipes ) , has been reported for the hypertrophic cardiomyopathy (HCM) caused by titin missense variants in an Ig domain located in the M-band/A-band transition zone [8]. This cardiovascular mutant medaka model, named non-spring heart (nsh) , showed diastolic dysfunction and hypertrophic myocardium. The nsh homozygotes had fewer myofibrils and disrupted sarcomeres, while the heterozygotes showed M-band disassembly in myofibrils. This pioneering study on medaka revealed a novel mechanism underlying the pathogenesis of HCM and highlighted the medaka fish as a promising new model to study the molecular mechanisms of titinopathies. The medaka fish Oryzias latipes is an emerging alternative fish model, successfully used for genetic, developmental, ecotoxicology and mechanical studies [16, 28]. The effectiveness of genome editing techniques [17] and the transparent embryos and larvae makes it an ideal candidate model to investigate neuromuscular disorders. Notably, medaka has a small genome (800 mb) and, in contrast with zebrafish, it has only one copy of the Titin gene due to a lower degree of genome duplication [20]. Although mouse and fish models have been developed for titin mutations associated with cardiomyopathies and skeletal muscle diseases, no model has ever been generated for HMERF disease. Here, we focused on the generation and characterization of the medaka fish as the first vertebrate model for HMERF disease. Using CRISPR/Cas9 we generated medaka knock-in mutants carrying a missense variant corresponding to the HMERF- causing variant c.95134T>C p.(C31712R). The analysis of these mutants revealed the impairment of muscles’ structure and function, with homozygous larvae exhibiting a more severe phenotype compared to their heterozygous siblings. Transcriptome analysis through RNA-Sequencing revealed significant dysregulation of extracellular matrix organization and metabolic processes, that are suggestive of exacerbated muscle damage and dysfunction. Moreover, genes with key roles in autophagy, cell homeostasis and filament organization exhibited a higher level of dysregulation in homozygous larvae than compared to wild type larvae. In conclusion, this is the first study to model an HMERF variant in a vertebrate system, paving the way for a refined analysis of the pathomechanisms and, thereby, new potential therapeutic approaches. Our study also confirms the potential of medaka as a promising new model for studying titinopathies. Material and Methods Medaka fish husbandry and embryo maintenance Medaka fish ( Oryzias latipes ) from the Cab inbred strain were used throughout the study and maintained in the standard conditions of 12h/12h light/dark at 27°C. Embryos were staged according to Iwamatsu [ 10 ]. All studies on fish larvae were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health, Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experimentation (article 31; D.L. 26/2014; protocol number: 0016304-21/07/2020-DGSAF-MDS-P). CRISPR/Cas9 mutagenesis and generation of the founder lines A single guide RNA (sgRNA) and single strand donor DNA (ssDNA) were designed in-house at the TIGEM Institute (Pozzuoli, Italy). The sgRNA (ATGCTACCTTCACATACTCC) was 20 bp with a terminal NGG (PAM sequence) and with a single genome match to medaka exon 206 (corresponding to the human exon 344). SgRNA was ordered from Genewiz company (from Azenta Life Sciences, Germany). A custom donor ssDNA was designed to carry the HMERF missense variant (T > C) together with silent mutations to inhibit the Cas9 cutting within the inserted donor, and homology arms to increase its specificity for the correct sequence pairing, and ordered from Synthego company (California, US). A solution of mRNA Cas9 (200 ng/ml), sgRNA (20 ng/ml) and donor ssDNA (10 ng/ml) was prepared and injected in one-cell stage embryos. After hatching, larvae were genotyped by genomic DNA extraction and sequencing of caudal fins. Each larva was anesthetized with 0,2% Tricaine in fish medium (Yamamoto: 0.75% NaCl, 0.02% KCl, 0.02% CaCl 2 , 0.002% NaHCO 3 ) and a piece of their tail was cut. The tail pieces were than lysed with the lysis buffer (Tris-HCl 1M, IGEPAL® CA-630, Tween20) and proteinase K 20 mg/mL (Sigma-Aldrich) overnight at 56°C. After the genomic DNA extraction, single larvae tails were genotyped by PCR amplification (custom primers RNAC2Fw-AGTACTCGGTACGTAGCC and RNAC2Rv-TTAAGTCTGTTGGTGTCTCG). PCR products were then sequenced using the same primers to determine the presence of the CRISPR/Cas9 induced mosaicism in larvae. F 0 generation fish from the injected embryos and F 1 heterozygous fish were then selected and crossed to generate F 2 populations. Each generation was again genotyped through PCR amplification on genomic DNA extracted from the caudal fin, to identify heterozygous and homozygous individuals. Hematoxylin and Eosin Staining and fiber number analysis For Hematoxylin and Eosin analysis, larvae were fixed in Carnoy solution (ethanol 60%, chloroform 30%, glacial acetic acid 10%) at room temperature (RT) for 4 h or at 4°C overnight, rocking. Samples were then transferred in ethanol 70%, processed and finally embedded in paraffin blocks, with the correct orientation to obtain coronal sections of the myotomes. Sections of 5–6 µm were cut with a microtome (Leica RM2245) and mounted on glass slides. Histological sections were then stained with Harris hematoxylin and alcoholic eosin Y 0.1% to visualize, respectively, nuclei and cytoplasmatic components. Fiber counting was done with ImageJ2-Fiji (version 2.14.0; RRID:SCR_003070). Fibers of different histological sections (n = 3) were counted at three different point along the larval body (abdomen, center and tail). The results and statistical analyses (2way ANOVA-Multiple Comparison) were plotted with GraphPad Prism (RRID:SCR_002798) 9.0. Immunostainings on cryosections Stage 40 larvae were anesthetized and fixed by incubation in 4% paraformaldehyde (PFA) in PBS1× for 2 h at room temperature (RT). Samples were rinsed three times with PTW1× (PBS1×, 0.1% Tween20, pH 7.3), incubated overnight in 15% sucrose/PTW1× at 4°C, and then again incubated overnight in 30% sucrose/PTW1× at 4°C. Finally, larvae were included in gelatin/sucrose blocks and preserved frozen at -20°C. Frozen blocks were then cut with cryostat in 7 µm sections and mounted on glass slides. Larval cryosections were rehydrated in PBS1× for 5 minutes, washed 3 times in PTW for 20 min, and incubated with blocking solution (BSA 5% in PTW filtered or Normal Goat Serum 5%, depending on the primary antibody) for 2h at RT. Cryosections then were incubated with primary antibodies (anti-titin T11-1:500 T9030 Sigma, anti-myosin F59 1:20 Hybridoma Bank DSHB, anti-a-actinin EA-53 Sigma A781) overnight at 4°C. Next, the cryosections were washed with PBS1× 3 times, and incubated with Alexa-Fluor-secondary antibodies (1:500 Anti-Mouse, A32723 and Anti-Rabbit A-11059, ThermoFisher) for 1h at RT. Nuclei were stained with DAPI (1:500). After washes in PBS1×, cryosections were finally mounted in glycerol 80%/PBS1×. Transmission electron microscopy and Sarcomere length Whole larvae and dissected skeletal muscles of adult fish were fixed with 1% glutaraldehyde prepared in 0.2 M HEPES buffer, pH 7.3. Then, they were postfixed with a mixture of 2% osmium tetroxide and 3% potassium ferrocyanide for 30 min and incubated in 0.5% uranyl acetate at 4°C overnight. The following day, the samples were dehydrated in a series of ethanol and propylene oxide and embedded in epoxy resin. Ultrathin 60 nm sections were cut using a Leica EM UC7 ultramicrotome. Electron micrographs were acquired using a FEI Tecnai 12 electron microscope (Thermo Fisher) equipped with a Veletta CCD digital camera. Sarcomere length was analyzed using iTEM software (Olympus SYS, Germany), and plotted in a graph using GraphPad Prism (RRID:SCR_002798) 9.0 (Prism). The statistical significance of difference in measured variables was determined by two-tailed unpaired t-test with Welch's correction when appropriate. RNA-Sequencing Larval bodies were dissected to separate caudal skeletal muscles from the upper-trunk internal organs. The caudal sections were then pooled together (n = 5 for each genotype) in single tubes and total RNA was extracted with TRIzol™ Reagent (cat:15596026, Thermo Fisher). Illumina Sequencing (NovaSeq 6000) was performed at CeGat (Tübingen, Germany). The RNA library was prepared with the SMART-Seq Stranded Kit (Takara Bio), with an input of 10 ng RNA. Due to the scarcity of RNA material when dealing samples from larvae, the samples exhibited a low RIN value (< 2). This necessitated the acquisition of technical duplicates, wherein two libraries were prepared for each pool. A total RNA sequencing procedure was performed, yielding pair-end (PE) reads with a length of 101 base pairs. Subsequently, the reads were aligned to the reference genome (Japanese medaka fish ASM223467v1) using STAR v2.7.3 [2]. Read counts were generated using quantMode GeneCounts in STAR scripts. The principal component analysis (PCA) plot was generated using variance stabilized transformed (vst) counts. Differential gene expression (DGE) analysis was performed between homozygous samples oltitin C31712R/C31712R and wild type oltitin +/+ using the DESeq2 [14] package in R (v4.3.2). Genes exhibiting a log2foldchange (log2FC) greater than 0.5 and an adjusted p-value (padj) determined using the Benjamini-Hochberg (BH) method greater than 0.05 were considered to be significantly upregulated, and genes with a log2FC less than 0.5 and a padj less than 0.05 were considered to be significantly downregulated. The volcano and heatmap plots were made using Python and R languages. Pathway enrichment analyses was conducted in R using the gprofiler2 package [11]. Fold enrichment was calculated as the measure of how much more a pathway term could be represented in the differential gene set than expected by chance as background. The calculation was performed as follows: The top significant Gene Ontology (GO) terms (p-value < 0.05) and KEGG terms were checked and plotted. The volcano, heatmap and pathway enrichment plots were made using Python and R language scripts. Locomotor test and swimming behavior analysis Larval locomotion was investigated on medaka larvae at stage 40 using the automated analyzer DanioVisionTM Observation Chamber (Noldus Information Technology) at the Stazione Zoologica “Anton Dohrn” in Naples. Each single larva was isolated in single well of the 24-well plate and maintained in 1.5ml of Yamamoto solution. The first recording started after a 30 min acclimation period. Following the luminous stimulus, the activity was recorded at least three times for 10 min, with 10 minutes of dark interval between each recording, yielding a cumulative recording duration of 30 minutes. The measured activity in heterozygous ( n = 9), homozygous ( n = 5) and wild type ( n = 5) larvae included the total duration (in seconds) spent moving and the total duration spent resting or immobile. The data were analyzed and plotted in graph using GraphPad Prism (RRID:SCR_002798) 9.0 (Prism). The statistical significance of difference in measured variables was determined by unpaired Student t-test. Mechanical experiments Intact muscle preparations, obtained from the tails of the wild type and homozygous larvae, were used to determine the mechanical performance [ 15 ]. Euthanized larvae were transferred in vials containing ice-cold Ringer solution and daily delivered to the PhysioLab research unit (University of Florence, Italy) to perform the experiments. Larvae were selected at random and dissected under a stereomicroscope (Zeiss SV11) with small forceps and scissors. The tail ends were clamped with aluminum T-shaped clips and mounted between the lever arms of a capacitance force transducer and a loudspeaker motor in a thermo-regulated aluminum trough [ 15 ]. The sarcomere length ( sl ) was set at 2.0-2.1 µm under a 40x dry objective and a 25x eyepiece and the length of the tail ( L 0 ) was measured as the distance between the clips. The width ( w ) and height ( h ) of the tail were measured at two-three points along it at interval distances of 0.5–0.7 mm starting from the clip end. At each point w was determined as the extreme width of the tail while h was determined from the extremes focus distances at the middle of the tail width. The cross-sectional area (CSA) at each point was calculated assuming an elliptical boundary as w · h ·π/4 and the average CSA was taken to get a first estimate of the force density of the medaka larva muscle. In oltitin +/+ tail CSA varied between 16,300 and 37,200 µm 2 (mean value ± SE, 25,600 ± 4,700 µm 2 from five tails). In oltitin C31712R/C31712R tail CSA varied between 14,700 and 34,600 µm 2 (21,200 ± 2,000 µm 2 from nine tails). The mechanical output was measured during isometric and isotonic contractions of the muscle from oltitin +/+ and oltitin C31712R/C31712R medaka larvae at 30°C. The sample was stimulated by means of two platinum plate electrodes, running parallel to the fish tail 4 mm apart, carried on a microscope cover glass positioned on the top of the trough. Pulses of 0.5 ms duration and amplitude 1.5 times the threshold voltage for contraction were delivered as single stimuli to elicit twitch contractions or as trains of an even number of stimuli of alternate polarity to elicit tetanic contractions [ 15 ]. The stimulation frequency for a fused tetanus ranged between 280–320 Hz. The force-velocity ( T - V ) relation was determined with after-loaded contractions (load, T : 1 and 0.75, 0.50, 0.25 and 0 the isometric force, T 0 ). Velocity ( V ) was estimated as the slope of the linear fit to the initial part of the shortening trace following the start of the isotonic phase of the contraction. The power ( W ) at each load was determined as the product of the applied load and the shortening velocity ( W = T × V ). Data are fitted with the Hill hyperbolic equation [ 9 ], ( T / T 0 + a / T 0 ) × ( V + b ) = ( V 0 + b ) × a / T 0 , where - a / T 0 and - b are the coordinates of the vertical and horizontal asymptotes of the hyperbola and V 0 the velocity of unloaded shortening. The Ringer solution used for the mechanical experiments had the following composition (mM): 115 NaCl, 2.5 KCI, 1.8 CaCl 2 , 3-phosphate buffer (2.15 Na 2 HPO 4 and 0.85 NaH 2 PO 4 ) at pH 7.1. Force, motor position and half-sarcomere length changes were recorded with a multifunction I/O board (PXIE-6358, National Instruments). A program written in LabVIEW (National Instruments) was used for signal generation and data acquisition. Analysis of the mechanical data was performed using Excel (Microsoft), OriginPro 8.0 (OriginLab Corporation) and programs written in LabVIEW. Results Generation of the medaka knock-in model Taking advantage of the fact that medaka fish has a single copy of the titin gene in its genome, we used CRISPR/Cas9 genome editing technology to generate knock-in mutant lines. These mutant fish were engineered to carry the specific missense variant commonly found in patients diagnosed with Hereditary Myopathy with Early Respiratory Failure (HMERF). In the human genome, the missense nucleotide variant c.95134T > C is localized in exon 344 and results in the substitution of a Cysteine with an Arginine residue p.(C31712R) in the FN3-119 (A150) domain, close to the end of the A-band of the titin protein (Fig. 1 )[ 19 , 29 ]. This domain is highly conserved among vertebrates, including medaka, allowing the introduction of a single nucleotide change in the corresponding medaka exon (exon 206) causing the same amino acid substitution Cysteine to Arginine (Fig. 2 a-b). Exploiting the CRISPR/Cas9 homology arms strategy, we injected the sgRNA and the ssDNA at the one-cell stage into wild type medaka embryos, which were raised and genotyped after larval hatching. We first investigated the effects of this mutation on the body size, lifespan, and fertility of the F 1 generation of heterozygous adults ( oltitin C31712R/+ ). Interestingly, we observed that the heterozygotes did not exhibit any noticeable alterations in body size, lifespan, or fertility at adult stage (data not shown), suggesting that the variant did not affect these parameters in the heterozygous state. The p.