Differential growth, Cardiovascular risk, and Polymorphism in Targeted Regions of Ryanodine Receptor 2 (RYR2) gene in Three Breeds of Chickens.

Differential growth, Cardiovascular risk, and Polymorphism in Targeted Regions of Ryanodine Receptor 2 (RYR2) gene in Three Breeds of Chickens. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Differential growth, Cardiovascular risk, and Polymorphism in Targeted Regions of Ryanodine Receptor 2 (RYR2) gene in Three Breeds of Chickens. Olayiwola Kolawole Faisal, Dr. Sulaiman Mariam K, Professor Toye A.A This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5790536/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Sudden death syndrome (SDS) is a stress-related genetic disease in broilers with no diagnostic clinical or necropsy finding. SDS is often preceded by elevated markers of cardiovascular risks (Obesity, Blood glucose, Lipidemia and Inflammation) in broilers. Mutation of Ryanodine Receptor 2 (RYR2) gene, which controls rapid release of ca 2+ from the sarcoplasmic reticulum (SR) into the Cystol during muscle contraction has been associated with sudden death syndrome in broilers, but there are no reports on the genetic association between RYR2 mutation and cardiovascular risk markers in broiler. This study aims to investigate the role of RYR2 mutation in the development of SDS using the linkage association approach. The study compares exotic broiler chicken (Ross 308, Arbor Acres) with the less susceptible indigenous Noiler chicken breed as a contrast to identifying genetic markers linked to SDS susceptibility. Key findings revealed a Single Nucleotide Polymorphism (SNP) near a functional RYR2 region at chicken genome location 3:36968262. The Noiler and Arbor Acres breeds carried an A (Adenosine) allele, while Ross 308 carried a G (Guanine) allele, with the G allele associated with increased cardiovascular risk and stress. Moreover, Arbor Acres and Ross 308 breeds exhibited higher stress levels and cardiovascular risk than the Noiler breed using certain metrics of measurement. These results underscore the critical role of RYR2 genetic differences in growth and cardiovascular traits in poultry, these findings suggest that genetic differences in the RYR2 gene play a crucial role in growth and cardiovascular traits in poultry, offering valuable insights for breeding programs. Molecular Genetics DNA extraction Exons Polymerase Chain Reaction (PCR) Cardiovascular risks Broiler Chickens Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Implications This research provides critical insights into the genetic basis of growth and cardiovascular health in poultry, emphasizing its implications for sustainable breeding in tropical and subtropical regions. By identifying a Single Nucleotide Polymorphism (SNP) in the Ryanodine Receptor 2 (RYR2) gene associated with sudden death, the study highlights genetic markers that can guide breeding programs to enhance productivity and resilience in poultry. These findings hold economic importance by promoting healthier, stress-resilient chicken breeds, reducing losses in poultry production. Environmentally, the results support breeding strategies that minimize stress-induced mortality, improving resource efficiency. Socially, this research contributes to food security in tropical regions. Introduction Broiler chickens play a crucial role in addressing Nigeria’s protein needs (Olorunwa, 2018 ). Broiler production provides employment, income, and an affordable protein source within 6–10 weeks (Olorunwa, 2018 ). Broilers are favored in Nigeria for their high feed conversion ratio, rapid growth, and profitability. With over 200 million chickens raised commercially (FAO, 2008; Oloso et al., 2020 ), broiler production is significant to the economy. However, the fast growth rate of broilers comes with challenges, including sudden death syndrome (SDS), where healthy birds suddenly die, often due to cardiovascular complications (Sosnowka-Czajka & Skomorucha, 2022). Years of selection for rapid growth and feed efficiency have increased the cardiovascular system’s workload, predisposing broilers to metabolic disorders like right ventricular failure, cardiac arrhythmias, and sudden death (Julian, 2005 ). SDS accounts for a 3–6% mortality rate, with further studies indicating up to 17–35% of fast-growing birds suffer from cardiac arrhythmias, a key cause of sudden death (Olkowski et al., 2005 , 2008 , 2010 ). Slow-growing chicken breeds are less prone to SDS, as they have slower metabolic rates and reduced cardiovascular stress (Olkowski & Classen, 1998 ). One such breed is the Noiler chicken, a Nigerian crossbreed between exotic broilers and pullets. Though smaller and slower growing, Noilers are hardy and less susceptible to sudden death, making them a preferred breed for many (Animashahun et al., 2022 ). Genetic selection has been linked to SDS in broilers, with rapid growth and feed efficiency also increasing cardiovascular risks (Ajayi, 2010 ). Traditional animal improvement methods, such as black box selection, are less efficient than molecular approaches like marker-assisted selection (Meuwissen et al., 2001 ). One promising approach is candidate gene studies, which investigate known genetic variations associated with traits or diseases. For SDS, studies have identified polymorphisms in genes like calsequestrin 2 and ryanodine receptor 2 (RYR2), which are linked to cardiac disorders and sudden death (Basaki et al., 2019 ; Peng et al., 2016 ). This research will focus on RYR2's role in cardiovascular risk in broilers and Noiler chickens and will also explore SDS by examining cardiovascular stress and risk factors, including obesity, lipidemia, inflammation, and blood glucose. Materials And Method Experimental site The experiment was conducted at the University of Ilorin Teaching and Research Farm, Ilorin, Kwara State, Nigeria (Latitude: 8°27'09.5"N, Longitude: 4°39'44.5"E). Molecular biology analyses were performed at three locations: University of Ilorin Central Research Laboratories (DNA extraction). University of Ilorin Teaching Hospital, Molecular Diagnostic and Research Laboratories (PCR amplification). Inqaba Biotechnology Limited, South Africa (DNA sequencing). Experimental Birds A total of 150-day-old chicks from three breeds were used: 50 Noiler (from Amo Sieberer Hatchery, Ibadan), 50 Abor Acres (from Valentine Hatchery, Ilorin), and 50 Ross 308 (from Agrited Hatchery, Lagos). Management Upon arrival, the chicks received electrolytes (Vitranor by Jubaili) and were wing-tagged for identification. The birds were divided into three compartments based on breed and fed ad-libitum with commercial feeds. For the first 4 weeks, they were fed Ultima broiler starter (23% protein), and for the remaining 2 weeks, they were fed Ultima broiler finisher (18% protein). Vaccinations against infectious bursal disease and Newcastle disease were administered weekly. Housing The birds were housed in a deep-litter system for the entire experiment. Data Collection Weekly data were collected on growth parameters: body length, wing length, thigh length, drumstick length, shank length, keel length, and body girth. Body weight was measured using a top-loading scale. Body Mass Index (BMI) was also calculated as a metric of evaluating cardiovascular risk, providing an indicator of susceptibility to sudden death related to obesity. Growth rates were determined using Maciejowski and Ziêba's formula (1982). BODY LENGTH: The distance between the top of the head and pygostyle (Oludoyi & Toye, 2012 ) WING LENGTH: Distance between the tip of the phalanges and the coracoids-humerus joint (Oludoyi & Toye, 2012 ). THIGH LENGTH: The distance between the beginning of the fibula to the hock joint. DRUMSTICK LENGTH: The length of the Femur bone (Oludoyi & Toye, 2012 ). SHANK LENGTH: The distance between the beginning of the hock joint to the last ring before the tarsal or meta-tarsal digit (Oludoyi & Toye, 2012 ). KEEL LENGTH: The distance from the V-joint to the end of the sternum (Oludoyi & Toye, 2012 ). BODY GIRTH: This was taken from the point of depression to the breast round the body back to the point of depression (Oludoyi & Toye, 2012 ). BODY WEIGTH: Body weight was measured weekly using a top loading 20kg scale with sensitivity of 10g (Oludoyi & Toye, 2012 ). BODY MASS INDEX (BMI): The body mass index was derived by dividing body weight expressed in gram units by the square of body length expressed in cm units (Oludoyi & Toye, 2012 ). GROWTH RATE: For body weight (g), and eachof the linear measures of body growth recorded (cm), Growth rate/velocity/potential for 1, 3 and 6 successive week periods were determined by use of an adapted version of the formula of Maciejowski and Ziêba (1982), I = [(T2 T1) / (T2 + T1)/2] x 100 ……………………… Eq. 1 Where: I = Growth rate per unit period (%). T1 = Average initial reading for the stated period (g or cm) T2 = Average final reading for the stated period (g or cm) These measurements were taken with the use of a tailor rule and recorded in centimeter (cm) except for body weight which was recorded in Grams (g), following the procedures of (Oludoyi & Toye, 2012 ). Primer Design The RYR2 gene (ENSGALT00010021632.1) on chromosome 3, with five variants in Gallus gallus domesticus, was the target gene in this experiment. This gene, associated with sudden death syndrome in broilers, has 104 exons (Basaki, 2019). Genomic organization and gene sequences were obtained from ENSEMBL ( www.ensembl.org ). Forward and reverse primers were designed to amplify exons 23, 40, and 44 (Table 1 ), identified as mutational hotspots across species (Alvarado et al ., 2019). Using Primer3web Version 4.0.0, primers were anchored 50–100 base pairs from each exon’s flanking regions. These primers were synthesized by Inqaba Biotechnical Industries, South Africa. Table 1 Summary Of Results from Forward and Reverse Primer Sequencing Of Ryr2 Gene And Exon Pcr Products From Ross 308, Arbor Acre And Noiler Chicken. Primer Name Primer sequence (5’ – 3’) Primer length (bases) Actual primer temperature (°c) Product size (bp) Exon position (nt) Sequencing result R3 AA NO RYR2_XN23-F RYR2_XN23-R GACAACTGTGGAAGCCTGTT TCCCATTAGCACACTGAAATTGA 20 23 51.78 51.71 253 37,010,713 − 37,010,894 S S S S S S RYR2_XN40-F RYR2_XN40-R TCTGCAGACAAAGTAGAAAGCA TTGGGGTGCACAGATCTTTC 22 20 51.11 51.78 344 36,968,268 − 36,968,758 S S S S S S RYR2_XN44-F RYR2_XN44-R GTGCAAGATGATTATAAATTGAGTGGT TCAAAGTTCAATCATCCAGAGCA 27 23 53.66 51.71 464 36,959,346 − 36,959,916 NS NS NS NS NS NS * Ryr2- Ryanodine Receptor 2; Xn- Exon; F- Forward; R- Reverse; Ta- Annealing Temperature; Bp- Base Pair; Nt- Nucleotide; S- Sequenced; Ns- Not Sequenced; R3- Ross 308 Chicken; Aa- Arbor Acre Chicken; No- Noiler Chicken. *Exon Position And Location Relating To Nt- 100 (3’utr) Primary Transcript (Ryr2- Ensgalt00010021632.1) Blood Collection and DNA Extraction Blood samples were collected for hematological analysis, serum biochemistry, and genotyping. 