Overexpression of CIRP in astrocytes contributes to Alzheimer’s disease via downregulation of uPA

Overexpression of CIRP in astrocytes contributes to Alzheimer’s disease via downregulation of uPA | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Overexpression of CIRP in astrocytes contributes to Alzheimer’s disease via downregulation of uPA Ze Li, Jing-Peng Liu, Feng-Hua Yao, Yang Chao, Shou-Chun Li, Yuan-Yang Liu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4685039/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 3 You are reading this latest preprint version Abstract Background: Cold inducible RNA-binding protein (CIRP) is an important danger-associated molecular pattern involved in tissue-specific and systemic inflammation and is also regarded as a potential regulator of Alzheimer’s disease (AD). However, the precise roles and mechanism of CIRP in the functional changes in astrocytes during the development of AD are still unknown. This study aimed to assess gene expression alterations in astrocytes after they overexpress CIRP (oe-CIRP) and to explore the relationship between abnormal CIRP expression and AD. Methods: We established astrocyte cell lines that stably expressed CIRP or control vectors using 3 different kinds of human glioma cell lines, namely, U87, U251 and H4, and analyzed the mRNA expression profiles of 3 pairs of cells via microarray. Then, the significantly differentially expressed mRNAs between the CIRP-overexpressing (ov-CIRP) group and the control group were identified by bioinformatics analysis and validated by quantitative real-time PCR (q-PCR) and western blotting (WB). Finally, the effect of CIRP overexpression in astrocytes on neurons was observed in a coculture system. Results: We identified 119 mRNAs with obvious fold changes between the ov-CIRP and control groups for all 3 pairs of human glioma cell lines. These mRNAs are associated with diseases such as asthma IgE, dehydroepiandrosterone, rheumatoid arthritis, autism spectrum disorder, AD and so on. The biological functional analysis indicated that urokinase plasminogen activator (uPA), a gene whose expression significantly decreased after CIRP overexpression, was closely associated with AD. The results from q-PCR and WB assays confirmed that overexpression of CIRP significantly inhibited uPA at both the mRNA and protein levels in U87, U251 and H4 cells. Moreover, compared with those cocultured with control astrocytes, SH-SY5Y cells cocultured with CIRP-overexpressing astrocytes exhibited a significant increase in the expression of amyloid-β (Aβ)1-42 and the hyperphosphorylated microtubule-associated protein tau (Tau). Conclusion: CIRP overexpression inhibited the expression of uPA in human astrocytes, which promoted the expression of Aβ1‒42 and the phosphorylation of tau in neurons, thus increasing the risk of AD. These results suggest that the overexpression of CIRP in astrocytes contributes to the development of AD. Cold-inducible RNA-binding protein Alzheimer disease astrocyte neuron Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background AD is one of the most common neurodegenerative dementia diseases and is the sixth leading cause of death in the US [1]. In recent years, a large number of new candidate drugs for AD treatment have failed in clinical trials, which has led to poor prospects for AD drug development. Neuronal injury and degeneration are the major features of AD and are specifically manifested as synaptic damage in the hippocampus and defects in learning and memory in neocortex regions[2]. Thus, further exploration of the pathophysiology of synaptic damage during the development of AD is important for identifying new therapeutic methods to protect synapses from irreversible neuron degeneration. As one of the most common cell types in the brain, astrocytes are vital for sustaining neuronal health because they not only supply structural support to neurons but also maintain the balance of brain microenvironments. The interaction between astrocytes and neurons is crucial for the survival and function of dopaminergic neurons. Previous studies have shown that astrocyte dysfunction can cause degenerative alterations in dopaminergic neurons [3, 4]. For example, Cheng et al reported that astrocytes derived from induced pluripotent stem cells could alleviate dopaminergic neurodegeneration in vitro[[5]. Kuter et al. demonstrated that astrocytes play a crucial role in the early degeneration of nigrostriatal neurons[6]. However, the mechanism by which astrocytes affect synaptic function during neurodegeneration is still unclear. Cold-inducible RNA-binding protein (CIRP) comprises an amino-terminal consensus sequence RNA binding domain and a carboxyl-terminal glycine-rich domain[7]. Recent studies have shown that CIRP is involved not only in the regulation of cellular stress responses such as UV irradiation, hypoxia and hypothermia but also in the regulation of damage-associated molecular patterns (DAMPs), which can bind to TLR4 and promote inflammation by activating the nuclear transcription factor nuclear factor-κB[8, 9]. Moreover, several studies have reported that CIRP is capable of regulating neuronal dysfunction via the IL-6Rα/STAT3/Cdk5 pathway and promoting neuronal calpain activity, which is closely associated with pathological changes in neurons from AD patients [10, 11]. Notably, a recent study reported that CIRP may be a potential target of alcohol-induced AD because alcohol-induced CIRP from microglia contributes to the development of AD[12]. Therefore, it is interesting to determine whether abnormal CIRP expression in astrocytes is a risk factor for AD. In this article, we aimed to explore the effects of CIRP overexpression on the expression profiles of mRNAs in human astrocytes and to identify whether and how CIRP regulates AD-associated genes in astrocytes. The microarray results revealed that CIRP overexpression and AD were closely correlated in 3 different human glioma astrocyte cell lines. In addition, this study revealed for the first time that overexpression of CIRP could inhibit the expression of uPA, a favorable factor for AD, in astrocytes. Furthermore, in vitro astrocyte–neuron coculture experiments revealed that the overexpression of CIRP in astrocytes promoted the expression of BACE, Aβ1–42 and phosphorylated tau protein (p-Tau) in neurons. These findings revealed a potential new mechanism of CIRP in the pathology of AD and confirmed that eCIRP is a promising therapeutic target for treating neural degenerative disease. Materials and methods Cell culture Human glioma cell lines, including U87, U251, H4 and human neuroblastoma SH-SY5Y cells, were obtained from Shanghai GeneChem Co., Ltd. (Shanghai, China). The cells were cultured in 6-well plates in DMEM or RPMI-1640 medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Thermo Fisher Scientific) at 37°C and 5% CO 2 . Generation of human CIRP glioma cell lines stably overexpressing CIRP CIRP lentiviral particles containing green fluorescent protein (GFP) and the full length CIRP gene (overexpressing CIRP group) and control lentiviral particles (control group) were purchased from Shanghai Genechem Co., Ltd. Transfection was carried out according to the manufacturer’s instructions. Briefly, the cells were cultured with lentiviral particles and polybrene (5 µg/mL) in medium for 12 h. Then, the medium containing the lentiviral particles was removed, the cells were washed, and complete medium was added. GFP gene expression was observed by fluorescence microscopy at 3 days after transfection. A coculture system SH-SY5Y cells were cultured with complete medium containing 10 µM retinoic acid (Sigma‒Aldrich) for 7 days to allow them to differentiate into neurons, as previously reported[13]. Then, a coculture system was established by plating SH-SY5Y cells and astrocytes in a Transwell system (0.4 µm pore size, Corning, NY, USA). Oe-CIRP or control human astrocytes were cultured in the lower chamber (LC) of the transwell system, and neurons were cultured in the upper chamber (UC). After 24 h, culture medium supplemented with or without uPA (20 ng/ml) was added to the upper and lower chambers. After they were cocultured for 48 h, the cells were collected for gene and protein analysis. Profiling of mRNA expression A core ® lncRNA + mRNA expression profile microarray was used to profile the expression of mRNAs, which was generated by Capitalbio Biotech (Beijing, China). Briefly, RNA samples from cells in different groups were purified, amplified and transcribed into fluorescent cRNAs. Next, cRNA was hybridized to the microarray. The