Modeling Chronic Arsenic Toxicity in Drosophila melanogaster: Insights into Oxidative Stress, Neurotoxicity, and Carcinogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Modeling Chronic Arsenic Toxicity in Drosophila melanogaster: Insights into Oxidative Stress, Neurotoxicity, and Carcinogenesis Jane-Rose I. Oche, Jonathan D. Dabak, Titilayo O. Johnson This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6932906/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Arsenic, a pervasive environmental toxin, is implicated in carcinogenesis, neurotoxicity, and metabolic disorders. This study investigates chronic sodium arsenite toxicity in Drosophila melanogaster, evaluating its impact on survival, oxidative stress, tissue integrity, and gene expression to model neurotoxicity and carcinogenesis. Flies were exposed to graded concentrations of sodium arsenite (0.03–0.14 mM) over 21 days. We assessed survival rates, oxidative stress biomarkers, gene expression, and histological changes in key tissues including the brain, gastrointestinal tract, and fat body. Results revealed dose-dependent reductions in survival, elevated oxidative stress markers, and significant tissue damage. Notably, tumor-like growths and disrupted enterocyte architecture were observed, alongside altered expression of genes such as Ras, p53, SOD1, and CncC. These findings underscore the utility of Drosophila as a translational model for studying arsenic-induced pathologies and provide mechanistic insights into its role in disease development. Arsenic toxicity Drosophila melanogaster oxidative stress neurotoxicity carcinogenesis gene expression Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Arsenic (As) is a naturally occurring toxic metalloid that poses significant health risks, including carcinogenesis and organ damage, when ingested through contaminated water or food. As is highly soluble in water, and most plants, such as rice, have the ability to bioaccumulate As in their tissues. The World Health Organization (WHO) classifies arsenic as a major public health concern, with exposure limits set at 10 µg/L in drinking water (WHO, 2022a) Similarly, the US Environmental Protection Agency (EPA) has set the Maximum Contaminant Level (MCL) for arsenic in drinking water at 10 µg/L (Frisbie & Mitchell, 2022). This reduction from an earlier standard of 50 µg/L was implemented in 2001 to address concerns about the role of arsenic as a carcinogen and its other adverse health effects (WHO, 2022b). When disturbed by natural processes, such as weathering, biological activity, and volcanic eruption, arsenic may be released into the environment. Arsenic is released into the environment through both natural processes (e.g., volcanic eruptions, weathering, and earthquakes) and anthropogenic activities such as mining, smelting, well drilling, and fossil fuel combustion (Shen et al., 2013). Increased exposure to arsenic, especially in less developed and emerging nations, is a global issue because of its negative effects, including genetic damage that can lead to diseases (WHO, 2022). Arsenic exposure threatens the health of 230 million people worldwide. These implications include increased risks for cancer, cardiovascular disease, diabetes, skin lesions, neurological disorders, kidney disease, and difficulties related to foetal development and cognition (Bhat et al., 2024). The toxicity of arsenic is a consequence of its metabolism. When absorbed, As bioaccumulates in the liver, kidneys, heart, and even lungs. The muscles and neural tissues can store lower levels of arsenic. Arsenic accumulation in various tissues has been linked to a variety of diseases, including cancer, diabetes, hepatotoxicity, neurotoxicity, cardiotoxicity (Singh et al., 2011) and dermatological diseases (Sanyal, Bhattacharjee, Paul & Bhattacharjee, 2020). Arsenic promotes chromosomal instability and clonal variability, which mediate arsenic-induced carcinogenesis, as observed in hsa-miR-186-overexpressing human keratinocytes (Lykoudi et al., 2023). Studies have also demonstrated that arsenic exposure leads to metabolic reprogramming, which in turn contributes to carcinogenesis, although the underlying pathways of arsenic carcinogenesis are unknown (Cardoso et al., 2018; Ruan et al., 2022). The International Agency for Research on Cancer (IARC) classifies arsenic as a Class I human carcinogen (Ruan et al., 2022). Prolonged arsenic exposure poses considerable risks to human health, and severe cases can lead to breast, meningeal and brain, stomach, liver, and other digestive organ cancers and leukemia (Rahmani et al., 2023). In addition to being a carcinogen, arsenic can induce neurotoxicity. Arsenics deactivate some enzymes involved in the cellular energy system, DNA synthesis, and repair, by binding to their active sites (Bibha et al., 2024). Most pathways are involved in arsenic-induced neurotoxicity, including oxidative stress, thiamine shortage, and reduced acetylcholinesterase activity (Mochizuki, 2019). Arsenic neurotoxicity has also been related to alterations in neurotransmitter metabolism, which leads to abnormalities in synaptic transmission (Garza-Lombó et al., 2019). Arsenic readily crosses the blood‒brain barrier and accumulates in the striatum and hippocampus, hence increasing arsenic toxicity and tissue injury (Thakur et al., 2021). On the basis of the knowledge of arsenic toxicity and how some of the effects are observed in most diseases, such as cancer, the use of a suitable model to express such diseases via the use of arsenic could be explored. The use of mammalian and in vitro models, although offering means of expressing diseases, has limitations (Davis et al., 2014). The human and Drosophila genomes are similar not only in terms of genetic material but also in terms of their relationships, with several examples of similar biological systems (Calap-Quintana et al., 2017). Approximately 75% of the genes associated with human diseases have homologs in Drosophila (Mariateresa et al., 2018; Mirzoyan et al., 2019),which presents Drosophila as a model organism used to investigate a variety of human genetic diseases, including metabolic disorders, cancer and neurodegeneration. Pathways involved in oxidative stress in humans have been found to also exist in Drosophila (Singhal & Jaiswal, 2018). Additionally, most signalling pathways that are involved in cell growth, proliferation, and apoptosis are also conserved between Drosophila and humans, including pathways such as the Ras-MAPK, PI3K-Akt, and Hippo pathways (Mirzoyan et al., 2019). These pathways have been found to be vital in understanding tumorigenesis. Pathways known to be involved in neurodegeneration, such as those related to mitochondrial dysfunction, protein aggregation, and neuronal cell death, are also conserved in Drosophila , as