1ml of blood was collected via the brachial vein of each bird using sterilized disposable 2ml syringe and needle into EDTA (Ethylene-di-amine-tetra-acetic acid) bottles to prevent coagulation. DNA was then extracted from blood samples using the procedure described by Udeze et al. ( 2020 ). DNA yield and purity were accessed by the use of Nano-drop spectrophotometry analysis. Target Fragment Amplification by PCR Fifteen DNA templates from three chicken breeds (five replicates per breed) were amplified using polymerase chain reaction (PCR) following standard protocol. The PCR process was conducted at the Molecular Diagnostic and Research Laboratory, University of Ilorin, Nigeria, using a MyGene™ Series Peltier Thermal Cycler. The NEB PCR cocktail included 2X Master mix with buffer, chicken DNA template, primers, and deionized water, totaling 25µl. The thermal cycle used are: denaturation at 95°C, annealing at 55°C, 58°C, or 62°C, and extension at 72°C. PCR products were resolved on a 2% agarose gel with ethidium bromide, revealing a single clear band. Sequencing The band of the five replicates of each breed’s PCR products was purified and sequenced through a commercial service (Inqaba Biotec Company, South Africa; using LIZ500 (ThermoScientific), ABI 3500XL Genetic Analyzer for Applied Biosystems, POP7™). Sequences results (electrophoretogram) supplied by Inqaba were viewed using Finch TV v1.4.0. Multiple Sequence Alignment The sequence of each successfully sequenced Exon from each of the examined breeds was aligned (MultAlin; Corpet, 1996) against the known sequence of the corresponding chicken gene (RYR2; ENSGALT00010021632.1) to confirm that the intended fragment of the target gene has been correctly amplified and sequenced. Phylogenetic Analysis Phylogenetic analysis was carried out using MultAlin (Corpet, 1996) and phylogenyfr (Dereeper et al., 2008 ) to determine the evolutionary relationship amongst orthologs. Search for Regulatory Sequences (MOTIFS) Tfsitescan ( http://www.ifti.org/cgi-bin/ifti/Tfsitescan.pl ) online Motif searching software was used to scan for known gene regulatory sequences within the polymorphic intronic flanks of Exons DNA. Search for Endonuclease Restriction Site NEBcutter ( https://nc3.neb.com/NEBcutter/ ) online endonuclease cleaving site software was used to scan for known gene restriction site sequences within the overlapping intronic SNPs. SNP Association with Trait Related to Cardiovascular Risks and Physiological Stress. Data collected was analyzed by observing the effect of SNP on traits of cardiovascular risks and physiological stress by using SPSS version 27. Results All three exons from each of the 15 DNA templates were successfully amplified. However, clear bands were observed in only 66.7%, 66%, and 60% of the template DNA for exon 40, 23, and 44, respectively (Fig. 1 & 2 ). The sharpest bands from the five replicates of each breed were selected for sequencing. Despite attempts, sequencing exon 44 did not yield successful results in any of the reactions. Nucleotide Sequence Polymorphism in RYR2 RYR2 gene Exon 23 Multiple sequence alignment of RYR2 exon 23 from Ross 308, Arbor acres and Noiler breeds (including flanking intron DNA) against corresponding region of corresponding chicken gene (RYR2; ENSGALT00010021632.1) RYR2 revealed no sequence polymorphism (deletion, insertion, inversion or substitution) in the coding and non-coding portion (Fig. 3 ) RYR2 gene Exon 40 Multiple sequence alignment of RYR2 exon 40 from Ross 308, Arbor acres and Noiler breeds (including flanking intron DNA) against corresponding region of corresponding chicken gene (RYR2; ENSGALT00010021632.1) RYR2 revealed no sequence polymorphism (deletion, insertion, inversion or substitution) in the coding portion. However, a purine (Adenine A) to purine (Guanine G), Inversion single nucleotide polymorphism (SNP) located at base 3:36968262 of the primary transcript (numbering from nt-100 in the 3’UTR following Exon 40) was observed. This polymorphism falls in the 3’ non-coding portion of the amplified exon 40 fragment; the primary transcript (ENSGALT00010021632.1) together with the Arbor Acre and Noiler breed carries the 36968262 Guanine (G) allele and the Ross 308 carrying the Adenine (A) allele (Fig. 4 ). (See Figs. 5 , 6 and 7 for the chromogram of a segment of sequence at the 3’ flanking intron DNA sequence (within intron 40–41) of RYR2 Exon 40 of Arbor Acre, Noiler and Ross 308 chicken respectively.) Phylogenetic Analysis RYR2 Gene Exon 23 The phylogenetic analysis of RYR2 Exon 23 (intron 23) for Noiler, Arbor Acre, and Ross 308, compared to the red jungle fowl and other avian orthologs, revealed multiple conserved regions. These include conserved sequences within the exon and the 5’ and 3’ flanking intronic regions, such as an 8-base stretch (GTACCTTC) near the 3' splice donor site (GT) corresponding to position 37010779 − 37010771 of the primary transcript and a 7-base stretch (TCTCTTT) at the 5’ splice acceptor site (AG) corresponding to position 37010898 − 37010891 of the primary transcript. Within the exon, sequences like (ATTGTTTTGCCTCC, CATGAACTTTGGGTTATGAATAAGATT) were conserved (see Fig. 8 ). However, conservation decreased when non-avian species were included, except for the dinucleotide GA within the exon (See Figs. 8 & 9 ). RYR2 Gene Exon 40 The phylogenetic analysis of RYR2 Exon 40 (intron 40) for Noiler, Arbor Acre, and Ross 308, compared to the red jungle fowl and other avian orthologs against the primary transcript (ENSGALT00010021632.1), revealed multiple conserved regions within the exon and flanking intronic regions. Conserved sequences include a 5-base stretch (TTC AG ) at the 5' splice acceptor site except in duck corresponding to position 36968349 of the primary transcript and a 3-base stretch (T GT ) at the 3' splice donor site corresponding to position 36968494 of the primary transcript, along with the canonical splice dinucleotides AG and GT. Within the exon, conserved sequences such as TTGA, TGG, ATGG, and GGAA were observed from positions 36,968,350 − 36,968,493 in the chicken gene (See Figs. 10 , 11 & 12 ) Regulatory Sequence (MOTIFS) RYR2 Gene Exon 23 The search for regulatory signatures in the intron sequences flanking RYR2 Exon 23 in Ross 308, Arbor Acre, and Noiler chickens revealed no regulatory elements. No polymorphisms were found in flanking introns of exon 23, corresponding to positions 37,010,785–37,010,889 in the broiler reference genome ENSGALT00000020816. Thus, the analysis did not identify any regulatory signatures in these regions for the three chicken breeds. RYR2 Gene Exon 40 A sequential search for regulatory signatures in the polymorphic intron DNA sequence 3’ flanking RYR2 Exon 40 of Ross 308, Arbor Acre, and Noiler chickens revealed no regulatory elements. Ross 308 carries an alternate allele (Adenosine; A) while Arbor Acre and Noiler carry Guanine (G) at positions 36,968,350–36,968,493 of the broiler reference (ENSGALT00010021632.1). Despite this, no regulatory signature was found at the polymorphic site, next to this site is an important motif, EF II (AAGCAACATTA), a transcription factor known as Elongation Factor 2, vital for protein synthesis and essential for cellular growth and development. The EF II motif, though critical, has not been reported in the RYR2 gene. Search for Endonuclease Restriction Site A search for endonuclease restriction sites in the polymorphic intron DNA sequence 3’ flanking RYR2 Exon 40 in Ross 308, Arbor Acre, and Noiler chickens revealed no restriction signature. Ross 308 carries an alternate allele (Adenosine; A), while Arbor Acre and Noiler carry Guanine (G) at positions 36,968,350–36,968,493 of the broiler reference (ENSGALT00010021632.1). Despite being a highly endonuclease-restrictive region, PCR by Restriction Fragment Length Polymorphism (RFLP) is unsuitable for determining allele inheritance at this SNP. An alternative approach, such as genotyping by tetra-arms PCR, should be used instead. SNP Association with Trait Related to Cardiovascular Risks and Physiological Stress. Bird genotypes were classified at each SNP locus, with Ross 308 broilers carrying the Adenosine (A) allele and Noiler and Arbor Acre chickens carrying the Guanine (G) allele. This classification aimed to assess genotype effects on cardiovascular risks, including obesity (BMI), blood glucose, inflammation, lipidemia, and stress levels, measured by the Heterophil/lymphocyte ratio. Effect of Genotype on Obesity At week 1, there was no significant BMI difference between genotypes (ROSS 308 = Arbor Acre & Noiler). From weeks 2 to 6, BMI was significantly different (p < 0.05) between genotypes, with Ross 308 having higher BMI than Arbor Acre and Noiler (See Table 2 ). Table 2 Effect of genotype on body weight growth rate from week 1 to 6. BMI: Body Mass Index (g/cm 2 ), means with different superscript within row are significantly different. TRAITS GENOTYPE SNP (rs734634989) A (ROSS 308) G (Arbor Acre & Noiler) BMI_wk1 (g/cm 2 ) 9.8 ± 0.29(49) a 9.1 ± 0.18(99) a BMI_wk2 (g/cm 2 ) 23.5 ± 0.83(49) a 17.2 ± 0.52(99) b BMI_wk3 (g/cm 2 ) 38.3 ± 1.52(49) a 26.4 ± 0.96(99) b BMI_wk4 (g/cm 2 ) 54.1 ± 2.0(49) a 32.6 ± 1.26(99) b BMI_wk5 (g/cm 2 ) 69.5 ± 2.65(49) a 41.7 ± 1.69(99) b BMI_wk6 (g/cm 2 ) 82.5 ± 3.34(40) a 49.5 ± 2.11(97) b Effect of Genotype on Blood Glucose. There was no significant difference in glucose levels between the genotypes A (ROSS 308) and G (Arbor Acre & Noiler) (See Table 3 ). Table 3 Effect of breed on body weight growth rate from week 1 to 6. BLOOD PROFILE GENOTYPE SNP (rs734634989) A (ROSS 308) G (Arbor Acre & Noiler) TC (mg/dl) 21.7 ± 0.95(10) a 21.6 ± 0.67(10) a LDL (mg/dl) 13.4 ± 1.3(10) a 11.3 ± 0.88(10) a HDL (mg/dl) 6.5 ± 0.52(10) a 8.4 ± 0.36(10) b GLUCOSE (mg/dl) 59.2 ± 2.7(10) a 62.1 ± 1.9(10) a HB (g/dL) 7.7 ± 0.32(10) a 8.4 ± 0.22(10) a RBC (x10 6 /mcl) 3.8 ± 0.18(10) a 4.02 ± 0.13(10) a MCV (fL) 60.9 ± 0.54(10) a 61.3 ± 0.38(10) a MCH (pg) 20.3 ± 0.18(10) a 20.4 ± 0.13(10) a MCHC (g/dL) 33.2 ± 0.2(10) a 33.2 ± 0.14(10) a WBC (x10 3 /mcl) 2.6 ± 0.24(10) a 2.7 ± 0.17(10) a LYM (%) 71.6 ± 4.1(10) a 65.8 ± 2.9(10) a HETERO 28.7 ± 4.0(10) a 38.7 ± 2.8(10) a H/L RATIO 0.41 ± 0.66(10) a 0.57 ± 0.47(10) a TRYGLY (mg/dl) 3.9 ± 0.9(10) a 3.95 ± 0.06(10) a TC: Total cholesterol, LDL: Low Density Lipoprotein, HDL: High Density Lipoprotein, HB: Hemoglobin, RBC: Red Blood Count, MCV: Mean Corpuscular Volume, MCH: Mean Corpuscular Haemoglobin, MCHC: Mean Corpuscular Concentration, WBC: White Blood Count, LYM: Lymphocytes, HETERO: Heterophils, TRYGLY: Triglycerides, H/L RATIO: Heterophils/Lymphocytes Ratio. means with different superscript within row are significantly different. Effect of Genotype on Inflammation (White Blood Count, Heterophil, Lymphocyte). There were no significant differences in white blood cell counts, heterophil percentages, or lymphocyte percentages between genotypes A (ROSS 308) and G (Arbor Acre & Noiler) (See Table 3 ). Effect of Genotype on Lipidemia (Tc, Ldl, Hdl). There were no significant differences in total cholesterol (TC) or LDL levels between genotypes A (ROSS 308) and G (Arbor Acre & Noiler), as shown in Table 4.9.2. However, HDL levels were significantly different (p < 0.05), with genotype A having lower levels than genotype G (See Table 3 ). Effect of Genotype on Physiological Stress (Heterophil/Lymphocyte Ratio) Genotype does not significantly (p < 0.05) affect Heterophil/Lymphocyte ratio. However, with the p value approaching 0.05 may point to a weak but significant difference detectable only in experiments with high power (higher replication per group and lower environmental noise). Facilitating a stronger distinction between group variance from within group variance (See Table 3 ). Author’s Point of View The absence of polymorphisms in RYR2 Exon 23 for Noiler, Ross 308, and Arbor Acre chickens suggests this exon is not responsible for cardiovascular risk and stress differences. However, intronic polymorphisms identified could serve as molecular markers, creating breed-specific identities for future research on distinct variants. Evidence from 167 chicken genotypes across diverse geographical regions, including China, Indonesia, Korea, and Tibet, supports the existence of the SNP. Studies indicate this SNP is conserved across various populations, suggesting its evolutionary significance or selective pressure