gene expression profiles of human species were detected using the Boao core LncRNA + mRNA Human Gene Expression Microarray V4.0,4x180K chip with the method number AG-GE-WL 10-01-2010 and the data analysis method number AG-GE-DL 00-01-2010. Screening and Mapping of Differentially Expressed Genes After expression spectrum chip hybridization scanning, tiff-format image data were processed using Feature Extraction lift software. Gene expression differences and statistically significant p values were calculated using GeneSpring GX software. Briefly, the tiff plots derived from chip scans were processed with feature extraction software to obtain the raw data files. Then, the raw data files were imported into GeneSpring software, and the data were subjected to written grouping and other parameter information. Each sample was normalized, and QC analysis, cluster analysis and graphical presentation were performed with Cluster3.0 software. Finally, differential comparisons were made to obtain differential genes according to the grouping information, and the differential mRNAs were analyzed by GO pathway analysis. Validation of differentially expressed genes The expression of the screened mRNAs was validated by qRT‒PCR. Briefly, TRIzol reagent was used to extract total RNA from cells, and cDNA was synthesized with SuperScript III reverse transcriptase. Then, target gene expression was quantified using a SLAN Real-Time PCR System (Hongshi, Shanghai, China). GAPDH was used as an internal control. The expression levels were calculated with the primer pairs used for the amplification of target mRNAs, as shown in Table 1 . The data were analyzed using the comparative cycle threshold method. Table 1 The Sequence of Primers Primer Sequence(5' to 3') GAPDH-F AGGTCGGTGTGAACGGATTTG GAPDH-R TGTAGACCATGTAGTTGAGGTCA CIRP-F GGACTCAGCTTCGACACCAAC CIRP-R ATGGCGTCCTTAGCGTCATC BACE-F ATGGTTTCTGGCTAGGAGAGC BACE-R TTGGTAACCTCACCCATTAGGTA Western blotting The cells from the different groups were collected and washed with PBS. Then, the proteins were mixed with cell lysate and centrifuged at 12000 × g at 4°C for 10 min. The supernatant of the mixture was collected for protein extraction with a Qproteome Mammalian Protein Prer kit. The protein concentration was determined using a BCA protein assay kit. Then, the proteins were separated on polyacrylamide gels and transferred onto nitrocellulose membranes by iBlot. The bands were visualized by chemiluminescence using a FluorChem E system. Antibodies against Aβ1 − 42 (25524-1-AP, Proteintech), uPA (ab32057, Abcam) and p-Tau (Ser396) (ab32057, Abcam) were used to determine protein expression. β-Actin was used as the internal control. Statistical analysis The data are shown as the mean ± standard error of the mean (SEM). Statistical analyses were performed with GraphPad Prism 9. One- or two-way analysis of variance (ANOVA) was used to analyze significant differences among the groups, and Student's t test was used to assess the differences between the two groups. P values less than 0.05 were regarded as statistically significant. Results Establishment of astrocyte cell lines overexpressing CIRP The cells were observed by fluorescence microscopy on the third day after they were transfected with control-GFP or CIRP-GFP lentiviral vectors. As shown in Fig. 1 A, more than 80% of the transfected cells expressed GFP, which implied that the efficiency of the infection was greater than 80%. The results from the q-PCR assay demonstrated that the mRNA levels of CIRP were significantly greater in the ov-CIRP group than in the control group, with approximately 59.66-fold, 78.11-fold, and 38.09-fold increases in the U87, U251, and H4 groups, respectively, in the oe-CIRP group compared with the control group (p < 0.001, Fig. 4 D.1B). Western blotting confirmed that the protein expression of CIRP was also greatly increased in the oe-CIRP group compared with the control group for all 3 pairs of astrocytes (all p < 0.001, Fig. 1 B). Identification of mRNAs with significant fold changes in the expression of CIRP in astrocytes We used volcano plots and heatmaps to determine the differences in gene expression between ov-CIRP and control human glioma cells. In total, 119 mRNAs were differentially expressed in all 3 pairs of cells. Among them, 39 mRNAs were strongly upregulated, and 80 mRNAs were obviously downregulated (a threshold of ≥ 2-fold and P < 0.05, Fig. 2 A-C). The changed mRNAs were associated with reproductive progress, rhythmic progress, response to stimulation and so on (Fig. 2 D). The KEGG and GO pathway analyses showed that the up- or downregulated mRNAs were mostly enriched in the FGF signaling pathway, activated NOTCH1 Transmits Signal to the Nucleus, interleukin receptor SHC signaling and so on (Fig. 3 A). Of note, the results of significantly enriched disease terms indicated that the overexpression of CIRP was involved in asthma ige, dehydroepiandrosterone, rheumatoid arthritis, autism spectrum disorder, Alzheimer's disease and so on (Fig. 3 B). CIRP overexpression in astrocytes induced AD-like changes in neurons in a coculture system As shown in Fig. 4 A, SH-SY5Y cells were cocultured with ov-CIRP or control astrocyte cell lines (U251, U87 and H4) to examine whether CIRP overexpression in astrocytes affects amyloid accumulation and hyperphosphorylation in neural cells. The results from q-PCR showed that the mRNA levels of BACE were greatly increased in the ov-CIRP groups compared to those in the control groups, with approximately 5.51-fold, 7.31-fold, and 3.41-fold decreases in the U87, U251, and H4 ov-CIRP groups, respectively, compared with those in the control groups (p < 0.001, Fig. 4 B). The results from the WB assay indicated that the expression levels of Aβ1–42 and p-Tau (Ser396) were significantly greater in the SH-SY5Y cells from the ov-CIRP group than in those from the control group (Aβ1–42:group effect F (1, 12) = 346.8; p-Tau: F (1, 12) = 524.7; all p < 0.001). Figure 4 C). uPA was significantly downregulated after CIRP overexpression To further explore the relationship between CIRP and AD, the top ten mRNAs whose expression changed after CIRP overexpression are listed in Fig. 5 A, which included WNT5B, FGFR3, PSD4, UNC93B1, IFI44, uPA, LBH, BNIP3, LIF and KYNU. Accumulating evidence has shown that tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA) play important roles in the pathogenesis of AD. Thus, we verified the mRNA and protein expression of uPA in all 3 pairs of cells by q‒PCR and WB assays. The results showed that the mRNA levels of uPA were greatly decreased in the ov-CIRP groups compared with those in the control groups, with approximately 38.09-fold, 78.11-fold, and 59.66-fold decreases in U87, U251, and H4, respectively, in the oe-CIRP groups compared with those in the control groups (p < 0.001, Fig. 5 A). Accordingly, the protein expression of uPA was also significantly lower in the oe-CIRP group than in the control group for all 3 pairs of astrocytes (group effect F (1, 12) = 277.3, p < 0.001; Fig. 5 B). uPA alleviated ov-CIRP astrocyte-induced dysfunction of neurons To analyze the effect of uPA on ov-CIRP astrocyte-induced dysfunction of neurons, SH-SY5Y cells were cocultured with ov-CIRP astrocytes treated with or without uPA (Fig. 6 A). Moreover, when ov-CIRP astrocytes (U87, U251, and H4) were treated with uPA, the levels of the Aβ1–42 protein and p-Tau promoted in SH-SY5Y cells induced by ov-CIRP astrocytes were significantly inhibited (ov-CIRP + uPA vs ov-CIRP groups: Aβ1–42 decreased by approximately 40%, 41%, and 30%, respectively, in U87, U251, and H4 cells; p-Tau decreased by approximately 50%, 61%, and 45%, respectively, in U87, U251, and H4 cells, all p < 0.001; Fig. 6 B). Discussion Many researchers believe that more in-depth studies on novel molecular mechanisms and pathological changes in AD are crucial for identifying new drug targets. However, the mechanism by which CIRP affects the development of AD is still unclear. To gain novel insights into the functions of CIRP in the pathogenesis of astrocytes, we comprehensively analyzed the mRNA profiles of 3 pairs of control and ov-CIRP human astrocytoma cell lines. We identified the significantly differentially expressed mRNAs in all 3 pairs of cells and annotated their functions. Previous studies have reported that CIRP is widely involved in various biological processes, including circadian modulation, cell proliferation and survival, telomere maintenance, cellular stress response, inflammation and cancer [14]. Here, the microarray data also revealed that the changes in mRNAs induced by CIRP overexpression