(C31712R) variant is germline inherited as for the sequencing results of the F 1 and F 2 generation (Fig. 2 c). Subsequent in-cross breeding of the F 1 heterozygous adult fishes oltitin C31712R/+ resulted in the production of both heterozygous oltitin C31712R/+ and homozygous larvae oltitin C31712R/C31712R in the F 2 generation. Thus, we analyzed these freshly hatched larvae for any phenotypic differences. The results revealed that the three groups -heterozygous oltitin C31712R/+ , homozygous oltitin C31712R/C31712R , and wild type oltitin +/+ larvae- did not display any noticeable differences in the gross morphology of their bodies and heart (Fig. 2 d). However, the homozygous oltitin C31712R/C31712R larvae showed a significantly reduced lifespan, with most of them dying around 12 days after hatching (Fig. 2 e). In contrast, the heterozygous oltitin C31712R/+ and wild type oltitin +/+ larvae survived to adulthood. These findings indicate that the homozygous condition for this mutation is likely lethal and that the alteration in the FN3-119 (A150) domain of titin may be critically important for the survival of fish, highlighting the crucial role of this protein in the organism’s development and longevity. Medaka oltitin C31712R/C31712R larvae showed defective muscle structure Because of the lethality observed in homozygous larvae, we sought to investigate whether the alteration of Titin gene in the two knock-in mutants, oltitin C31712R/+ and oltitin C31712R/C31712R , would impact the structure and ultrastructure of skeletal muscles. Thereby, we conducted a detailed histological analysis of larval transverse cross-sections, focusing on skeletal muscle morphology. The histological examination revealed that both oltitin C31712R/+ and oltitin C31712R/C31712R larvae exhibited impairments in the structure of their skeletal muscles. However, oltitin C31712R/+ larvae displayed mildly compromised muscle bundles, with a slightly reduced number of muscle fibers compared to the oltitin +/+ larvae (Fig. 3a-b). These findings suggest that even a single copy of the mutated allele can lead to a moderate impairment in medaka muscle structure. In contrast, the oltitin C31712R/C31712R larvae showed a more severe phenotype, with a significantly reduced number of muscle fibers and extensive disorganization of muscle bundles across all body sections analyzed, including abdomen, center, and tail (Fig. 3a-b). These results indicate that the variant in a homozygous state has a stronger impact on medaka skeletal muscle integrity. Consistently, immunostainings confirmed the disorganization of the muscle fibers in both oltitin C31712R/+ and oltitin C31712R/C31712R larvae when compared to the wild type larvae (Fig. 3c). Labeling titin, myosin heavy chain (F59) and a-actinin in the skeletal muscles showed a loose organization of the fibers in the mutants, although their myofibrils still showed typical striation (Fig. 3c). Notably, we further observed that oltitin C31712R/+ larvae exhibit a milder alteration of the muscle fibers, while oltitin C31712R/C31712R larvae showed a higher level of fibers disorganization. These structural changes could indicate that the mutant skeletal muscles are functionally compromised rather than visibly malformed. To gain a deeper understanding of the muscle damage at a subcellular level, we conducted ultrastructural analysis using transmission electron microscopy (TEM) on longitudinal sections of the three genotypes. The TEM images further corroborated the findings: oltitin C31712R/+ larvae showed a mildly altered sarcomeric architecture, with sarcomere length comparable to that of wild type larvae, while oltitin C31712R/C31712R larvae exhibited a more severe phenotype (Fig. 3d) with markedly shortened sarcomeres, confirming that this variant has a more detrimental effect on the organization of the muscle fibers in the homozygous state (Fig. 3d). Transcriptomics reveals dysregulation of muscle genes in oltitin C31712R/C31712R larvae To molecularly characterize the effect of this variant, we analyzed the whole transcriptome of the oltitin +/+ , oltitin C31712R/+ and, oltitin C31712R/C31712R larvae by RNA sequencing. Principal Component Analysis (PCA) plot showed separate clustering of sample groups (Fig. 4a). We therefore analyzed and compared the differential gene expression among these three groups. Heterozygous oltitin C31712R/+ samples revealed that 1,133 genes were significantly upregulated, while 1,415 genes were downregulated compared to wild type oltitin +/+ . On the other hand, the comparison of homozygous samples against wild type revealed 537 significantly upregulated and 470 significantly downregulated genes. From these, a total of 237 genes were found to be commonly upregulated, while 128 genes were found to be commonly downregulated (Fig. 4b). As homozygous larvae exhibited a dysregulated gene pattern and a more compromised muscle phenotype, subsequent analysis focused on comparing homozygous and wild type larvae. Pathway analysis revealed enriched GO terms for extracellular matrix, external encapsulating structure, endopeptidase activity and regulation, and several metabolic processes (Fig. 4c). In this context, oltitin C31712R/C31712R samples exhibited a higher fold enrichment for most of the top-enriched terms. Furthermore, differential gene expression analysis revealed a dysregulated pattern of specific genes involved in cytoskeletal regulation and muscle structure (Fig. 4d). Interestingly, myosin heavy chain β, fast skeletal muscle genes (LOC101164699 and LOC101163903), fast skeletal muscle-like genes (LOC101163631 and LOC101163661), and cnn2 (Calponin) were found notably downregulated in oltitin C31712R/C31712R larvae, compared to wild type larvae (Fig. 4d). In contrast, a significant upregulation of twf1 (Twinfilin-1), plastin 1- I isoform (LOC101168586), plastin-3 T-plastin (LOC101161915), coro6 (Coronin) and mylpf (myosin light chain, phosphorylatable) was observed. Also, unc45b (Protein unc-45 homolog B) a myosin-specific chaperone integral for sarcomere assembly and maintenance was significantly upregulated in oltitin C31712R/C31712R larvae compared to wild type larvae. These results suggest the disruption of actin filament organization and muscle integrity in the oltitin C31712R/C31712R larvae. Moreover, genes involved in autophagy, protein turnover and cellular homeostasis were also notably dysregulated in oltitin C31712R/C31712R samples (Fig. 4d). We observed a significant downregulation of autophagy genes such as sqstm1 (Sequestosome 1) and plekhg2 (Pleckstrin homology domain containing, family G with RhoGef domain) member 2), and a significant upregulation of sesn1 (Sestrin 1) and tp53in2 (Tumor protein p53 inducible nuclear protein 2). Co-chaperone genes such as bag3 (bcl2-associated athanogene 3), involved in protein homeostasis, were also significantly downregulated in oltitin C31712R/C31712R samples, thus suggesting a possible alteration in autophagy pathways. Finally, rbm20 encoding for the main factor regulating titin splicing, was also found to be downregulated in oltitin C31712R/C31712R samples. Mutant larvae exhibit an impaired swimming behavior To investigate the impact of this variant on the skeletal muscle function, we analyzed the free-swim behavior of the larvae at seven days post-hatching. The analysis of the movement trace of individual larvae within the well showed clear differences in the swimming behavior of the larvae, with the oltitin C31712R/C31712R larvae exhibiting faltering swimming (Fig. 5A). Quantification of the movement over the recording period showed that oltitin C31712R/C31712R larvae displayed lower movement time (Fig. 5b-c). Therefore, oltitin C31712R/C31712R larvae exhibit a longer period of inactivity, compared to their siblings, indicating that muscle fibers damage hinders their swimming behavior. Mechanical performance of skeletal muscle The faltering swimming of the oltitin C31712R/C31712R larvae with respect to the oltitin +/+ larvae was further investigated by determining the performance of the skeletal muscle. The tail muscle was electrically stimulated under isometric conditions with trains of pulses to elicit fused tetani (Fig. 6a-b). In oltitin C31712R/C31712R larvae, the latency between the stimulus start and the beginning of force development ( l R ) and the half-time for the development of tetanic force ( t 1/2D ) are not significantly different (p > 0.1) compared to the oltitin +/+ larvae, while the plateau tetanic force ( T 0 ), normalized by the CSA of the tail, is significantly reduced from 84 ± 5 kPa to 30 ± 8 kPa (p < 0.01) (Fig. 6a-b and Table 1 ). Considering the cross-sectional area of the tail (CSA), the fractional area occupied by the muscle fibers in the muscle of the tail ( f ) and the number of fibers in the cross-section ( n ) (Fig. 3b and Table 1 ), the average CSA per fiber (CSA fiber ) can be calculated as CSA × f / n . The average isometric force per fiber ( f fiber ) can be calculated as T 0 / f . CSA fiber is about 30 mm 2 independently on genotype, resulting in f fiber of 1.6 mN in the oltitin C31712R/C31712R larvae, about 40% compared to in oltitin +/+ larvae (3.8 mN) (Table 1 ). The force-velocity ( T - V ) relation was determined with after-loaded contractions (Fig. 6c). Following the transition to the isotonic contraction, the shortening exhibits an initial velocity that progressively reduces with time (inset Fig. 6), likely because of the rising resistance to shortening of the noncontractile internal structures, as the notochord in parallel with the myofibers. The initial shortening velocity ( V ) at each imposed load ( T ) was measured as the slope of the first order regression line to the initial part of the shortening. The velocity of unloaded shortening ( V 0 ) was determined as free parameter of the Hill hyperbolic equation [ 9 ] (Table 1 ). V 0 reduced to about 50% in oltitin C31712R/C31712R larvae (about 11.5 L 0 /s, Table 1 ) compared to the oltitin +/+ larvae (about 23. 3 L 0 /s) and the power output, calculated from the T - V relation as W = T × V , has a maximum value ( W max ) reduced to about 20% in the homozygous larvae (from 3.2 T / T 0 × L 0 /s in oltitin +/+ larvae, to 0.64 T / T 0 × L 0 /s in oltitin C31712R/C31712R larvae, Table 1 ). Table 1 Structural ( A ) and mechanical ( B and C ) parameters of the skeletal muscles of the tail of the medaka fish larva. oltitin +/+ (n = 5) oltitin C31712R/C31712R (n = 9) p-value A CSA, µm 2 25,600 ± 4,700 21,200 ± 2,000 0.523 Fractional area occupied by the fibers ( f ) 0.641 ± 0,012 0.594 ± 0.009* 0.040 Number of fibers in the cross-section ( n ) 568 ± 28 392 ± 22** 0.003 CSA fiber , µm 2 29.5 ± 1.64 32.9 ± 2.14 0.373 Number of fibers per m 2 (x10 12 ) 0.035 ± 0.002 0.031 ± 0.002 0.332 B T 0 , kPa 84 ± 5 30 ± 8** 0.002 T 0,c , kPa 131 ± 7 51 ± 14** 0.003 l R , ms 1.34 ± 0.12 1.47 ± 0.07 0.511 t 1/2,D , ms 3.55 ± 0.55 2.49 ± 0.20 0.190 f fiber , µN 3.79 ± 0.28 1.63 ± 0.44** 0.009 C V 0 , L 0 /s 23.25 ± 0.53 11.49 ± 0.84*** 6.3×10 − 6 W max , T/T 0 ×L 0 /s 3.19 ± 0.10 0.64 ± 0.04*** 7.4×10 − 9 Mechanical parameters are determined during isometric ( B ) and isotonic ( C ) contractions. CSA, cross-sectional area of the tail; CSA fiber , average CSA per fiber (calculated as CSA × f / n ); the number of fibers per unit area is calculated as 1/CSA fiber . T 0 , steady isometric force; T 0,c , steady isometric force taking into account of the fractional area occupied by the fibers ( T 0,c = T 0 / f ); l R , latency of force rise measured from the beginning of the stimulation; t 1/2D , time from the start of force rise to one-half T 0 during force development; f fiber , average force per fiber calculated as T 0,c / number of fibers per m 2 ); V 0 , unloaded shortening velocity estimated by the ordinate intercept of the Hill’s equation interpolated to the T - V data; W max , maximum power output. In the mechanical experiments the sarcomere length was 2.05 ± 0.02 µN in oltitin +/+ larvae and 2.07 ± 0.01 µN in oltitin C31712R/C31712R larvae. Values are mean ± SE. Asterisks indicate statistical significance (*p < 0.05; **p < 0.01; ***p < 0.001). Discussion Hereditary Myopathy with Early Respiratory Failure (HMERF) is a severe neuromuscular disorder that has a high impact on patients’ health and life expectancy. Initially thought to be an extremely rare disease, several variants have been described in many different families over the last two decades, sparking the interest in its pathomechanism [ 19 , 29 ]. HMERF is characterized by distinctive clinical features and muscle pathology, including respiratory failure, muscles weakness, fiber-size variation and cytoplasmic bodies (CB) [ 26 , 29 ]. In this study, we investigate the impact of the most frequent variant of HMERF patients p.(C31712R), to reveal its downstream effects leading to the muscle disease. To this end, we have generated and thoroughly characterized the first vertebrate model for HMERF, establishing medaka fish as a new genetic model for this disease. The striking aspect of our study is the severe phenotype and the heavily reduced lifespan of the homozygous knock-in animals. While human HMERF patients typically harbor the p.(C31712R) missense mutation in heterozygosity, the same heterozygous variant in medaka slightly alters the fiber muscle development and organization. However, the pathological signs do not seem to affect the development or the lifespan of the fish. This discrepancy might be attributed to species-specific differences in gene expression regulation, penetrance, or epistasis. At the same time, the absence of homozygous patients for the p.(C31712R) variants may even suggest homozygosity to be incompatible with human life. Notably, although both oltitin C31712R/C31712R and oltitin C31712R/+ larvae showed a wild type-like phenotype when freshly hatched, our analysis revealed that already the seven days post-hatched larvae show impaired muscle organization and function. This was corroborated by histological sections, immunostainings and TEM sections of skeletal muscles which showed a severe disorganization of myofibers and sarcomeres in the oltitin C31712R/C31712R larvae. The altered fibers integrity and sarcomere length observed in the oltitin C31712R/C31712R larvae is consistent with findings from other studies on titin-related muscle diseases, where mutations in titin result in the degeneration of muscle fiber ultrastructure and function [ 27 , 30 ]. Taken together, these results underscore the critical role of titin in maintaining muscle structure and function, and they highlight that variants in the specific FN3-119 (A150) domain led to significant muscle defects in both human and medaka fish. Moreover, one hallmark of the HMERF disease is the presence of cytoplasmic bodies (CBs), which are identified by immunohistochemical analysis [ 29 ]. Neither oltitin C31712R/C31712R nor oltitin C31712R/+ larvae exhibited cytoplasmic bodies. Instead, they clearly displayed myofibrillar disorganization, which is another striking characteristic feature of HMERF patients [ 19 , 29 ]. The absence of CBs in our model could be due to the timing of our analyses, as such aggregates may accumulate at later adult stages, that were not captured in our study. Transcriptomic analyses reveal that most of the differentially expressed genes are involved in extracellular matrix organization and metabolic processes, alterations commonly observed as secondary effects of muscle damage and disrupted sarcomere dynamics. Also, targeted analysis of specific genes implicated in cytoskeletal structure, protein quality control, and autophagy regulation uncovers significant dysregulation in homozygous larvae. Alterations to the autophagy process have already been reported in skeletal myopathies [ 4 , 21 , 23 ] and in titin-related cardiomyopathies [ 35 ]. Notably, also the co-chaperone BAG3 (bcl2-associated athanogene 3), known to be involved in hereditary myopathies with disorganized myofibrillar structure [ 25 , 33 ], was found highly dysregulated in homozygous larvae. These results suggest that autophagy dysregulation may play a role also in the HMERF pathogenesis and may be related to the cytoplasmic bodies and rimmed vacuolar pathology seen in the patients. Furthermore, the RNA-binding motif protein 20 (RBM20), a key regulator of alternative splicing in striated muscle, is also found to be differentially expressed in our model. RBM20 is known to control the splicing of several genes, including TTN , and its mutation leads to dilated cardiomyopathy in humans [ 6 , 7 , 32 ]. These findings suggest that RBM20-mediated splicing alterations may contribute to the observed muscle pathology in medaka model. In line with the observed muscle structural defects, functional assessments through locomotor assays indicate that homozygous medaka larvae spend significantly more time in a resting state and exhibit limited movement. This behavioral phenotype is likely due to the reduced performance of the skeletal muscle, as supported by the mechanical analysis of the tail, which shows that skeletal muscle fibers of homozygous larvae develop lower power output because of a reduced capability to generate force and shortening at high speed. These findings are consistent with previous studies on titinopathies [ 5 ], demonstrating that structural abnormalities in muscle fibers are directly correlated with impaired function. The development of animal models that faithfully recapitulate human TTN gene variants has been pivotal in advancing our understanding of titin-related disorders. Several rodent and zebrafish models have been successfully engineered to mimic disease-relevant mutations observed in patients [ 16 ]. The FINmaj mouse model, a model for LGMD R10, exhibits muscle weakness and progressive cardiomyopathy, reinforcing the critical role of intact titin for sarcomere stability and contractile function. On the other hand, fish models provide complementary advantages, including rapid development, optical transparency, and the ability to conduct high-throughput genetic studies. For example, the “runzel” (ruz) and “ pickwick” (pik) zebrafish models, which carry mutations in the N2A and in the N2B regions of titin respectively, manifest skeletal muscle ( ruz ) and cardiac ( ruz) phenotypes [ 27 , 34 ]. Similarly, “ non-spring heart model” ( nsh ), a medaka model carrying a mutation in the MURF1-titin interacting domain, also presents a cardiac phenotype [ 8 ]. In this context, our study provides the first medaka model reproducing a missense mutation found in HMERF patients and to manifest a skeletal muscle phenotype. In conclusion, our study provides novel insights into the muscle pathology associated with Hereditary Myopathy with Early Respiratory Failure and establishes a robust in vivo knock-in medaka model that faithfully recapitulates key aspects of the human disease. The combination of altered muscle architecture, impaired locomotor behavior reflecting reduced muscle performance, and dysregulated gene expression underscores the complexity of the pathological mechanisms underlying HMERF. Beyond advancing our understanding of disease mechanisms, this work highlights the value of genome editing in animal models to dissect the molecular basis of human genetic disorders and underscores the potential of medaka fish as a powerful and versatile experimental system. Compared to zebrafish, medaka possess a smaller genome and lack duplication of many genes, including titin, enabling more straightforward and genetically interpretable genome editing approaches. Importantly, the suitability of medaka for drug screening applications positions this model as a promising platform for future studies aimed at delineating the pathogenic cascade and identifying therapeutic targets for neuromuscular disorders. Declarations Ethics approval and consent to participate This study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). All studies on fish larvae