such have been used to study diseases like Parkinson's, Alzheimer's, and Huntington's disease (Bülow et al., 2020; Singhal & Jaiswal, 2018). Also, a study found that methylated arsenic species can induce chromosomal instability and reduce lifespan in Drosophila melanogaster , mirroring the effects seen in humans (Muñiz Ortiz et al., 2011). The mechanisms by which arsenic induces toxicity are complex and involve genetic factors. In both humans and Drosophila, arsenic exposure can lead to DNA damage, disruption of key signaling pathways, and oxidative stress (Rizki et al., 2006). The antioxidant defense systems of Drosophila melanogaster, including superoxide dismutase (SOD), catalase, and the Keap1-CncC signaling pathway, are analogous to those in humans, facilitating in vivo investigations into redox imbalance (Hong et al., 2024). Likewise, critical pathways involved in carcinogenesis, such as p53 (Chakravarti et al., 2022; Zhou, 2019) and Ras (Mirey et al., 2003), as well as those associated with neurodegeneration, including amyloid precursor (Poeck et al., 2012) and tau proteins (Prüßing et al., 2013; Yang et al., 2023), exhibit significant conservation, offering valuable insights into the mechanistic role of arsenic in disease pathogenesis. Drosophila melanogaster possess a short life cycle, which allows simple survival, neural function, and behavioral studies, making them suitable for modelling diseases. Its ease of maintenance, and reduced ethical concerns make it an ideal model for cost-effective, scalable research. Previous studies on arsenic exposure in Drosophila melanogaster (Oyibo et al., 2021) did not establish any disease conditions induced by arsenic but focused only on oxidative stress. Using Drosophila melanogaster , long-term effects could be observed and extrapolated to humans since both organisms have conserved pathways. In summary, Drosophila melanogaster serves as a versatile and cost-efficient model for elucidating the molecular mechanisms underlying arsenic toxicity and facilitating the development of therapeutic strategies. This study leverages the Drosophila model to evaluate arsenic-induced disease conditions, providing insights into neurotoxicity, carcinogenesis and other arsenic-related pathologies that could inform human-relevant toxicological research as well as explore its potential as an affordable model for carrying out research. MATERIALS AND METHODS Sodium arsenite was acquired from Oxford Lab Fine Chem LLP Vasai East, Palghar-410210, Maharashtra, India. All the reagents used for this study were obtained commercially and were of analytical grade. Experimental Flies The mixed sex of the Canton-S strain of Drosophila melanogaster, which were no older than 3 days, was used for the study. The flies were bred on a medium comprising cornmeal with 1% w/v brewer's yeast, 1% w/v agar and 0.08% v/w nipagin at constant temperature and humidity (25 °C; 60–70% relative humidity) under 12 h dark/light cycle conditions at the Drosophila Laboratory, Department of Biochemistry, College of Medicine, University of Ibadan, Oyo State, Nigeria. The flies were obtained from the Federal University of Santa Maria in Brazil and were originally obtained from the National Stock Centre in Bowling Green, Oklahoma, in the United States of America. The experimental flies used for the study were grouped as indicated in Table 1. Table 1 Treatment Groups Group Description Group 1 Positive Control (Distilled water) Group 2 Exposed to 0.03 mM of NaASO 2 Group 3 Exposed to 0.06 mM of NaASO 2 Group 4 Exposed to 0.12 mM of NaASO 2 Group 5 Exposed to 0.14 mM of NaASO 2 (n = 5 vials per group; 50 flies/vial). Preparation of fly samples for biochemical assays All flies were anaesthetized with carbon dioxide, weighed and homogenized at a ratio of 1:10 – field/volume (µL) in 0.1 M potassium phosphate buffer (pH 7.4), and centrifuged at 4,000 × g for 10 min at 4 °C. The resulting supernatants were used to determine the following biochemical parameters: total thiol level, hydrogen peroxide (H 2 O 2 ) level, reduced glutathione (GSH) level, nitric oxide content, lipid peroxidation, protein carbonyl content and gene expression. Histology and morphology To determine structural alterations caused by arsenite on selected organs, histology was carried out using the method described by Drobysheva et al. (2008). Bouin solution was used to fix the flies for 24 hours. Phosphate-buffered saline was used to rinse the flies after fixation four times for 15 minutes at room temperature. The tissues of the gastrointestinal tract were placed in disposable petri dishes and covered with agarose, and the blocks were chilled at 4 °C, followed by sectioning. The images were then viewed and analysed. The morphology of the whole gastrointestinal tract was observed microscopically using Olympus LS compound microscope (100x) following dissection of the flies in phosphate buffer solution. Images were viewed and analysed via ImageJ software (bundled with 64-bit Java 8). Effect of Sodium Arsenite on the Survival Rate To evaluate the effect of chronic exposure of arsenic on the lifespan of the flies as a measure of cumulative toxicity, the flies were exposed to sodium arsenite (NaAsO 2 ) at different doses (0, 0.03, 0.06, 0.12, and 0.14 mM/g diet) for 21-day survival analysis. The flies were observed for survival via the method described by Farombi et al. (2018). The daily death rate of the flies was recorded, and the Kaplan‒Meier survival method was used to assess the survival rate of the flies exposed to sodium arsenite in contrast to the positive control group, which had not been exposed to arsenite. Biochemical analysis of oxidative stress markers Oxidative stress was evaluated by analysing the markers of oxidative stress. Flies were exposed to 0.03, 0.06, 0.12, and 0.14 mM/g diet concentrations of sodium arsenite (NaAsO 2 ) for 10 days to carry out biochemical analysis, gene expression studies, and histology and morphological examinations. Protein Determination Lowry’s method was used to determine the protein concentration. The protein concentrations of the various samples were determined via the modified Lowry method as described by Everette et al. (2010). Determination of Hydrogen Peroxide Level The hydrogen peroxide level was measured according to the method described by Wolff (1994). After the sample was incubated in the FOX 1 reagent for 30 minutes at room temperature, the absorbance at 560 nm was measured. Protein concentrations in μmole/mg were converted to H2O2 values derived from a standard curve. Determination of Total Thiol Level The total thiol level was analysed via the method of Ellman (1959). To perform the test, 510 μL of 0.1 M phosphate buffer (pH 7.4) was added to 35 μL of 1 mM DTNB, 35 μL of distilled water, and 20 μL of sample, mixed and allowed to incubate