related to environmental adaptation. Notably, the exon 40 sequence of Arbor Acre and Ross 308 in the RYR2 gene has not been previously described, highlighting an intronic SNP that could be useful for selective breeding. Using the SNP haplotypes identified outside RYR2 Exon 40, the three breeds—Arbor Acre Broiler, Ross 308 Broiler, and Noiler chicken—can be distinguished at the molecular level regarding cardiovascular risk and physiological stress. This study underscores the importance of comparative sequencing of candidate genes for identifying breed-specific haplotypes, paving the way for gene association studies. However, the SNP haplotype does not fully distinguish effects on cardiovascular risk and stress, except for HDL levels. Genotype A is associated with about 10% lower HDL than Genotype G, indicating that birds inheriting allele A may experience higher stress due to reduced HDL. Although this SNP likely does not directly cause HDL differences, it may be in linkage disequilibrium with a causal variant nearby. Further sequencing studies are needed to identify the actual causal variant within this gene. Conclusion The unsampled RYR2 Exon 44 should be sequenced and analyzed by future researchers. Further studies are needed to identify additional mutations to address the gaps in this research. Additionally, other candidate genes linked to cardiovascular risks and stress in different chicken breeds should be amplified and sequenced in Noiler and indigenous birds to enhance local chicken populations. The haplotypes identified outside RYR2 Exon 40 could serve as molecular markers for distinguishing Ross 308 broiler chickens. Future investigations should also explore how variations in RYR2 Exon 40 haplotypes contribute to differences in cardiovascular risks and stress levels. Declarations Ethical Approval All experimental procedures involving animals were conducted in compliance with the university of Ilorin department of animal production ethical committee guidelines and approved by the Animal Ethics Committee of the department. Authors ORICD 0009-0000-2119-2265 Author Contributions Kolawole Olayiwola Faisal: Conceived and designed the study, performed the experiments, analyzed the data, and wrote the manuscript. Prof. Toye, A. A: Supervised the research and offered guidance. Dr. Sulaiman, M.K: Provided expertise in the molecular techniques used, supervised the laboratory aspect of the project, and helped revise the manuscript. Declaration of Interest The author declares no conflict of interest regarding the publication of this study. Acknowledgements I am deeply grateful to God for His wisdom, guidance, and strength throughout this research journey. His grace has been my source of inspiration and perseverance, helping me overcome every challenge along the way. I would also like to express my heartfelt appreciation to my family, whose unwavering love, support, and encouragement have been invaluable. Their understanding, patience, and belief in me have provided the foundation I needed to pursue this work with dedication. To my friends, thank you for standing by me, offering motivation, and reminding me to keep going even during the most demanding moments. Your kindness, laughter, and reassurance made this journey not only bearable but enjoyable. I am profoundly blessed to have each of you in my life, and I owe this accomplishment to the role you all have played in this endeavor. Thank you for being there every step of the way. Financial Support Statement The author declares that no funding was received for conducting this study. All expenses related to the research were covered by the author personally. References Ajayi, F. O. (2010). Nigerian indigenous chicken: A valuable genetic resource for meat and egg production. Asian journal of poultry science , 4(4), 164-172. Animashahun, R. A., Alabi, O. O., Okeniyi, F. A., Olawoye, S. O., Shoyombo, J. A., & Falana, B. M. (2022). Performance and blood profile of Noiler chickens fed diets containing graded levels of Parkia biglobosa leaf meal. Food Research , 6(5), 256-265. Basaki, M., Asasi, K., Tabandeh, M. R., & Aminlari, M., (2016). Polymorphism identification and cardiac gene expression analysis of the calsequestrin 2 gene in broiler chickens with sudden death syndrome. British Poultry Science , 57(2), 151-160. Basaki, M., Tabandeh, M. R., Aminlari, M., Asasi, K., Mohsenifard, E., & Abdi-Hachesoo, B. (2019). Sequence and expression analysis of cardiac ryanodine receptor 2 in broilers that died from sudden death syndrome. Avian Pathology , 48(5), 444-453. Corpet F. (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res . Nov 25;16(22):10881-90. (PubMed) Dereeper A., Guignon V., Blanc G., Audic S., Buffet S., Chevenet F., Dufayard J.F., Guindon S., Lefort V., Lescot M., Claverie J.M., and O. Gascuel (2008). Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic Acids Res . 2008 Jul 1;36 (Web Server issue):W465-9. Epub 2008 Apr 19. (PubMed). FAO/WHO Expert Committee on Food Additives. Meeting, & World Health Organization. (2008). Safety evaluation of certain food additives and contaminants (Vol. 68). World Health Organization. Julian, R. J. (2005). Production and growth related disorders and other metabolic diseases of poultry–a review. The Veterinary Journal , 169(3), 350-369. Maciejowski J., ZiebaJ. (1982). Genetics and animal breeding; ISBN 0444417036, 9780444997326 Meuwissen, T. H., Hayes, B. J., & Goddard, M. (2001). Prediction of total genetic value using genome-wide dense marker maps. genetics, 157(4), 1819-1829. Olorunwa, O. J. (2018). Economic analysis of broiler production in Lagos State poultry estate, Nigeria. Journal of Investment and Management , 7(1), 35-44. Oloso, N. O., Smith, P. W., Adeyemo, I. A., Odeokun, I. A., Isola, T. O., Fasanmi, O. G., & Fasina, F. O. (2020). The broiler chicken production value chain in Nigeria between needs and policy: situation analysis, action plan for development, and lessons for other developing countries. CABI Reviews, (2020). Olkowski, A. A., & Classen, H. L. (1998). High incidence of cardiac arrhythmias in broiler chickens. Journal of Veterinary Medicine Series A, 45(1‐10), 83-91. Olkowski, A. A., Abbott, J. A., & Classen, H. L. (2005). Pathogenesis of ascites in broilers raised at low altitude: aetiological considerations based on echocardiographic findings. Journal of Veterinary Medicine Series A, 52(4), 166-171. Olkowski, A. A., Wojnarowicz, C., Nain, S., Ling, B., Alcorn, J. M., & Laarveld, B. (2008). A study on pathogenesis of sudden death syndrome in broiler chickens. Research in veterinary science , 85(1), 131-140. Olkowski, A. A., Kettlewell, P. J., Mitchell, M. A., & Classen, H. L. (2010). Temperature gradients in trailers and changes in broiler rectal and core body temperature during winter transportation in Saskatchewan. Canadian Journal of Animal Science , 90(3), 321-330. Oludoyi, I. A., & Toye, A. A. (2012). The effects of early feeding of Moringa oleifera leaf meal on performance of broiler and pullet chicks. Agrosearch, 12(2), 160-172. Peng, W., Shen, H., Wu, J., Guo, W., Pan, X., Wang, R.,Chen, S.R. & Yan, N. (2016). Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2.Science, 354, aah5324. Udeze, A. O., Olaleye, D. O., & Odaibo, G. N. (2020). Phylogeny of partial gag, pol and env genes show predominance of HIV-1G and CRF02_AG with emerging recombinants in south-eastern Nigeria. Heliyon, 6(8). Additional Declarations The authors declare no competing interests. Supplementary Files 26APrimer2H1022copy.ab1 exon 26 Ryr2 gene Arbor Acre chicken breed reverse primer chromatogram 26APrimer1B1004copy.ab1 exon 26 Ryr2 gene Arbor Acre chicken breed forward primer chromatogram Ryr2XN261NOILERNPrimer1D0312copy.ab1 exon 26 Ryr2 gene Noiler chicken breed forward primer chromatogram Ryr2XN261NOILERNPrimer2E0315copy.ab1 exon 26 Ryr2 gene Noiler chicken breed reverse primer chromatogram Ryr2XN261ROSSRPrimer1B0306copy.ab1 exon 26 Ryr2 gene Ross 308 chicken breed forward primer chromatogram Ryr2XN261ROSSRPrimer2C0309copy.ab1 exon 26 Ryr2 gene Ross 308 chicken breed reverse primer chromatogram 43APrimer3C1007copy.ab1 exon 40 Ryr2 gene Arbor acre chicken breed forward primer chromatogram 43APrimer4A1102copy.ab1 exon 40 Ryr2 gene Arbor acre chicken breed reverse primer chromatogram Ryr2XN431NOILERNPrimer3H0324copy.ab1 exon 40 Ryr2 gene Noiler chicken breed forward primer chromatogram Ryr2XN432ROSSRPrimer3F0318copy.ab1 exon 40 Ryr2 gene Ross 308 chicken breed forward primer chromatogram Ryr2XN432ROSSRPrimer4G0321copy.ab1 exon 40 Ryr2 gene Ross 308 chicken breed reverse primer chromatogram RYR2exon23bottom40top.tif : Gel image of electrophoretically resolved RYR2 Exon 40 and 23 PCR amplified products RYR2exon44.tif Gel image of electrophoretically resolved RYR2 Exon 44 PCR amplified products SpreadsheetMs.c2.1.xlsx Morphometric and blood profile data of the experiment. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5790536","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":399530373,"identity":"ebd1a2a6-850a-469c-8b5a-03ca329c28ca","order_by":0,"name":"Olayiwola Kolawole Faisal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYBACCQbmxgMJIBYzQ+IDIMXDR1gLYwNQiwEDAzvDYwOQFjaitDCAtPAzPpMAiRDUItne2HDg4Y4/cubMzGmVX3PsZNgYmB8+uoFHizTPwYYDiWcMjC2b2dJuy25LBjqMzdg4B48WOYlEoJY2g8QNh3nSbktuYwZq4WGTJlIL/7diyW31hLVII7QwpDF+3HaYsBbJHpBf2oyNDQ4zJEszbjvOw8ZMwC8Sx5sPPvzZJidncP5A4sef26rt+dmbHz7GpwUFMPOASWKVgwDjD1JUj4JRMApGwYgBABP8SQ3/rnOoAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0000-2119-2265","institution":"University of Ilorin","correspondingAuthor":true,"prefix":"","firstName":"Olayiwola","middleName":"Kolawole","lastName":"Faisal","suffix":""},{"id":399530374,"identity":"1f86811e-4dc5-4822-b6ec-c69e4df7ef3a","order_by":1,"name":"Dr. Sulaiman Mariam K","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"prefix":"Dr.","firstName":"Sulaiman","middleName":"Mariam","lastName":"K","suffix":""},{"id":399530375,"identity":"667221c0-b5f5-471e-9468-a9a230036bcc","order_by":2,"name":"Professor Toye A.A","email":"","orcid":"","institution":"University of Ilorin","correspondingAuthor":false,"prefix":"","firstName":"Professor","middleName":"Toye","lastName":"A.A","suffix":""}],"badges":[],"createdAt":"2025-01-08 15:56:08","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-5790536/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5790536/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":73412521,"identity":"adcdbc9a-d9c3-43bc-865e-3b903a39cd43","added_by":"auto","created_at":"2025-01-09 16:23:43","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":310812,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of electrophoretically resolved RYR2 Exon 40 and 23 PCR amplified products. Ladder shown (lane M) and fragment size to the right.\u003c/p\u003e\n\u003cp\u003eLane M= 100 base pair DNA ladder; Lanes 1,2,3,4 and 5 = Exon 40 and 23 of Ross 308 respectively; Lanes 6,7,8,9 and 10 = Exon 40 and 23 of Arbor Acres respectively; Lanes 11,12,13,14 and 15 = Exon 40 and 23 of Noiler respectively; bp = base pair.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/1162cb721b6c901435c4639d.png"},{"id":73411627,"identity":"4cfb1c2d-63e4-4159-8159-9eba97318e91","added_by":"auto","created_at":"2025-01-09 16:15:43","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":96702,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of electrophoretically resolved RYR2 Exon 44 PCR amplified products. Ladder shown (lane M) and fragment size to the right.\u003c/p\u003e\n\u003cp\u003eLane M= 100 base pair DNA ladder; Lanes 1,2,3,4 and 5 = Exon 44 of Ross 308; Lanes 6,7,8,9 and 10 = Exon 44 of Arbor Acres; Lanes 11,12,13,14 and 15 = Exon 44 of Noiler; bp = base pair.