were implicated in the response to stimuli, inflammatory bowel disease, cell growth and so on, which was in accordance with previous studies (Fig. 2 , 3 ). Moreover, our work revealed a comprehensive transcriptional network implying that the abnormal expression of CIRP in astrocytes was associated with a series of nervous system diseases, such as autism spectrum disorder, Parkinson's disease (motor and cognitive disorders), bipolar disorder, schizophrenia, and AD (Table 2 ). Table 2 The relative disease of CNS after CIRP over-expression Term Database Input gene symbols P-Value Autism spectrum disorder NHGRI GWAS Catalog IFI44,MAP4K4 0.0171048995095 Parkinson's disease (motor and cognition) NHGRI GWAS Catalog C8orf 0.0253314272708 Normalized brain volume NHGRI GWAS Catalog BICD1 0.0253314272708 Response to antidepressant treatment NHGRI GWAS Catalog DTWD1 0.0581276711223 Bipolar disorder and schizophrenia NHGRI GWAS Catalog LRRIQ3 0.1204990915480 Alzheimer's disease GAD TCN2,PLAU,PSEN2, 0.0278533148062 Hippocampal atrophy GAD PRUNE2 0.0800292664413 Depression GAD ARGLU1 0.1578254639020 Attention deficit disorder with hyperactivity GAD URB2 0.1673380884350 Neuro-degenerative diseases KEGG DISEASE ANO10, PSEN2, 0.3888821624070 It is well known that the pathological damage of AD is related to the accumulation of extracellular senile plaques composed of aggregates of Aβ peptides and the hyperphosphorylation of Tau [15]. Wang et al reported that eCIRP activated STAT3 via IL-6Rα and speculated that eCIRP-derived microglia may be important mediators of neuronal tau phosphorylation after exposure to alcohol [10]. Here, to explore the function of CIRP in astrocyte-induced neuronal injury, the phosphorylation of p-Tau and the expression of BACE and Aβ1–42 in neurons were measured after they were cocultured with ov-CIRP or control astrocytes. Our data revealed for the first time that the overexpression of CIRP in astrocytes greatly promoted the expression of p-Tau (Ser396), Aβ1–42, and BACE in neurons in a coculture system. These results proved that CIRP in astrocytes could act as a vital mediator of AD. Finally, we explored the molecular mechanisms by which CIRP in astrocytes regulates neuronal tau phosphorylation. Microarray analysis revealed three mRNAs in astrocytes that are candidates for AD after CIRP overexpression. Among them, uPAs gained our attention. uPA encodes a secreted serine protease that converts plasminogen to plasmin, and mutation of uPA is closely associated with the onset of Alzheimer's disease. Thus, we measured the expression levels of uPA in control and ov-CIRP astrocytoma cells by q-PCR and WB assays. The results confirmed a significant decrease in uPA in ov-CIRP astrocytes compared with control astrocytes at both the mRNA and protein levels. Merino et al. reported that uPA and its receptor were mainly expressed in neuronal extensions, growth cones and a subpopulation of astrocytes in the mature brain, and the release of uPA in the mature central nervous system could improve axonal and synaptic function after injury[16, 17]. Moreover, increasing evidence has shown that the plasminogen activator urokinase can protect neurons from amyloid β-triggered synaptic injury[18, 19]. On the basis of this evidence, we speculated that the neuronal damage induced by CIRP overexpression in astrocytes may involve decreased expression of uPA. Thus, we added uPA to an astrocyte neuron coculture system and found that uPA treatment significantly alleviated ov-CIRP astrocyte-induced dysfunction of neurons, as evidenced by decreased Aβ1‒42 accumulation and tau hyperphosphorylation in the ov-CIRP + uPA group. These results implied that the overexpression of CIRP in astrocytes could cause AD-like alterations in neurons partly through the downregulation of uPA. Notably, previous studies have focused mainly on the function of neuronal uPAs in AD. Here, we revealed for the first time that abnormal expression of uPAs in astrocytes is another cause of neuron dysfunction. Our data confirmed the significant role of CIRP in the development of AD, provided insight into the molecular signaling involved in CIRP-induced neuronal damage, and provided a possible new therapeutic target for alleviating cognitive decline during AD. However, the current work explored the roles of CIRP only in astrocytes at the cellular level, and further studies should be carried out in animals. Moreover, the mechanism by which CIRP affects the levels of uPA is still unclear. In summary, this study revealed that the overexpression of CIRP in astrocytes exerts a harmful impact on neurons by elevating the expression levels of BACE, Aβ1–42 and p-Tau (Ser396) in neurons via the downregulation of uPA (Figure. 7). Thus, the downregulation of CIRP expression may be a useful method for alleviating synaptic dysfunction during AD. Declarations Funding The present work was supported by grants from the PLA General Hospital Youth Independent Innovation Science Fund project (22QNFC106, 22QNFC003) and the National Natural Science Foundation of China (82172124). Competing interests All the authors declare that they have no competing interests. Author's contributions ZL, JPL and FHY carried out the cell experiments and drafted the article. YC and SCL performed the data analysis. YXL and XWS drew the illustrations. YXL and AJL conceived and supervised the study. All the authors have read and approved the final manuscript. Availability of data and materials All the datasets in the manuscript or additional files are available from the corresponding authors upon reasonable request. Ethics approval and consent to participate The experiments were approved by the Ethical Committee of the General Hospital of the Chinese PLA, Beijing, China. Consent for publication All the authors approved the publication of the final manuscript. References 2020 Alzheimer's disease facts and figures . Alzheimers Dement 2020. Sanabria-Castro A, Alvarado-Echeverria I, Monge-Bonilla C: Molecular Pathogenesis of Alzheimer's Disease: An Update . Ann Neurosci 2017, 24 (1):46-54. Booth HDE, Hirst WD, Wade-Martins R: The Role of Astrocyte Dysfunction in Parkinson's Disease Pathogenesis . Trends Neurosci 2017, 40 (6):358-370. Bantle CM, Hirst WD, Weihofen A, Shlevkov E: Mitochondrial Dysfunction in Astrocytes: A Role in Parkinson's Disease? Front Cell Dev Biol 2020, 8 :608026. Cheng XY, Biswas S, Li J, Mao CJ, Chechneva O, Chen J, Li K, Li J, Zhang JR, Liu CF et al: Human iPSCs derived astrocytes rescue rotenone-induced mitochondrial dysfunction and dopaminergic neurodegeneration in vitro by donating functional mitochondria . Transl Neurodegener 2020, 9 (1):13. Kuter K, Olech L, Glowacka U: Prolonged Dysfunction of Astrocytes and Activation of Microglia Accelerate Degeneration of Dopaminergic Neurons in the Rat Substantia Nigra and Block Compensation of Early Motor Dysfunction Induced by 6-OHDA . Mol Neurobiol 2018, 55 (4):3049-3066. Nishiyama H, Itoh K, Kaneko Y, Kishishita M, Yoshida O, Fujita J: A glycine-rich RNA-binding protein mediating cold-inducible suppression of mammalian cell growth . J Cell Biol 1997, 137 (4):899-908. Murao A, Tan C, Jha A, Wang P, Aziz M: Exosome-Mediated eCIRP Release From Macrophages to Induce Inflammation in Sepsis . Front Pharmacol 2021, 12 :791648. Zhong P, Zhou M, Zhang J, Peng J, Zeng G, Huang H: The role of Cold-Inducible RNA-binding protein in respiratory diseases . J Cell Mol Med 2022, 26 (4):957-965. Sharma A, Brenner M, Jacob A, Marambaud P, Wang P: Extracellular CIRP Activates the IL-6Ralpha/STAT3/Cdk5 Pathway in Neurons . Mol Neurobiol 2021, 58 (8):3628-3640. Sharma A, Sari E, Lee Y, Patel S, Brenner M, Marambaud P, Wang P: Extracellular CIRP Induces Calpain Activation in Neurons via PLC-IP(3)-Dependent Calcium Pathway . Mol Neurobiol 2023, 60 (6):3311-3328. Sharma A, Brenner M, Wang P: Potential Role of Extracellular CIRP in Alcohol-Induced Alzheimer's Disease . Mol Neurobiol 2020, 57 (12):5000-5010. Mendsaikhan A, Takeuchi S, Walker DG, Tooyama I: Differences in Gene Expression Profiles and Phenotypes of Differentiated SH-SY5Y Neurons Stably Overexpressing Mitochondrial Ferritin . Front Mol Neurosci 2018, 11 :470. Han J, Zhang Y, Ge P, Dakal TC, Wen H, Tang S, Luo Y, Yang Q, Hua B, Zhang G et al: Exosome-derived CIRP: An amplifier of inflammatory diseases . Front Immunol 2023, 14 :1066721. DeTure MA, Dickson DW: The neuropathological diagnosis of Alzheimer's disease . Mol Neurodegener 2019, 14 (1):32. Merino P, Diaz A, Jeanneret V, Wu F, Torre E, Cheng L, Yepes M: Urokinase-type Plasminogen Activator (uPA) Binding to the uPA Receptor (uPAR) Promotes Axonal Regeneration in the Central Nervous System . J Biol Chem 2017, 292 (7):2741-2753. Merino P, Diaz A, Manrique LG, Cheng L, Yepes M: Urokinase-type plasminogen activator (uPA) promotes ezrin-mediated reorganization of the synaptic cytoskeleton in the ischemic brain . J Biol Chem 2018, 293 (24):9234-9247. Diaz A, Merino P, Guo JD, Yepes MA, McCann P, Katta T, Tong EM, Torre E, Rangaraju S, Yepes M: Urokinase-Type Plasminogen Activator Protects Cerebral Cortical Neurons from Soluble Abeta-Induced Synaptic Damage . J Neurosci 2020, 40 (21):4251-4263. Yepes M: The plasminogen activating system in the pathogenesis of Alzheimer's disease . Neural Regen Res 2021, 16 (10):1973-1977. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editor assigned by journal 05 Jul, 2024 Submission checks completed at journal 05 Jul, 2024 First submitted to journal 04 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4685039","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":326466978,"identity":"af12fbc9-56ad-45eb-b27c-80c869c2d4d0","order_by":0,"name":"Ze Li","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ze","middleName":"","lastName":"Li","suffix":""},{"id":326466979,"identity":"ec63c6a2-6038-408f-82bb-4560792a31cd","order_by":1,"name":"Jing-Peng Liu","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jing-Peng","middleName":"","lastName":"Liu","suffix":""},{"id":326466980,"identity":"93da5aeb-f56b-4d11-b8cb-e37c8976eb9d","order_by":2,"name":"Feng-Hua Yao","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Feng-Hua","middleName":"","lastName":"Yao","suffix":""},{"id":326466981,"identity":"f93a6621-b533-4365-9f54-898f6d7fc17c","order_by":3,"name":"Yang Chao","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Chao","suffix":""},{"id":326466982,"identity":"6aa25938-572f-4adf-ae85-98a3207968c1","order_by":4,"name":"Shou-Chun Li","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shou-Chun","middleName":"","lastName":"Li","suffix":""},{"id":326466983,"identity":"19e6e961-a681-4b5a-a184-b42b6a4cbdef","order_by":5,"name":"Yuan-Yang Liu","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yuan-Yang","middleName":"","lastName":"Liu","suffix":""},{"id":326466984,"identity":"5ab7c777-a2d1-4b14-8fad-5a98fcbcc6c0","order_by":6,"name":"Xin-Wen Su","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xin-Wen","middleName":"","lastName":"Su","suffix":""},{"id":326466985,"identity":"de76de55-415b-47cb-ae19-1cf553e05a59","order_by":7,"name":"Yu-Xiao Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIie3RoQ7CMBCA4WsQmBKQxewNSJY0mSLjWRqSYZGTXUg6M/yW8RIYLG1OYPYCOOYRewTKHKrFkdBf35dLrwCh0E+GUkPOKCmLoh/8iLGkW0eTCg+c+REigaiMT+udWlAfEBtTIO1QHJteAYM0WkkX0UYizVE0rVCPPWx5oh0kGYndcm5FGTPQ4uJFZgrF9W4Uo1+QjJOaeJKNJeZkj0wqYY8ce7xlWSMOz/Erb30/5GnkJMA+JmLX+Lu59JkKhUKhv+4FxFxRX+D2dTkAAAAASUVORK5CYII=","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yu-Xiao","middleName":"","lastName":"Liu","suffix":""},{"id":326466986,"identity":"9fde63c0-ae13-4fc3-be40-ac6e33f7d204","order_by":8,"name":"Ai-Jun Liu","email":"","orcid":"","institution":"Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ai-Jun","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-07-04 08:38:36","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4685039/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4685039/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61434697,"identity":"ac5c7a26-d442-41e0-9292-3fb95b795cc8","added_by":"auto","created_at":"2024-07-30 16:55:34","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":794715,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of CIRP in astrocyte cell lines. Human glioma cell lines, including U87, U251 and H4, which overexpress CIRP, were observed under a light microscope (bar=50 µm). U87, U251 and H4 cells were transfected with lentiviral particles containing green fluorescent protein (GFP) and the full-length CIRP gene. B, C mRNA and protein expression of CIRP in U87, U251 and H4 cells was examined by Q-PCR and WB. Compared with those in the control group, the cells in the control group were transfected with control lentiviral particles. The data are expressed as the means ± SDs. Statistical significance: *p\u0026lt;0.05; **p\u0026lt;0.01; ***p\u0026lt;0.001; ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/840f7747f2da1b1e01cafff8.png"},{"id":61434956,"identity":"60d878b5-1fdc-40dd-be47-8cb03c6302cc","added_by":"auto","created_at":"2024-07-30 17:03:34","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1037120,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmapmaps and volcano plots showing the differences in the expression profiles of mRNAs between control and CIRP-overexpressing astrocytes. A. The maps represent the expression values of all mRNAs detected by microarray. B-C. The plots show the obviously differentially expressed mRNAs with a fold change ≥2.0\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/b2479bc743963fd9d55df5ab.png"},{"id":61434698,"identity":"ddb09da9-05dc-4e9b-ab8e-a1907aed4ce2","added_by":"auto","created_at":"2024-07-30 16:55:34","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":148140,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of differentially expressed mRNAs between control and ov-CIRP astrocytes. A. The significantly differentially expressed mRNAs between the control and ov-CIRP groups in all three pairs of astrocytes were analyzed to identify the top 30 enrichment pathway terms by KEGG pathway annotation. B. The significantly differentially expressed mRNAs with the top 30 enrichment scores for disease were analyzed by KEGG disease annotation.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/8861921b9e813970a5fb3efe.png"},{"id":61434957,"identity":"9b9ae6c1-92eb-47c8-bffa-4ffdb9f83527","added_by":"auto","created_at":"2024-07-30 17:03:34","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":186144,"visible":true,"origin":"","legend":"\u003cp\u003eCIRP overexpression in astrocytes induced AD-like changes in neurons. The schematic diagram shows the details of the coculture system. B. mRNA expression of BACE in astrocytes in the different groups was measured by q‒PCR. β-Actin was used as the internal standard (n=3). C. The protein expression levels of Aβ1-42 and p-Tau (Ser396) in astrocytes in the different groups were examined by WB (n=3). The data are presented as the means ± SDs. Statistical significance: *p\u0026lt;0.05; **p\u0026lt;0.01; ***p\u0026lt;0.001; ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/462315da48e4dc02fed9e290.png"},{"id":61434700,"identity":"2735e7cb-b7bc-4239-a5e6-e8ba68cd32ac","added_by":"auto","created_at":"2024-07-30 16:55:35","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":169136,"visible":true,"origin":"","legend":"\u003cp\u003euPA was significantly downregulated after CIRP overexpression. A. The top ten differentially expressed mRNAs between the control and ov-CIRP groups in all three pairs of astrocytes were identified via microarray analysis. The mRNA (B) and protein (C) expression of uPA in all 3 pairs of cells was determined by q-PCR and WB assays. The data are presented as the means ± SDs from 3 independent experiments (n=3/group). Statistical significance: *p\u0026lt;0.05; **p\u0026lt;0.01; ***p\u0026lt;0.001; ****p\u0026lt;0.0001\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/69d887c83d9a384eebf3d44d.png"},{"id":61434958,"identity":"05fd18cc-6359-4c8c-93e4-0afc17ebffff","added_by":"auto","created_at":"2024-07-30 17:03:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":147125,"visible":true,"origin":"","legend":"\u003cp\u003euPA alleviated ov-CIRP astrocyte-induced dysfunction of neurons. A chart showing the details of the coculture system. The protein expression of Aβ1-42 and p-Tau in SH-SY5Y cells from different groups was examined by WB. The data are presented as the means ± SDs from 3 independent experiments (n=3/group). Statistical significance: *p\u0026lt;0.05; **p\u0026lt;0.01; ***p\u0026lt;0.001; ****p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/78507e20f1e96cc348cd6373.png"},{"id":61434695,"identity":"371d4b1a-83f0-486d-a28b-0c00afb307e7","added_by":"auto","created_at":"2024-07-30 16:55:34","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":132180,"visible":true,"origin":"","legend":"\u003cp\u003eThe possible mechanism by which CIRP in astrocytes regulates the AD-like pathogenesis of neuronal cells. Overexpression of CIRP in astrocytes could inhibit the expression of uPA, a favorable factor in AD that contributes to the promotion of BACE, Aβ1-42 and p-Tau expression.