were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health, Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experimentation (article 31; D.L. 26/2014; protocol number: 0016304-21/07/2020-DGSAF-MDS-P). Consent for publication: Not applicable Competing interests: No conflict of interest to declare Availability of data and materials: All data generated in this study are available in the manuscript or from the authors upon reasonable request. Funding This study was funded by the European Commission under the HORIZON EUROPE Framework Program (grant approval #101080874 to MS), the Research Council of Finland (#351510 to BU, #339437 to MS), Samfundet Folkhälsan (to MS and BU), the Sigrid Jusélius Foundation (#230217 to MS and BU), European Joint Program on Rare Diseases (‘Improved diagnostic output in large sarcomeric genes IDOLS-G’ EJPRD19-126 to BU and ML), AFM-Téléthon (#25116 BU, IC, ML and VN), Recovery plan for Europe (Next Generation EU program) (DM 1557 11.10.2022, Investment PE8–Project Age-It, to ML), Italian Ministry of University and Research (MUR, PRIN2022-PNRR, P2022XPT32, CUP: B53D23033280001 to ML) and the Telethon Foundation (Program for Undiagnosed Diseases-TUDP #GSP1500124 to VC and VN). Authors' contributions Conceptualization: VC, MS, JS, BJ, VN, IC, ML. Experimental data preparation and analysis: VC. RNA-Sequencing: VC, SNG. TEM experiments: VC, FGS, EP. Mechanical experiments: VC, MM, ML, IM, MR, MC. Locomotor experiments: VC, AS. Manuscript writing and editing: VC, SNG, MS, ML. Manuscript final review and editing: alla authors. Acknowledgments We thank the staff from the Medaka facility and Conte’s lab for their help with fish husbandry and helpful discussion during the preparation of the manuscript. We thank Ylenia Monfregola for her help in the design of guide RNAs and donor ssRNA. We also thank Annalaura Torella for the help in managing the project and for her critical review of the manuscript draft. Finally, we thank Graziano Fiorito and Giovanni Annona for the support with the swimming behavioral tests using DanioVision. References Bang ML, Centner T, Fornoff F, Geach AJ, Gotthardt M, McNabb M, Witt CC, Labeit D, Gregorio CC, Granzier H, Labeit S (2001) The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ Res 89:1065–1072. doi: 10.1161/hh2301.100981 Dobin A, Gingeras TR (2016) Optimizing RNA-Seq Mapping with STAR. Methods Mol Biol 1415:245–262. doi: 10.1007/978-1-4939-3572-7_13 Ehler E, Gautel M (2008) The sarcomere and sarcomerogenesis. Adv Exp Med Biol 642:1–14. doi: 10.1007/978-0-387-84847-1_1 Ghaoui R, Palmio J, Brewer J, Lek M, Needham M, Evilä A, Hackman P, Jonson P-H, Penttilä S, Vihola A, Huovinen S, Lindfors M, Davis RL, Waddell L, Kaur S, Yiannikas C, North K, Clarke N, MacArthur DG, Sue CM, Udd B (2016) Mutations in HSPB8 causing a new phenotype of distal myopathy and motor neuropathy. Neurology 86:391–398. doi: 10.1212/WNL.0000000000002324 Gohlke J, Lindqvist J, Hourani Z, Heintzman S, Tonino P, Elsheikh B, Morales A, Vatta M, Burghes A, Granzier H, Roggenbuck J (2024) Pathomechanisms of Monoallelic variants in TTN causing skeletal muscle disease. Hum Mol Genet 33:2003–2023. doi: 10.1093/hmg/ddae136 Guo W, Schafer S, Greaser ML, Radke MH, Liss M, Govindarajan T, Maatz H, Schulz H, Li S, Parrish AM, Dauksaite V, Vakeel P, Klaassen S, Gerull B, Thierfelder L, Regitz-Zagrosek V, Hacker TA, Saupe KW, Dec GW, Ellinor PT, MacRae CA, Spallek B, Fischer R, Perrot A, Özcelik C, Saar K, Hubner N, Gotthardt M (2012) RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing. Nat Med 18:766–773. doi: 10.1038/nm.2693 Guo W, Zhu C, Yin Z, Wang Q, Sun M, Cao H, Greaser ML (2018) Splicing Factor RBM20 Regulates Transcriptional Network of Titin Associated and Calcium Handling Genes in The Heart. Int J Biol Sci 14:369–380. doi: 10.7150/ijbs.24117 Higashikuse Y, Mittal N, Arimura T, Yoon SH, Oda M, Enomoto H, Kaneda R, Hattori F, Suzuki T, Kawakami A, Gasch A, Furukawa T, Labeit S, Fukuda K, Kimura A, Makino S (2019) Perturbation of the titin/MURF1 signaling complex is associated with hypertrophic cardiomyopathy in a fish model and in human patients. Dis Model Mech 12:dmm041103. doi: 10.1242/dmm.041103 Hill AV (1938) The heat of shortening and the dynamic constants of muscle. Proc R Soc Lond B 126:136–195. doi: 10.1098/rspb.1938.0050 Iwamatsu T (2004) Stages of normal development in the medaka Oryzias latipes. Mech Dev 121:605–618. doi: 10.1016/j.mod.2004.03.012 Kolberg L, Raudvere U, Kuzmin I, Vilo J, Peterson H (2020) gprofiler2 -- an R package for gene list functional enrichment analysis and namespace conversion toolset g:Profiler. F1000Res 9:ELIXIR-709. doi: 10.12688/f1000research.24956.2 Krüger M, Kötter S (2016) Titin, a Central Mediator for Hypertrophic Signaling, Exercise-Induced Mechanosignaling and Skeletal Muscle Remodeling. Front Physiol 7:76. doi: 10.3389/fphys.2016.00076 Lange S, Xiang F, Yakovenko A, Vihola A, Hackman P, Rostkova E, Kristensen J, Brandmeier B, Franzen G, Hedberg B, Gunnarsson LG, Hughes SM, Marchand S, Sejersen T, Richard I, Edström L, Ehler E, Udd B, Gautel M (2005) The kinase domain of titin controls muscle gene expression and protein turnover. Science 308:1599–1603. doi: 10.1126/science.1110463 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550. doi: 10.1186/s13059-014-0550-8 Marcello M, Cetrangolo V, Morotti I, Squarci C, Caremani M, Reconditi M, Savarese M, Bianco P, Piazzesi G, Lombardi V, Udd B, Conte I, Nigro V, Linari M (2024) Sarcomere level mechanics of the fast skeletal muscle of the medaka fish larva. Am J Physiol Cell Physiol 326:C632–C644. doi: 10.1152/ajpcell.00530.2023 Marcello M, Cetrangolo V, Savarese M, Udd B (2022) Use of animal models to understand titin physiology and pathology. J Cell Mol Med 26:5103–5112. doi: 10.1111/jcmm.17533 Murakami Y, Futamata R, Horibe T, Ueda K, Kinoshita M (2020) CRISPR/Cas9 nickase-mediated efficient and seamless knock-in of lethal genes in the medaka fish Oryzias latipes. Dev Growth Differ 62:554–567. doi: 10.1111/dgd.12700 Palmio J, Evilä A, Chapon F, Tasca G, Xiang F, Brådvik B, Eymard B, Echaniz-Laguna A, Laporte J, Kärppä M, Mahjneh I, Quinlivan R, Laforêt P, Damian M, Berardo A, Taratuto AL, Bueri JA, Tommiska J, Raivio T, Tuerk M, Gölitz P, Chevessier F, Sewry C, Norwood F, Hedberg C, Schröder R, Edström L, Oldfors A, Hackman P, Udd B (2014) Hereditary myopathy with early respiratory failure: occurrence in various populations. J Neurol Neurosurg Psychiatry 85:345–353. doi: 10.1136/jnnp-2013-304965 Palmio J, Leonard-Louis S, Sacconi S, Savarese M, Penttilä S, Semmler A-L, Kress W, Mozaffar T, Lai T, Stojkovic T, Berardo A, Reisin R, Attarian S, Urtizberea A, Cobo AM, Maggi L, Kurbatov S, Nikitin S, Milisenda JC, Fatehi F, Raimondi M, Silveira F, Hackman P, Claeys KG, Udd B (2019) Expanding the importance of HMERF titinopathy: new mutations and clinical aspects. J Neurol 266:680–690. doi: 10.1007/s00415-019-09187-2 Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I, Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y, Bobe J (2016) Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database. BMC Genomics 17:368. doi: 10.1186/s12864-016-2709-z Qian F-Y, Guo Y-D, Zu J, Zhang J-H, Zheng Y-M, Abdoulaye IA, Pan Z-H, Xie C-M, Gao H-C, Zhang Z-J (2021) A novel recessive mutation affecting DNAJB6a causes myofibrillar myopathy. Acta Neuropathol Commun 9:23. doi: 10.1186/s40478-020-01046-w Rees M, Nikoopour R, Fukuzawa A, Kho AL, Fernandez-Garcia MA, Wraige E, Bodi I, Deshpande C, Özdemir Ö, Daimagüler H-S, Pfuhl M, Holt M, Brandmeier B, Grover S, Fluss J, Longman C, Farrugia ME, Matthews E, Hanna M, Muntoni F, Sarkozy A, Phadke R, Quinlivan R, Oates EC, Schröder R, Thiel C, Reimann J, Voermans N, Erasmus C, Kamsteeg E-J, Konersman C, Grosmann C, McKee S, Tirupathi S, Moore SA, Wilichowski E, Hobbiebrunken E, Dekomien G, Richard I, Van den Bergh P, Domínguez-González C, Cirak S, Ferreiro A, Jungbluth H, Gautel M (2021) Making sense of missense variants in TTN-related congenital myopathies. Acta Neuropathol 141:431–453. doi: 10.1007/s00401-020-02257-0 Sarparanta J, Jonson PH, Golzio C, Sandell S, Luque H, Screen M, McDonald K, Stajich JM, Mahjneh I, Vihola A, Raheem O, Penttilä S, Lehtinen S, Huovinen S, Palmio J, Tasca G, Ricci E, Hackman P, Hauser M, Katsanis N, Udd B (2012) Mutations affecting the cytoplasmic functions of the co-chaperone DNAJB6 cause limb-girdle muscular dystrophy. Nat Genet 44:450–455, S1-2. doi: 10.1038/ng.1103 Savarese M, Sarparanta J, Vihola A, Udd B, Hackman P (2016) Increasing Role of Titin Mutations in Neuromuscular Disorders. J Neuromuscul Dis 3:293–308. doi: 10.3233/JND-160158 Selcen D, Muntoni F, Burton BK, Pegoraro E, Sewry C, Bite AV, Engel AG (2009) Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Ann Neurol 65:83–89. doi: 10.1002/ana.21553 Steele HE, Harris E, Barresi R, Marsh J, Beattie A, Bourke JP, Straub V, Chinnery PF (2016) Cardiac involvement in hereditary myopathy with early respiratory failure: A cohort study. Neurology 87:1031–1035. doi: 10.1212/WNL.0000000000003064 Steffen LS, Guyon JR, Vogel ED, Howell MH, Zhou Y, Weber GJ, Zon LI, Kunkel LM (2007) The zebrafish runzel muscular dystrophy is linked to the titin gene. Dev Biol 309:180–192. doi: 10.1016/j.ydbio.2007.06.015 Takeda H, Shimada A (2010) The art of medaka genetics and genomics: what makes them so unique? Annu Rev Genet 44:217–241. doi: 10.1146/annurev-genet-051710-151001 Tasca G, Udd B (2018) Hereditary myopathy with early respiratory failure (HMERF): Still rare, but common enough. Neuromuscul Disord 28:268–276. doi: 10.1016/j.nmd.2017.12.002 Töpf A, Cox D, Zaharieva IT, Di Leo V, Sarparanta J, Jonson PH, Sealy IM, Smolnikov A, White RJ, Vihola A, Savarese M, Merteroglu M, Wali N, Laricchia KM, Venturini C, Vroling B, Stenton SL, Cummings BB, Harris E, Marini-Bettolo C, Diaz-Manera J, Henderson M, Barresi R, Duff J, England EM, Patrick J, Al-Husayni S, Biancalana V, Beggs AH, Bodi I, Bommireddipalli S, Bönnemann CG, Cairns A, Chiew M-T, Claeys KG, Cooper ST, Davis MR, Donkervoort S, Erasmus CE, Fassad MR, Genetti CA, Grosmann C, Jungbluth H, Kamsteeg E-J, Lornage X, Löscher WN, Malfatti E, Manzur A, Martí P, Mongini TE, Muelas N, Nishikawa A, O’Donnell-Luria A, Ogonuki N, O’Grady GL, O’Heir E, Paquay S, Phadke R, Pletcher BA, Romero NB, Schouten M, Shah S, Smuts I, Sznajer Y, Tasca G, Taylor RW, Tuite A, Van den Bergh P, VanNoy G, Voermans NC, Wanschitz JV, Wraige E, Yoshimura K, Oates EC, Nakagawa O, Nishino I, Laporte J, Vilchez JJ, MacArthur DG, Sarkozy A, Cordell HJ, Udd B, Busch-Nentwich EM, Muntoni F, Straub V (2024) Digenic inheritance involving a muscle-specific protein kinase and the giant titin protein causes a skeletal muscle myopathy. Nat Genet 56:395–407. doi: 10.1038/s41588-023-01651-0 Tskhovrebova L, Trinick J (2010) Roles of titin in the structure and elasticity of the sarcomere. J Biomed Biotechnol 2010:612482. doi: 10.1155/2010/612482 Van Den Hoogenhof MMG, Beqqali A, Amin AS, Van Der Made I, Aufiero S, Khan MAF, Schumacher CA, Jansweijer JA, Van Spaendonck-Zwarts KY, Remme CA, Backs J, Verkerk AO, Baartscheer A, Pinto YM, Creemers EE (2018) RBM20 Mutations Induce an Arrhythmogenic Dilated Cardiomyopathy Related to Disturbed Calcium Handling. Circulation 138:1330–1342. doi: 10.1161/CIRCULATIONAHA.117.031947 Weihl CC, Töpf A, Bengoechea R, Duff J, Charlton R, Garcia SK, Domínguez-González C, Alsaman A, Hernández-Laín A, Franco LV, Sanchez MEP, Beecroft SJ, Goullee H, Daw J, Bhadra A, True H, Inoue M, Findlay AR, Laing N, Olivé M, Ravenscroft G, Straub V (2023) Loss of function variants in DNAJB4 cause a myopathy with early respiratory failure. Acta Neuropathol 145:127–143. doi: 10.1007/s00401-022-02510-8 Xu X, Meiler SE, Zhong TP, Mohideen M, Crossley DA, Burggren WW, Fishman MC (2002) Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat Genet 30:205–209. doi: 10.1038/ng816 Zhu P, Li J, Yan F, Islam S, Lin X, Xu X (2024) Allelic heterogeneity of TTNtv dilated cardiomyopathy can be modeled in adult zebrafish. JCI Insight 9:e175501. doi: 10.1172/jci.insight.175501 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8840201","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":589360737,"identity":"5149bef9-51be-4056-97dc-71d252ae1ab8","order_by":0,"name":"Viviana Cetrangolo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYHAD5gaGDwwSYOYBgoohKhgbGGckQLUQ1APTwsyTgCKCHRgcYH74+OMeuzx598bGx7Y/LOz6xQ4wHv6AVwubscGBZ8nFhmcONhvnJEgkz5ydgN9hkg08bBIHDjAnbpyR2CYN0mJwm7AW9h8HDtRDtFgAtdgT0sLPwMMGVHE4cb4EUAtDgoSdgTQhLcxsxhJnDhxP3MBzsNmwJ00iQeJ2YsOBM3i0sLE3P/xQcaA6cX5788EHP2zq7PlnJx/+UIFHCwMzlDaAuiWxARhB+DQggDxUnT1xykfBKBgFo2AkAQA24lRdhv2SXwAAAABJRU5ErkJggg==","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":true,"prefix":"","firstName":"Viviana","middleName":"","lastName":"Cetrangolo","suffix":""},{"id":589360739,"identity":"6a4c47d9-ecb9-4c4b-8295-a8eef1e7166e","order_by":1,"name":"Swethaa Natraj Gayathri","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Swethaa","middleName":"Natraj","lastName":"Gayathri","suffix":""},{"id":589360742,"identity":"609abddb-9e1a-4f2e-b9bb-a1c15fe44393","order_by":2,"name":"Matteo Marcello","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Matteo","middleName":"","lastName":"Marcello","suffix":""},{"id":589360744,"identity":"443c8244-5160-427c-8b76-d4383772caaf","order_by":3,"name":"Francesco Giuseppe Salierno","email":"","orcid":"","institution":"Telethon Institute of Genetics And Medicine","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"Giuseppe","lastName":"Salierno","suffix":""},{"id":589360745,"identity":"be3eded7-71cf-445e-bfec-2291fc70737c","order_by":4,"name":"Elena Polishchuk","email":"","orcid":"","institution":"Telethon Institute of Genetics And Medicine","correspondingAuthor":false,"prefix":"","firstName":"Elena","middleName":"","lastName":"Polishchuk","suffix":""},{"id":589360746,"identity":"d542d1db-a8d1-4230-adc6-4ff4cd9eca5e","order_by":5,"name":"Marco Caremani","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Caremani","suffix":""},{"id":589360747,"identity":"c0c5ed4d-3421-47c6-b904-b66043e4b96b","order_by":6,"name":"Ilaria Morotti","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Ilaria","middleName":"","lastName":"Morotti","suffix":""},{"id":589360748,"identity":"6fd06297-e2dc-41d7-8a83-4eac98fa47df","order_by":7,"name":"Massimo Reconditi","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Massimo","middleName":"","lastName":"Reconditi","suffix":""},{"id":589360749,"identity":"00cc23f0-45ea-4fd5-b57a-7b7e3c4e7eb2","order_by":8,"name":"Andrea Sommella","email":"","orcid":"","institution":"Stazione Zoologica Anton Dohrn","correspondingAuthor":false,"prefix":"","firstName":"Andrea","middleName":"","lastName":"Sommella","suffix":""},{"id":589360750,"identity":"1f7dc3fc-1bd0-4523-ae08-e413865a64d3","order_by":9,"name":"Jaakko Sarparanta","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Jaakko","middleName":"","lastName":"Sarparanta","suffix":""},{"id":589360751,"identity":"ec2be7c2-1dc0-4b2a-bf25-edb65c3df731","order_by":10,"name":"Marco Linari","email":"","orcid":"","institution":"University of Florence","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Linari","suffix":""},{"id":589360752,"identity":"18809e92-251b-4a5b-af25-161cce8e0b74","order_by":11,"name":"Ivan Conte","email":"","orcid":"","institution":"University of Naples Federico II","correspondingAuthor":false,"prefix":"","firstName":"Ivan","middleName":"","lastName":"Conte","suffix":""},{"id":589360753,"identity":"299bd147-7a1a-4cb3-b7b7-66c0dfd0d044","order_by":12,"name":"Vincenzo Nigro","email":"","orcid":"","institution":"University of Campania \"Luigi Vanvitelli\"","correspondingAuthor":false,"prefix":"","firstName":"Vincenzo","middleName":"","lastName":"Nigro","suffix":""},{"id":589360754,"identity":"3b644fd9-0655-4f60-9204-697727e8f09e","order_by":13,"name":"Marco Savarese","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Marco","middleName":"","lastName":"Savarese","suffix":""},{"id":589360755,"identity":"98d00f15-c427-4956-8028-943866f7d4dd","order_by":14,"name":"Bjarne Udd","email":"","orcid":"","institution":"Folkhälsans Forskningscentrum","correspondingAuthor":false,"prefix":"","firstName":"Bjarne","middleName":"","lastName":"Udd","suffix":""}],"badges":[],"createdAt":"2026-02-10 11:26:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8840201/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8840201/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103049478,"identity":"2e872cbe-7ed2-423b-83e6-e48e42333bdb","added_by":"auto","created_at":"2026-02-20 07:41:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":177772,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea\u003c/strong\u003e Top: Schematic representation of the sarcomere and titin localization. Middle: Titin protein (in purple) spans in the half-sarcomere, connecting the end of actin (cerulean) with the tip of myosin (violet) in the M-band. Bottom: Titin is represented in purple with some highlighted regions: the N2B and N2A elements, the PEVK Proline, Glutamate, Valine, Lysine-rich region and the FN3-119 domain close to the M-band. Created in BioRender. Nigro, V. (2025) \u003ca href=\"https://biorender.com/bzrm1fr\"\u003ehttps://BioRender.com/\u003c/a\u003e\u003ca href=\"https://biorender.com/bzrm1fr\"\u003ebzrm1fr\u003c/a\u003e. \u003cstrong\u003eb\u003c/strong\u003e In the green square the 12 pathogenic variants associated with HMERF. The variant p. C31712R (in bold) is the most common variant modeled in this study in medaka fish. The image is created with Biorender.