for 30 minutes at room temperature, and the absorbance was read at 412 nm. Determination Of Glutathione-S-Transferase Activity Glutathione-S-transferase activity was evaluated via the method described by Habig and Jakoby (1981). Solution A was prepared by mixing 0.25 M potassium phosphate buffer (20 μL), 2.5 mM EDTA, 10.5 μL of distilled water and 0.1 M GSH (500 μL) at pH 7.0 and 25 °C. A total of 20 μL of the sample, at a ratio of 1:5 dilution, was added to 270 μL of solution A, followed by the addition of 10 μL of 25 mM CDNB. The absorbance was read at 340 nm for 5 min at intervals of 10 seconds via a spectrophotometer. Determination of Reduced Glutathione Level The method described by Beutler et al. (1963) was used to assess the level of reduced glutathione (GSH). Serial dilutions of GSH stock solutions containing 20–200 µg of reduced glutathione were prepared in different test tubes and made up to 100 µl with 0.1 M phosphate buffer, pH 7.4. Approximately 900 µl of Ellman’s reagent was then added to each sample tube. Readings were taken immediately after the addition of Ellman’s reagent, as there could be a loss of 1–2% color 5–10 minutes. The GSH concentration in each test tube was determined, and the absorbance was read at 412 nm. Determination of Nitric Oxide Level The nitric oxide concentration was analysed via the Greiss method as described by Johnson et al. (2021). For 20 min at room temperature, 250 μL of each sample was incubated with 250 μL of Griess reagent. By comparing the absorbance of the sample with that of a standard solution with a known nitrite concentration, the nitrite concentration was determined via spectrophotometric measurement at 550 nm. Determination of Protein Carbonyl Level The protein carbonyls were evaluated as described previously Wehr and Levine (2013). First, 2.0 g of DNPH (dry weight) was dissolved in 1,000 mL of 2 M HCl and stirred in the dark. Afterwards, it was filtered and concentrated by precipitation in 10% trichloroacetic acid via slow speed centrifugation to form a loose, easily dispersed pellet for 2 min at 2,000 × g. 0.5 mL of the solution was added to the sample and vortexed to suspend the sample. The tubes were allowed to stand for 10 min at room temperature, with occasional vortexing. TCA (10%) was added to precipitate the pellets, which were recovered via slow speed centrifugation. The supernatant was removed, and free DNPH was extracted by rinsing with 1 mL of ethanol-ethyl acetate three times, after which the mixture was centrifuged at 5000 × g for 2 minutes. The supernatant was discarded, and the pellet was dried. The dried pellet was redissolved in 200 μL of 6.0 M guanidine 500 mM KCl (pH 2.5) and centrifuged. The solution was read at 370 nm and 276 nm. Determination of Acetylcholinesterase Activity Acetylcholinesterase activity was assayed via the method of Ellman et al. (1961). The process was started by adding 0.8 mM acetylthiocholine to a mixture of 1 mM DTNB and 0.1 M potassium phosphate buffer (pH 7.4). For two minutes, the absorbance was measured at 412 nm every thirty seconds. The AChE activity was measured in μmol of hydrolysed acetylthiocholine per minute per milligram of protein, which was expressed in mmol of hydrolysed acetylthiocholine per minute per milligram of protein. Effect of Sodium Arsenite on Gene Expression The effect of sodium arsenite on the Ras gene was determined via mRNA expression kits. Extraction of mRNA was carried out via the Quick-RNA™ MiniPrep Plus Kit, and cDNA was synthesized via the ProtoScript II First Strand cDNA Synthesis Kit according to the manufacturer’s protocols. Quantitative real-time PCR was carried out to evaluate the expression of the identified genes in the flies. RNA isolation and extraction were carried out rapidly on ice to prevent degradation by RNase. The primers used are presented in Table 2: Table 2 Primers Statistical analysis Genes Sequence p53 F 5’ ATCCAGCCTACGGAGGCAAC 3’ R 5’ CGACCTCCGTGGAGTCATCC 3’ RAS F 5’ ACGGCAAATCGAAAACGGAC 3’ R 5’ TCGGCTTGTTCATTTTGCGG 3’ CNC F 5’ CGCCAACGAGGTGGAAATCG 3’ R 5’ CGCCTCCTGGTCCAAACTGA 3’ SOD1 F 5’ CATCGGGTGCGGCGTTATT 3’ R 5’ AATAACGCCGCACCCGATG 3’ The data were statistically analysed via GraphPad Prism software (version 9.5.1) from San Diego, CA, USA. The results are presented as the means + standard deviations (SDs). To assess significant differences, Tukey's post hoc test was employed. Additionally, the statistical significance of the survival rate was determined via the log-rank (Mantel‒Cox) test. RESULTS Relative to the control group, arsenite-exposed flies displayed significant physiological and molecular alterations across various parameters, including oxidative stress markers, tissue integrity, and gene expression. Effect of Sodium Arsenite on the Survival Rates of Drosophila melanogaster The graph in fig. 1 displays Drosophila melanogaster survival rates after 21 days of exposure to various doses of sodium arsenite. Exposure to 0.14 mM arsenite reduced fly survival to 12% (p=0.021), indicating significant toxicity relative to the 48% survival observed in controls. This finding suggests that chronic exposure to high concentrations of sodium arsenite is harmful and could reduce longevity. Histology and morphology The histology of the digestive tract, fat body, and brain demonstrated that sodium arsenite had a detrimental effect on these tissues. Fig. 2 depicts the histology of the dissected organs, which were stained with haematoxylin and eosin (HE) and viewed via 400x objectives. Histology of the Intestine of Drosophila melanogaster In the control (Fig. 2a), the intestinal structure appears normal, with clear and intact cell boundaries. Coagulative necrosis was observed in the intestine of the fly exposed to sodium arsenite (Fig. 2b), as well as hyperchromacia and hypertrophy (HE x400) compared with those in the unexposed Drosophila melanogaster . Dysplastic cells, characterised by disorganized cells, were also observed. Hyperchromatic nuclei, marked by intense purple staining, were visible in arsenite-exposed tissues, suggesting nuclear activity associated with pre-cancerous transformation. Compared with the control, the enterocytes of the sodium arsenite-exposed flies appeared disrupted, as indicated by the stars. Fat body of Drosophila melanogaster The fat body in the control (Fig. 2c) shows a uniform, healthy structure without lesions, whereas the arsenite-exposed group (Fig. 2d) exhibits atrophy, with shrunken and irregularly shaped cells. Compared with unexposed flies, exposed flies presented significantly altered tissue structure, demonstrating that sodium arsenite exposure causes negative changes in fat body morphology. These findings suggest that As can affect energy storage and metabolism in flies. Brain of Drosophila melanogaster The control brain (Fig. 2e) shows intact gray