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/277256f27619354d3d31674a.png"},{"id":61435256,"identity":"9d50cacb-c649-429e-be01-274eacaf1bc0","added_by":"auto","created_at":"2024-07-30 17:11:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3641062,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4685039/v1/1d8d866c-500f-40f1-ac20-e82412c47068.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Overexpression of CIRP in astrocytes contributes to Alzheimer’s disease via downregulation of uPA","fulltext":[{"header":"Background","content":"\u003cp\u003eAD is one of the most common neurodegenerative dementia diseases and is the sixth leading cause of death in the US [1]. In recent years, a large number of new candidate drugs for AD treatment have failed in clinical trials, which has led to poor prospects for AD drug development. Neuronal injury and degeneration are the major features of AD and are specifically manifested as synaptic damage in the hippocampus and defects in learning and memory in neocortex regions[2]. Thus, further exploration of the pathophysiology of synaptic damage during the development of AD is important for identifying new therapeutic methods to protect synapses from irreversible neuron degeneration.\u003c/p\u003e \u003cp\u003eAs one of the most common cell types in the brain, astrocytes are vital for sustaining neuronal health because they not only supply structural support to neurons but also maintain the balance of brain microenvironments. The interaction between astrocytes and neurons is crucial for the survival and function of dopaminergic neurons. Previous studies have shown that astrocyte dysfunction can cause degenerative alterations in dopaminergic neurons [3, 4]. For example, Cheng et al reported that astrocytes derived from induced pluripotent stem cells could alleviate dopaminergic neurodegeneration in vitro[[5]. Kuter et al. demonstrated that astrocytes play a crucial role in the early degeneration of nigrostriatal neurons[6]. However, the mechanism by which astrocytes affect synaptic function during neurodegeneration is still unclear.\u003c/p\u003e \u003cp\u003eCold-inducible RNA-binding protein (CIRP) comprises an amino-terminal consensus sequence RNA binding domain and a carboxyl-terminal glycine-rich domain[7]. Recent studies have shown that CIRP is involved not only in the regulation of cellular stress responses such as UV irradiation, hypoxia and hypothermia but also in the regulation of damage-associated molecular patterns (DAMPs), which can bind to TLR4 and promote inflammation by activating the nuclear transcription factor nuclear factor-κB[8, 9]. Moreover, several studies have reported that CIRP is capable of regulating neuronal dysfunction via the IL-6Rα/STAT3/Cdk5 pathway and promoting neuronal calpain activity, which is closely associated with pathological changes in neurons from AD patients [10, 11]. Notably, a recent study reported that CIRP may be a potential target of alcohol-induced AD because alcohol-induced CIRP from microglia contributes to the development of AD[12]. Therefore, it is interesting to determine whether abnormal CIRP expression in astrocytes is a risk factor for AD.\u003c/p\u003e \u003cp\u003eIn this article, we aimed to explore the effects of CIRP overexpression on the expression profiles of mRNAs in human astrocytes and to identify whether and how CIRP regulates AD-associated genes in astrocytes. The microarray results revealed that CIRP overexpression and AD were closely correlated in 3 different human glioma astrocyte cell lines. In addition, this study revealed for the first time that overexpression of CIRP could inhibit the expression of uPA, a favorable factor for AD, in astrocytes. Furthermore, in vitro astrocyte\u0026ndash;neuron coculture experiments revealed that the overexpression of CIRP in astrocytes promoted the expression of BACE, Aβ1\u0026ndash;42 and phosphorylated tau protein (p-Tau) in neurons. These findings revealed a potential new mechanism of CIRP in the pathology of AD and confirmed that eCIRP is a promising therapeutic target for treating neural degenerative disease.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman glioma cell lines, including U87, U251, H4 and human neuroblastoma SH-SY5Y cells, were obtained from Shanghai GeneChem Co., Ltd. (Shanghai, China). The cells were cultured in 6-well plates in DMEM or RPMI-1640 medium (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Thermo Fisher Scientific) at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of human CIRP glioma cell lines stably overexpressing CIRP\u003c/h2\u003e \u003cp\u003eCIRP lentiviral particles containing green fluorescent protein (GFP) and the full length CIRP gene (overexpressing CIRP group) and control lentiviral particles (control group) were purchased from Shanghai Genechem Co., Ltd. Transfection was carried out according to the manufacturer\u0026rsquo;s instructions. Briefly, the cells were cultured with lentiviral particles and polybrene (5 \u0026micro;g/mL) in medium for 12 h. Then, the medium containing the lentiviral particles was removed, the cells were washed, and complete medium was added. GFP gene expression was observed by fluorescence microscopy at 3 days after transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eA coculture system\u003c/h2\u003e \u003cp\u003eSH-SY5Y cells were cultured with complete medium containing 10 \u0026micro;M retinoic acid (Sigma‒Aldrich) for 7 days to allow them to differentiate into neurons, as previously reported[13]. Then, a coculture system was established by plating SH-SY5Y cells and astrocytes in a Transwell system (0.4 \u0026micro;m pore size, Corning, NY, USA). Oe-CIRP or control human astrocytes were cultured in the lower chamber (LC) of the transwell system, and neurons were cultured in the upper chamber (UC). After 24 h, culture medium supplemented with or without uPA (20 ng/ml) was added to the upper and lower chambers. After they were cocultured for 48 h, the cells were collected for gene and protein analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eProfiling of mRNA expression\u003c/h2\u003e \u003cp\u003eA core \u0026reg; lncRNA\u0026thinsp;+\u0026thinsp;mRNA expression profile microarray was used to profile the expression of mRNAs, which was generated by Capitalbio Biotech (Beijing, China). Briefly, RNA samples from cells in different groups were purified, amplified and transcribed into fluorescent cRNAs. Next, cRNA was hybridized to the microarray. The gene expression profiles of human species were detected using the Boao core LncRNA\u0026thinsp;+\u0026thinsp;mRNA Human Gene Expression Microarray V4.0,4x180K chip with the method number AG-GE-WL 10-01-2010 and the data analysis method number AG-GE-DL 00-01-2010.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eScreening and Mapping of Differentially Expressed Genes\u003c/h2\u003e \u003cp\u003eAfter expression spectrum chip hybridization scanning, tiff-format image data were processed using Feature Extraction lift software. Gene expression differences and statistically significant p values were calculated using GeneSpring GX software. Briefly, the tiff plots derived from chip scans were processed with feature extraction software to obtain the raw data files. Then, the raw data files were imported into GeneSpring software, and the data were subjected to written grouping and other parameter information. Each sample was normalized, and QC analysis, cluster analysis and graphical presentation were performed with Cluster3.0 software. Finally, differential comparisons were made to obtain differential genes according to the grouping information, and the differential mRNAs were analyzed by GO pathway analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eValidation of differentially expressed genes\u003c/h2\u003e \u003cp\u003eThe expression of the screened mRNAs was validated by qRT‒PCR. Briefly, TRIzol reagent was used to extract total RNA from cells, and cDNA was synthesized with SuperScript III reverse transcriptase. Then, target gene expression was quantified using a SLAN Real-Time PCR System (Hongshi, Shanghai, China). GAPDH was used as an internal control. The expression levels were calculated with the primer pairs used for the amplification of target mRNAs, as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The data were analyzed using the comparative cycle threshold method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe Sequence of Primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence(5' to 