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/67b5ee9fd1fc8d7bbeb2cb67.png"},{"id":102989883,"identity":"241e4aed-3b1a-42c3-bf9d-7a609e90014c","added_by":"auto","created_at":"2026-02-19 11:16:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":435200,"visible":true,"origin":"","legend":"\u003cp\u003eGeneration of the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e\u0026nbsp;knock-in model. \u003cstrong\u003ea\u003c/strong\u003e Amino acid sequences alignment of the FN3-119 domain. In pink, the cysteine residues that are evolutionary conserved among vertebrates (Hs \u003cem\u003eHomo sapiens\u003c/em\u003e, Mm \u003cem\u003eMus musculus\u003c/em\u003e, Dr \u003cem\u003eDanio rerio\u003c/em\u003e, Ol \u003cem\u003eOryzias latipes)\u003c/em\u003e. \u003cstrong\u003eb\u003c/strong\u003e Wild type and mutated nucleotide sequence of the medaka exon 206 (in turquoise), corresponding to human exon 344. \u003cstrong\u003ec \u003c/strong\u003eElectropherograms showing the sequences of the F\u003csub\u003e2\u003c/sub\u003e genotypes. The red arrow indicates the C\u0026gt;T mutation, while the asterisk indicates a silent mutation introduced in the donor DNA to avoid Cas9 cutting. \u003cstrong\u003ed \u003c/strong\u003eComparison of the three phenotypes: whole larval body on the left and their hearts on the right. Scalebar = 1mm.\u003cstrong\u003e e \u003c/strong\u003eSurvival rates of the three genotypes at 15 days post hatch.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/f8fdd5c0a46edf1bd67aad9b.png"},{"id":103049762,"identity":"c3d86a70-ec02-4c11-90f7-add04b195799","added_by":"auto","created_at":"2026-02-20 07:45:43","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":535131,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R \u003c/sup\u003elarvae showed disorganized muscle fibers and defective skeletal muscles. \u003cstrong\u003ea\u003c/strong\u003e Histological analysis of the abdominal section of different genotypes showed alteration in muscle tissue in the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R \u003c/sup\u003elarvae. Scale bars represent 75 μm. \u003cstrong\u003eb\u003c/strong\u003e Upper image: quantification of the number of fibers of the three genotypes. Mean values (±SEM) of histological sections (n=3) are shown for each body sections (abdomen, centre and tail) of the three genotypes. Lower: lateral view of the larva. Scale bar= 1mm. \u003cstrong\u003ec\u003c/strong\u003e Immunostainings using antibodies against titin, myosin (F59) and a-actinin showing defective skeletal muscles in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+ \u003c/sup\u003eand \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e\u0026nbsp;larvae. Nuclei are stained with DAPI (magenta). Scale bar= 50 μm. \u003cstrong\u003ed\u003c/strong\u003e Representative trasmission electron microscopy (TEM) of longitudinal sections of the three genotypes showing the gradual degradation of the sarcomere structure. Scale bar= 800 nm. \u003cstrong\u003ee\u003c/strong\u003e Sarcomere length measurement showed shorter sarcomere length in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e\u0026nbsp;larvae. Dots represent individual values of 3 biological replicates (±SD) for each phenotype. Asterisks indicate statistical significance: (*, p \u0026lt;0.02; **, p \u0026lt; 0.002; ***, p \u0026lt;0.001 and ****, p \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/a651bacd7c9814788a9e2969.png"},{"id":102989887,"identity":"fbf2b796-9a35-4e5d-ad5a-46b434c4c15c","added_by":"auto","created_at":"2026-02-19 11:16:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":170091,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic analysis of the mutant medaka larvae. \u003cstrong\u003ea\u003c/strong\u003e Principal Component Analysis (PCA) shows separate clustering of the samples’ genotypes.\u003cstrong\u003e b \u003c/strong\u003eVolcano plot shows the differential expression of genes in the three genotypes. Red dots refer to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae, green dots refer to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae and light blue dots refer the genes found commonly dysregulated among the two siblings. The labeled dysregulated genes are the ones involved in autophagy process. \u003cstrong\u003ec\u003c/strong\u003e Pathway analysis reveals enriched GO and KEGG terms for \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e compared to \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. \u003cstrong\u003ed\u003c/strong\u003e Clustered heatmap of differential gene expression across the three genotypes.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/7d87809d485127b7f4c40d74.png"},{"id":103050055,"identity":"ae04127c-63e2-4bb2-9182-60a4cbe274fc","added_by":"auto","created_at":"2026-02-20 07:47:53","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":245848,"visible":true,"origin":"","legend":"\u003cp\u003eLocomotor analysis of mutant medaka larvae. \u003cstrong\u003ea\u003c/strong\u003e Representative individual traces of locomotor activity of medaka larvae in the 24-wells. \u003cstrong\u003eb\u003c/strong\u003e Time (seconds ± SD) spent moving and not moving (resting time) of the larvae.\u003cstrong\u003e c\u003c/strong\u003e Comparison of the movement time (seconds ± SD) between wild type and homozygous. Asterisks indicate statistical significance ( **, p \u0026lt; 0.01; ***, p \u0026lt;0.001).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/acbc559b178cc2ec00a1171a.png"},{"id":103049832,"identity":"0411492b-781e-4b5b-87cb-f790d7e792da","added_by":"auto","created_at":"2026-02-20 07:46:43","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":112078,"visible":true,"origin":"","legend":"\u003cp\u003eMechanical responses from the tail muscle of \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (black traces, symbols and lines) and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae (gray traces, symbols and lines). \u003cstrong\u003ea\u003c/strong\u003e Force traces following a train of stimuli at 300 Hz. The line below force traces indicates the stimulation frequency. \u003cstrong\u003eb\u003c/strong\u003e Same traces as in \u003cstrong\u003ea\u003c/strong\u003e on a faster time scale after normalization for the isometric force in each condition; \u003cem\u003el\u003c/em\u003e\u003csub\u003eR\u003c/sub\u003e, latency of force rise measured from the beginning of the stimulation; \u003cem\u003et\u003c/em\u003e\u003csub\u003e1/2,D\u003c/sub\u003e, time from the start of force rise to one-half \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e during force development. The arrow indicates the stimulus start. \u003cstrong\u003ec \u003c/strong\u003eForce-velocity relations. Lines are the hyperbolic Hill equations (see Methods) fitted to the data points (symbols). The estimated parameters of the Hill equation are: \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, \u003cem\u003ea\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, 0.66 ± 0.09; \u003cem\u003eb\u003c/em\u003e, 15.43 ± 2.37 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s; \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, 23.25 ± 0.53 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s; \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e, \u003cem\u003ea\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, 1.13 ± 0.66; \u003cem\u003eb\u003c/em\u003e, 12.52 ± 7.51 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s; \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, 11.49 ± 0.84 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s. Inset, records of force (top traces) and motor length change (bottom traces) during after-loaded contraction at 0.5 \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e. D. Force-power relation calculated as the product \u003cem\u003eT\u003c/em\u003e × \u003cem\u003eV\u003c/em\u003e from data (symbols and lines) reported in \u003cstrong\u003ec\u003c/strong\u003e. In \u003cstrong\u003ea\u003c/strong\u003e sarcomere length: oltitin\u003csup\u003e+/+\u003c/sup\u003e, 2.05 mm; o\u003cem\u003eltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e, 2.02 mm. In \u003cstrong\u003ec \u003c/strong\u003eand \u003cstrong\u003ed\u003c/strong\u003e, force is normalized for the isometric force in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+ \u003c/sup\u003egenotype (\u003cem\u003eT\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0,\u003c/sub\u003e\u003csub\u003e\u003cem\u003eoltitin\u003c/em\u003e\u003c/sub\u003e\u003csup\u003e+/+\u003c/sup\u003e). Temperature, 30°C.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/6016fc595d1310fd602572b3.png"},{"id":103507986,"identity":"58c4c589-d933-480d-87e3-ad6e2a0012fc","added_by":"auto","created_at":"2026-02-26 13:46:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2587079,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8840201/v1/99180f35-77de-4ef1-a94b-0042993104e5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eA Titin Knock-in model for Hereditary Myopathy with Early Respiratory Failure\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTitin (TTN) is one of the largest proteins known, composed of more than 35,000 amino acids in human, reaching a length of over 1 µm and spanning a half-sarcomere from the Z-disk to the M-band. It has a key role in the architecture of the sarcomeres in striated heart and skeletal muscles. Acting as a molecular spring, titin protein contributes to the passive tension of the muscle and regulates sarcomere length. It also acts as scaffold protein, helping the myofibrillar assembly during myogenesis and as a mechanosensor, regulating transcription and various signaling pathways [3, 31]. The titin filament contains 132 fibronectin-3 (FN3) domains and more than 169 immunoglobulin-like domains interspaced with several unique sequence (US) regions, a PEVK (Proline, Glutamate, Valine, Lysine- rich) region in the I-band and a pseudokinase domain TK (titin kinase) in the M-band (Fig. 1a) [1, 12, 13]. The \u003cem\u003eTitin\u003c/em\u003e gene is 300 kb long with 364 exons (363 coding) and a predicted maximal full-length transcript of more than 100 kb [22]. Because of its key functions, \u003cem\u003etitin\u003c/em\u003e variants have an enormous impact on human health. Pathogenic variants in the\u003cem\u003e\u0026nbsp;TTN\u003c/em\u003e human gene have been associated with several cardiomyopathies and a wide range of dominant and recessive skeletal muscle diseases with or without cardiac involvement [24]. Among these, an autosomal dominant disease, the Hereditary Myopathy with Early Respiratory Failure (HMERF, OMIM#603689) is caused by missense variants within exon 344, encoding the FN3 domain FN3-119 (also called A150 domain) in the A-band region (Fig. 1b) [18, 19, 29]. Typical pathological features of HMERF patients are early respiratory failure, proximodistal muscle weakness and muscle histopathology showing cytoplasmatic bodies (CB) with subsarcolemmal localization, myofibrillar disintegration and rimmed vacuoles (RV) [19, 29]. The most common causative variant c.95134T\u0026gt;C p.(C31712R) shows a fully penetrant autosomal dominant inheritance. While clinical, phenotypical, and genetic pictures are nowadays well established, the molecular pathological mechanism of HMERF-causing mutations has not yet been identified. The conspicuous number of variants located in the FN3-119 domain indicates a mutational hotspot in this region, suggesting a mechanism related to a highly specific function of this domain. Therefore, it seems necessary to elucidate the molecular and pathogenetic mechanisms underlying variations in this specific mutational hotspot domain to develop therapies for HMERF patients.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSeveral animal models have been developed for \u003cem\u003eTitin\u003c/em\u003e variants associated with titinopathies in general. Vertebrate models, including zebrafish and mice, have been reported for muscular dystrophies and cardiomyopathies [16]. In addition, another teleost fish model, the medaka fish (\u003cem\u003eOryzias latipes\u003c/em\u003e)\u003cem\u003e,\u0026nbsp;\u003c/em\u003ehas been reported for the hypertrophic cardiomyopathy (HCM) caused by titin missense variants in an Ig domain located in the M-band/A-band transition zone [8]. This cardiovascular mutant medaka model, named \u003cem\u003enon-spring heart (nsh)\u003c/em\u003e, showed diastolic dysfunction and hypertrophic myocardium. The \u003cem\u003ensh\u0026nbsp;\u003c/em\u003ehomozygotes had fewer myofibrils and disrupted sarcomeres, while the heterozygotes showed M-band disassembly in myofibrils. This pioneering study on medaka revealed a novel mechanism underlying the pathogenesis of HCM and highlighted the medaka fish as a promising new model to study the molecular mechanisms of titinopathies.\u003c/p\u003e\n\u003cp\u003eThe medaka fish \u003cem\u003eOryzias latipes\u003c/em\u003e is an emerging alternative fish model, successfully used for genetic, developmental, ecotoxicology and mechanical studies [16, 28]. The effectiveness of genome editing techniques [17] and the transparent embryos and larvae makes it an ideal candidate model to investigate neuromuscular disorders. Notably, medaka has a small genome (800 mb) and, in contrast with zebrafish, it has only one copy of the \u003cem\u003eTitin\u003c/em\u003e gene due to a lower degree of genome duplication [20]. Although mouse and fish models have been developed for titin mutations associated with cardiomyopathies and skeletal muscle diseases, no model has ever been generated for HMERF disease. Here, we focused on the generation and characterization of the medaka fish as the first vertebrate model for HMERF disease. Using CRISPR/Cas9 we generated medaka knock-in mutants carrying a missense variant corresponding to the HMERF- causing variant c.95134T\u0026gt;C p.(C31712R). The analysis of these mutants revealed the impairment of muscles’ structure and function, with homozygous larvae exhibiting a more severe phenotype compared to their heterozygous siblings. Transcriptome analysis through RNA-Sequencing revealed significant dysregulation of extracellular matrix organization and metabolic processes, that are suggestive of exacerbated muscle damage and dysfunction. Moreover, genes with key roles in autophagy, cell homeostasis and filament organization exhibited a higher level of dysregulation in homozygous larvae than compared to wild type larvae.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, this is the first study to model an HMERF variant in a vertebrate system, paving the way for a refined analysis of the pathomechanisms and, thereby, new potential therapeutic approaches. Our study also confirms the potential of medaka as a promising new model for studying titinopathies.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMedaka fish husbandry and embryo maintenance\u003c/h2\u003e \u003cp\u003eMedaka fish (\u003cem\u003eOryzias latipes\u003c/em\u003e) from the Cab inbred strain were used throughout the study and maintained in the standard conditions of 12h/12h light/dark at 27\u0026deg;C. Embryos were staged according to Iwamatsu [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. All studies on fish larvae were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health, Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experimentation (article 31; D.L. 26/2014; protocol number: 0016304-21/07/2020-DGSAF-MDS-P).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCRISPR/Cas9 mutagenesis and generation of the founder lines\u003c/h3\u003e\n\u003cp\u003eA single guide RNA (sgRNA) and single strand donor DNA (ssDNA) were designed in-house at the TIGEM Institute (Pozzuoli, Italy). The sgRNA (ATGCTACCTTCACATACTCC) was 20 bp with a terminal NGG (PAM sequence) and with a single genome match to medaka exon 206 (corresponding to the human exon 344). SgRNA was ordered from Genewiz company (from Azenta Life Sciences, Germany). A custom donor ssDNA was designed to carry the HMERF missense variant (T\u0026thinsp;\u0026gt;\u0026thinsp;C) together with silent mutations to inhibit the Cas9 cutting within the inserted donor, and homology arms to increase its specificity for the correct sequence pairing, and ordered from Synthego company (California, US). A solution of mRNA Cas9 (200 ng/ml), sgRNA (20 ng/ml) and donor ssDNA (10 ng/ml) was prepared and injected in one-cell stage embryos. After hatching, larvae were genotyped by genomic DNA extraction and sequencing of caudal fins. Each larva was anesthetized with 0,2% Tricaine in fish medium (Yamamoto: 0.75% NaCl, 0.02% KCl, 0.02% CaCl\u003csub\u003e2\u003c/sub\u003e, 0.002% NaHCO\u003csub\u003e3\u003c/sub\u003e) and a piece of their tail was cut. The tail pieces were than lysed with the lysis buffer (Tris-HCl 1M, IGEPAL\u0026reg; CA-630, Tween20) and proteinase K 20 mg/mL (Sigma-Aldrich) overnight at 56\u0026deg;C. After the genomic DNA extraction, single larvae tails were genotyped by PCR amplification (custom primers RNAC2Fw-AGTACTCGGTACGTAGCC and RNAC2Rv-TTAAGTCTGTTGGTGTCTCG). PCR products were then sequenced using the same primers to determine the presence of the CRISPR/Cas9 induced mosaicism in larvae. F\u003csub\u003e0\u003c/sub\u003e generation fish from the injected embryos and F\u003csub\u003e1\u003c/sub\u003e heterozygous fish were then selected and crossed to generate F\u003csub\u003e2\u003c/sub\u003e populations. Each generation was again genotyped through PCR amplification on genomic DNA extracted from the caudal fin, to identify heterozygous and homozygous individuals.\u003c/p\u003e\n\u003ch3\u003eHematoxylin and Eosin Staining and fiber number analysis\u003c/h3\u003e\n\u003cp\u003eFor Hematoxylin and Eosin analysis, larvae were fixed in Carnoy solution (ethanol 60%, chloroform 30%, glacial acetic acid 10%) at room temperature (RT) for 4 h or at 4\u0026deg;C overnight, rocking. Samples were then transferred in ethanol 70%, processed and finally embedded in paraffin blocks, with the correct orientation to obtain coronal sections of the myotomes. Sections of 5\u0026ndash;6 \u0026micro;m were cut with a microtome (Leica RM2245) and mounted on glass slides. Histological sections were then stained with Harris hematoxylin and alcoholic eosin Y 0.1% to visualize, respectively, nuclei and cytoplasmatic components. Fiber counting was done with ImageJ2-Fiji (version 2.14.0; RRID:SCR_003070). Fibers of different histological sections (n\u0026thinsp;=\u0026thinsp;3) were counted at three different point along the larval body (abdomen, center and tail). The results and statistical analyses (2way ANOVA-Multiple Comparison) were plotted with GraphPad Prism (RRID:SCR_002798) 9.0.