\u003c/p\u003e\n\u003cp\u003eElectrophoresis setup: 2% agarose, 145 volts for 45 minutes.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/0345ec05f187bb22df03b657.png"},{"id":73411632,"identity":"e39716e3-797e-42e2-8e35-a10cbbebd287","added_by":"auto","created_at":"2025-01-09 16:15:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":183721,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of RYR2 Exon 23 and flanking intron DNA sequence for Ross 308 broiler (Reverse: Ross 308), Arbor acre broiler (Forward: Arbor) and Noiler chicken (Reverse: noiler) amplified in this study against RYR2 Exon 23 and flanking intron DNA sequence for broiler reference (XN26Ref) (ENSGALT00010021632.1) with no polymorphic base arrowed.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/017d7d544af88ddd1b7ef2d1.png"},{"id":73412525,"identity":"73c1861e-e20c-4df5-902d-a055ff6e2c88","added_by":"auto","created_at":"2025-01-09 16:23:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":54794,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of RYR2 Exon 40 and flanking intron DNA sequence for Ross 308 broiler (Reverse and Forward: Ross 308), Arbor acre broiler (Forward and Reverse: Arbor) and Noiler chicken (Reverse: noiler) amplified in this study against RYR2 Exon 40 and flanking intron DNA sequence for broiler reference (XN40Ref) (ENSGALT00010021632.1) with polymorphic base arrowed.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/681007f32fad113785bc214b.png"},{"id":73412527,"identity":"a6bff0f3-47a9-41b2-bd7f-6b35d73bd83f","added_by":"auto","created_at":"2025-01-09 16:23:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":51551,"visible":true,"origin":"","legend":"\u003cp\u003eChromatogram of a segment of sequence at the 3’ flanking intron DNA sequence (within intron 40-41) of RYR2 Exon 40 of Arbor Acre broiler showing the G insertion region corresponding to the bases 36968444insA of the broiler reference (ENSGALT00010021632.1) primary transcript.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/77943c763cf26f779b4fc4e1.png"},{"id":73411660,"identity":"12ce5498-bb5b-4ad0-be30-a9efe3973f1a","added_by":"auto","created_at":"2025-01-09 16:15:45","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":81527,"visible":true,"origin":"","legend":"\u003cp\u003eChromatogram of a segment of sequence at the 3’ flanking intron DNA sequence (within intron 40-41) of RYR2 Exon 40 of Noiler chicken showing the G insertion region corresponding to the bases 36968444insA of the broiler reference (ENSGALT00010021632.1) primary transcript.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/b04e345aff7c60d7f81837ca.png"},{"id":73411724,"identity":"1fa77d35-a56b-4f7a-aa4a-f3c519f8562f","added_by":"auto","created_at":"2025-01-09 16:15:50","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":72912,"visible":true,"origin":"","legend":"\u003cp\u003eChromatogram of a segment of sequence at the 3’ flanking intron DNA sequence (within intron 40-41) of RYR2 Exon 40 of Ross 308 broiler chicken showing the A substitution region corresponding to the bases 36968444insA of the broiler reference (ENSGALT00010021632.1) primary transcript.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/178f53b00aae23637be4a926.png"},{"id":73412555,"identity":"90aea8af-43ff-4a2e-8578-c7f8115fdb39","added_by":"auto","created_at":"2025-01-09 16:23:48","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":284807,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis alignment result showing conserved regions within RYR2 intron and Exon 23 (i.e. 100 bases before and after Exon) amongst arbor acre broiler, Ross 308 broiler and noiler chicken against red jungle fowl and other avian orthologs.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/9a93104f0abf0d473fba2397.png"},{"id":73411657,"identity":"ed56a2e0-9302-45ea-9613-16182e4b2190","added_by":"auto","created_at":"2025-01-09 16:15:45","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":368904,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis alignment result showing conserved regions within RYR2 intron and Exon 23 (i.e. 100 bases before and after Exon) amongst arbor acre broiler, Ross 308 broiler and noiler chicken against red jungle fowl and other orthologs spanning Aves, Eutherian and non-eutherian mammals, Pisces, and other vertebrates.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/873a8b8fbec1ee56c62a354d.png"},{"id":73411655,"identity":"b3bb0fe5-19bc-4423-89ee-4d7e6d561cf1","added_by":"auto","created_at":"2025-01-09 16:15:45","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":255556,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis alignment result showing highly conserved region within RYR2 exon 40 flanking intron DNA (100bp before and after the exon) for arbor acre broiler, Ross 308 broiler and noiler chicken against red jungle fowl and other avian orthologs.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/a9dc66e58572f851cbe6cc44.png"},{"id":73411651,"identity":"52ec91f4-966e-4f5f-aaf6-7612dbc50e63","added_by":"auto","created_at":"2025-01-09 16:15:45","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":557471,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis alignment result showing limited conserved region within RYR2 exon 40 flanking intron DNA (100bp before and after the exon) for arbor acre broiler, Ross 308 broiler and noiler chicken and orthologs spanning Aves, Eutherian and non-eutherian mammals, Pisces, and other vertebrates.\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/c6aec005ac635d9b6259a6b4.png"},{"id":73411643,"identity":"9ef70d36-5432-4400-b2e0-64ad9f91a84e","added_by":"auto","created_at":"2025-01-09 16:15:44","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":345510,"visible":true,"origin":"","legend":"\u003cp\u003e(Continuation) Phylogenetic analysis alignment result showing limited conserved region within RYR2 exon 40 flanking intron DNA (100bp before and after the exon) for arbor acre broiler, Ross 308 broiler and noiler chicken and orthologs spanning Aves, Eutherian and non-eutherian mammals, Pisces, and other vertebrates.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/84a2877cc55e602003037949.png"},{"id":73414256,"identity":"9e4eca12-b3f2-45c7-89f2-9c7c148056b2","added_by":"auto","created_at":"2025-01-09 16:39:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4499994,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/965cf856-647d-4333-bae9-739cae8aba84.pdf"},{"id":73411622,"identity":"0c56098e-f4bf-4434-ba6e-11245f36dd56","added_by":"auto","created_at":"2025-01-09 16:15:42","extension":"ab1","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":217100,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Arbor Acre chicken breed reverse primer chromatogram\u003c/p\u003e","description":"","filename":"26APrimer2H1022copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/b9acb45e33670ce3b410a770.ab1"},{"id":73411634,"identity":"8ce75048-d11d-413b-9a44-5e5f7291fed8","added_by":"auto","created_at":"2025-01-09 16:15:44","extension":"ab1","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":216557,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Arbor Acre chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"26APrimer1B1004copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/a9681d78a2873677b266a1ad.ab1"},{"id":73411636,"identity":"00c2ec14-bb5a-409f-9e7c-47f764fa1472","added_by":"auto","created_at":"2025-01-09 16:15:44","extension":"ab1","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":221018,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Noiler chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN261NOILERNPrimer1D0312copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/18841c754cdf67527a879833.ab1"},{"id":73412528,"identity":"805bfe17-546b-4502-a932-7468b0f36de4","added_by":"auto","created_at":"2025-01-09 16:23:44","extension":"ab1","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":223382,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Noiler chicken breed reverse primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN261NOILERNPrimer2E0315copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/ea06732ee25fbf6148b1f15b.ab1"},{"id":73411640,"identity":"d902d6db-bce1-4c86-a584-0912ea1f13b5","added_by":"auto","created_at":"2025-01-09 16:15:44","extension":"ab1","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":220514,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Ross 308 chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN261ROSSRPrimer1B0306copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/1c5ccc6bc47516691c2eb60a.ab1"},{"id":73411666,"identity":"b66286ec-80d3-46df-9fb0-c1b382af739f","added_by":"auto","created_at":"2025-01-09 16:15:46","extension":"ab1","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":226980,"visible":true,"origin":"","legend":"\u003cp\u003eexon 26 Ryr2 gene Ross 308 chicken breed reverse primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN261ROSSRPrimer2C0309copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/2d9755afc6b6e98bc97d5bdb.ab1"},{"id":73411673,"identity":"497e9050-8869-458c-b84c-9604c68071e1","added_by":"auto","created_at":"2025-01-09 16:15:47","extension":"ab1","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":227556,"visible":true,"origin":"","legend":"\u003cp\u003eexon 40 Ryr2 gene Arbor acre chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"43APrimer3C1007copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/1cd15f5b1226287be500b00e.ab1"},{"id":73411712,"identity":"3ba5fa13-d544-4983-b4be-5492ccc1c9fd","added_by":"auto","created_at":"2025-01-09 16:15:49","extension":"ab1","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":227331,"visible":true,"origin":"","legend":"\u003cp\u003eexon 40 Ryr2 gene Arbor acre chicken breed reverse primer chromatogram\u003c/p\u003e","description":"","filename":"43APrimer4A1102copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/c47a1e7af67db175fe0fa685.ab1"},{"id":73411663,"identity":"6a7c7d0c-4973-4224-8523-5e65d527fc6e","added_by":"auto","created_at":"2025-01-09 16:15:46","extension":"ab1","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":231793,"visible":true,"origin":"","legend":"\u003cp\u003eexon 40 Ryr2 gene Noiler chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN431NOILERNPrimer3H0324copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/684165bb0ede6f2e945a9e19.ab1"},{"id":73413202,"identity":"0c23a03c-1421-400a-a980-be4ac144aae7","added_by":"auto","created_at":"2025-01-09 16:31:45","extension":"ab1","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":231810,"visible":true,"origin":"","legend":"\u003cp\u003eexon 40 Ryr2 gene Ross 308 chicken breed forward primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN432ROSSRPrimer3F0318copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/02cd17077a5574cd085b630c.ab1"},{"id":73411659,"identity":"5e65cc4e-4833-4c43-9cd7-e96533106133","added_by":"auto","created_at":"2025-01-09 16:15:45","extension":"ab1","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":232443,"visible":true,"origin":"","legend":"\u003cp\u003eexon 40 Ryr2 gene Ross 308 chicken breed reverse primer chromatogram\u003c/p\u003e","description":"","filename":"Ryr2XN432ROSSRPrimer4G0321copy.ab1","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/9aab591e9743637183b7d0e9.ab1"},{"id":73411676,"identity":"473dad5f-3eb4-47c4-9fdd-6621d1d2a44b","added_by":"auto","created_at":"2025-01-09 16:15:47","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":6312463,"visible":true,"origin":"","legend":"\u003cp\u003e: Gel image of electrophoretically resolved RYR2 Exon 40 and 23 PCR amplified products\u003c/p\u003e","description":"","filename":"RYR2exon23bottom40top.tif","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/adb25d06bdc596cc03c0e398.tif"},{"id":73411630,"identity":"353a3a45-96a0-4119-8ddb-ca56d2a759e2","added_by":"auto","created_at":"2025-01-09 16:15:43","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":6312464,"visible":true,"origin":"","legend":"\u003cp\u003eGel image of electrophoretically resolved RYR2 Exon 44 PCR amplified products\u003c/p\u003e","description":"","filename":"RYR2exon44.tif","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/3eb3055106221ea0e0b0279c.tif"},{"id":73411711,"identity":"ac39504f-fb3b-4d07-9d1d-b1c80f1b003d","added_by":"auto","created_at":"2025-01-09 16:15:49","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":181048,"visible":true,"origin":"","legend":"\u003cp\u003eMorphometric and blood profile data of the experiment.