3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTAGACCATGTAGTTGAGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCIRP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACTCAGCTTCGACACCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCIRP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGCGTCCTTAGCGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBACE-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGTTTCTGGCTAGGAGAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBACE-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGGTAACCTCACCCATTAGGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eThe cells from the different groups were collected and washed with PBS. Then, the proteins were mixed with cell lysate and centrifuged at 12000 \u0026times; g at 4\u0026deg;C for 10 min. The supernatant of the mixture was collected for protein extraction with a Qproteome Mammalian Protein Prer kit. The protein concentration was determined using a BCA protein assay kit. Then, the proteins were separated on polyacrylamide gels and transferred onto nitrocellulose membranes by iBlot. The bands were visualized by chemiluminescence using a FluorChem E system. Antibodies against Aβ1\u0026thinsp;\u0026minus;\u0026thinsp;42 (25524-1-AP, Proteintech), uPA (ab32057, Abcam) and p-Tau (Ser396) (ab32057, Abcam) were used to determine protein expression. β-Actin was used as the internal control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe data are shown as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical analyses were performed with GraphPad Prism 9. One- or two-way analysis of variance (ANOVA) was used to analyze significant differences among the groups, and Student's t test was used to assess the differences between the two groups. P values less than 0.05 were regarded as statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of astrocyte cell lines overexpressing CIRP\u003c/h2\u003e \u003cp\u003eThe cells were observed by fluorescence microscopy on the third day after they were transfected with control-GFP or CIRP-GFP lentiviral vectors. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, more than 80% of the transfected cells expressed GFP, which implied that the efficiency of the infection was greater than 80%. The results from the q-PCR assay demonstrated that the mRNA levels of CIRP were significantly greater in the ov-CIRP group than in the control group, with approximately 59.66-fold, 78.11-fold, and 38.09-fold increases in the U87, U251, and H4 groups, respectively, in the oe-CIRP group compared with the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD.1B). Western blotting confirmed that the protein expression of CIRP was also greatly increased in the oe-CIRP group compared with the control group for all 3 pairs of astrocytes (all p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of mRNAs with significant fold changes in the expression of CIRP in astrocytes\u003c/h2\u003e \u003cp\u003eWe used volcano plots and heatmaps to determine the differences in gene expression between ov-CIRP and control human glioma cells. In total, 119 mRNAs were differentially expressed in all 3 pairs of cells. Among them, 39 mRNAs were strongly upregulated, and 80 mRNAs were obviously downregulated (a threshold of \u0026ge;\u0026thinsp;2-fold and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). The changed mRNAs were associated with reproductive progress, rhythmic progress, response to stimulation and so on (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The KEGG and GO pathway analyses showed that the up- or downregulated mRNAs were mostly enriched in the FGF signaling pathway, activated NOTCH1 Transmits Signal to the Nucleus, interleukin receptor SHC signaling and so on (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Of note, the results of significantly enriched disease terms indicated that the overexpression of CIRP was involved in asthma ige, dehydroepiandrosterone, rheumatoid arthritis, autism spectrum disorder, Alzheimer's disease and so on (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCIRP overexpression in astrocytes induced AD-like changes in neurons in a coculture system\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, SH-SY5Y cells were cocultured with ov-CIRP or control astrocyte cell lines (U251, U87 and H4) to examine whether CIRP overexpression in astrocytes affects amyloid accumulation and \u003cb\u003ehyperphosphorylation in\u003c/b\u003e neural cells. The results from q-PCR showed that the mRNA levels of BACE were greatly increased in the ov-CIRP groups compared to those in the control groups, with approximately 5.51-fold, 7.31-fold, and 3.41-fold decreases in the U87, U251, and H4 ov-CIRP groups, respectively, compared with those in the control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The results from the WB assay indicated that the expression levels of Aβ1\u0026ndash;42 and p-Tau (Ser396) were significantly greater in the SH-SY5Y cells from the ov-CIRP group than in those from the control group (Aβ1\u0026ndash;42:group effect F (1, 12)\u0026thinsp;=\u0026thinsp;346.8; p-Tau: F (1, 12)\u0026thinsp;=\u0026thinsp;524.7; all p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003euPA was significantly downregulated after CIRP\u003c/b\u003e overexpression\u003c/p\u003e \u003cp\u003eTo further explore the relationship between CIRP and AD, the top ten mRNAs whose expression changed after CIRP overexpression are listed in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, which included WNT5B, FGFR3, PSD4, UNC93B1, IFI44, uPA, LBH, BNIP3, LIF and KYNU.\u003c/p\u003e \u003cp\u003eAccumulating evidence has shown that tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator (uPA) play important roles in the pathogenesis of AD. Thus, we verified the mRNA and protein expression of uPA in all 3 pairs of cells by q‒PCR and WB assays. The results showed that the mRNA levels of uPA were greatly decreased in the ov-CIRP groups compared with those in the control groups, with approximately 38.09-fold, 78.11-fold, and 59.66-fold decreases in U87, U251, and H4, respectively, in the oe-CIRP groups compared with those in the control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Accordingly, the protein expression of uPA was also significantly lower in the oe-CIRP group than in the control group for all 3 pairs of astrocytes (group effect F (1, 12)\u0026thinsp;=\u0026thinsp;277.3, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003euPA alleviated ov-CIRP astrocyte-induced dysfunction of neurons\u003c/h2\u003e \u003cp\u003eTo analyze the effect of uPA on ov-CIRP astrocyte-induced dysfunction of neurons, SH-SY5Y cells were cocultured with ov-CIRP astrocytes treated with or without uPA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Moreover, when ov-CIRP astrocytes (U87, U251, and H4) were treated with uPA, the levels of the Aβ1\u0026ndash;42 protein and p-Tau promoted in SH-SY5Y cells induced by ov-CIRP astrocytes were significantly inhibited (ov-CIRP\u0026thinsp;+\u0026thinsp;uPA vs ov-CIRP groups: Aβ1\u0026ndash;42 decreased by approximately 40%, 41%, and 30%, respectively, in U87, U251, and H4 cells; p-Tau decreased by approximately 50%, 61%, and 45%, respectively, in U87, U251, and H4 cells, all p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eMany researchers believe that more in-depth studies on novel molecular mechanisms and pathological changes in AD are crucial for identifying new drug targets. However, the mechanism by which CIRP affects the development of AD is still unclear.