\u003c/p\u003e\n\u003ch3\u003eImmunostainings on cryosections\u003c/h3\u003e\n\u003cp\u003eStage 40 larvae were anesthetized and fixed by incubation in 4% paraformaldehyde (PFA) in PBS1\u0026times; for 2 h at room temperature (RT). Samples were rinsed three times with PTW1\u0026times; (PBS1\u0026times;, 0.1% Tween20, pH 7.3), incubated overnight in 15% sucrose/PTW1\u0026times; at 4\u0026deg;C, and then again incubated overnight in 30% sucrose/PTW1\u0026times; at 4\u0026deg;C. Finally, larvae were included in gelatin/sucrose blocks and preserved frozen at -20\u0026deg;C. Frozen blocks were then cut with cryostat in 7 \u0026micro;m sections and mounted on glass slides. Larval cryosections were rehydrated in PBS1\u0026times; for 5 minutes, washed 3 times in PTW for 20 min, and incubated with blocking solution (BSA 5% in PTW filtered or Normal Goat Serum 5%, depending on the primary antibody) for 2h at RT. Cryosections then were incubated with primary antibodies (anti-titin T11-1:500 T9030 Sigma, anti-myosin F59 1:20 Hybridoma Bank DSHB, anti-a-actinin EA-53 Sigma A781) overnight at 4\u0026deg;C. Next, the cryosections were washed with PBS1\u0026times; 3 times, and incubated with Alexa-Fluor-secondary antibodies (1:500 Anti-Mouse, A32723 and Anti-Rabbit A-11059, ThermoFisher) for 1h at RT. Nuclei were stained with DAPI (1:500). After washes in PBS1\u0026times;, cryosections were finally mounted in glycerol 80%/PBS1\u0026times;.\u003c/p\u003e\n\u003ch3\u003eTransmission electron microscopy and Sarcomere length\u003c/h3\u003e\n\u003cp\u003eWhole larvae and dissected skeletal muscles of adult fish were fixed with 1% glutaraldehyde prepared in 0.2 M HEPES buffer, pH 7.3. Then, they were postfixed with a mixture of 2% osmium tetroxide and 3% potassium ferrocyanide for 30 min and incubated in 0.5% uranyl acetate at 4°C overnight. The following day, the samples were dehydrated in a series of ethanol and propylene oxide and embedded in epoxy resin. Ultrathin 60 nm sections were cut using a Leica EM UC7 ultramicrotome. Electron micrographs were acquired using a FEI Tecnai 12 electron microscope (Thermo Fisher) equipped with a Veletta CCD digital camera. Sarcomere length was analyzed using iTEM software (Olympus SYS, Germany), and plotted in a graph using GraphPad Prism (RRID:SCR_002798) 9.0 (Prism). The statistical significance of difference in measured variables was determined by two-tailed unpaired t-test with Welch's correction when appropriate.\u003c/p\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eRNA-Sequencing\u003c/h2\u003e\n \u003cp\u003eLarval bodies were dissected to separate caudal skeletal muscles from the upper-trunk internal organs. The caudal sections were then pooled together (n = 5 for each genotype) in single tubes and total RNA was extracted with TRIzol™ Reagent (cat:15596026, Thermo Fisher). Illumina Sequencing (NovaSeq 6000) was performed at CeGat (Tübingen, Germany). The RNA library was prepared with the SMART-Seq Stranded Kit (Takara Bio), with an input of 10 ng RNA. Due to the scarcity of RNA material when dealing samples from larvae, the samples exhibited a low RIN value (\u0026lt; 2). This necessitated the acquisition of technical duplicates, wherein two libraries were prepared for each pool. A total RNA sequencing procedure was performed, yielding pair-end (PE) reads with a length of 101 base pairs. Subsequently, the reads were aligned to the reference genome (Japanese medaka fish ASM223467v1) using STAR v2.7.3 [2]. Read counts were generated using quantMode GeneCounts in STAR scripts.\u003c/p\u003e\n \u003cp\u003eThe principal component analysis (PCA) plot was generated using variance stabilized transformed (vst) counts. Differential gene expression (DGE) analysis was performed between homozygous samples \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e and wild type \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e using the DESeq2 [14] package in R (v4.3.2). Genes exhibiting a log2foldchange (log2FC) greater than 0.5 and an adjusted p-value (padj) determined using the Benjamini-Hochberg (BH) method greater than 0.05 were considered to be significantly upregulated, and genes with a log2FC less than 0.5 and a padj less than 0.05 were considered to be significantly downregulated. The volcano and heatmap plots were made using Python and R languages.\u003c/p\u003e\n \u003cp\u003ePathway enrichment analyses was conducted in R using the gprofiler2 package [11]. Fold enrichment was calculated as the measure of how much more a pathway term could be represented in the differential gene set than expected by chance as background. The calculation was performed as follows:\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAkEAAABkCAYAAACB+uQBAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAACGDSURBVHhe7Z3PiyPH+f/f+v4BcVqTqyFsz0JMHMYkPV7jzB42YPcwCcYm60jr3YMhJnaLxWA77NrSLiGsM4kGOweTrDRmDT4ESwsb8GFHzHjAgbTIwVbMCGwc8LbwIceWFdt/QH0O7qe/1Y+qWz/ml9Z6XlDsbFV3dVU9T1U9XV31KKeUUhAEQRAEQZgz/h+PEARBEARBmAfECBIEQRAEYS4RI0gQBEEQhLlEjCBBEARBEOYSMYIEQRAEQZhLxAgSBEEQBGEuESNIEARBEIS5RIwgQRAEQRDmEjGCBEEQBEGYS8QIEgRBEARhLhEjSBAEQRCEuUSMIEEQBEEQ5hIxggRBEARBmEtm1ghqNptYXV3F6uoqT8qk1+thY2MD+Xwe7XabJ9/VdLtd5PN5LC8v86SJ6ff7aDabWFxcxMbGBk8WBIFRKpWQy+XQarV40l3LQY4pB0U+n0e32+XRwj7o9/tYXl5GPp9Hr9fjyXNNqhG0sbGBXC43cdiv4UHGz7lz57Czs8OTMymVSrBtG5cvX8ZgMODJRtrt9lAdxg1H3VF3dnYwGAzQ6XT21c6bm5s4f/48zp07hyAIeLIwQ4zqh2LAHh21Wg0A8MYbb/Cku5aDGlMOilarhXw+j6WlJZ4k7INPP/0UnU4Hg8EAt27d4slzTaoRdOnSJSilUK/X4zjXdaGUGgpBEKBcLifun5ZisYjt7W24rsuTRnLt2jX4vs+jM1lZWYnrYNt2HM/rSCEMw7hNvv76ay2nw8d1XViWBdd1sbKywpPH5tlnn8X29naivsJsYuqHAOD7PpRSuHTpUiJeODw8z4NlWXj++ed50l3LQY0pB8Xt27dRKBR4tLBP7rvvPjiOA9u2cfbsWZ4836gxAKAAKNd1eVKCQqGgfN/n0VNRLpfHeqYJKu+kZaFnjtMsnudNnP+s4bquAqCq1SpPmgs8z+NRM824/XAagiCYWz3Qudt04tuGZVlqb2+PRwvCoZG6EjQNr7zyCv71r3/x6Km45557eNShM8kzf/GLX/Ao4S6i2WzKt3GN1157jUfNHaITx4t8ChOOgwM1gpaWluZmeX5tbW0mlo+Fyen3+yiVSjx6bmm32/F+l3lFdOL4uX37Nn7zm9/waEE4VA7UCBKEWaff72N1dXXsjfPfdrrdLh577DEePVeITswGzWZT9qsIR86BGEGVSoVHJeh2uyiVSsjn88jlcsjn8ygWi/s+jdBut1EsFuOTMsvLy0dyfDXtRE673Y6P0SIaXOm4fi6Xw+rqqvFEGd2Xz+eBqL0WFxeHTv+0Wq1E/iaoTfS2LpVKYy3zt9ttrK6uxveZ6klH65eXl+P0brebkEOpVEK/34/v2djYiOuzuLiYKaNerzekK2nl524U6N60crRaLZw8eRKdTgeITsbQtZO6Ypg1+v0+Njc3Ey4PRslzY2MDDzzwQDz5X758OW4Pfu2kcikWi3GbNptN5PN55PP5hOypvJRfsVhEpVIZejbB+zvVVZexDvW/5eXl+J7l5WU0m834mnF1otfrDbWvic3NzaHnpZVxGpmNQ6/XGxoXK5WK8Rh81phC948Km5ubifuo3Um2uVxu5HjfarVg2zZOnDjBk4CUOaRUKqHVamF5eTnOm9qOgi5D00ngNGiMo+u43hC9Xg+VSgWLi4tot9uxQU3P5uUxPZeXa9yxaBI5d7tdVCoV5A2uY9LKyEOxWEzcN42cZxK+SchE1oZM3/eVZVk8OqbRaMSbb8MwjOMsy1IAVL1e57copZSqVqupz1RKqXq9nsg3DMM4btqN0fTMrGYxbSANgkB5nhfXCYAKw1A5jqNs2443IANQjuNk3re3t6ccxxmK49eZoHalNg3DUHmepwAoy7JUEASJ6/WN0XSv67rKtu34OVtbW/H1jUYjUZdqtar29vaM93meF7cBpVMagKGyUP62bcfP5OWnDZO+76tCoRDn5bpuXA7HcZTjOHFauVxmTxmtW5Oi682kYRIdpXt4uRuNRqLOJE+6Nk2exKgN8vuRCy8blb1arSrLsuL6h2EYt6OpHOVyWTmOEz8rCII4X8dx4rGFIN1zXTfWNRqrYNCLLJ2o1+tD7cuh5zmOE9cpCIK4PRzHSeg8b5dJZZZGGIbKsqy4/6mo3vQsYpwxBSn6Sc8wtdfe3p6ybVvV6/X4+fq43Gg0EtcTnuelzgWmOWRraytRdr2cQRDE7cfLp0aM82EYKtd1led5Rr3RN86Xy+UhOZlkR30FgCoUCtrT/j9hGMbpXJdNjCtnFbWtXiYuU9d1jTqttLHBsqxEuaaV8ywyrAUGqGJZwYTv+wpMcXgaUjp51qC0tbWlYBjIFFNwLuxRZHUOFXWuLIWhzkrl1p+v15eXi+pDdQrDMDaQdGXKKh/lwQeSvb29+B4uB1Jwx3ESnUlPM7U/dbRCoTB0n97hXddNlEcfPLnsgiBQiAw+Dj3Ptu1EPD2LDE19kslqqyzdmoYgCJTv+1OFcQY8Qm9XEzTQTSpPSjPp9TRyoVOWjuPEcvYjA4nysSzL+DzP84biyQjjbUUTBwy67UQvIPwe3Ugz6YupfQi6j5dPaW1oMu71fsaZVmZp0ETEITlysvpJ2oRNbcgnRhXVh49Bip28NbWRZXhJU9qYaspTHzd9NqbS2GBqO18bizme5xnrrT9LH5N1HST9DiODnnQ/DMNYzlxPCZKPqQ1MTCpnvc68rUz1Vcyo4fdMK+dZZLi1DFCl6C1HD9SJTJDgeQMS1Mktw0pS2qCkT6S8AypNCbKem4Y+IGQF0yComKKZykbl5vdnKaiO3hE5lmUZ21Fp7cyVluJNHZM6gClPuo8bMooZXSbjNs31ged5xklCMbnokzHFm+7Ty8HbNE23Zh2qT1q5s+SiD2icLCNoP3IxTZJEWj0Cw0qrbdvGOqmUMYTqyvVdaSsI3EAaRyfI6OPl01dwTOj9m5dpWpmlQfXgOq9Sjv9njSm8noqVifdvageTzLPaYGtry6hjNNZzI1uH8uT1zZKnXhYdmjt4vQi6hxsNFG9qL4LaJq1PlMtlY1nTmFTOurHG7zGVWx8/uW5OK+dZZaI9QQsLC1hZWUmES5cuGZ1bdbvd2Btx2imqp59+GgAwGAwy94no7O7uYjAYwHEcLCws8OTUb8qTEhmIiRCGITzP45caMZXtwQcf5FFDpLUVAHznO9/hUUD0PX0wGKTmv729DaUUnn32WZ4EAPj+97/Po/DDH/4QiGSThsmlgH681VRe0z2IvPF2Op2h79C5XA6XL1+Or/v0008T9yGlrY/ymG2v10O73Z4qmPaK7BdTG5M8J2U/cnnwwQeNsgEAy7Kws7ODYrGY2Fd04sSJxAnTdruNIAiwvr4+9PxcLhd7lR8MBnE+N27cAFLqvLa2hi+++AJ37txJLVsaade/++67AICf/exnPAmI+jQ5JqWycQ5KZpTPY489NrSH5fr164n/I6WPEvykb7fbxXPPPQcAKJfLWFtbS6S//fbbAIDvfe97Q3I6ffp0fB3fF3n79m0888wziTgAuHXrFgaDAR599FGedCiQJ+Wf//znQ+XPaft4aP8Y5+GHH+ZRMcViEbZtYzAY4K233uLJqNVqEznhnFTOaboLg5z7/T5++ctfAgAcx8Ef/vCHRPq0cp5VJjKC0vjxj3/Mo8b6yYv77rsv/vvjjz9OpKVBA06WUA+LhYUFXLt2jUcfO+O23axCnSXNI7ke+Oa8WeDWrVs4ffr0VMFkPMwKhykXGqhv3rwJ27ZTN1l/8sknAIBqtTr0TB7oBShtkjosbt68yaOGcBwHOIKynT17Fo7jYDAY4Ny5c1hcXByaJKeh3+/HhoppYgSADz74AEh5gdQDn6SbzSYeeeSRRBwA/OMf/wBSXtIOg48++gjQvLGnhTt37vBbx+LVV18FAPzpT39KvPzQwQFuVGZxWHIGgKtXryIIAliWZdTtaeU8qxyIEcQtyXGZ5m39f//7H486UhYWFqaur2CGfn7kMFZFjgL6aYtpQtbK33FzmHIpFovwfT/+eZxarQbbtlGpVBLP+/LLLxP/3q2YXhQPg4WFBWxvb6NarcKyLARBEE+S+zm1c/XqVXQ6HViWlbqaRavGk+hL1qmwox7r6XlfffUVTzoQ0laDXn/99Yn9Ix2WnJvNZuwz7Pr160a5TCPnWeZAjKBRjLMsZloOFiZjnNW3WabT6RhXA4Tj5bDksrKygu3tbfi+H6+UrK+v4/z58/xS4xvpKA7Ke/240EpCFpZl8agDh17UPvvsM1SrVQBAEAQ4ffr0VBNkq9VKTIyjXl53d3d5VCppn8J0Pv/8cx51qNy+fZtHHRhk7NBqULfbRafTmco/0kHLmdxgIPqdvFGru5PIeZY5NCPo/vvvj/8eZ8nftBxq4rvf/S4QTfjHbYmSj4jjRm/rrCVRUvBZQ18NMX0vJ2gfjXA0HJVcVlZW8OGHH8YD+c7OTpwf7bMIgiBz36DuT4cMqjfffFO7Ikm32x3ybzMtk3zqGjWxHCQ0Se7t7cVlpE8y49Lr9XDhwgVgjImRVvVef/11nhRDvpGItE9hOu+99x6POhRoT1dzxM+nTOO7ifj1r38Ny7Li1aDNzU0UCgXjisu4HIScAaBQKMT7bbO2fUwj51nm0IygtbW1eDMgbaTi0EDnuu7YSvD444/Hf2cNzEfBa6+9hl/96lc8+sg5depU/HepVDKuvGUZR7MAba5fX183lrXf7+OFF15I7CMTDp/Dkovp5eHSpUvxIE57gVZWVuLVkwsXLhh1u9vt4v3334//TxtpgyAwGv60v2XU5DsuL730EhA9L80YpPI99dRTPOlAMTlmXFpawu9//3tA288xLqVSCYPBALZtGydG3QB+4okngMgYNLU7os9q9957LzDiUxi0/IIgME6ovJ7jon/u0uVFk/tgMEChUDDm32w29/VpdmFhAS+//DIQrQbVajVcvHiRXzaSg5bzxsZGbMTfuHHDuOeWjL9J5TzrHJoRBABvvPEGEL3Zmd7i3nnnHSDa9MhJWwKl76qIPNzygVlX6v/+97+JtEngCsZpNpt47733Ri4NT0rWG0jat+qFhYW4DQeDAc6cOYONjQ202+3YI2ypVMJvf/tbfuu+2M9gwNEHgnPnzqFYLKLVaqHdbmNzcxOnTp3Ck08+aeyc06JvcDTp57yh9zlqj/3IJWsDaa1WMxo05O32oYceiuNo0hgMBnjggQdQqVTiybdSqeDMmTO4cuVKfP2LL74YG061Wg2rq6tDZX700UeNk2+WTqSNCcViMTbeXnjhBZ6MXq+HnZ0dFAqFI9kDdvXqVR6FH/zgB4BmIBJpYwqiSY8+sf/97383ypiMVUSbdfV2Jy/L7XYbzci7e6/XizcAj/oUpuf33HPPJSb+drttrCdB2yt2dnYSetZqteJ5Caz+S0tLsSHU6XRw8uRJbG5uDo2jL774YnyPzrjzjb4aZNv21Dphqn+anNN0F1Fb0knPer1unNP0NpxUzjMPPzPP0f1CYApPkOQXxmKejMnPgSm/QPP4aWkeaYm9yDswlalQKKhqtRo776N4y7JUuVwey2mT7/vxM9PKpTQ/JjD419EdsfH7db8LjubhNtS871KeJv8LiuVv8mWh56MHy7KGyuNrXlBt2x5qo7RnBUGQeZ/uO4b7lwgjr7qUzv1V6M4meeC+OXQHZCYd0fWWy0mXBemMyVfGLDGqH6bpF5Glm3re5K9El80kcgk0T87I8BUCTS+prPQcLi+Vodtpz+BjhB5c1x1qn1E6oaen3U/66DIv1U7kSdp0D+VpSs+SWRrU/8hxn9KcvJr6SVo/H8ffC40huq5ktTv3zWSlOEjU0f0Y6YHai/7Px5JQ8yeHSCa2bSvP8xJ1s5jXZT5G6YHXVbG+4zCv4FmQnNLadhSTypn3cUJvJ96XCerTvD+MK+dZJ9UI0iczU5hk0vCZO31SPJPCpD2XO5IK2E9OOI4TDxSIBlKuCCb0DjFpoEEjKw+lOUTjIWtg1ztbWv68TRRzx29ZVqKTEGnlqVarmc8aJRseT8HXnGrywOvAdcW27SFdG5UXj6egt2k1+tkGK8Vz8ayQVlcK1Wp1KnlCe/8JNUPc1n4eQ2c/ctGfRdiRl299INX7sAldt+l6U1kJ0xjBy6yTphNp7csnxDB6udNfptLqlJbnuDJLg/RBbyfTeJv2DOpDeh1GBT6O83bnhobKcJBoYm9vL24vnheVgcuC7qN20PXVj4y3tBdkkxxN4yhvBwpZOkZQ+09rLIwrZ5VRTjXi5YIHrsfjyPluIKe+aSRBEARBuKsgJ4a+70/9Wek4qFQqGAwGd40vnW8zh7onSBAEQRCEJLVa7dA3yQvjIUaQIAiCIBwRzWZzXxuihYNFPocJwgyj/2aRIAjC3casmxiyEiQIMwz/mQ0JEiR8E+r1etxPPM8bSp+F4Pt+oj/PclkPK8w6shIkCIIg3FWkrZDO4gbpSqWC9fV12LaNV199NdPrtnD0iBEkCIIgCMJcIp/DBEEQBEGYS8QIEgRBEARhLhEjSBAEQRCEuUSMIEEQBEEQ5hIxggRBEARBmEvECBIEQRAEYS4RI0gQBEEQhLlEjCBBEARBEOYSMYIEQRAEQZhLxAgSBEEQBGEuESNIEARBEIS5RIwgQRAEQRDmEjGCBEEQBEGYS8QIEgRBEARhLhEjSBAEQRCEuUSMIEEQBEEQ5hIxggRBEARBmEvECBIEQRAEYS4RI0gQBEEQhLlEjCBBEARBEOYSMYIEQRAEQZhLxAgSBEEQBGEuESNIEARBEIS5RIwgQRAEQRDmEjGCBEEQBEGYS8QIEgRBEARhLhEjSBAEQRCEuUSMIEEQBEEQ5hIxggRBEARBmEvECBIEQRAEYS4RI0gQBEEQhLlEjCBBEARBEOYSMYIEQRAEQZhLxAgSBEEQBGEuESNIEISZpFQqIZfLodVq8aRjoVgsYnNzk0dPRb/fx8bGBhYXF5HL5ZDP51EqldDr9RLXNZtNLC8vI5fLIZfLoVgsot1uJ645LmZNPpPQ7/fRbDaxuLiIjY0NnnzX0+12kc/nsby8zJNmgmaziVwuh0qlwpOOHiUIgjCDAFAAlOu6POnICcNQAVBBEPCkiQnDUDmOo6rVqlJKqb29PeU4jgKgLMtSYRgqpZTyPE8VCgUVhqEKw1AVCoW4TXzfZ7kePbMkn0mo1+vKsqy4/CSHbxPVanWmdIXjum5cvuNGVoIEQZhJPM+DZVl4/vnnedKRs7u7C8dxcOLECZ40MVevXkWn08GlS5cAAEtLS7hx4wZs20Y+nweiN+VarYaLFy9iYWEBCwsL+Otf/wrXdWFZFsvxeJgl+UzC2bNn8dlnn81MOx4GpCeu62JlZYUnHztPP/00AKBarfKkIyenvrHoBUE4Rnq9Hm7duhVPjMJsUSwWcebMGTz77LM8aSJ6vR5s24brutje3ubJMYuLiwiCAMc9PJdKJVy/fp1HfytYXV3Fzs4OqtWq9Ls5RlaCBGEGeO2113iUMCP0+33cvHkTjzzyCE+amP/85z88aoh+v48gCHj0kdPr9VCr1Xi0IHyrECNIEI6Zdrstk80Ms7u7C9d1D+RT2Mcff8yjhvj000951LFQKpV4lCB86xAjSBCOkW63i8cee4xHCzPEu+++G+9hmBdKpRJ2dnZ4tCB8++A7pQVBOBr0Exw88BMrQRAoz/PiUy2WZSnP84ynlRqNhioUCvGpnUajoSzLUpZlqa2tLaWiE0mUH1GtVpVt2wqAsm07vpau108neZ4Xn2IalzAMVblcjutg23Z8AoqfYAmCQNXrdWXb9lBbZLWbHvS6Eb7vJ+pB+afVhU6FpaWPmx8vGw+KnZgxBVMbjasTRKPRSDyHlzcIglgHTIFIk09aHfSy+76fSOOny8IwTOgiAKOOjAtvJyozlZXrF6H3EUTtm1WOw+xT9Xo9PkGol2Vvb49fqpRSamtrS3mep2CY4n3fT6RRe1M9XddNzTcL0ge9fOVyeah9wzCM9ZDLnutGVuBl5HIepz8opdRwCwmCcKSMGowbjUZiAA3DMB7ELMuKBwM+IbuuqxqNRmLwdBwnMVAgGgg9z1O2bQ9NYkEQqEajEd+rT0ye5yXKOQrXdZXjOPGgFARBXF59YuEDPm+XarUaHx3n6AYSn6zK5bJyHCduryAI4uc4jmPMjwxKE9PkR+Xjg7+OPhGkMa5O6JCMqV14eXWyypAlnzAMVb1ej9N4vgQZl1yH9vb2lG3bql6vx+2n59doNBLXj8L3/XhCJr3b2tpK6D/XLxW1L6VROehlAoCq1+vxtdT2h9WnqI/QM7msdT3jhhuVRRmMBETGPZVBL2ea3NIgI4p0iwwrsPbd2toaGqN0fN9Xtm0bDRddJ7nMpukPxLCGC4JwpGQZQUEQKBjeepRS8URk23YivlwuxwNZuVxWSjOQKJ+tra14QCmXy0NvqDRQOo6jXNdNDEq6oWGa6E3s7e0pGAwTpVRiYtZJG/Cq1aqxPegZpntokOTlpckYGROQaeKdNr+DMIL2oxP8njQDY1QZVIZ8lKbTaZNpEATKMqzUkQHEofJjAl9N9AxTGbImVEozyU+/T+8z6pD6VJocdD0z6aeeH4cMMER6qPc9/XmmPpmGZVlD7agiQ9AUT/rB+4Hv+0b5h2EYG4v8nmn6g85wCwmCcKRkGUGe5xkHccUGOn0AoHj+lqijD3ama+htzfRsfQAed6Ck55nq2Gg0jPnQAMbv4f9XbJA0ldm27dgg5FD780mZ6mlqn2nyUwdkBE2qE2Qcmla0gujzl/4Wr8Yog8qQj2L3m4wW02cSmpxN7a3nZ5okTZAcuLFCkL7wclC8SSdVhnwPo09lGXJZ44ZukHFGlZOMNVO+aSBFp4MgMOZDRi2/x/d9Y7tT21mWNaRPk/YHznALCYJwpGQNZtSBRwX9bfAgJtpRedC9pgHLBF+lMQ2+nKx24WQNknpdRwX93rRPYdPmp8ZoVzWGbPgz0gLpBE0447QjMaoMagz5kDHBV1TCMDTKifIbFXh+Jmh1ACkTvUopv66naegrKbqBNarNRsme7h23T5nKT2SVJStNjcg3DTKc9M+OWYxqCx19tdJk0FLaqGBaMVPiMVoQZpdutwtE3l+jF5bUUCwW+e0zxdLSEjzPAwBcvnwZJ0+exMbGBvr9Pr90YprNJm7evAkA+Nvf/jZ0lP2TTz4BIu+0vN140O9999138fjjj2s5fcO0+R0E0+jEv//9b5bL0fDqq68CAGq1WkLOu7u7KBaLQ23zwQcfAN/MzJlhHOeNu7u78d8LCwuJtCzGORF33333xX+P4/LgIKHfPCNHj7MCyeTmzZuwbdv4O3jT0O128corrwAAyuUy1tbWhtIxYX/giBEkCDPK119/DUQD37eB69evo9FowLZtDAaD2Bjaz4+Sdrvd2J+N53lDgyQAfPnll4l/xyHLQeI0+R0Ud5NOFIvF+Kcp3nrrrTj+ypUreOqpp7Qrv2EwGAAHVLfDlM3S0hKPOnR6vR5KpRJOnjyJf/7zn7hy5Qpc1+WXHRvFYhG+78dlqtVqsG0blUplann2+30888wzGAwGcBwHL774Ir/kQPqDGEGCMON0Op0DeauaBYrFIu7cuYNGowHLsjAYDPDcc89N/Uve+iB57do1npyAVovGYXd3F4VCIXMVYZL8DpppdOL999/nUYfOyy+/DAB48803gcgxqGVZmb9npa/iHCe0ypDFPffcw6MOnGazCcdx8MUXX6DT6eD69euZ7XdcrKysYHt7G77vw3EcAMD6+jrOnz/PLx2LP//5z+h0OrAsCzdu3Mjsi9P0B0KMIEGYUfSBTn+T5rTbbbTbbR490xSLRXz22WcoFApA9IlsUiqVyliD5MMPPwwACIIArVaLJ8fohljapzBMmd9BMY1O/OQnPwGiTz1pE0W/30elUuHR++bs2bNA1FbNZhN/+ctf8NJLL/HLgOiTBgC8/vrrPCmm3++PtXKoGydZMuLcf//98d/jeO42rRQeJK1WC+fOnYNt22g2m0OfEGeRlZUVfPjhh/GPo+7s7Ew8PrVaLayvrwPRCnLa6ts0/YEjRpAgzDBkJKyvr6PZbPJk9Pt9vPDCC4l9CrNIu90emozol9GJcd68iXa7HQ+Sf/zjH42DJBkhKysr8WeZCxcuGJ/T7XbjlZKsT2GYIr+DZlKd+OlPfxqnFQoF46eDq1ev4kc/+hGP3jcnTpyI94JduXIF7733XurejCeeeAKI3urTfrLj6tWruPfee3n0ELrs3njjjURaFmtra7BtGwDw9ttv82Qg0j1ERtthGyVU9ieffJInzRQmA/rSpUvxihDtoxuHfr+PCxcuAJG+mvRFf8GYtD9wxAgShBnh888/j/8mg+HixYtx3Llz51AsFtFqtdBut7G5uYlTp07hySefNK6C3Llzh0cZMU2Kh8Hvfve7oWctLCzAtm1YljVkyPBriX6/H//USKFQSP1l948++ij+mz7LDAYDPPDAA6hUKvHbYaVSwZkzZ3DlyhVgzE9hk+RnIq1uHNN1k+rE2tpavMrS6XRw6tQpNJtNtNvteJPthx9+aJxsEO1HQWTY6StJprKZIPkEQRC3m4mzZ8/GxmWtVsPy8vJQOXu9nnHfF0c3vnZ2doaMql6vF/cPvd9BMzx2dnaGDHcAeOedd4BoY3wa47bNuNDnRKLdbscbyRE9TzcAvvrqq/jvo6BWqxlfBpaXlwEADz30UCI+a8/W+fPnMRgMYNt24iVJR+/bk/aHIfhxMUEQjhb9CGi5XFYuc2CmH8nlgR/hDjQvwMjwqaI7n+NHYcl3DFKOnOvlSfPczKFjuY7jJLy6Ujn48VX9qLLruoln0BFek7NCpXmL5cdvyYOsKejtlOYgkTNufsRe5A2ZrjE9IwzDxFHxtOPgk+iEivLV9UIPtm0bfajozv3K5XIi3yz5mKA6cV3i6E4FeUiTdxq8zo7jqGq1GuuGnuZ5XqLPkV5alpXw1ExHu02yO4w+xR0bVqOf+6B/KT9H81yuNJcRMBwr19N4PXS5Oilez01QORqNxlDZuQ6Hmk8v3hbUvsjw60Pjpc6k/UFHjCBBOGZo0obh94UIP+U3qnT0AYQHHZ5Gwff91DzIoODx+r1Z+L6vnMhTrn5fwfBbTPwa/RlZgx0PfPBV0WDJJ0a9vcMMB4kmRuVHpNUJWtumtT0Fzjg6oUOTOE1AdvTbbWl13draSvj6oevS6sLlqNNoNIzyMBGk/AZUWjmzMNW5GvmpcqPfrjLJSxnal8rBDRg1ol+kyXXcPlXVftfLcZw4nhwi6kasn+LDyo1erHg8BZUh1yydIuzoZzd0A9ZxnCEjK60tqtVqwrfTqGAbPEBzeY3qD0ROfSMEQRAEQRCEuUL2BAmCIAiCMJeIESQIgiAIwlwiRpAgCIIgCHOJGEGCIAiCIMwl/wdvht8NPVMyywAAAABJRU5ErkJggg==\" width=\"577\" height=\"100\"\u003e\u003c/p\u003e\n \u003cp\u003eThe top significant Gene Ontology (GO) terms (p-value \u0026lt; 0.05) and KEGG terms were checked and plotted. The volcano, heatmap and pathway enrichment plots were made using Python and R language scripts.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eLocomotor test and swimming behavior analysis\u003c/h3\u003e\n\u003cp\u003eLarval locomotion was investigated on medaka larvae at stage 40 using the automated analyzer DanioVisionTM Observation Chamber (Noldus Information Technology) at the Stazione Zoologica \u0026ldquo;Anton Dohrn\u0026rdquo; in Naples. Each single larva was isolated in single well of the 24-well plate and maintained in 1.5ml of Yamamoto solution. The first recording started after a 30 min acclimation period. Following the luminous stimulus, the activity was recorded at least three times for 10 min, with 10 minutes of dark interval between each recording, yielding a cumulative recording duration of 30 minutes. The measured activity in heterozygous (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;9), homozygous (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;5) and wild type (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;5) larvae included the total duration (in seconds) spent moving and the total duration spent resting or immobile. The data were analyzed and plotted in graph using GraphPad Prism (RRID:SCR_002798) 9.0 (Prism). The statistical significance of difference in measured variables was determined by unpaired Student t-test.