\u003c/p\u003e","description":"","filename":"SpreadsheetMs.c2.1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5790536/v1/130f3e5b97eff17eb116b0b3.xlsx"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eDifferential growth, Cardiovascular risk, and Polymorphism in Targeted Regions of Ryanodine Receptor 2 (RYR2) gene in Three Breeds of Chickens.\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Implications","content":"\u003cp\u003eThis research provides critical insights into the genetic basis of growth and cardiovascular health in poultry, emphasizing its implications for sustainable breeding in tropical and subtropical regions. By identifying a Single Nucleotide Polymorphism (SNP) in the Ryanodine Receptor 2 (RYR2) gene associated with sudden death, the study highlights genetic markers that can guide breeding programs to enhance productivity and resilience in poultry. These findings hold economic importance by promoting healthier, stress-resilient chicken breeds, reducing losses in poultry production. Environmentally, the results support breeding strategies that minimize stress-induced mortality, improving resource efficiency. Socially, this research contributes to food security in tropical regions.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eBroiler chickens play a crucial role in addressing Nigeria\u0026rsquo;s protein needs (Olorunwa, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Broiler production provides employment, income, and an affordable protein source within 6\u0026ndash;10 weeks (Olorunwa, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Broilers are favored in Nigeria for their high feed conversion ratio, rapid growth, and profitability. With over 200\u0026nbsp;million chickens raised commercially (FAO, 2008; Oloso et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), broiler production is significant to the economy. However, the fast growth rate of broilers comes with challenges, including sudden death syndrome (SDS), where healthy birds suddenly die, often due to cardiovascular complications (Sosnowka-Czajka \u0026amp; Skomorucha, 2022). Years of selection for rapid growth and feed efficiency have increased the cardiovascular system\u0026rsquo;s workload, predisposing broilers to metabolic disorders like right ventricular failure, cardiac arrhythmias, and sudden death (Julian, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). SDS accounts for a 3\u0026ndash;6% mortality rate, with further studies indicating up to 17\u0026ndash;35% of fast-growing birds suffer from cardiac arrhythmias, a key cause of sudden death (Olkowski et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2008\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSlow-growing chicken breeds are less prone to SDS, as they have slower metabolic rates and reduced cardiovascular stress (Olkowski \u0026amp; Classen, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1998\u003c/span\u003e). One such breed is the Noiler chicken, a Nigerian crossbreed between exotic broilers and pullets. Though smaller and slower growing, Noilers are hardy and less susceptible to sudden death, making them a preferred breed for many (Animashahun et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenetic selection has been linked to SDS in broilers, with rapid growth and feed efficiency also increasing cardiovascular risks (Ajayi, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Traditional animal improvement methods, such as black box selection, are less efficient than molecular approaches like marker-assisted selection (Meuwissen et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). One promising approach is candidate gene studies, which investigate known genetic variations associated with traits or diseases. For SDS, studies have identified polymorphisms in genes like calsequestrin 2 and ryanodine receptor 2 (RYR2), which are linked to cardiac disorders and sudden death (Basaki et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Peng et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). This research will focus on RYR2's role in cardiovascular risk in broilers and Noiler chickens and will also explore SDS by examining cardiovascular stress and risk factors, including obesity, lipidemia, inflammation, and blood glucose.\u003c/p\u003e"},{"header":"Materials And Method","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental site\u003c/h2\u003e \u003cp\u003eThe experiment was conducted at the University of Ilorin Teaching and Research Farm, Ilorin, Kwara State, Nigeria (Latitude: 8\u0026deg;27'09.5\"N, Longitude: 4\u0026deg;39'44.5\"E). Molecular biology analyses were performed at three locations:\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eUniversity of Ilorin Central Research Laboratories (DNA extraction).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eUniversity of Ilorin Teaching Hospital, Molecular Diagnostic and Research Laboratories (PCR amplification).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eInqaba Biotechnology Limited, South Africa (DNA sequencing).\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExperimental Birds\u003c/h3\u003e\n\u003cp\u003eA total of 150-day-old chicks from three breeds were used: 50 Noiler (from Amo Sieberer Hatchery, Ibadan), 50 Abor Acres (from Valentine Hatchery, Ilorin), and 50 Ross 308 (from Agrited Hatchery, Lagos).\u003c/p\u003e\n\u003ch3\u003eManagement\u003c/h3\u003e\n\u003cp\u003eUpon arrival, the chicks received electrolytes (Vitranor by Jubaili) and were wing-tagged for identification. The birds were divided into three compartments based on breed and fed ad-libitum with commercial feeds. For the first 4 weeks, they were fed Ultima broiler starter (23% protein), and for the remaining 2 weeks, they were fed Ultima broiler finisher (18% protein). Vaccinations against infectious bursal disease and Newcastle disease were administered weekly.\u003c/p\u003e\n\u003ch3\u003eHousing\u003c/h3\u003e\n\u003cp\u003eThe birds were housed in a deep-litter system for the entire experiment.\u003c/p\u003e\n\u003ch3\u003eData Collection\u003c/h3\u003e\n\u003cp\u003eWeekly data were collected on growth parameters: body length, wing length, thigh length, drumstick length, shank length, keel length, and body girth. Body weight was measured using a top-loading scale. Body Mass Index (BMI) was also calculated as a metric of evaluating cardiovascular risk, providing an indicator of susceptibility to sudden death related to obesity. Growth rates were determined using Maciejowski and Zi\u0026ecirc;ba's formula (1982).\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eBODY LENGTH: The distance between the top of the head and pygostyle (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e)\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eWING LENGTH: Distance between the tip of the phalanges and the coracoids-humerus joint (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eTHIGH LENGTH: The distance between the beginning of the fibula to the hock joint.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eDRUMSTICK LENGTH: The length of the Femur bone (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eSHANK LENGTH: The distance between the beginning of the hock joint to the last ring before the tarsal or meta-tarsal digit (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eKEEL LENGTH: The distance from the V-joint to the end of the sternum (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eBODY GIRTH: This was taken from the point of depression to the breast round the body back to the point of depression (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eBODY WEIGTH: Body weight was measured weekly using a top loading 20kg scale with sensitivity of 10g (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eBODY MASS INDEX (BMI): The body mass index was derived by dividing body weight expressed in gram units by the square of body\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003elength expressed in cm units (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eGROWTH RATE: For body weight (g), and eachof the linear measures of body growth recorded (cm), Growth rate/velocity/potential for 1, 3 and 6 successive week periods were determined by use of an adapted version of the formula of Maciejowski and Zi\u0026ecirc;ba (1982),\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eI = [(T2 T1) / (T2\u0026thinsp;+\u0026thinsp;T1)/2] x 100 \u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip;\u0026hellip; Eq.\u0026nbsp;1\u003c/p\u003e \u003cp\u003eWhere:\u003c/p\u003e \u003cp\u003eI\u0026thinsp;=\u0026thinsp;Growth rate per unit period (%).\u003c/p\u003e \u003cp\u003eT1\u0026thinsp;=\u0026thinsp;Average initial reading for the stated period (g or cm)\u003c/p\u003e \u003cp\u003eT2\u0026thinsp;=\u0026thinsp;Average final reading for the stated period (g or cm)\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eThese measurements were taken with the use of a tailor rule and recorded in centimeter (cm) except for body weight which was recorded in Grams (g), following the procedures of (Oludoyi \u0026amp; Toye, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePrimer Design\u003c/h2\u003e \u003cp\u003eThe RYR2 gene (ENSGALT00010021632.1) on chromosome 3, with five variants in Gallus gallus domesticus, was the target gene in this experiment. This gene, associated with sudden death syndrome in broilers, has 104 exons (Basaki, 2019). Genomic organization and gene sequences were obtained from ENSEMBL (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.ensembl.org\u003cspan address=\"http://www.ensembl.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Forward and reverse primers were designed to amplify exons 23, 40, and 44 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), identified as mutational hotspots across species (Alvarado \u003cem\u003eet al\u003c/em\u003e., 2019). Using Primer3web Version 4.0.0, primers were anchored 50\u0026ndash;100 base pairs from each exon\u0026rsquo;s flanking regions. These primers were synthesized by Inqaba Biotechnical Industries, South Africa.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary Of Results from Forward and Reverse Primer Sequencing Of Ryr2 Gene And Exon Pcr Products From Ross 308, Arbor Acre And Noiler Chicken.