\u003c/p\u003e \u003cp\u003eTo gain novel insights into the functions of CIRP in the pathogenesis of astrocytes, we comprehensively analyzed the mRNA profiles of 3 pairs of control and ov-CIRP human astrocytoma cell lines. We identified the significantly differentially expressed mRNAs in all 3 pairs of cells and annotated their functions. Previous studies have reported that CIRP is widely involved in various biological processes, including circadian modulation, cell proliferation and survival, telomere maintenance, cellular stress response, inflammation and cancer [14]. Here, the microarray data also revealed that the changes in mRNAs induced by CIRP overexpression were implicated in the response to stimuli, inflammatory bowel disease, cell growth and so on, which was in accordance with previous studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Moreover, our work revealed a comprehensive transcriptional network implying that the abnormal expression of CIRP in astrocytes was associated with a series of nervous system diseases, such as autism spectrum disorder, Parkinson's disease (motor and cognitive disorders), bipolar disorder, schizophrenia, and AD (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe relative disease of CNS after CIRP over-expression\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTerm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDatabase\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInput gene symbols\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eP-Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAutism spectrum disorder\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNHGRI GWAS Catalog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIFI44,MAP4K4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0171048995095\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParkinson's disease (motor and cognition)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNHGRI GWAS Catalog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eC8orf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0253314272708\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNormalized brain volume\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNHGRI GWAS Catalog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBICD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0253314272708\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eResponse to antidepressant treatment\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNHGRI GWAS Catalog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDTWD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0581276711223\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBipolar disorder and schizophrenia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNHGRI GWAS Catalog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLRRIQ3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1204990915480\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlzheimer's disease\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCN2,PLAU,PSEN2,\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0278533148062\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHippocampal atrophy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePRUNE2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0800292664413\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDepression\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eARGLU1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1578254639020\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAttention deficit disorder with hyperactivity\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eURB2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.1673380884350\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNeuro-degenerative diseases\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKEGG\u003c/p\u003e \u003cp\u003eDISEASE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eANO10, PSEN2,\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.3888821624070\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eIt is well known that the pathological damage of AD is related to the accumulation of extracellular senile plaques composed of aggregates of Aβ peptides and the hyperphosphorylation of Tau [15]. Wang et al reported that eCIRP activated STAT3 via IL-6Rα and speculated that eCIRP-derived microglia may be important mediators of neuronal tau phosphorylation after exposure to alcohol [10]. Here, to explore the function of CIRP in astrocyte-induced neuronal injury, the phosphorylation of p-Tau and the expression of BACE and Aβ1\u0026ndash;42 in neurons were measured after they were cocultured with ov-CIRP or control astrocytes. Our data revealed for the first time that the overexpression of CIRP in astrocytes greatly promoted the expression of p-Tau (Ser396), Aβ1\u0026ndash;42, and BACE in neurons in a coculture system. These results proved that CIRP in astrocytes could act as a vital mediator of AD.\u003c/p\u003e \u003cp\u003eFinally, we explored the molecular mechanisms by which CIRP in astrocytes regulates neuronal tau phosphorylation. Microarray analysis revealed three mRNAs in astrocytes that are candidates for AD after CIRP overexpression. Among them, uPAs gained our attention. uPA encodes a secreted serine protease that converts plasminogen to plasmin, and mutation of uPA is closely associated with the onset of Alzheimer's disease. Thus, we measured the expression levels of uPA in control and ov-CIRP astrocytoma cells by q-PCR and WB assays. The results confirmed a significant decrease in uPA in ov-CIRP astrocytes compared with control astrocytes at both the mRNA and protein levels.\u003c/p\u003e \u003cp\u003eMerino et al. reported that uPA and its receptor were mainly expressed in neuronal extensions, growth cones and a subpopulation of astrocytes in the mature brain, and the release of uPA in the mature central nervous system could improve axonal and synaptic function after injury[16, 17]. Moreover, increasing evidence has shown that the plasminogen activator urokinase can protect neurons from amyloid β-triggered synaptic injury[18, 19]. On the basis of this evidence, we speculated that the neuronal damage induced by CIRP overexpression in astrocytes may involve decreased expression of uPA. Thus, we added uPA to an astrocyte neuron coculture system and found that uPA treatment significantly alleviated ov-CIRP astrocyte-induced dysfunction of neurons, as evidenced by decreased Aβ1‒42 accumulation and tau hyperphosphorylation in the ov-CIRP\u0026thinsp;+\u0026thinsp;uPA group. These results implied that the overexpression of CIRP in astrocytes could cause AD-like alterations in neurons partly through the downregulation of uPA. Notably, previous studies have focused mainly on the function of neuronal uPAs in AD. Here, we revealed for the first time that abnormal expression of uPAs in astrocytes is another cause of neuron dysfunction. Our data confirmed the significant role of CIRP in the development of AD, provided insight into the molecular signaling involved in CIRP-induced neuronal damage, and provided a possible new therapeutic target for alleviating cognitive decline during AD. However, the current work explored the roles of CIRP only in astrocytes at the cellular level, and further studies should be carried out in animals. Moreover, the mechanism by which CIRP affects the levels of uPA is still unclear.\u003c/p\u003e \u003cp\u003eIn summary, this study revealed that the overexpression of CIRP in astrocytes exerts a harmful impact on neurons by elevating the expression levels of BACE, Aβ1\u0026ndash;42 and p-Tau (Ser396) in neurons via the downregulation of uPA (Figure. 7). Thus, the downregulation of CIRP expression may be a useful method for alleviating synaptic dysfunction during AD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present work was supported by grants from the PLA General Hospital Youth Independent Innovation Science Fund project (22QNFC106, 22QNFC003) and the National Natural Science Foundation of China (82172124).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026apos;s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZL, JPL and FHY carried out the cell experiments and drafted the article. YC and SCL performed the data analysis. YXL and XWS drew the illustrations. YXL and AJL conceived and supervised the study. All the authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the datasets in the manuscript or additional files are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiments were approved by the Ethical Committee of the General Hospital of the Chinese PLA, Beijing, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the authors approved the publication of the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u003cstrong\u003e2020 Alzheimer\u0026apos;s disease facts and figures\u003c/strong\u003e. \u003cem\u003eAlzheimers Dement \u003c/em\u003e2020.\u003c/li\u003e\n\u003cli\u003eSanabria-Castro A, Alvarado-Echeverria I, Monge-Bonilla C: \u003cstrong\u003eMolecular Pathogenesis of Alzheimer\u0026apos;s Disease: An Update\u003c/strong\u003e. \u003cem\u003eAnn Neurosci \u003c/em\u003e2017, \u003cstrong\u003e24\u003c/strong\u003e(1):46-54.\u003c/li\u003e\n\u003cli\u003eBooth HDE, Hirst WD, Wade-Martins R: \u003cstrong\u003eThe Role of Astrocyte Dysfunction in Parkinson\u0026apos;s Disease Pathogenesis\u003c/strong\u003e. \u003cem\u003eTrends Neurosci \u003c/em\u003e2017, \u003cstrong\u003e40\u003c/strong\u003e(6):358-370.\u003c/li\u003e\n\u003cli\u003eBantle CM, Hirst WD, Weihofen A, Shlevkov E: \u003cstrong\u003eMitochondrial Dysfunction in Astrocytes: A Role in Parkinson\u0026apos;s Disease?\u003c/strong\u003e \u003cem\u003eFront Cell Dev Biol \u003c/em\u003e2020, \u003cstrong\u003e8\u003c/strong\u003e:608026.