\u003c/p\u003e\n\u003ch3\u003eMechanical experiments\u003c/h3\u003e\n\u003cp\u003eIntact muscle preparations, obtained from the tails of the wild type and homozygous larvae, were used to determine the mechanical performance [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Euthanized larvae were transferred in vials containing ice-cold Ringer solution and daily delivered to the PhysioLab research unit (University of Florence, Italy) to perform the experiments. Larvae were selected at random and dissected under a stereomicroscope (Zeiss SV11) with small forceps and scissors. The tail ends were clamped with aluminum T-shaped clips and mounted between the lever arms of a capacitance force transducer and a loudspeaker motor in a thermo-regulated aluminum trough [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The sarcomere length (\u003cem\u003esl\u003c/em\u003e) was set at 2.0-2.1 \u0026micro;m under a 40x dry objective and a 25x eyepiece and the length of the tail (\u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e) was measured as the distance between the clips. The width (\u003cem\u003ew\u003c/em\u003e) and height (\u003cem\u003eh\u003c/em\u003e) of the tail were measured at two-three points along it at interval distances of 0.5\u0026ndash;0.7 mm starting from the clip end. At each point \u003cem\u003ew\u003c/em\u003e was determined as the extreme width of the tail while \u003cem\u003eh\u003c/em\u003e was determined from the extremes focus distances at the middle of the tail width. The cross-sectional area (CSA) at each point was calculated assuming an elliptical boundary as \u003cem\u003ew\u003c/em\u003e\u0026middot;\u003cem\u003eh\u003c/em\u003e\u0026middot;π/4 and the average CSA was taken to get a first estimate of the force density of the medaka larva muscle. In \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e tail CSA varied between 16,300 and 37,200 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e (mean value\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, 25,600\u0026thinsp;\u0026plusmn;\u0026thinsp;4,700 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e from five tails). In \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e tail CSA varied between 14,700 and 34,600 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e (21,200\u0026thinsp;\u0026plusmn;\u0026thinsp;2,000 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e from nine tails).\u003c/p\u003e \u003cp\u003eThe mechanical output was measured during isometric and isotonic contractions of the muscle from \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e medaka larvae at 30\u0026deg;C. The sample was stimulated by means of two platinum plate electrodes, running parallel to the fish tail 4 mm apart, carried on a microscope cover glass positioned on the top of the trough. Pulses of 0.5 ms duration and amplitude 1.5 times the threshold voltage for contraction were delivered as single stimuli to elicit twitch contractions or as trains of an even number of stimuli of alternate polarity to elicit tetanic contractions [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The stimulation frequency for a fused tetanus ranged between 280\u0026ndash;320 Hz. The force-velocity (\u003cem\u003eT\u003c/em\u003e-\u003cem\u003eV\u003c/em\u003e) relation was determined with after-loaded contractions (load, \u003cem\u003eT\u003c/em\u003e: 1 and 0.75, 0.50, 0.25 and 0 the isometric force, \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e). Velocity (\u003cem\u003eV\u003c/em\u003e) was estimated as the slope of the linear fit to the initial part of the shortening trace following the start of the isotonic phase of the contraction. The power (\u003cem\u003eW\u003c/em\u003e) at each load was determined as the product of the applied load and the shortening velocity (\u003cem\u003eW\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eT\u003c/em\u003e\u0026times;\u003cem\u003eV\u003c/em\u003e). Data are fitted with the Hill hyperbolic equation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], (\u003cem\u003eT\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003ea\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e) \u0026times; (\u003cem\u003eV\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eb\u003c/em\u003e) = (\u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eb\u003c/em\u003e) \u0026times; \u003cem\u003ea\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, where -\u003cem\u003ea\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e and -\u003cem\u003eb\u003c/em\u003e are the coordinates of the vertical and horizontal asymptotes of the hyperbola and \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e the velocity of unloaded shortening.\u003c/p\u003e \u003cp\u003eThe Ringer solution used for the mechanical experiments had the following composition (mM): 115 NaCl, 2.5 KCI, 1.8 CaCl\u003csub\u003e2\u003c/sub\u003e, 3-phosphate buffer (2.15 Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e and 0.85 NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e) at pH 7.1. Force, motor position and half-sarcomere length changes were recorded with a multifunction I/O board (PXIE-6358, National Instruments). A program written in LabVIEW (National Instruments) was used for signal generation and data acquisition. Analysis of the mechanical data was performed using Excel (Microsoft), OriginPro 8.0 (OriginLab Corporation) and programs written in LabVIEW.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eGeneration of the medaka knock-in model\u003c/h2\u003e\n \u003cp\u003eTaking advantage of the fact that medaka fish has a single copy of the \u003cem\u003etitin\u003c/em\u003e gene in its genome, we used CRISPR/Cas9 genome editing technology to generate knock-in mutant lines. These mutant fish were engineered to carry the specific missense variant commonly found in patients diagnosed with Hereditary Myopathy with Early Respiratory Failure (HMERF). In the human genome, the missense nucleotide variant c.95134T\u0026thinsp;\u0026gt;\u0026thinsp;C is localized in exon 344 and results in the substitution of a Cysteine with an Arginine residue p.(C31712R) in the FN3-119 (A150) domain, close to the end of the A-band of the titin protein (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e)[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. This domain is highly conserved among vertebrates, including medaka, allowing the introduction of a single nucleotide change in the corresponding medaka exon (exon 206) causing the same amino acid substitution Cysteine to Arginine (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea-b). Exploiting the CRISPR/Cas9 homology arms strategy, we injected the sgRNA and the ssDNA at the one-cell stage into wild type medaka embryos, which were raised and genotyped after larval hatching.\u003c/p\u003e\n \u003cp\u003eWe first investigated the effects of this mutation on the body size, lifespan, and fertility of the F\u003csub\u003e1\u003c/sub\u003e generation of heterozygous adults (\u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e). Interestingly, we observed that the heterozygotes did not exhibit any noticeable alterations in body size, lifespan, or fertility at adult stage (data not shown), suggesting that the variant did not affect these parameters in the heterozygous state. The p.(C31712R) variant is germline inherited as for the sequencing results of the F\u003csub\u003e1\u003c/sub\u003e and F\u003csub\u003e2\u003c/sub\u003e generation (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec). Subsequent in-cross breeding of the F\u003csub\u003e1\u003c/sub\u003e heterozygous adult fishes \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e resulted in the production of both heterozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and homozygous larvae \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e in the F\u003csub\u003e2\u003c/sub\u003e generation. Thus, we analyzed these freshly hatched larvae for any phenotypic differences. The results revealed that the three groups -heterozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e, homozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e, and wild type \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae- did not display any noticeable differences in the gross morphology of their bodies and heart (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed). However, the homozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae showed a significantly reduced lifespan, with most of them dying around 12 days after hatching (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee). In contrast, the heterozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and wild type \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae survived to adulthood. These findings indicate that the homozygous condition for this mutation is likely lethal and that the alteration in the FN3-119 (A150) domain of titin may be critically important for the survival of fish, highlighting the crucial role of this protein in the organism\u0026rsquo;s development and longevity.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eMedaka\u003c/strong\u003e \u003cstrong\u003eoltitin\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eC31712R/C31712R\u003c/strong\u003e\u003c/sup\u003e \u003cstrong\u003elarvae showed defective muscle structure\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eBecause of the lethality observed in homozygous larvae, we sought to investigate whether the alteration of \u003cem\u003eTitin\u003c/em\u003e gene in the two knock-in mutants, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e, would impact the structure and ultrastructure of skeletal muscles. Thereby, we conducted a detailed histological analysis of larval transverse cross-sections, focusing on skeletal muscle morphology. The histological examination revealed that both \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae exhibited impairments in the structure of their skeletal muscles. However, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae displayed mildly compromised muscle bundles, with a slightly reduced number of muscle fibers compared to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae (Fig. 3a-b). These findings suggest that even a single copy of the mutated allele can lead to a moderate impairment in medaka muscle structure. In contrast, the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae showed a more severe phenotype, with a significantly reduced number of muscle fibers and extensive disorganization of muscle bundles across all body sections analyzed, including abdomen, center, and tail (Fig. 3a-b). These results indicate that the variant in a homozygous state has a stronger impact on medaka skeletal muscle integrity. Consistently, immunostainings confirmed the disorganization of the muscle fibers in both \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae when compared to the wild type larvae (Fig. 3c). Labeling titin, myosin heavy chain (F59) and a-actinin in the skeletal muscles showed a loose organization of the fibers in the mutants, although their myofibrils still showed typical striation (Fig. 3c). Notably, we further observed that \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae exhibit a milder alteration of the muscle fibers, while \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae showed a higher level of fibers disorganization. These structural changes could indicate that the mutant skeletal muscles are functionally compromised rather than visibly malformed. To gain a deeper understanding of the muscle damage at a subcellular level, we conducted ultrastructural analysis using transmission electron microscopy (TEM) on longitudinal sections of the three genotypes. The TEM images further corroborated the findings: \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae showed a mildly altered sarcomeric architecture, with sarcomere length comparable to that of wild type larvae, while \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae exhibited a more severe phenotype (Fig. 3d) with markedly shortened sarcomeres, confirming that this variant has a more detrimental effect on the organization of the muscle fibers in the homozygous state (Fig. 3d).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTranscriptomics reveals dysregulation of muscle genes in\u003c/strong\u003e \u003cstrong\u003eoltitin\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eC31712R/C31712R\u003c/strong\u003e\u003c/sup\u003e \u003cstrong\u003elarvae\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eTo molecularly characterize the effect of this variant, we analyzed the whole transcriptome of the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e and, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae by RNA sequencing. Principal Component Analysis (PCA) plot showed separate clustering of sample groups (Fig. 4a). We therefore analyzed and compared the differential gene expression among these three groups. Heterozygous \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e samples revealed that 1,133 genes were significantly upregulated, while 1,415 genes were downregulated compared to wild type \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e. On the other hand, the comparison of homozygous samples against wild type revealed 537 significantly upregulated and 470 significantly downregulated genes. From these, a total of 237 genes were found to be commonly upregulated, while 128 genes were found to be commonly downregulated (Fig.\u0026nbsp;4b).\u003c/p\u003e\n \u003cp\u003eAs homozygous larvae exhibited a dysregulated gene pattern and a more compromised muscle phenotype, subsequent analysis focused on comparing homozygous and wild type larvae. Pathway analysis revealed enriched GO terms for extracellular matrix, external encapsulating structure, endopeptidase activity and regulation, and several metabolic processes (Fig. 4c). In this context, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e samples exhibited a higher fold enrichment for most of the top-enriched terms.\u003c/p\u003e\n \u003cp\u003eFurthermore, differential gene expression analysis revealed a dysregulated pattern of specific genes involved in cytoskeletal regulation and muscle structure (Fig. 4d). Interestingly, myosin heavy chain \u0026beta;, fast skeletal muscle genes (LOC101164699 and LOC101163903), fast skeletal muscle-like genes (LOC101163631 and LOC101163661), and \u003cem\u003ecnn2\u003c/em\u003e (Calponin) were found notably downregulated in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae, compared to wild type larvae (Fig. 4d). In contrast, a significant upregulation of \u003cem\u003etwf1\u003c/em\u003e (Twinfilin-1), \u003cem\u003eplastin 1- I isoform\u003c/em\u003e (LOC101168586), \u003cem\u003eplastin-3 T-plastin\u003c/em\u003e (LOC101161915), \u003cem\u003ecoro6\u003c/em\u003e (Coronin) and \u003cem\u003emylpf\u003c/em\u003e (myosin light chain, phosphorylatable) was observed. Also, \u003cem\u003eunc45b\u003c/em\u003e (Protein unc-45 homolog B) a myosin-specific chaperone integral for sarcomere assembly and maintenance was significantly upregulated in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae compared to wild type larvae. These results suggest the disruption of actin filament organization and muscle integrity in the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae.\u003c/p\u003e\n \u003cp\u003eMoreover, genes involved in autophagy, protein turnover and cellular homeostasis were also notably dysregulated in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e samples (Fig. 4d). We observed a significant downregulation of autophagy genes such as \u003cem\u003esqstm1\u003c/em\u003e (Sequestosome 1) and \u003cem\u003eplekhg2\u003c/em\u003e (Pleckstrin homology domain containing, family G with RhoGef domain) member 2), and a significant upregulation of \u003cem\u003esesn1\u003c/em\u003e (Sestrin 1) and \u003cem\u003etp53in2\u003c/em\u003e (Tumor protein p53 inducible nuclear protein 2). Co-chaperone genes such as \u003cem\u003ebag3\u003c/em\u003e (bcl2-associated athanogene 3), involved in protein homeostasis, were also significantly downregulated in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e samples, thus suggesting a possible alteration in autophagy pathways. Finally, \u003cem\u003erbm20\u003c/em\u003e encoding for the main factor regulating titin splicing, was also found to be downregulated in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e samples.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eMutant larvae exhibit an impaired swimming behavior\u003c/h2\u003e\n \u003cp\u003eTo investigate the impact of this variant on the skeletal muscle function, we analyzed the free-swim behavior of the larvae at seven days post-hatching. The analysis of the movement trace of individual larvae within the well showed clear differences in the swimming behavior of the larvae, with the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae exhibiting faltering swimming (Fig. 5A). Quantification of the movement over the recording period showed that \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae displayed lower movement time (Fig. 5b-c). Therefore, \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae exhibit a longer period of inactivity, compared to their siblings, indicating that muscle fibers damage hinders their swimming behavior.