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo; \u0026ndash; 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePrimer length (bases)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eActual primer temperature (\u0026deg;c)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eExon position (nt)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c9\" namest=\"c7\"\u003e \u003cp\u003eSequencing result\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eR3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eAA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eNO\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRYR2_XN23-F\u003c/p\u003e \u003cp\u003eRYR2_XN23-R\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAACTGTGGAAGCCTGTT\u003c/p\u003e \u003cp\u003eTCCCATTAGCACACTGAAATTGA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003cp\u003e23\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e51.78\u003c/p\u003e \u003cp\u003e51.71\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e253\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e37,010,713\u0026thinsp;\u0026minus;\u0026thinsp;37,010,894\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eS\u003c/p\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eS\u003c/p\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eS\u003c/p\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRYR2_XN40-F\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eRYR2_XN40-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTCTGCAGACAAAGTAGAAAGCA\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eTTGGGGTGCACAGATCTTTC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e22\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e20\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e51.11\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e51.78\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e344\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e36,968,268\u0026thinsp;\u0026minus;\u0026thinsp;36,968,758\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRYR2_XN44-F\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eRYR2_XN44-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGTGCAAGATGATTATAAATTGAGTGGT\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eTCAAAGTTCAATCATCCAGAGCA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e27\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e23\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e53.66\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e51.71\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u003cb\u003e464\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026minus;\" colname=\"c6\"\u003e \u003cp\u003e\u003cb\u003e36,959,346\u0026thinsp;\u0026minus;\u0026thinsp;36,959,916\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003eNS\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003e\u003cb\u003e*\u003c/b\u003eRyr2- Ryanodine Receptor 2; Xn- Exon; F- Forward; R- Reverse; Ta- Annealing Temperature; Bp- Base Pair; Nt- Nucleotide; S- Sequenced; Ns- Not Sequenced; R3- Ross 308 Chicken; Aa- Arbor Acre Chicken; No- Noiler Chicken. *Exon Position And Location Relating To Nt- 100 (3\u0026rsquo;utr) Primary Transcript (Ryr2- Ensgalt00010021632.1)\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBlood Collection and DNA Extraction\u003c/h3\u003e\n\u003cp\u003eBlood samples were collected for hematological analysis, serum biochemistry, and genotyping.\u003c/p\u003e \u003cp\u003e1ml of blood was collected via the brachial vein of each bird using sterilized disposable 2ml syringe and needle into EDTA (Ethylene-di-amine-tetra-acetic acid) bottles to prevent coagulation. DNA was then extracted from blood samples using the procedure described by Udeze et al. (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). DNA yield and purity were accessed by the use of Nano-drop spectrophotometry analysis.\u003c/p\u003e\n\u003ch3\u003eTarget Fragment Amplification by PCR\u003c/h3\u003e\n\u003cp\u003eFifteen DNA templates from three chicken breeds (five replicates per breed) were amplified using polymerase chain reaction (PCR) following standard protocol. The PCR process was conducted at the Molecular Diagnostic and Research Laboratory, University of Ilorin, Nigeria, using a MyGene\u0026trade; Series Peltier Thermal Cycler. The NEB PCR cocktail included 2X Master mix with buffer, chicken DNA template, primers, and deionized water, totaling 25\u0026micro;l. The thermal cycle used are: denaturation at 95\u0026deg;C, annealing at 55\u0026deg;C, 58\u0026deg;C, or 62\u0026deg;C, and extension at 72\u0026deg;C. PCR products were resolved on a 2% agarose gel with ethidium bromide, revealing a single clear band.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSequencing\u003c/h2\u003e \u003cp\u003eThe band of the five replicates of each breed\u0026rsquo;s PCR products was purified and sequenced through a commercial service (Inqaba Biotec Company, South Africa; using LIZ500 (ThermoScientific), ABI 3500XL Genetic Analyzer for Applied Biosystems, POP7\u0026trade;). Sequences results (electrophoretogram) supplied by Inqaba were viewed using Finch TV v1.4.0.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMultiple Sequence Alignment\u003c/h2\u003e \u003cp\u003eThe sequence of each successfully sequenced Exon from each of the examined breeds was aligned (MultAlin; Corpet, 1996) against the known sequence of the corresponding chicken gene (RYR2; ENSGALT00010021632.1) to confirm that the intended fragment of the target gene has been correctly amplified and sequenced.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic Analysis\u003c/h2\u003e \u003cp\u003ePhylogenetic analysis was carried out using MultAlin (Corpet, 1996) and phylogenyfr (Dereeper et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) to determine the evolutionary relationship amongst orthologs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSearch for Regulatory Sequences (MOTIFS)\u003c/h2\u003e \u003cp\u003eTfsitescan (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ifti.org/cgi-bin/ifti/Tfsitescan.pl\u003c/span\u003e\u003cspan address=\"http://www.ifti.org/cgi-bin/ifti/Tfsitescan.pl\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) online Motif searching software was used to scan for known gene regulatory sequences within the polymorphic intronic flanks of Exons DNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eSearch for Endonuclease Restriction Site\u003c/h2\u003e \u003cp\u003eNEBcutter (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://nc3.neb.com/NEBcutter/\u003c/span\u003e\u003cspan address=\"https://nc3.neb.com/NEBcutter/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) online endonuclease cleaving site software was used to scan for known gene restriction site sequences within the overlapping intronic SNPs.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSNP Association with Trait Related to Cardiovascular Risks and Physiological Stress.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eData collected was analyzed by observing the effect of SNP on traits of cardiovascular risks and physiological stress by using SPSS version 27.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eAll three exons from each of the 15 DNA templates were successfully amplified. However, clear bands were observed in only 66.7%, 66%, and 60% of the template DNA for exon 40, 23, and 44, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e\u0026amp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The sharpest bands from the five replicates of each breed were selected for sequencing. Despite attempts, sequencing exon 44 did not yield successful results in any of the reactions.\u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eNucleotide Sequence Polymorphism in RYR2\u003c/h2\u003e \u003cdiv id=\"Sec18\" class=\"Section3\"\u003e \u003ch2\u003eRYR2 gene Exon 23\u003c/h2\u003e \u003cp\u003eMultiple sequence alignment of RYR2 exon 23 from Ross 308, Arbor acres and Noiler breeds (including flanking intron DNA) against corresponding region of corresponding chicken gene (RYR2; ENSGALT00010021632.1) RYR2 revealed no sequence polymorphism (deletion, insertion, inversion or substitution) in the coding and non-coding portion (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eRYR2 gene Exon 40\u003c/h2\u003e \u003cp\u003eMultiple sequence alignment of RYR2 exon 40 from Ross 308, Arbor acres and Noiler breeds (including flanking intron DNA) against corresponding region of corresponding chicken gene (RYR2; ENSGALT00010021632.1) RYR2 revealed no sequence polymorphism (deletion, insertion, inversion or substitution) in the coding portion. However, a purine (Adenine A) to purine (Guanine G), Inversion single nucleotide polymorphism (SNP) located at base 3:36968262 of the primary transcript (numbering from nt-100 in the 3\u0026rsquo;UTR following Exon 40) was observed. This polymorphism falls in the 3\u0026rsquo; non-coding portion of the amplified exon 40 fragment; the primary transcript (ENSGALT00010021632.1) together with the Arbor Acre and Noiler breed carries the 36968262 Guanine (G) allele and the Ross 308 carrying the Adenine (A) allele (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). (See Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e,\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e for the chromogram of a segment of sequence at the 3\u0026rsquo; flanking intron DNA sequence (within intron 40\u0026ndash;41) of RYR2 Exon 40 of Arbor Acre, Noiler and Ross 308 chicken respectively.)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic Analysis\u003c/h2\u003e \u003cdiv id=\"Sec21\" class=\"Section3\"\u003e \u003ch2\u003eRYR2 Gene Exon 23\u003c/h2\u003e \u003cp\u003eThe phylogenetic analysis of RYR2 Exon 23 (intron 23) for Noiler, Arbor Acre, and Ross 308, compared to the red jungle fowl and other avian orthologs, revealed multiple conserved regions. These include conserved sequences within the exon and the 5\u0026rsquo; and 3\u0026rsquo; flanking intronic regions, such as an 8-base stretch (GTACCTTC) near the 3' splice donor site (GT) corresponding to position 37010779\u0026thinsp;\u0026minus;\u0026thinsp;37010771 of the primary transcript and a 7-base stretch (TCTCTTT) at the 5\u0026rsquo; splice acceptor site (AG) corresponding to position 37010898\u0026thinsp;\u0026minus;\u0026thinsp;37010891 of the primary transcript. Within the exon, sequences like (ATTGTTTTGCCTCC, CATGAACTTTGGGTTATGAATAAGATT) were conserved (see Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). However, conservation decreased when non-avian species were included, except for the dinucleotide GA within the exon (See Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eRYR2 Gene Exon 40\u003c/h2\u003e \u003cp\u003eThe phylogenetic analysis of RYR2 Exon 40 (intron 40) for Noiler, Arbor Acre, and Ross 308, compared to the red jungle fowl and other avian orthologs against the primary transcript (ENSGALT00010021632.1), revealed multiple conserved regions within the exon and flanking intronic regions. Conserved sequences include a 5-base stretch (TTC\u003cem\u003eAG\u003c/em\u003e) at the 5' splice acceptor site except in duck corresponding to position 36968349 of the primary transcript and a 3-base stretch (T\u003cem\u003eGT\u003c/em\u003e) at the 3' splice donor site corresponding to position 36968494 of the primary transcript, along with the canonical splice dinucleotides AG and GT. Within the exon, conserved sequences such as TTGA, TGG, ATGG, and GGAA were observed from positions 36,968,350\u0026thinsp;\u0026minus;\u0026thinsp;36,968,493 in the chicken gene (See Figs.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e,\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e)\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eRegulatory Sequence (MOTIFS)\u003c/h2\u003e \u003cdiv id=\"Sec24\" class=\"Section4\"\u003e \u003ch2\u003eRYR2 Gene Exon 23\u003c/h2\u003e \u003cp\u003eThe search for regulatory signatures in the intron sequences flanking RYR2 Exon 23 in Ross 308, Arbor Acre, and Noiler chickens revealed no regulatory elements. No polymorphisms were found in flanking introns of exon 23, corresponding to positions 37,010,785\u0026ndash;37,010,889 in the broiler reference genome ENSGALT00000020816. Thus, the analysis did not identify any regulatory signatures in these regions for the three chicken breeds.