matter and white matter structures. In the arsenite-exposed group (Fig. 2f), loss of gray matter neurons, deformation of white matter, and disorganized tissue architecture are apparent, suggesting possible nuclear and cytoplasmic damage. Morphological Alterations There were no physiological changes observed in the flies, although arsenic toxicity was observed in the movement of the flies. The flies exhibited extreme weakness; therefore, male and female flies were dissected to observe whether there were any change(s) within the internal organs. Tumor-like structures are visible in the gastrointestinal crop of arsenite-exposed male flies (Fig. 3b) compared to the normal control (Fig. 3a). This suggests carcinogenic changes, which could be linked to oxidative stress and oncogene activation. This was measured via ImageJ software, and the size of the tumor-like growth was 0.18 mm × 0.28 mm. In the dissected female fly, the control ovary (Fig. 3c) appears intact, while the ovary in the arsenite-exposed female fly (Fig. 3d) shows signs of rupture, indicating ovotoxicity. Biochemical analyses of markers of oxidative stress The results of the biochemical analysis of the oxidative stress markers are shown in Fig. 4. Hydrogen Peroxide Levels The bar chart in Fig. 4a shows the concentrations of hydrogen peroxide in the various treatment groups. Compared with the control group (24.84 ± 0.46 mmol/mL), the group exposed to 0.14 mM/g of sodium arsenite presented a significant increase in hydrogen peroxide levels (35.08 ± 3.14 mmol/mL) (p = 0.0007). These findings indicate that arsenic exposure promotes increased oxidative stress, as demonstrated by increased hydrogen peroxide generation, which may overwhelm cellular antioxidant defenses, leading to the development of degenerative diseases. Total thiol concentration The total thiol content was measured because arsenite is known to have high affinity for thiol groups. At relatively low concentrations, the thiol content was not affected, which could imply that the concentration of arsenite was not high enough to cause a decrease in the thiol pool of the system. However, as the concentration increased, the thiol content decreased significantly (p = 0.029) at 0.14 mM/g diet of arsenite. This was an indication of a compromised antioxidant system (Fig. 4b). Reduced Glutathione Concentrations Reduced glutathione (GSH) is a nonenzyme antioxidant. It is responsible for the detoxification of arsenite. However, owing to the thiol groups present in GSH, arsenite tends to bind to the thiol groups, thereby depleting the concentration of GSH due to the formation of the arsenite-GSH complex. The results in Fig. 4c show that at low concentrations, GSH was not depleted, but there was a significant decline (p = 0.0003) in the GSH level of the group exposed to 0.14 mM/g diet of sodium arsenite. Nitric oxide concentration In Fig. 4d, following exposure to sodium arsenite, nitric oxide levels increased in the groups exposed to lower concentrations. At higher concentrations (0.12 mM/g diet and 0.14 mM/g diet), there was decreased nitric oxide in a dose-dependent manner, with p values of 0.00017 and 0.0088, respectively. Protein carbonyl concentration In the presence of oxidative stress, free radicals, which can bind randomly to macromolecules, are produced. Binding of these free radicals to amino acids in the protein components of the cell leads to the production of protein carbonyls via protein oxidation. Amino acids are oxidized by free radicals. The results of the present study (Fig. 4e) revealed that, at lower concentrations, the protein carbonyl levels were low. However, there was a corresponding increase in arsenite concentration with increasing protein carbonyl content (p= 0.0009). Glutathione-S-Transferase Activity The antioxidant system is composed of enzyme and nonenzyme components. Glutathione-S-transferase (GST) is an antioxidant enzyme involved in the detoxification of arsenic. Owing to the presence of thiol-containing amino acids, arsenic tends to have high affinity for proteins. The results of this study in Fig. 4f show that at low concentrations, arsenite does not affect the activity of the protein, but an increase in the concentration of sodium arsenite leads to decreased enzyme activity (p=0.013). Acetylcholinesterase activity Acetylcholinesterase (AChE) is a hydrolase involved in neurotransmission. It degrades acetylcholine to acetic acid and choline. Inhibition of its activity can lead to the development of neurodegenerative diseases. At a relatively high concentration of sodium arsenite (0.14 mM), the activity of AChE decreased significantly, p=0.01 (Fig. 4g). Gene expression of sodium arsenite- exposed Drosophila melanogaster The effects of sodium arsenite on genes were also observed. The results (Fig. 4h) revealed that p53 was downregulated in the exposed group. The Ras oncogene was overexpressed. SOD1 was downregulated, and CNC was also overexpressed. DISCUSSION In this study, toxic effects of sodium arsenite were observed in flies. Chronic arsenic exposure in Drosophila melanogaster provides a valuable framework for studying disease mechanisms relevant to human health. Its ability to mimic long-term toxicity pathways, including carcinogenesis, neurotoxicity, and systemic organ damage, offers critical insights that complement acute exposure studies. By examining cumulative and progressive biological impacts, this approach addresses real-world scenarios of prolonged arsenic exposure, advancing the understanding of its insidious health risks. The Canton-S strain was used due to the genetic makeup that may include mutations or genetic variations which could make it more susceptible to carcinogens compared to other strains (FlyBase, 2024). Their reduced genetic diversity, accumulation of deleterious alleles, relaxed selection pressures, metabolic changes, and altered behaviors, can collectively increase their susceptibility to oxidative stress and other environmental insults (Stanley & Kulathinal, 2016). Different studies have shown that arsenic has a negative effect on the lifespan of individuals, reducing their lifespan and reducing their quality of health as a result of chronic exposure. In this study, the survival rate of the flies decreased upon exposure to arsenic. Flies exposed to relatively high concentrations of sodium arsenite for 21 days presented a relatively high mortality rate, possibly due to arsenic accumulation. This cumulative damage arsenic inflicts on cellular and systemic processes, underscores its potential to disrupt homeostasis over time in the flies. This finding is consistent with a prior study by Rahman et al. (2019), which indicated that arsenic exposure can increase mortality in humans. The observed decline in the survival of the flies may be attributed to arsenic accumulation in