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eMechanical performance of skeletal muscle\u003c/h2\u003e\n \u003cp\u003eThe faltering swimming of the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae with respect to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae was further investigated by determining the performance of the skeletal muscle. The tail muscle was electrically stimulated under isometric conditions with trains of pulses to elicit fused tetani (Fig. 6a-b). In \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae, the latency between the stimulus start and the beginning of force development (\u003cem\u003el\u003c/em\u003e\u003csub\u003eR\u003c/sub\u003e) and the half-time for the development of tetanic force (\u003cem\u003et\u003c/em\u003e\u003csub\u003e1/2D\u003c/sub\u003e) are not significantly different (p\u0026thinsp;\u0026gt;\u0026thinsp;0.1) compared to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae, while the plateau tetanic force (\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e), normalized by the CSA of the tail, is significantly reduced from 84\u0026thinsp;\u0026plusmn;\u0026thinsp;5 kPa to 30\u0026thinsp;\u0026plusmn;\u0026thinsp;8 kPa (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig. 6a-b and Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Considering the cross-sectional area of the tail (CSA), the fractional area occupied by the muscle fibers in the muscle of the tail (\u003cem\u003ef\u003c/em\u003e) and the number of fibers in the cross-section (\u003cem\u003en\u003c/em\u003e) (Fig. 3b and Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e), the average CSA per fiber (CSA\u003csub\u003efiber\u003c/sub\u003e) can be calculated as CSA \u0026times; \u003cem\u003ef\u003c/em\u003e / \u003cem\u003en\u003c/em\u003e. The average isometric force per fiber (\u003cem\u003ef\u003c/em\u003e\u003csub\u003efiber\u003c/sub\u003e) can be calculated as \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/\u003cem\u003ef\u003c/em\u003e. CSA\u003csub\u003efiber\u003c/sub\u003e is about 30 mm\u003csup\u003e2\u003c/sup\u003e independently on genotype, resulting in \u003cem\u003ef\u003c/em\u003e\u003csub\u003efiber\u003c/sub\u003e of 1.6 mN in the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae, about 40% compared to in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae (3.8 mN) (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). The force-velocity (\u003cem\u003eT\u003c/em\u003e-\u003cem\u003eV\u003c/em\u003e) relation was determined with after-loaded contractions (Fig.\u0026nbsp;6c). Following the transition to the isotonic contraction, the shortening exhibits an initial velocity that progressively reduces with time (inset Fig.\u0026nbsp;6), likely because of the rising resistance to shortening of the noncontractile internal structures, as the notochord in parallel with the myofibers. The initial shortening velocity (\u003cem\u003eV\u003c/em\u003e) at each imposed load (\u003cem\u003eT\u003c/em\u003e) was measured as the slope of the first order regression line to the initial part of the shortening. The velocity of unloaded shortening (\u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e) was determined as free parameter of the Hill hyperbolic equation [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e] (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e reduced to about 50% in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae (about 11.5 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s, Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) compared to the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae (about 23. 3 \u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s) and the power output, calculated from the \u003cem\u003eT\u003c/em\u003e-\u003cem\u003eV\u003c/em\u003e relation as \u003cem\u003eW\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eT\u003c/em\u003e\u0026times;\u003cem\u003eV\u003c/em\u003e, has a maximum value (\u003cem\u003eW\u003c/em\u003e\u003csub\u003emax\u003c/sub\u003e) reduced to about 20% in the homozygous larvae (from 3.2 \u003cem\u003eT\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e\u0026times;\u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae, to 0.64 \u003cem\u003eT\u003c/em\u003e/\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e\u0026times;\u003cem\u003eL\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e/s in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae, Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\" class=\"fr-table-selection-hover\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eStructural (\u003cstrong\u003eA\u003c/strong\u003e) and mechanical (\u003cstrong\u003eB\u003c/strong\u003e and \u003cstrong\u003eC\u003c/strong\u003e) parameters of the skeletal muscles of the tail of the medaka fish larva.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"4\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e (n\u0026thinsp;=\u0026thinsp;5)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e (n\u0026thinsp;=\u0026thinsp;9)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ep-value\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCSA, \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e25,600\u0026thinsp;\u0026plusmn;\u0026thinsp;4,700\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e21,200\u0026thinsp;\u0026plusmn;\u0026thinsp;2,000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.523\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFractional area occupied by the fibers (\u003cem\u003ef\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.641\u0026thinsp;\u0026plusmn;\u0026thinsp;0,012\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.594\u0026thinsp;\u0026plusmn;\u0026thinsp;0.009*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.040\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNumber of fibers in the cross-section (\u003cem\u003en\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e568\u0026thinsp;\u0026plusmn;\u0026thinsp;28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e392\u0026thinsp;\u0026plusmn;\u0026thinsp;22**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCSA\u003csub\u003efiber\u003c/sub\u003e, \u0026micro;m\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e29.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e32.9\u0026thinsp;\u0026plusmn;\u0026thinsp;2.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.373\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNumber of fibers per m\u003csup\u003e2\u003c/sup\u003e (x10\u003csup\u003e12\u003c/sup\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.035\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.031\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.332\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, kPa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e84\u0026thinsp;\u0026plusmn;\u0026thinsp;5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e30\u0026thinsp;\u0026plusmn;\u0026thinsp;8**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.002\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0,c\u003c/sub\u003e, kPa\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e131\u0026thinsp;\u0026plusmn;\u0026thinsp;7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e51\u0026thinsp;\u0026plusmn;\u0026thinsp;14**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003el\u003c/em\u003e\u003csub\u003eR\u003c/sub\u003e, ms\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.511\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003et\u003c/em\u003e\u003csub\u003e1/2,D\u003c/sub\u003e, ms\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e2.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.190\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ef\u003c/em\u003e\u003csub\u003efiber\u003c/sub\u003e, \u0026micro;N\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.79\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.009\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, L\u003csub\u003e0\u003c/sub\u003e/s\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e23.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e11.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e6.3\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;6\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eW\u003c/em\u003e\u003csub\u003emax\u003c/sub\u003e, T/T\u003csub\u003e0\u003c/sub\u003e\u0026times;L\u003csub\u003e0\u003c/sub\u003e/s\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.19\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.4\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;9\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eMechanical parameters are determined during isometric (\u003cstrong\u003eB\u003c/strong\u003e) and isotonic (\u003cstrong\u003eC\u003c/strong\u003e) contractions. CSA, cross-sectional area of the tail; CSA\u003csub\u003efiber\u003c/sub\u003e, average CSA per fiber (calculated as CSA \u0026times; \u003cem\u003ef\u003c/em\u003e / \u003cem\u003en\u003c/em\u003e); the number of fibers per unit area is calculated as 1/CSA\u003csub\u003efiber\u003c/sub\u003e. \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, steady isometric force; \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0,c\u003c/sub\u003e, steady isometric force taking into account of the fractional area occupied by the fibers (\u003cem\u003eT\u003c/em\u003e\u003csub\u003e0,c\u003c/sub\u003e \u003cem\u003e= T\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e \u003cem\u003e/ f\u003c/em\u003e); \u003cem\u003el\u003c/em\u003e\u003csub\u003e\u003cem\u003eR\u003c/em\u003e\u003c/sub\u003e, latency of force rise measured from the beginning of the stimulation; \u003cem\u003et\u003c/em\u003e\u003csub\u003e1/2D\u003c/sub\u003e, time from the start of force rise to one-half \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e during force development; \u003cem\u003ef\u003c/em\u003e\u003csub\u003efiber\u003c/sub\u003e, average force per fiber calculated as \u003cem\u003eT\u003c/em\u003e\u003csub\u003e0,c\u003c/sub\u003e / number of fibers per m\u003csup\u003e2\u003c/sup\u003e); \u003cem\u003eV\u003c/em\u003e\u003csub\u003e0\u003c/sub\u003e, unloaded shortening velocity estimated by the ordinate intercept of the Hill\u0026rsquo;s equation interpolated to the \u003cem\u003eT\u003c/em\u003e-\u003cem\u003eV\u003c/em\u003e data; \u003cem\u003eW\u003c/em\u003e\u003csub\u003emax\u003c/sub\u003e, maximum power output. In the mechanical experiments the sarcomere length was 2.05\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02 \u0026micro;N in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e larvae and 2.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01 \u0026micro;N in \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae. Values are mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Asterisks indicate statistical significance (*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eHereditary Myopathy with Early Respiratory Failure (HMERF) is a severe neuromuscular disorder that has a high impact on patients\u0026rsquo; health and life expectancy. Initially thought to be an extremely rare disease, several variants have been described in many different families over the last two decades, sparking the interest in its pathomechanism [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. HMERF is characterized by distinctive clinical features and muscle pathology, including respiratory failure, muscles weakness, fiber-size variation and cytoplasmic bodies (CB) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In this study, we investigate the impact of the most frequent variant of HMERF patients p.(C31712R), to reveal its downstream effects leading to the muscle disease. To this end, we have generated and thoroughly characterized the first vertebrate model for HMERF, establishing medaka fish as a new genetic model for this disease. The striking aspect of our study is the severe phenotype and the heavily reduced lifespan of the homozygous knock-in animals. While human HMERF patients typically harbor the p.(C31712R) missense mutation in heterozygosity, the same heterozygous variant in medaka slightly alters the fiber muscle development and organization. However, the pathological signs do not seem to affect the development or the lifespan of the fish. This discrepancy might be attributed to species-specific differences in gene expression regulation, penetrance, or epistasis. At the same time, the absence of homozygous patients for the p.(C31712R) variants may even suggest homozygosity to be incompatible with human life.\u003c/p\u003e \u003cp\u003eNotably, although both \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e and \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae showed a wild type-like phenotype when freshly hatched, our analysis revealed that already the seven days post-hatched larvae show impaired muscle organization and function. This was corroborated by histological sections, immunostainings and TEM sections of skeletal muscles which showed a severe disorganization of myofibers and sarcomeres in the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae. The altered fibers integrity and sarcomere length observed in the \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e larvae is consistent with findings from other studies on titin-related muscle diseases, where mutations in titin result in the degeneration of muscle fiber ultrastructure and function [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Taken together, these results underscore the critical role of titin in maintaining muscle structure and function, and they highlight that variants in the specific FN3-119 (A150) domain led to significant muscle defects in both human and medaka fish. Moreover, one hallmark of the HMERF disease is the presence of cytoplasmic bodies (CBs), which are identified by immunohistochemical analysis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Neither \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/C31712R\u003c/sup\u003e nor \u003cem\u003eoltitin\u003c/em\u003e\u003csup\u003eC31712R/+\u003c/sup\u003e larvae exhibited cytoplasmic bodies. Instead, they clearly displayed myofibrillar disorganization, which is another striking characteristic feature of HMERF patients [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The absence of CBs in our model could be due to the timing of our analyses, as such aggregates may accumulate at later adult stages, that were not captured in our study.\u003c/p\u003e \u003cp\u003eTranscriptomic analyses reveal that most of the differentially expressed genes are involved in extracellular matrix organization and metabolic processes, alterations commonly observed as secondary effects of muscle damage and disrupted sarcomere dynamics. Also, targeted analysis of specific genes implicated in cytoskeletal structure, protein quality control, and autophagy regulation uncovers significant dysregulation in homozygous larvae. Alterations to the autophagy process have already been reported in skeletal myopathies [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] and in titin-related cardiomyopathies [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Notably, also the co-chaperone BAG3 (bcl2-associated athanogene 3), known to be involved in hereditary myopathies with disorganized myofibrillar structure [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], was found highly dysregulated in homozygous larvae. These results suggest that autophagy dysregulation may play a role also in the HMERF pathogenesis and may be related to the cytoplasmic bodies and rimmed vacuolar pathology seen in the patients.\u003c/p\u003e \u003cp\u003eFurthermore, the RNA-binding motif protein 20 (RBM20), a key regulator of alternative splicing in striated muscle, is also found to be differentially expressed in our model. RBM20 is known to control the splicing of several genes, including \u003cem\u003eTTN\u003c/em\u003e, and its mutation leads to dilated cardiomyopathy in humans [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These findings suggest that RBM20-mediated splicing alterations may contribute to the observed muscle pathology in medaka model.\u003c/p\u003e \u003cp\u003eIn line with the observed muscle structural defects, functional assessments through locomotor assays indicate that homozygous medaka larvae spend significantly more time in a resting state and exhibit limited movement. This behavioral phenotype is likely due to the reduced performance of the skeletal muscle, as supported by the mechanical analysis of the tail, which shows that skeletal muscle fibers of homozygous larvae develop lower power output because of a reduced capability to generate force and shortening at high speed. These findings are consistent with previous studies on titinopathies [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], demonstrating that structural abnormalities in muscle fibers are directly correlated with impaired function.\u003c/p\u003e \u003cp\u003eThe development of animal models that faithfully recapitulate human \u003cem\u003eTTN\u003c/em\u003e gene variants has been pivotal in advancing our understanding of titin-related disorders. Several rodent and zebrafish models have been successfully engineered to mimic disease-relevant mutations observed in patients [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The FINmaj mouse model, a model for LGMD R10, exhibits muscle weakness and progressive cardiomyopathy, reinforcing the critical role of intact titin for sarcomere stability and contractile function. On the other hand, fish models provide complementary advantages, including rapid development, optical transparency, and the ability to conduct high-throughput genetic studies. For example, the \u003cem\u003e\u0026ldquo;runzel\u0026rdquo; (ruz)\u003c/em\u003e and \u0026ldquo;\u003cem\u003epickwick\u0026rdquo; (pik)\u003c/em\u003e zebrafish models, which carry mutations in the N2A and in the N2B regions of titin respectively, manifest skeletal muscle (\u003cem\u003eruz\u003c/em\u003e) and cardiac (\u003cem\u003eruz)\u003c/em\u003e phenotypes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Similarly, \u0026ldquo;\u003cem\u003enon-spring heart model\u0026rdquo;\u003c/em\u003e (\u003cem\u003ensh\u003c/em\u003e), a medaka model carrying a mutation in the MURF1-titin interacting domain, also presents a cardiac phenotype [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In this context, our study provides the first medaka model reproducing a missense mutation found in HMERF patients and to manifest a skeletal muscle phenotype.