\u003c/li\u003e\n\u003cli\u003eCheng XY, Biswas S, Li J, Mao CJ, Chechneva O, Chen J, Li K, Li J, Zhang JR, Liu CF\u003cem\u003e \u003c/em\u003eet al: \u003cstrong\u003eHuman iPSCs derived astrocytes rescue rotenone-induced mitochondrial dysfunction and dopaminergic neurodegeneration in vitro by donating functional mitochondria\u003c/strong\u003e. \u003cem\u003eTransl Neurodegener \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1):13.\u003c/li\u003e\n\u003cli\u003eKuter K, Olech L, Glowacka U: \u003cstrong\u003eProlonged Dysfunction of Astrocytes and Activation of Microglia Accelerate Degeneration of Dopaminergic Neurons in the Rat Substantia Nigra and Block Compensation of Early Motor Dysfunction Induced by 6-OHDA\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2018, \u003cstrong\u003e55\u003c/strong\u003e(4):3049-3066.\u003c/li\u003e\n\u003cli\u003eNishiyama H, Itoh K, Kaneko Y, Kishishita M, Yoshida O, Fujita J: \u003cstrong\u003eA glycine-rich RNA-binding protein mediating cold-inducible suppression of mammalian cell growth\u003c/strong\u003e. \u003cem\u003eJ Cell Biol \u003c/em\u003e1997, \u003cstrong\u003e137\u003c/strong\u003e(4):899-908.\u003c/li\u003e\n\u003cli\u003eMurao A, Tan C, Jha A, Wang P, Aziz M: \u003cstrong\u003eExosome-Mediated eCIRP Release From Macrophages to Induce Inflammation in Sepsis\u003c/strong\u003e. \u003cem\u003eFront Pharmacol \u003c/em\u003e2021, \u003cstrong\u003e12\u003c/strong\u003e:791648.\u003c/li\u003e\n\u003cli\u003eZhong P, Zhou M, Zhang J, Peng J, Zeng G, Huang H: \u003cstrong\u003eThe role of Cold-Inducible RNA-binding protein in respiratory diseases\u003c/strong\u003e. \u003cem\u003eJ Cell Mol Med \u003c/em\u003e2022, \u003cstrong\u003e26\u003c/strong\u003e(4):957-965.\u003c/li\u003e\n\u003cli\u003eSharma A, Brenner M, Jacob A, Marambaud P, Wang P: \u003cstrong\u003eExtracellular CIRP Activates the IL-6Ralpha/STAT3/Cdk5 Pathway in Neurons\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2021, \u003cstrong\u003e58\u003c/strong\u003e(8):3628-3640.\u003c/li\u003e\n\u003cli\u003eSharma A, Sari E, Lee Y, Patel S, Brenner M, Marambaud P, Wang P: \u003cstrong\u003eExtracellular CIRP Induces Calpain Activation in Neurons via PLC-IP(3)-Dependent Calcium Pathway\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2023, \u003cstrong\u003e60\u003c/strong\u003e(6):3311-3328.\u003c/li\u003e\n\u003cli\u003eSharma A, Brenner M, Wang P: \u003cstrong\u003ePotential Role of Extracellular CIRP in Alcohol-Induced Alzheimer\u0026apos;s Disease\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2020, \u003cstrong\u003e57\u003c/strong\u003e(12):5000-5010.\u003c/li\u003e\n\u003cli\u003eMendsaikhan A, Takeuchi S, Walker DG, Tooyama I: \u003cstrong\u003eDifferences in Gene Expression Profiles and Phenotypes of Differentiated SH-SY5Y Neurons Stably Overexpressing Mitochondrial Ferritin\u003c/strong\u003e. \u003cem\u003eFront Mol Neurosci \u003c/em\u003e2018, \u003cstrong\u003e11\u003c/strong\u003e:470.\u003c/li\u003e\n\u003cli\u003eHan J, Zhang Y, Ge P, Dakal TC, Wen H, Tang S, Luo Y, Yang Q, Hua B, Zhang G\u003cem\u003e \u003c/em\u003eet al: \u003cstrong\u003eExosome-derived CIRP: An amplifier of inflammatory diseases\u003c/strong\u003e. \u003cem\u003eFront Immunol \u003c/em\u003e2023, \u003cstrong\u003e14\u003c/strong\u003e:1066721.\u003c/li\u003e\n\u003cli\u003eDeTure MA, Dickson DW: \u003cstrong\u003eThe neuropathological diagnosis of Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eMol Neurodegener \u003c/em\u003e2019, \u003cstrong\u003e14\u003c/strong\u003e(1):32.\u003c/li\u003e\n\u003cli\u003eMerino P, Diaz A, Jeanneret V, Wu F, Torre E, Cheng L, Yepes M: \u003cstrong\u003eUrokinase-type Plasminogen Activator (uPA) Binding to the uPA Receptor (uPAR) Promotes Axonal Regeneration in the Central Nervous System\u003c/strong\u003e. \u003cem\u003eJ Biol Chem \u003c/em\u003e2017, \u003cstrong\u003e292\u003c/strong\u003e(7):2741-2753.\u003c/li\u003e\n\u003cli\u003eMerino P, Diaz A, Manrique LG, Cheng L, Yepes M: \u003cstrong\u003eUrokinase-type plasminogen activator (uPA) promotes ezrin-mediated reorganization of the synaptic cytoskeleton in the ischemic brain\u003c/strong\u003e. \u003cem\u003eJ Biol Chem \u003c/em\u003e2018, \u003cstrong\u003e293\u003c/strong\u003e(24):9234-9247.\u003c/li\u003e\n\u003cli\u003eDiaz A, Merino P, Guo JD, Yepes MA, McCann P, Katta T, Tong EM, Torre E, Rangaraju S, Yepes M: \u003cstrong\u003eUrokinase-Type Plasminogen Activator Protects Cerebral Cortical Neurons from Soluble Abeta-Induced Synaptic Damage\u003c/strong\u003e. \u003cem\u003eJ Neurosci \u003c/em\u003e2020, \u003cstrong\u003e40\u003c/strong\u003e(21):4251-4263.\u003c/li\u003e\n\u003cli\u003eYepes M: \u003cstrong\u003eThe plasminogen activating system in the pathogenesis of Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eNeural Regen Res \u003c/em\u003e2021, \u003cstrong\u003e16\u003c/strong\u003e(10):1973-1977.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Cold-inducible RNA-binding protein, Alzheimer disease, astrocyte, neuron","lastPublishedDoi":"10.21203/rs.3.rs-4685039/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4685039/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Cold inducible RNA-binding protein (CIRP) is an important danger-associated molecular pattern involved in tissue-specific and systemic inflammation and is also regarded as a potential regulator of Alzheimer’s disease (AD). However, the precise roles and mechanism of CIRP in the functional changes in astrocytes during the development of AD are still unknown. This study aimed to assess gene expression alterations in astrocytes after they overexpress CIRP (oe-CIRP) and to explore the relationship between abnormal CIRP expression and AD.\u003c/p\u003e\n\u003cp\u003eMethods: We established astrocyte cell lines that stably expressed CIRP or control vectors using 3 different kinds of human glioma cell lines, namely, U87, U251 and H4, and analyzed the mRNA expression profiles of 3 pairs of cells via microarray. Then, the significantly differentially expressed mRNAs between the CIRP-overexpressing (ov-CIRP) group and the control group were identified by bioinformatics analysis and validated by quantitative real-time PCR (q-PCR) and western blotting (WB). Finally, the effect of CIRP overexpression in astrocytes on neurons was observed in a coculture system.\u003c/p\u003e\n\u003cp\u003eResults: We identified 119 mRNAs with obvious fold changes between the ov-CIRP and control groups for all 3 pairs of human glioma cell lines. These mRNAs are associated with diseases such as asthma IgE, dehydroepiandrosterone, rheumatoid arthritis, autism spectrum disorder, AD and so on. The biological functional analysis indicated that urokinase plasminogen activator (uPA), a gene whose expression significantly decreased after CIRP overexpression, was closely associated with AD. The results from q-PCR and WB assays confirmed that overexpression of CIRP significantly inhibited uPA at both the mRNA and protein levels in U87, U251 and H4 cells. Moreover, compared with those cocultured with control astrocytes, SH-SY5Y cells cocultured with CIRP-overexpressing astrocytes exhibited a significant increase in the expression of amyloid-β (Aβ)1-42 and the hyperphosphorylated microtubule-associated protein tau (Tau).\u003c/p\u003e\n\u003cp\u003eConclusion: CIRP overexpression inhibited the expression of uPA in human astrocytes, which promoted the expression of Aβ1‒42 and the phosphorylation of tau in neurons, thus increasing the risk of AD. These results suggest that the overexpression of CIRP in astrocytes contributes to the development of AD.\u003c/p\u003e","manuscriptTitle":"Overexpression of CIRP in astrocytes contributes to Alzheimer’s disease via downregulation of uPA","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-30 16:55:29","doi":"10.21203/rs.3.rs-4685039/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorAssigned","content":"","date":"2024-07-05T10:14:25+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-05T10:11:50+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Molecular and Cell Biology","date":"2024-07-04T08:37:19+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"069416c0-5e5f-4abc-9264-1a30211e2c9f","owner":[],"postedDate":"July 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-07-30T16:55:29+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-30 16:55:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4685039","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4685039","identity":"rs-4685039","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}