flies due to their overwhelmed system, resulting in a shorter survival rate of the flies (Anushree et al., 2023). Epidemiological studies have also shown that arsenic exposure can have negative health consequences, including mortality, depending on the quantity and duration of exposure (Garkal et al., 2023). Chronic exposure or acute exposure to high levels of inorganic arsenic over time can result in mortality. The histological evidence of cellular dysplasia and structural disorganization, especially in the cells of the small intestine, suggests genomic instability, potentially caused by the interference of arsenic with DNA repair mechanisms. These changes align with the ability for chronic arsenic exposure to induce mutagenesis and promote malignant transformation (Cardoso et al., 2018; Nail et al., 2023), bridging findings from acute studies with long-term cancer development. Hyperchromacia observed suggests increased nuclear activity, often associated with uncontrolled cell division, a hallmark of cancer (Fischer, 2020). The hypertrophy, observed in the enterocytes of the intestinal sections was characterized by enlarged cells with an abnormal structure. The hypertrophic cells appear swollen and irregularly shaped compared to the uniform cell size in the control group. Cellular hypertrophy can indicate pre-cancerous or cancerous conditions due to changes in cellular growth and metabolism (Penzo et al., 2019). The dark-stained nuclei likely represent hyperchromatic features associated with DNA damage or increased mitotic activity. These findings align with the mechanisms of arsenite-induced mutagenesis. Oxidative stress in neuronal tissues of the brain suggests that arsenic impairs neurotransmission and neuronal survival, reflecting mechanisms linked to neurodegenerative diseases in humans. Additionally, the histology of fat bodies revealed arsenic toxicity, which led to atrophy of fat body cells. This finding corroborates the findings of Zhang et al. (2024) that arsenite trioxide induces hepatotoxicity. Atrophy and necrosis can be indicative of metabolic stress caused by developing tumors, which can induce necrosis in surrounding tissues by outcompeting them for resources, leading to a lack of blood flow (ischemia) and subsequent cell death (Cui et al., 2021). Tumors create a high demand for nutrients and oxygen, which can lead to metabolic stress in the surrounding tissues. This stress can cause cells to undergo atrophy and eventually necrosis if the deprivation is severe enough (Hou et al., 2020). The fat body in Drosophila melanogaster performs functions similar to those of the human liver, making it a suitable model for studying liver-related conditions. The Drosophila fat body is an organ that resembles liver and adipose tissue, storing fat and acting as a detoxifying and immunological response system (Musselman et al., 2013). On the other hand, the atrophied fat body cells highlight disrupted energy metabolism and storage, which can be extrapolated to metabolic impairments seen in arsenite toxicity in humans (Khandayataray et al., 2024; Ro et al., 2022). The results of this study suggest that sodium arsenite could be used to induce toxicity in these organs in Drosophila melanogaster to develop therapeutic strategies. The histological changes observed in these results provide compelling evidence for the systemic damage caused by chronic arsenite exposure. In Fig. 3b (crop of arsenite-exposed flies), a tumor-like growth is observed as a dense, irregular mass protruding from the crop tissue. It appears larger and more compact compared to the smooth and normal structure in the control. Tumor-like growth indicates localized proliferation of cells, a characteristic of neoplasia (Turek et al., 2022). These growths are often precursors to invasive cancer, though they are not always cancerous. However, if the cells acquire additional mutations, they may invade surrounding tissues and spread to other parts of the body. Tumor-like growth observed in Drosophila suggests that arsenite can induce gastrointestinal tract cancer. This finding supports the findings of the study carried out by Kasmi et al. (2023). The ovarian toxicity of arsenic was also observed in this study. A previous study confirmed that exposure to arsenic leads to an overall decline in ovarian functions, such as disruption of steroidogenesis, where the effect of arsenic exposure leads to decreased levels of estradiol (E2) and other steroid hormones (Chen et al., 2022). Like in humans and other living organisms, arsenic can induce oxidative stress in flies. The results of the markers of oxidative stress revealed that exposure to arsenite triggered oxidative stress in flies similar to that in higher organisms, including humans. Oxidative stress has been proposed as a possible mechanism for arsenite toxicity. Increased oxidative stress owing to an imbalance in the antioxidative system caused by excessive ROS might overwhelm the system, leading to different disease conditions. This study demonstrated that arsenic-induced toxicity in flies increased hydrogen peroxide production, which could be associated with the activities of NADPH oxidase, a transmembrane protein that metabolizes oxygen and water to form hydrogen peroxide. This enzyme, present in both phagocytic and nonphagocytic cells, is usually overexpressed in response to arsenite (Zhou et al., 2021). It produces superoxide anion radicals (O 2 − ) by reducing oxygen via NADPH or NADH. Electrons are transferred from NADPH in the cytosol to FAD, the inner and outer heme, and O 2 outside the cell, resulting in reactive and short-lived O 2 − . These reactive O 2 − can dismutate spontaneously into H 2 O 2 or via SOD (Zasu et al., 2022). These findings indicate that arsenic exposure can induce ROS production via NADPH oxidase activity. Hydrogen peroxide is diffusible, crosses membranes via aquaporins (AQPs), and initiates cell signalling (Vilchis-Landeros et al., 2020). It is also known to cause cellular damage at extremely high concentrations. A high level of hydrogen peroxide is one of the hallmarks of the tumor microenvironment including the transformation, proliferation, and survival of cancer cells, as well as angiogenesis and metastasis (Ali et al., 2024). The increased production of H₂O₂ in cancer cells compared to normal cells is a significant factor in the altered redox balance within the tumor microenvironment (Lennicke et al., 2015). Hydrogen peroxide accumulation can lead to the development of numerous diseases, making it a potential cancer diagnostic marker (Ali et al., 2024; Yang et al., 2020). By increasing the concentration of sodium arsenite, there was a decrease in the level of reduced glutathione (GSH), an important antioxidant in cells that decreases arsenic-induced ROS and increases arsenic excretion. GSH is