\u003c/p\u003e \u003cp\u003eIn conclusion, our study provides novel insights into the muscle pathology associated with Hereditary Myopathy with Early Respiratory Failure and establishes a robust in vivo knock-in medaka model that faithfully recapitulates key aspects of the human disease. The combination of altered muscle architecture, impaired locomotor behavior reflecting reduced muscle performance, and dysregulated gene expression underscores the complexity of the pathological mechanisms underlying HMERF. Beyond advancing our understanding of disease mechanisms, this work highlights the value of genome editing in animal models to dissect the molecular basis of human genetic disorders and underscores the potential of medaka fish as a powerful and versatile experimental system. Compared to zebrafish, medaka possess a smaller genome and lack duplication of many genes, including titin, enabling more straightforward and genetically interpretable genome editing approaches. Importantly, the suitability of medaka for drug screening applications positions this model as a promising platform for future studies aimed at delineating the pathogenic cascade and identifying therapeutic targets for neuromuscular disorders.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study falls under the ethical approval HUS/16896/2022 by the ethics committee of the Hospital District of Helsinki and Uusimaa (HUS). All studies on fish larvae were conducted in strict accordance with the institutional guidelines for animal research and approved by the Italian Ministry of Health, Department of Public Health, Animal Health, Nutrition and Food Safety in accordance with the law on animal experimentation (article 31; D.L. 26/2014; protocol number: 0016304-21/07/2020-DGSAF-MDS-P).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u0026nbsp;\u003c/strong\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eNo conflict of interest to declare\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials:\u0026nbsp;\u003c/strong\u003eAll data generated in this study are available in the manuscript or from the authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the European Commission under the HORIZON EUROPE Framework Program (grant approval #101080874 to MS), the Research Council of Finland (#351510 to BU, #339437 to MS), Samfundet Folkhälsan (to MS and BU), the Sigrid Jusélius Foundation (#230217 to MS and BU), European Joint Program on Rare Diseases (‘Improved diagnostic output in large sarcomeric genes IDOLS-G’ EJPRD19-126 \u0026nbsp;to BU and ML), AFM-Téléthon (#25116 BU, IC, ML and VN), Recovery plan for Europe (Next Generation EU program) (DM 1557 11.10.2022, Investment PE8–Project Age-It, to ML), Italian Ministry of University and Research (MUR, PRIN2022-PNRR, P2022XPT32, CUP: B53D23033280001 to ML) and the Telethon Foundation (Program for Undiagnosed Diseases-TUDP #GSP1500124 to VC and VN).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors' contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: VC, MS, JS, BJ, VN, IC, ML. Experimental data preparation and analysis: VC. RNA-Sequencing: VC, SNG. TEM experiments: VC, FGS, EP. Mechanical experiments: VC, MM, ML, IM, MR, MC. Locomotor experiments: VC, AS. Manuscript writing and editing: VC, SNG, MS, ML. Manuscript final review and editing: alla authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the staff from the Medaka facility and Conte’s lab for their help with fish husbandry and helpful discussion during the preparation of the manuscript. We thank Ylenia Monfregola for her help in the design of guide RNAs and donor ssRNA. We also thank Annalaura Torella for the help in managing the project and for her critical review of the manuscript draft. Finally, we thank Graziano Fiorito and Giovanni Annona for the support with the swimming behavioral tests using DanioVision.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBang ML, Centner T, Fornoff F, Geach AJ, Gotthardt M, McNabb M, Witt CC, Labeit D, Gregorio CC, Granzier H, Labeit S (2001) The complete gene sequence of titin, expression of an unusual approximately 700-kDa titin isoform, and its interaction with obscurin identify a novel Z-line to I-band linking system. Circ Res 89:1065\u0026ndash;1072. doi: 10.1161/hh2301.100981\u003c/li\u003e\n\u003cli\u003eDobin A, Gingeras TR (2016) Optimizing RNA-Seq Mapping with STAR. Methods Mol Biol 1415:245\u0026ndash;262. doi: 10.1007/978-1-4939-3572-7_13\u003c/li\u003e\n\u003cli\u003eEhler E, Gautel M (2008) The sarcomere and sarcomerogenesis. Adv Exp Med Biol 642:1\u0026ndash;14. doi: 10.1007/978-0-387-84847-1_1\u003c/li\u003e\n\u003cli\u003eGhaoui R, Palmio J, Brewer J, Lek M, Needham M, Evil\u0026auml; A, Hackman P, Jonson P-H, Penttil\u0026auml; S, Vihola A, Huovinen S, Lindfors M, Davis RL, Waddell L, Kaur S, Yiannikas C, North K, Clarke N, MacArthur DG, Sue CM, Udd B (2016) Mutations in HSPB8 causing a new phenotype of distal myopathy and motor neuropathy. Neurology 86:391\u0026ndash;398. doi: 10.1212/WNL.0000000000002324\u003c/li\u003e\n\u003cli\u003eGohlke J, Lindqvist J, Hourani Z, Heintzman S, Tonino P, Elsheikh B, Morales A, Vatta M, Burghes A, Granzier H, Roggenbuck J (2024) Pathomechanisms of Monoallelic variants in TTN causing skeletal muscle disease. Hum Mol Genet 33:2003\u0026ndash;2023. doi: 10.1093/hmg/ddae136\u003c/li\u003e\n\u003cli\u003eGuo W, Schafer S, Greaser ML, Radke MH, Liss M, Govindarajan T, Maatz H, Schulz H, Li S, Parrish AM, Dauksaite V, Vakeel P, Klaassen S, Gerull B, Thierfelder L, Regitz-Zagrosek V, Hacker TA, Saupe KW, Dec GW, Ellinor PT, MacRae CA, Spallek B, Fischer R, Perrot A, \u0026Ouml;zcelik C, Saar K, Hubner N, Gotthardt M (2012) RBM20, a gene for hereditary cardiomyopathy, regulates titin splicing. Nat Med 18:766\u0026ndash;773. doi: 10.1038/nm.2693\u003c/li\u003e\n\u003cli\u003eGuo W, Zhu C, Yin Z, Wang Q, Sun M, Cao H, Greaser ML (2018) Splicing Factor RBM20 Regulates Transcriptional Network of Titin Associated and Calcium Handling Genes in The Heart. Int J Biol Sci 14:369\u0026ndash;380. doi: 10.7150/ijbs.24117\u003c/li\u003e\n\u003cli\u003eHigashikuse Y, Mittal N, Arimura T, Yoon SH, Oda M, Enomoto H, Kaneda R, Hattori F, Suzuki T, Kawakami A, Gasch A, Furukawa T, Labeit S, Fukuda K, Kimura A, Makino S (2019) Perturbation of the titin/MURF1 signaling complex is associated with hypertrophic cardiomyopathy in a fish model and in human patients. Dis Model Mech 12:dmm041103. doi: 10.1242/dmm.041103\u003c/li\u003e\n\u003cli\u003eHill AV (1938) The heat of shortening and the dynamic constants of muscle. Proc R Soc Lond B 126:136\u0026ndash;195. doi: 10.1098/rspb.1938.0050\u003c/li\u003e\n\u003cli\u003eIwamatsu T (2004) Stages of normal development in the medaka Oryzias latipes. Mech Dev 121:605\u0026ndash;618. doi: 10.1016/j.mod.2004.03.012\u003c/li\u003e\n\u003cli\u003eKolberg L, Raudvere U, Kuzmin I, Vilo J, Peterson H (2020) gprofiler2 -- an R package for gene list functional enrichment analysis and namespace conversion toolset g:Profiler. F1000Res 9:ELIXIR-709. doi: 10.12688/f1000research.24956.2\u003c/li\u003e\n\u003cli\u003eKr\u0026uuml;ger M, K\u0026ouml;tter S (2016) Titin, a Central Mediator for Hypertrophic Signaling, Exercise-Induced Mechanosignaling and Skeletal Muscle Remodeling. Front Physiol 7:76. doi: 10.3389/fphys.2016.00076\u003c/li\u003e\n\u003cli\u003eLange S, Xiang F, Yakovenko A, Vihola A, Hackman P, Rostkova E, Kristensen J, Brandmeier B, Franzen G, Hedberg B, Gunnarsson LG, Hughes SM, Marchand S, Sejersen T, Richard I, Edstr\u0026ouml;m L, Ehler E, Udd B, Gautel M (2005) The kinase domain of titin controls muscle gene expression and protein turnover. Science 308:1599\u0026ndash;1603. doi: 10.1126/science.1110463\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:550. doi: 10.1186/s13059-014-0550-8\u003c/li\u003e\n\u003cli\u003eMarcello M, Cetrangolo V, Morotti I, Squarci C, Caremani M, Reconditi M, Savarese M, Bianco P, Piazzesi G, Lombardi V, Udd B, Conte I, Nigro V, Linari M (2024) Sarcomere level mechanics of the fast skeletal muscle of the medaka fish larva. Am J Physiol Cell Physiol 326:C632\u0026ndash;C644. doi: 10.1152/ajpcell.00530.2023\u003c/li\u003e\n\u003cli\u003eMarcello M, Cetrangolo V, Savarese M, Udd B (2022) Use of animal models to understand titin physiology and pathology. J Cell Mol Med 26:5103\u0026ndash;5112. doi: 10.1111/jcmm.17533\u003c/li\u003e\n\u003cli\u003eMurakami Y, Futamata R, Horibe T, Ueda K, Kinoshita M (2020) CRISPR/Cas9 nickase-mediated efficient and seamless knock-in of lethal genes in the medaka fish Oryzias latipes. Dev Growth Differ 62:554\u0026ndash;567. doi: 10.1111/dgd.12700\u003c/li\u003e\n\u003cli\u003ePalmio J, Evil\u0026auml; A, Chapon F, Tasca G, Xiang F, Br\u0026aring;dvik B, Eymard B, Echaniz-Laguna A, Laporte J, K\u0026auml;rpp\u0026auml; M, Mahjneh I, Quinlivan R, Lafor\u0026ecirc;t P, Damian M, Berardo A, Taratuto AL, Bueri JA, Tommiska J, Raivio T, Tuerk M, G\u0026ouml;litz P, Chevessier F, Sewry C, Norwood F, Hedberg C, Schr\u0026ouml;der R, Edstr\u0026ouml;m L, Oldfors A, Hackman P, Udd B (2014) Hereditary myopathy with early respiratory failure: occurrence in various populations. J Neurol Neurosurg Psychiatry 85:345\u0026ndash;353. doi: 10.1136/jnnp-2013-304965\u003c/li\u003e\n\u003cli\u003ePalmio J, Leonard-Louis S, Sacconi S, Savarese M, Penttil\u0026auml; S, Semmler A-L, Kress W, Mozaffar T, Lai T, Stojkovic T, Berardo A, Reisin R, Attarian S, Urtizberea A, Cobo AM, Maggi L, Kurbatov S, Nikitin S, Milisenda JC, Fatehi F, Raimondi M, Silveira F, Hackman P, Claeys KG, Udd B (2019) Expanding the importance of HMERF titinopathy: new mutations and clinical aspects. J Neurol 266:680\u0026ndash;690. doi: 10.1007/s00415-019-09187-2\u003c/li\u003e\n\u003cli\u003ePasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I, Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y, Bobe J (2016) Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database. BMC Genomics 17:368. doi: 10.1186/s12864-016-2709-z\u003c/li\u003e\n\u003cli\u003eQian F-Y, Guo Y-D, Zu J, Zhang J-H, Zheng Y-M, Abdoulaye IA, Pan Z-H, Xie C-M, Gao H-C, Zhang Z-J (2021) A novel recessive mutation affecting DNAJB6a causes myofibrillar myopathy. Acta Neuropathol Commun 9:23. doi: 10.1186/s40478-020-01046-w\u003c/li\u003e\n\u003cli\u003eRees M, Nikoopour R, Fukuzawa A, Kho AL, Fernandez-Garcia MA, Wraige E, Bodi I, Deshpande C, \u0026Ouml;zdemir \u0026Ouml;, Daimag\u0026uuml;ler H-S, Pfuhl M, Holt M, Brandmeier B, Grover S, Fluss J, Longman C, Farrugia ME, Matthews E, Hanna M, Muntoni F, Sarkozy A, Phadke R, Quinlivan R, Oates EC, Schr\u0026ouml;der R, Thiel C, Reimann J, Voermans N, Erasmus C, Kamsteeg E-J, Konersman C, Grosmann C, McKee S, Tirupathi S, Moore SA, Wilichowski E, Hobbiebrunken E, Dekomien G, Richard I, Van den Bergh P, Dom\u0026iacute;nguez-Gonz\u0026aacute;lez C, Cirak S, Ferreiro A, Jungbluth H, Gautel M (2021) Making sense of missense variants in TTN-related congenital myopathies. Acta Neuropathol 141:431\u0026ndash;453. doi: 10.1007/s00401-020-02257-0\u003c/li\u003e\n\u003cli\u003eSarparanta J, Jonson PH, Golzio C, Sandell S, Luque H, Screen M, McDonald K, Stajich JM, Mahjneh I, Vihola A, Raheem O, Penttil\u0026auml; S, Lehtinen S, Huovinen S, Palmio J, Tasca G, Ricci E, Hackman P, Hauser M, Katsanis N, Udd B (2012) Mutations affecting the cytoplasmic functions of the co-chaperone DNAJB6 cause limb-girdle muscular dystrophy. Nat Genet 44:450\u0026ndash;455, S1-2. doi: 10.1038/ng.1103\u003c/li\u003e\n\u003cli\u003eSavarese M, Sarparanta J, Vihola A, Udd B, Hackman P (2016) Increasing Role of Titin Mutations in Neuromuscular Disorders. J Neuromuscul Dis 3:293\u0026ndash;308. doi: 10.3233/JND-160158\u003c/li\u003e\n\u003cli\u003eSelcen D, Muntoni F, Burton BK, Pegoraro E, Sewry C, Bite AV, Engel AG (2009) Mutation in BAG3 causes severe dominant childhood muscular dystrophy. Ann Neurol 65:83\u0026ndash;89. doi: 10.1002/ana.21553\u003c/li\u003e\n\u003cli\u003eSteele HE, Harris E, Barresi R, Marsh J, Beattie A, Bourke JP, Straub V, Chinnery PF (2016) Cardiac involvement in hereditary myopathy with early respiratory failure: A cohort study. Neurology 87:1031\u0026ndash;1035. doi: 10.1212/WNL.0000000000003064\u003c/li\u003e\n\u003cli\u003eSteffen LS, Guyon JR, Vogel ED, Howell MH, Zhou Y, Weber GJ, Zon LI, Kunkel LM (2007) The zebrafish runzel muscular dystrophy is linked to the titin gene. Dev Biol 309:180\u0026ndash;192. doi: 10.1016/j.ydbio.2007.06.015\u003c/li\u003e\n\u003cli\u003eTakeda H, Shimada A (2010) The art of medaka genetics and genomics: what makes them so unique? Annu Rev Genet 44:217\u0026ndash;241. doi: 10.1146/annurev-genet-051710-151001\u003c/li\u003e\n\u003cli\u003eTasca G, Udd B (2018) Hereditary myopathy with early respiratory failure (HMERF): Still rare, but common enough. Neuromuscul Disord 28:268\u0026ndash;276. doi: 10.1016/j.nmd.2017.12.002\u003c/li\u003e\n\u003cli\u003eT\u0026ouml;pf A, Cox D, Zaharieva IT, Di Leo V, Sarparanta J, Jonson PH, Sealy IM, Smolnikov A, White RJ, Vihola A, Savarese M, Merteroglu M, Wali N, Laricchia KM, Venturini C, Vroling B, Stenton SL, Cummings BB, Harris E, Marini-Bettolo C, Diaz-Manera J, Henderson M, Barresi R, Duff J, England EM, Patrick J, Al-Husayni S, Biancalana V, Beggs AH, Bodi I, Bommireddipalli S, B\u0026ouml;nnemann CG, Cairns A, Chiew M-T, Claeys KG, Cooper ST, Davis MR, Donkervoort S, Erasmus CE, Fassad MR, Genetti CA, Grosmann C, Jungbluth H, Kamsteeg E-J, Lornage X, L\u0026ouml;scher WN, Malfatti E, Manzur A, Mart\u0026iacute; P, Mongini TE, Muelas N, Nishikawa A, O\u0026rsquo;Donnell-Luria A, Ogonuki N, O\u0026rsquo;Grady GL, O\u0026rsquo;Heir E, Paquay S, Phadke R, Pletcher BA, Romero NB, Schouten M, Shah S, Smuts I, Sznajer Y, Tasca G, Taylor RW, Tuite A, Van den Bergh P, VanNoy G, Voermans NC, Wanschitz JV, Wraige E, Yoshimura K, Oates EC, Nakagawa O, Nishino I, Laporte J, Vilchez JJ, MacArthur DG, Sarkozy A, Cordell HJ, Udd B, Busch-Nentwich EM, Muntoni F, Straub V (2024) Digenic inheritance involving a muscle-specific protein kinase and the giant titin protein causes a skeletal muscle myopathy. Nat Genet 56:395\u0026ndash;407. doi: 10.1038/s41588-023-01651-0\u003c/li\u003e\n\u003cli\u003eTskhovrebova L, Trinick J (2010) Roles of titin in the structure and elasticity of the sarcomere. J Biomed Biotechnol 2010:612482. doi: 10.1155/2010/612482\u003c/li\u003e\n\u003cli\u003eVan Den Hoogenhof MMG, Beqqali A, Amin AS, Van Der Made I, Aufiero S, Khan MAF, Schumacher CA, Jansweijer JA, Van Spaendonck-Zwarts KY, Remme CA, Backs J, Verkerk AO, Baartscheer A, Pinto YM, Creemers EE (2018) RBM20 Mutations Induce an Arrhythmogenic Dilated Cardiomyopathy Related to Disturbed Calcium Handling. Circulation 138:1330\u0026ndash;1342. doi: 10.1161/CIRCULATIONAHA.117.031947\u003c/li\u003e\n\u003cli\u003eWeihl CC, T\u0026ouml;pf A, Bengoechea R, Duff J, Charlton R, Garcia SK, Dom\u0026iacute;nguez-Gonz\u0026aacute;lez C, Alsaman A, Hern\u0026aacute;ndez-La\u0026iacute;n A, Franco LV, Sanchez MEP, Beecroft SJ, Goullee H, Daw J, Bhadra A, True H, Inoue M, Findlay AR, Laing N, Oliv\u0026eacute; M, Ravenscroft G, Straub V (2023) Loss of function variants in DNAJB4 cause a myopathy with early respiratory failure. Acta Neuropathol 145:127\u0026ndash;143. doi: 10.1007/s00401-022-02510-8\u003c/li\u003e\n\u003cli\u003eXu X, Meiler SE, Zhong TP, Mohideen M, Crossley DA, Burggren WW, Fishman MC (2002) Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat Genet 30:205\u0026ndash;209. doi: 10.1038/ng816\u003c/li\u003e\n\u003cli\u003eZhu P, Li J, Yan F, Islam S, Lin X, Xu X (2024) Allelic heterogeneity of TTNtv dilated cardiomyopathy can be modeled in adult zebrafish. JCI Insight 9:e175501. doi: 10.1172/jci.insight.175501\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Titin, Hereditary myopathy with early respiratory failure (HMERF), knock-in model, medaka fish","lastPublishedDoi":"10.21203/rs.3.rs-8840201/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8840201/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTitin, the largest muscle protein, plays a key role in the architecture of sarcomeres in both the heart and skeletal muscles. Due to its crucial role, variants in this gene have a critical impact on human health. Titinopathies include severe cardiomyopathies and dominant and recessive skeletal muscle diseases, associated with several pathogenic variants. Among these, titin A150/FN3-119 domain variants are associated with hereditary myopathy with early respiratory failure (HMERF), a life-threatening disorder characterized by respiratory failure and proximodistal muscle weakness. Although murine and fish models have been developed for a wide range of titinopathies, an HMERF model is lacking. Here, we generated and characterized an HMERF knock-in model using \u003cem\u003eOryzias latipes\u003c/em\u003e (medaka fish). Upon the generation of this model, which carries the most common HMERF missense variant (p.C31712R), we found that the mutants had impaired muscle structure, with homozygous larvae exhibiting a more severe phenotype than their heterozygous siblings. Focusing our study on the homozygous larvae, we performed RNA sequencing (RNA-seq) analysis, revealing significant dysregulation of genes with key roles in muscle filament organization and autophagy pathway. This suggests exacerbated muscle damage and dysfunction. These results were corroborated by locomotor analyses and mechanical studies, which revealed that homozygous larvae exhibit limited movement and reduced muscle fiber capability to generate force and shortening at high speed. These results demonstrate that structural abnormalities directly correlate with the impaired function in HMERF mutants. Taken together, the altered muscle structure, impaired locomotor behavior, and dysregulated gene expression underscore the complex pathological mechanisms underlying HMERF disease. Beyond elucidating HMERF-disease mechanisms, our work highlights the value of genome editing in medaka fish, a powerful and versatile model system to dissect the molecular basis of human muscle diseases.\u003c/p\u003e","manuscriptTitle":"A Titin Knock-in model for Hereditary Myopathy with Early Respiratory Failure","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-19 11:16:10","doi":"10.21203/rs.3.rs-8840201/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"240b722b-8040-4a42-ba84-63318b0d8282","owner":[],"postedDate":"February 19th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-26T11:26:37+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-19 11:16:10","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8840201","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8840201","identity":"rs-8840201","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.