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eRYR2 Gene Exon 40\u003c/h2\u003e \u003cp\u003eA sequential search for regulatory signatures in the polymorphic intron DNA sequence 3\u0026rsquo; flanking RYR2 Exon 40 of Ross 308, Arbor Acre, and Noiler chickens revealed no regulatory elements. Ross 308 carries an alternate allele (Adenosine; A) while Arbor Acre and Noiler carry Guanine (G) at positions 36,968,350\u0026ndash;36,968,493 of the broiler reference (ENSGALT00010021632.1). Despite this, no regulatory signature was found at the polymorphic site, next to this site is an important motif, EF II (AAGCAACATTA), a transcription factor known as Elongation Factor 2, vital for protein synthesis and essential for cellular growth and development. The EF II motif, though critical, has not been reported in the RYR2 gene.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eSearch for Endonuclease Restriction Site\u003c/h2\u003e \u003cp\u003eA search for endonuclease restriction sites in the polymorphic intron DNA sequence 3\u0026rsquo; flanking RYR2 Exon 40 in Ross 308, Arbor Acre, and Noiler chickens revealed no restriction signature. Ross 308 carries an alternate allele (Adenosine; A), while Arbor Acre and Noiler carry Guanine (G) at positions 36,968,350\u0026ndash;36,968,493 of the broiler reference (ENSGALT00010021632.1). Despite being a highly endonuclease-restrictive region, PCR by Restriction Fragment Length Polymorphism (RFLP) is unsuitable for determining allele inheritance at this SNP. An alternative approach, such as genotyping by tetra-arms PCR, should be used instead.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSNP Association with Trait Related to Cardiovascular Risks and Physiological Stress.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBird genotypes were classified at each SNP locus, with Ross 308 broilers carrying the Adenosine (A) allele and Noiler and Arbor Acre chickens carrying the Guanine (G) allele. This classification aimed to assess genotype effects on cardiovascular risks, including obesity (BMI), blood glucose, inflammation, lipidemia, and stress levels, measured by the Heterophil/lymphocyte ratio.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eEffect of Genotype on Obesity\u003c/h2\u003e \u003cp\u003eAt week 1, there was no significant BMI difference between genotypes (ROSS 308\u0026thinsp;=\u0026thinsp;Arbor Acre \u0026amp; Noiler). From weeks 2 to 6, BMI was significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) between genotypes, with Ross 308 having higher BMI than Arbor Acre and Noiler (See Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of genotype on body weight growth rate from week 1 to 6. BMI: Body Mass Index (g/cm\u003csup\u003e2\u003c/sup\u003e), means with different superscript within row are significantly different.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTRAITS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eGENOTYPE SNP (rs734634989)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA (ROSS 308)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG (Arbor Acre \u0026amp; Noiler)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMI_wk1 (g/cm\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e9.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29(49)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18(99)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI_wk2 (g/cm\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e23.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.83(49)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e17.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52(99)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI_wk3 (g/cm\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e38.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.52(49)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e26.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.96(99)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI_wk4 (g/cm\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e54.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.0(49)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e32.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26(99)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI_wk5 (g/cm\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e69.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.65(49)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e41.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.69(99)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBMI_wk6 (g/cm\u003c/b\u003e\u003csup\u003e\u003cb\u003e2\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e82.5\u0026thinsp;\u0026plusmn;\u0026thinsp;3.34(40)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e49.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.11(97)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of Genotype on Blood Glucose.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThere was no significant difference in glucose levels between the genotypes A (ROSS 308) and G (Arbor Acre \u0026amp; Noiler) (See Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of breed on body weight growth rate from week 1 to 6.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBLOOD PROFILE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eGENOTYPE SNP (rs734634989)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA (ROSS 308)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eG (Arbor Acre \u0026amp; Noiler)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTC (mg/dl)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.95(10)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.67(10)\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLDL (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e13.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e11.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.88(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHDL (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e6.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.52(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e8.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003eb\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGLUCOSE (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e59.2\u0026thinsp;\u0026plusmn;\u0026thinsp;2.7(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e62.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHB (g/dL)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e7.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e8.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRBC (x10\u003c/b\u003e\u003csup\u003e\u003cb\u003e6\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e/mcl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e3.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e4.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMCV (fL)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e60.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e61.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMCH (pg)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e20.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMCHC (g/dL)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e33.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e33.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWBC (x10\u003c/b\u003e\u003csup\u003e\u003cb\u003e3\u003c/b\u003e\u003c/sup\u003e\u003cb\u003e/mcl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e2.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e2.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLYM (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e71.6\u0026thinsp;\u0026plusmn;\u0026thinsp;4.1(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e65.8\u0026thinsp;\u0026plusmn;\u0026thinsp;2.9(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHETERO\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e28.7\u0026thinsp;\u0026plusmn;\u0026thinsp;4.0(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e38.7\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eH/L RATIO\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e0.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e0.57\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTRYGLY (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e3.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003e3.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06(10)\u003c/b\u003e\u003csup\u003e\u003cb\u003ea\u003c/b\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cb\u003eTC: Total cholesterol, LDL: Low Density Lipoprotein, HDL: High Density Lipoprotein, HB: Hemoglobin, RBC: Red Blood Count, MCV: Mean Corpuscular Volume, MCH: Mean Corpuscular Haemoglobin, MCHC: Mean Corpuscular Concentration, WBC: White Blood Count, LYM: Lymphocytes, HETERO: Heterophils, TRYGLY: Triglycerides, H/L RATIO: Heterophils/Lymphocytes Ratio. means with different superscript within row are significantly different.\u003c/b\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of Genotype on Inflammation (White Blood Count, Heterophil, Lymphocyte).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThere were no significant differences in white blood cell counts, heterophil percentages, or lymphocyte percentages between genotypes A (ROSS 308) and G (Arbor Acre \u0026amp; Noiler) (See Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of Genotype on Lipidemia (Tc, Ldl, Hdl).\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThere were no significant differences in total cholesterol (TC) or LDL levels between genotypes A (ROSS 308) and G (Arbor Acre \u0026amp; Noiler), as shown in Table\u0026nbsp;4.9.2. However, HDL levels were significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), with genotype A having lower levels than genotype G (See Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eEffect of Genotype on Physiological Stress (Heterophil/Lymphocyte Ratio)\u003c/h2\u003e \u003cp\u003eGenotype does not significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) affect Heterophil/Lymphocyte ratio. However, with the p value approaching 0.05 may point to a weak but significant difference detectable only in experiments with high power (higher replication per group and lower environmental noise). Facilitating a stronger distinction between group variance from within group variance (See Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eAuthor\u0026rsquo;s Point of View\u003c/h2\u003e \u003cp\u003eThe absence of polymorphisms in RYR2 Exon 23 for Noiler, Ross 308, and Arbor Acre chickens suggests this exon is not responsible for cardiovascular risk and stress differences. However, intronic polymorphisms identified could serve as molecular markers, creating breed-specific identities for future research on distinct variants.\u003c/p\u003e \u003cp\u003eEvidence from 167 chicken genotypes across diverse geographical regions, including China, Indonesia, Korea, and Tibet, supports the existence of the SNP. Studies indicate this SNP is conserved across various populations, suggesting its evolutionary significance or selective pressure related to environmental adaptation. Notably, the exon 40 sequence of Arbor Acre and Ross 308 in the RYR2 gene has not been previously described, highlighting an intronic SNP that could be useful for selective breeding.