responsible for detoxifying arsenite and converting pentavalent arsenic to trivalent arsenic in cells. However, the propensity of arsenic to form a complex with thiol-containing compounds contributes to its toxicity since it depletes the antioxidant pool in mitochondria by complexing with reduced glutathione. This increases the vulnerability of the cell to oxidative stress-induced damage and death. When arsenic exposure increases, the activity is overwhelmed, resulting in a decrease in GSH synthesis. In addition, arsenite reduces glutamate levels, which in turn leads to a decrease in GSH synthesis (Ran et al., 2020). This study revealed that total thiol levels decreased after exposure to high concentration of arsenite, which is consistent with earlier researches (Mahajan et al., 2018; Ugbaja et al., 2021). Inorganic As III binds to thiol-containing compounds and protein-cysteine thiols, which can inhibit enzyme activity. Exporting inorganic arsenic-GSH adducts from the cell is crucial for detoxification because of their ability to bind to protein thiols. Dithiol molecules and proteins with surrounding cysteine molecules have been shown to bind inorganic As III (Garza-Lombó et al., 2019). Low thiol levels are associated with cancer. A study on the native and total thiol levels of lung cancer patients revealed that the progression and risk of lung cancer can be associated with reduced total thiol levels (Şener et al., 2020), as can prostate (Solakhan et al., 2019) and breast (Gào et al., 2020) cancers. There was increased protein carbonyl production, following increased sodium arsenite concentration. Protein oxidation, which leads to the production of protein carbonyls, perturbs the cellular redox balance, altering the cell cycle and possibly causing neuronal death. Protein carbonylation is a defining feature of oxidative stress and involves the direct oxidation of lysine, arginine, proline, and threonine side chains, resulting in reactive ketones or aldehydes that react with 2,4-dinitrophenylhydrazine to produce hydrazones (Martínez-Orgado et al., 2023). In addition to the known oxidation of essential proteins involved in DNA damage repair, oxidatively damaged proteins specifically impair DNA repair processes. Oxidative proteome damage is an independent cause of DNA damage and a separate inducer of DNA damage repair dysfunction. As a result, genetic modifications typically continue longer, increasing the likelihood of generating oncogenic mutations (Tramutola et al., 2020). These oncogenic mutations give rise to carcinogenesis. The activity of GST decreased significantly with increasing concentrations of sodium arsenite, which could be due to inhibition of the enzyme by arsenite, as observed in other studies (Ojo et al., 2022; Oyibo et al., 2021; Wang et al., 2019). The production of ROS when exposed to arsenic results in the formation of GSH complexes containing trivalent arsenicals. This process promotes arsenite methylation or membrane transfer, which results in the detoxification of arsenite and its metabolites. However, GST activity is usually inhibited in the presence of arsenite, which prevents GST conjugation with GSH (Sabe et al., 2021). Increased ROS levels deactivate antioxidant enzymes, resulting in lower antioxidant enzyme levels and cell toxicity. Decreased GST activity can result in the accumulation of reactive oxygen species (ROS), which can damage DNA and initiate or promote carcinogenesis. Carcinogens are generally detoxified by GST, but decreasing activity might lead to the accumulation of carcinogens, potentially initiating or promoting cancer. As a result, GST plays an important role in antioxidant activity. In this investigation, there was a decrease in the concentration of nitric oxide in the flies as the concentration of the arsenic was increased. However, this finding contradicts the findings of the study conducted by Oyibo et al. (2021). This could be due to the differences in the genetic makeup and other features of the Canton S strain of D. melanogaster , compared to the Harwich strain used in the other study (Oyibo et al ., 2021). The effect of arsenite on NO generation varies with cell type, increasing in some and decreasing or even having no effect on others. Nitric oxide (NO) is a well-known autocrine and paracrine signalling agent that performs pleiotropic functions, including the modulation of blood flow and circulation, thrombosis, inflammation, immunological control, and brain activity (Tran et al., 2022). However, in investigations where NO production is reduced by exposure to arsenite, it was postulated that the decline could be related to lower endothelial NO synthase (eNOS) expression and/or its phosphorylation at serine, which is associated with an increased risk of vascular disorders (Seo et al., 2014). Nitric oxide synthase (NOS) is important for the production of NO and L-citrulline from L-arginine, molecular oxygen, and NADPH. It exists in various isoforms, including endothelial NOS (eNOS), neuronal NOS (nNOS), and inducible NOS (iNOS). These isoforms play vital roles in various physiological and pathological processes. Endothelial dysfunction is caused primarily by oxidative stress, which has been linked to endothelial NO synthase dysfunction caused by eNOS uncoupling. This uncoupling occurs when NOS activity releases superoxide or hydrogen peroxide, negatively impacting NO bioavailability and potentially destroying NO generated elsewhere (Lundberg & Weitzberg, 2022). eNOS uncoupling may occur when NADPH oxidase is activated, which is sustained when exposed to arsenite, thus releasing ROS (Zhang et al., 2020). When NO activity is disrupted, it leads to disease conditions such as atherosclerosis. Overwhelming ROS production surpasses antioxidant defences, and oxidative stress results, which compromises endothelial function. AChE activity declined following exposure to high concentration of arsenite. Decreased AChE activity leads to acetylcholine accumulation in the synaptic cleft, leading to prolonged stimulation of neurons. This can cause excessive neuronal firing, disrupt normal neurotransmission, and potentially lead to neurotoxicity and neuronal damage (Akaike et al., 2010). Arsenite binds to AChE to inhibit its activity. This has been attributed to its ability to form diester bonds with the tyrosine residue of the protein (Page & Wilson, 1985). Inhibition of protein activity leads to the accumulation of acetylcholine, which can eventually lead to neurodegeneration. Most routinely used compounds can cause neurotoxicity by inhibiting acetylcholinesterase (AChE) activity. Acetylcholine facilitates neurotransmission at neuromuscular junctions and numerous synapses in the central nervous system. Thus, arsenite could be linked to neurotoxicity, as Drosophila melanogaster can be used as a model to