\u003c/p\u003e \u003cp\u003eUsing the SNP haplotypes identified outside RYR2 Exon 40, the three breeds\u0026mdash;Arbor Acre Broiler, Ross 308 Broiler, and Noiler chicken\u0026mdash;can be distinguished at the molecular level regarding cardiovascular risk and physiological stress. This study underscores the importance of comparative sequencing of candidate genes for identifying breed-specific haplotypes, paving the way for gene association studies. However, the SNP haplotype does not fully distinguish effects on cardiovascular risk and stress, except for HDL levels. Genotype A is associated with about 10% lower HDL than Genotype G, indicating that birds inheriting allele A may experience higher stress due to reduced HDL. Although this SNP likely does not directly cause HDL differences, it may be in linkage disequilibrium with a causal variant nearby. Further sequencing studies are needed to identify the actual causal variant within this gene.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe unsampled RYR2 Exon 44 should be sequenced and analyzed by future researchers. Further studies are needed to identify additional mutations to address the gaps in this research. Additionally, other candidate genes linked to cardiovascular risks and stress in different chicken breeds should be amplified and sequenced in Noiler and indigenous birds to enhance local chicken populations. The haplotypes identified outside RYR2 Exon 40 could serve as molecular markers for distinguishing Ross 308 broiler chickens. Future investigations should also explore how variations in RYR2 Exon 40 haplotypes contribute to differences in cardiovascular risks and stress levels.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental procedures involving animals were conducted in compliance with the university of Ilorin department of animal production ethical committee guidelines and approved by the Animal Ethics Committee of the department.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors ORICD\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e0009-0000-2119-2265\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKolawole Olayiwola Faisal: Conceived and designed the study, performed the experiments, analyzed the data, and wrote the manuscript.\u003c/p\u003e\n\u003cp\u003eProf. Toye, A. A: Supervised the research and offered guidance.\u003c/p\u003e\n\u003cp\u003eDr. Sulaiman, M.K: Provided expertise in the molecular techniques used, supervised the laboratory aspect of the project, and helped revise the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author declares no conflict of interest regarding the publication of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI am deeply grateful to God for His wisdom, guidance, and strength throughout this research journey. His grace has been my source of inspiration and perseverance, helping me overcome every challenge along the way.\u003c/p\u003e\n\u003cp\u003eI would also like to express my heartfelt appreciation to my family, whose unwavering love, support, and encouragement have been invaluable. Their understanding, patience, and belief in me have provided the foundation I needed to pursue this work with dedication.\u003c/p\u003e\n\u003cp\u003eTo my friends, thank you for standing by me, offering motivation, and reminding me to keep going even during the most demanding moments. Your kindness, laughter, and reassurance made this journey not only bearable but enjoyable.\u003c/p\u003e\n\u003cp\u003eI am profoundly blessed to have each of you in my life, and I owe this accomplishment to the role you all have played in this endeavor. Thank you for being there every step of the way.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFinancial Support Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author declares that no funding was received for conducting this study. All expenses related to the research were covered by the author personally.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAjayi, F. O. (2010). Nigerian indigenous chicken: A valuable genetic resource for meat and egg production. \u003cem\u003eAsian journal of poultry science\u003c/em\u003e, 4(4), 164-172.\u003c/li\u003e\n \u003cli\u003eAnimashahun, R. A., Alabi, O. O., Okeniyi, F. A., Olawoye, S. O., Shoyombo, J. A., \u0026amp; Falana, B. M. (2022). Performance and blood profile of Noiler chickens fed diets containing graded levels of Parkia biglobosa leaf meal. \u003cem\u003eFood Research\u003c/em\u003e, 6(5), 256-265.\u003c/li\u003e\n \u003cli\u003eBasaki, M., Asasi, K., Tabandeh, M. R., \u0026amp; Aminlari, M., (2016). Polymorphism identification and cardiac gene expression analysis of the calsequestrin 2 gene in broiler chickens with sudden death syndrome. \u003cem\u003eBritish Poultry Science\u003c/em\u003e, 57(2), 151-160.\u003c/li\u003e\n \u003cli\u003eBasaki, M., Tabandeh, M. R., Aminlari, M., Asasi, K., Mohsenifard, E., \u0026amp; Abdi-Hachesoo, B. (2019). Sequence and expression analysis of cardiac ryanodine receptor 2 in broilers that died from sudden death syndrome. \u003cem\u003eAvian Pathology\u003c/em\u003e, 48(5), 444-453.\u003c/li\u003e\n \u003cli\u003eCorpet F. (1988). Multiple sequence alignment with hierarchical clustering. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. Nov 25;16(22):10881-90. (PubMed)\u003c/li\u003e\n \u003cli\u003eDereeper A., Guignon V., Blanc G., Audic S., Buffet S., Chevenet F., Dufayard J.F., Guindon S., Lefort V., Lescot M., Claverie J.M., and O. Gascuel (2008). Phylogeny.fr: robust phylogenetic analysis for the non-specialist. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2008 Jul 1;36 (Web Server issue):W465-9. Epub 2008 Apr 19. (PubMed).\u003c/li\u003e\n \u003cli\u003eFAO/WHO Expert Committee on Food Additives. Meeting, \u0026amp; World Health Organization. (2008). Safety evaluation of certain food additives and contaminants (Vol. 68). \u003cem\u003eWorld Health Organization.\u003c/em\u003e\u003c/li\u003e\n \u003cli\u003eJulian, R. J. (2005). Production and growth related disorders and other metabolic diseases of poultry–a review. \u003cem\u003eThe Veterinary Journal\u003c/em\u003e, 169(3), 350-369.\u003c/li\u003e\n \u003cli\u003eMaciejowski J., ZiebaJ. (1982). Genetics and animal breeding; ISBN 0444417036, 9780444997326\u003c/li\u003e\n \u003cli\u003eMeuwissen, T. H., Hayes, B. J., \u0026amp; Goddard, M. (2001). Prediction of total genetic value using genome-wide dense marker maps. genetics, 157(4), 1819-1829.\u003c/li\u003e\n \u003cli\u003eOlorunwa, O. J. (2018). Economic analysis of broiler production in Lagos State poultry estate, Nigeria. \u003cem\u003eJournal of Investment and Management\u003c/em\u003e, 7(1), 35-44.\u003c/li\u003e\n \u003cli\u003eOloso, N. O., Smith, P. W., Adeyemo, I. A., Odeokun, I. A., Isola, T. O., Fasanmi, O. G., \u0026amp; Fasina, F. O. (2020). The broiler chicken production value chain in Nigeria between needs and policy: situation analysis, action plan for development, and lessons for other developing countries. CABI Reviews, (2020).\u003c/li\u003e\n \u003cli\u003eOlkowski, A. A., \u0026amp; Classen, H. L. (1998). High incidence of cardiac arrhythmias in broiler chickens. \u003cem\u003eJournal of Veterinary Medicine Series\u003c/em\u003e A, 45(1‐10), 83-91.\u003c/li\u003e\n \u003cli\u003eOlkowski, A. A., Abbott, J. A., \u0026amp; Classen, H. L. (2005). Pathogenesis of ascites in broilers raised at low altitude: aetiological considerations based on echocardiographic findings. \u003cem\u003eJournal of Veterinary Medicine Series\u003c/em\u003e A, 52(4), 166-171.\u003c/li\u003e\n \u003cli\u003eOlkowski, A. A., Wojnarowicz, C., Nain, S., Ling, B., Alcorn, J. M., \u0026amp; Laarveld, B. (2008). A study on pathogenesis of sudden death syndrome in broiler chickens. \u003cem\u003eResearch in veterinary science\u003c/em\u003e, 85(1), 131-140.\u003c/li\u003e\n \u003cli\u003eOlkowski, A. A., Kettlewell, P. J., Mitchell, M. A., \u0026amp; Classen, H. L. (2010). Temperature gradients in trailers and changes in broiler rectal and core body temperature during winter transportation in Saskatchewan. \u003cem\u003eCanadian Journal of Animal Science\u003c/em\u003e, 90(3), 321-330.\u003c/li\u003e\n \u003cli\u003eOludoyi, I. A., \u0026amp; Toye, A. A. (2012). The effects of early feeding of Moringa oleifera leaf meal on performance of broiler and pullet chicks. Agrosearch, 12(2), 160-172.\u003c/li\u003e\n \u003cli\u003ePeng, W., Shen, H., Wu, J., Guo, W., Pan, X., Wang, R.,Chen, S.R. \u0026amp; Yan, N. (2016). Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2.Science, 354, aah5324.\u003c/li\u003e\n \u003cli\u003eUdeze, A. O., Olaleye, D. O., \u0026amp; Odaibo, G. N. (2020). Phylogeny of partial gag, pol and env genes show predominance of HIV-1G and CRF02_AG with emerging recombinants in south-eastern Nigeria. Heliyon, 6(8).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"University of Ilorin","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"DNA extraction, Exons, Polymerase Chain Reaction (PCR), Cardiovascular risks, Broiler Chickens","lastPublishedDoi":"10.21203/rs.3.rs-5790536/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5790536/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSudden death syndrome (SDS) is a stress-related genetic disease in broilers with no diagnostic clinical or necropsy finding. SDS is often preceded by elevated markers of cardiovascular risks (Obesity, Blood glucose, Lipidemia and Inflammation) in broilers. Mutation of Ryanodine Receptor 2 (RYR2) gene, which controls rapid release of ca\u003csup\u003e2+\u003c/sup\u003e from the sarcoplasmic reticulum (SR) into the Cystol during muscle contraction has been associated with sudden death syndrome in broilers, but there are no reports on the genetic association between RYR2 mutation and cardiovascular risk markers in broiler. This study aims to investigate the role of RYR2 mutation in the development of SDS using the linkage association approach. The study compares exotic broiler chicken (Ross 308, Arbor Acres) with the less susceptible indigenous Noiler chicken breed as a contrast to identifying genetic markers linked to SDS susceptibility.\u003c/p\u003e \u003cp\u003eKey findings revealed a Single Nucleotide Polymorphism (SNP) near a functional RYR2 region at chicken genome location 3:36968262. The Noiler and Arbor Acres breeds carried an A (Adenosine) allele, while Ross 308 carried a G (Guanine) allele, with the G allele associated with increased cardiovascular risk and stress. Moreover, Arbor Acres and Ross 308 breeds exhibited higher stress levels and cardiovascular risk than the Noiler breed using certain metrics of measurement. These results underscore the critical role of RYR2 genetic differences in growth and cardiovascular traits in poultry, these findings suggest that genetic differences in the RYR2 gene play a crucial role in growth and cardiovascular traits in poultry, offering valuable insights for breeding programs.\u003c/p\u003e","manuscriptTitle":"Differential growth, Cardiovascular risk, and Polymorphism in Targeted Regions of Ryanodine Receptor 2 (RYR2) gene in Three Breeds of Chickens.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-09 16:15:37","doi":"10.21203/rs.3.rs-5790536/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3a8e8c52-6202-4bdd-914b-41a52a166213","owner":[],"postedDate":"January 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":42571445,"name":"Molecular Genetics"}],"tags":[],"updatedAt":"2025-01-09T16:15:37+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-09 16:15:37","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5790536","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5790536","identity":"rs-5790536","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}