study and understand the mechanism of neurotoxicity induced by arsenite. The toxicity of trivalent arsenicals is caused by their interaction with sulfhydryl groups in proteins. This binding can cause changes in the conformation of proteins, their functions, and even interactions with other functional proteins. As a result, research on arsenic binding to proteins is critical for understanding arsenic toxicity (Shen et al., 2013). In addition to antioxidant systems, the effects of sodium arsenite on genes also underscore the use of Drosophila melanogaster as a model to induce diseases related to these genes via the use of arsenite. ROS-mediated damage to lipids, proteins, and DNA is a well-known mechanism underlying both neurotoxicity and carcinogenesis. In this study, we observed tumor-like growth, with distorted enterocytes characterized by hypertrophy and hyperchromacia, alongside the overexpression of Ras, which corroborates the findings of Martorell et al. (2014) that these features of colorectal cancer are expressed in the gastrointestinal tract of Drosophila melanogaster. Observations of histological alterations and potential hyperplasia imply DNA damage or genomic instability. Ras activation is a cancer-specific characteristic in Drosophila and humans that regulates both growth and cancer. It is associated with Hpo activity in Drosophila epithelial cells, which causes tissues to shift from pro-differentiative to pro-growth processes (Dillard et al., 2021). Ras also promotes cell proliferation by regulating the transcription of growth factors and their receptors, which influences Drosophila growth and may cause cancer (Mirzoyan et al., 2019).The overexpression of Ras has been implicated in a wide range of cancers and is currently being explored for targeted therapy in cancer research (Chen et al., 2021; Yang & Wu, 2024). In this study, SOD1 was downregulated after exposure to sodium arsenite, which is consistent with the findings of Perker et al. (2019) and Sun et al. (2022), who reported that arsenite exposure causes SOD1 downregulation. SOD1 downregulation has been associated with a range of pathologies, including amyotrophic lateral sclerosis (ALS), cancer, accelerated ageing and age-related diseases (Xu et al., 2022). The downregulation of SOD1 is critical for cancer development because it decreases detoxification, accumulating reactive oxygen species. This oxidative stress affects DNA, proteins, and lipids, resulting in mutations and genome instability. Low SOD levels reduce cell antioxidant defence, increasing the vulnerability of cells to harm. This downregulation can also affect cell signalling pathways, which help cancer cells grow and survive (Skrzycki, 2021). The result of gene expression showed that Drosophila CNC (CNcC) was over expressed in flies exposed to the highest concentration of sodium arsenite. CNcC provides a practical and accessible model for studying the structure, function, and biology of Nrf2 transcription factors at different levels, utilizing the extensive genetic, genomic, and biochemical processes found in Drosophila (Pitoniak & Bohmann, 2015). CncC collaborates with the Drosophila Keap1 (dKeap1) protein to modulate the expression of genes associated with detoxification and antioxidant defense (Deng & Kerppola, 2013). This interaction parallels the Nrf2-Keap1 signaling pathway in mammals, wherein Keap1 suppresses Nrf2 activity under basal conditions but dissociates from Nrf2 during oxidative stress, enabling the activation of protective gene expression (Gunderson et al., 2020). The result of the CNcC could be translated to effect of arsenic on Nrf2, as it is the human homologue of CNcC. When Nrf2 activity is elevated, cancer cells become more resistant to radiation and chemotherapy. Furthermore, Nrf2 is essential for metabolic reprogramming during the development of cancer stem cells (Bi et al., 2021). Neurotoxicity can also be modelled in Drosophila melanogaster using arsenite, based on the results of this study. AChE, SOD1 and NO have direct implications for neurotoxicity. SOD1 , for example, is important for cytoprotection, gene transcription, and physiological regulation since it modulates signal transduction pathways in response to neurotoxic stimuli (Damiano et al., 2020), leading to the release of reactive oxygen species, and can serve as a target for modifying or developing therapies for neurodegenerative disorders. Acetylcholinesterase inhibitors cause acetylcholine to accumulate, leading to overstimulation of parasympathetic nervous system symptoms such as hypermotility, hypersecretion, bradycardia, miosis, diarrhoea, and hypotension (Colovic et al., 2013). Involuntary movements at neuromuscular junctions and muscle fibrillation, fasciculation, and paralysis could be indicators of acetylcholine toxicity. Nitric oxide, on the other hand, is involved in brain injuries, which leads to neurological conditions, which leads to neurological conditions. Nitric oxide (NO) contributes to oxidative damage by reacting with superoxide to form peroxynitrite, which damages lipids, proteins, and DNA, while also playing a role in glutamate-induced excitotoxicity by overactivating NMDA receptors, leading to neuronal injury (Manucha, 2017). Additionally, NO impairs mitochondrial function by inhibiting cytochrome c oxidase, reduces ATP production, promotes ROS generation (Manucha, 2017), and exacerbates neuroinflammation through microglial and astrocytic activation (Brunt et al., 2022). This study offers significant insights into the toxicological impacts of arsenite exposure, emphasizing the use of Drosophila melanogaster as a powerful model organism for examining disease mechanisms linked to arsenic toxicity. Physiological and molecular disruptions reported, following arsenite exposure, establishes D. melanogaster as an effective system for investigating pathways associated with oxidative stress, DNA damage, and metabolic dysregulation. The findings highlight the capacity of the organism to mimic human disease phenotypes, thus providing a valuable framework for exploring arsenic-induced pathologies, including carcinogenesis, diabetes, and neurodegenerative disorders. Furthermore, this study lays a foundation for using D. melanogaster in the screening and development of therapeutic agents to ameliorate arsenic toxicity. Integrating advanced genetic tools and omics-based approaches in future studies could further enhance the understanding of the involvement of arsenic in human health conditions, thereby advancing translational research efforts. Abbreviations AChE – Acetylcholinesterase GST – Glutathione-S-Transferase GSH – Reduced glutathione H 2 O 2 – Hydrogen Peroxide SA – Sodium Arsenite Declarations Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Credit Authorship Contribution Statement Conceptualization: T.O.J.; Methodology: T.O.J., J-R. I.O.; Formal analysis and investigation: J-R. I.O.; Writing - original draft preparation: J-R.I.O,. Writing - review and editing: J.D.D., T.O.J.; Funding acquisition: not applicable; Resources: J-R.I.O., J.D.D., T.O.J.; Supervision: T.O.J. Data Availability This manuscript does not report data generation or analysis Jane-Rose I. Oche has to be contacted in case of any queries or requirement of data. Conflict of Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ACKNOWLEDGEMENTS We are thankful to the Drosophila Research and Training Center (DRTC) University of Ibadan for providing their facilities and the fly stocks to carry out this research. We also appreciate Prof. Amos O. Abolaji for his technical help and support. References Akaike, A., Takada-Takatori, Y., Kume, T., & Izumi, Y. (2010). Mechanisms of Neuroprotective Effects of Nicotine and Acetylcholinesterase Inhibitors: Role of α4 and α7 Receptors in Neuroprotection. Journal of Molecular Neuroscience , 40 (1), 211–216. https://doi.org/10.1007/s12031-009-9236-1 Ali, T., Li, D., Ponnamperumage, T. N. F., Peterson, A. K., Pandey, J., Fatima, K., Brzezinski, J., Jakusz, J. A. R., Gao, H., Koelsch, G. E., Murugan, D. S., & Peng, X. (2024). Generation of Hydrogen Peroxide in Cancer Cells: Advancing Therapeutic Approaches for Cancer Treatment. Cancers , 16 (12), 2171. https://www.mdpi.com /2072-6694/16/12/2171 Anushree, Ali, M. Z., Bilgrami, A. L., & Ahsan, J. (2023). Acute Exposure to Arsenic Affects Pupal Development and Neurological Functions in Drosophila melanogaster. Toxics , 11 (4), 327. Beutler, E., Duron, O., & Kelly, B. M. (1963). Improved method for determination of blood glutathione. Bhat, A., Ravi, K., Tian, F., & Singh, B. (2024). Arsenic Contamination Needs Serious Attention: An Opinion and Global Scenario. Pollutants , 4 (2), 196–211. https://www.mdpi.com/ 2673-4672/4/2/13 Bi, Z., Zhang, Q., Fu, Y., Seno, A., Wadgaonkar, P., Qiu, Y., Almutairy, B., Xu, L., Zhang, W., Thakur, C., & Chen, F. (2021). Cooperation between NRF2-mediated transcription and MDIG-dependent epigenetic modifications in arsenic-induced carcinogenesis and cancer stem cells. Seminars in Cancer Biology , 76 , 310–318. https://doi.org/https://doi.org/10.1016/j.semcancer.2021.03.030 Bibha, K., Akhigbe, T. M., Hamed, M. A., & Akhigbe, R. E. (2024). Metabolic Derangement by Arsenic: a Review of the Mechanisms. Biological Trace Element Research , 202 (5), 1972–1982. https://doi.org/10.1007/s12011-023-03828-4 Brunt, T. M., van den Brink, W., & van Amsterdam, J. (2022). Mechanisms Involved in the Neurotoxicity and Abuse Liability of Nitrous Oxide: A Narrative Review. International Journal of Molecular Sciences , 23 (23), 14747. https://www.mdpi.com/ 1422-0067/23/23/14747 Bülow, M. H., Parsons, B. D., & Di Cara, F. (2020). The Drosophila melanogaster as Genetic Model System to Dissect the Mechanisms of Disease that Lead to Neurodegeneration in Adrenoleukodystrophy. In G. Lizard (Ed.), Peroxisome Biology: Experimental Models, Peroxisomal Disorders and Neurological Diseases (pp. 145–159). Springer International Publishing. https://doi.org/10.1007/978-3-030-60204-8_11 Calap-Quintana, P., González-Fernández, J., Sebastiá-Ortega, N., Llorens, J. V., & Moltó, M. D. (2017). Drosophila melanogaster Models of Metal-Related Human Diseases and Metal Toxicity. International Journal of Molecular Sciences , 18 (7), 1456. https://www.mdpi.com/ 1422-0067/18/7/1456 Cardoso, A. P. F., Al-Eryani, L., & States, J. C. (2018). Arsenic-Induced Carcinogenesis: The Impact of miRNA Dysregulation. Toxicological Sciences , 165 (2), 284–290. https://doi.org/10.1093/toxsci/kfy128 Chakravarti, A., Thirimanne, H. N., Brown, S., & Calvi, B. R. (2022). Drosophila p53 isoforms have overlapping and distinct functions in germline genome integrity and oocyte quality control. Elife , 11 , e61389. https://doi.org/10.7554/eLife.61389 Chen, K., Zhang, Y., Qian, L., & Wang, P. (2021). Emerging strategies to target RAS signaling in human cancer therapy. Journal of Hematology & Oncology , 14 (1), 116. https://doi.org/10.1186/s13045-021-01127-w Chen, Y., Sun, Y., Zhao, A., Cai, X., Yu, A., Xu, Q., Wang, P., Yao, J., Wang, Q., & Wang, W. (2022). Arsenic exposure diminishes ovarian follicular reserve and induces abnormal steroidogenesis by DNA methylation. Ecotoxicology and Environmental Safety , 241 , 113816. Colovic, M. B., Krstic, D. Z., Lazarevic-Pasti, T. D., Bondzic, A. M., & Vasic, V. M. (2013). Acetylcholinesterase inhibitors: pharmacology and toxicology. Current neuropharmacology , 11 (3), 315–335. Cui, J., Zhao, S., Li, Y., Zhang, D., Wang, B., Xie, J., & Wang, J. (2021). Regulated cell death: discovery, features and implications for neurodegenerative diseases. Cell Communication and Signaling , 19 (1), 120. https://doi.org/10.1186/s12964-021-00799-8 Damiano, S., Sozio, C., La Rosa, G., Guida, B., Faraonio, R., Santillo, M., & Mondola, P. (2020). Metabolism Regulation and Redox State: Insight into the Role of Superoxide Dismutase 1. International Journal of Molecular Sciences , 21 (18), 6606. https://www.mdpi.com/ 1422-0067/21/18/6606 Davis, E. E., Frangakis, S., & Katsanis, N. (2014). Interpreting human genetic variation with in vivo zebrafish assays. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease , 1842 (10), 1960–1970. https://doi.org/https://doi.org/10.1016/j.bbadis.2014.05.024 Deng, H., & Kerppola, T. K. (2013). Regulation of Drosophila metamorphosis by xenobiotic response regulators. PLoS genetics , 9 (2), e1003263. Dillard, C., Reis, J. G. T., & Rusten, T. E. (2021). RasV12; scrib–/– Tumors: A Cooperative Oncogenesis Model Fueled by Tumor/Host Interactions. International Journal of Molecular Sciences , 22 (16), 8873. https://www.mdpi.com/ 1422-0067/22/16/8873 Drobysheva, D., Ameel, K., Welch, B., Ellison, E., Chaichana, K., Hoang, B., Sharma, S., Neckameyer, W., Srinakevitch, I., Murphy, K. J., & Schmid, A. (2008). An optimized method for histological detection of dopaminergic neurons in Drosophila melanogaster. J Histochemistry Cytochemistry , 56 (12), 1049–1063. https://doi.org/10.1369/jhc.2008.951137 Ellman, G. L. (1959). Tissue sulfhydryl groups. Archives of biochemistry and biophysics , 82 (1), 70–77. Ellman, G. L., Courtney, K. D., Andres Jr, V., & Featherstone, R. M. (1961). A new and rapid colorimetric determination of acetylcholinesterase activity. Biochemical pharmacology , 7 (2), 88–95. Everette, J. D., Bryant, Q. M., Green, A. M., Abbey, Y. A., Wangila, G. W., & Walker, R. B. (2010). Thorough study of reactivity of various compound classes toward the Folin – Ciocalteu reagent. Journal of agricultural and food chemistry , 58 (14), 8139–8144. Farombi, E. O., Abolaji, A. O., Farombi, T. H., Oropo, A. S., Owoje, O. A., & Awunah, M. T. (2018). Garcinia kola seed biflavonoid fraction (Kolaviron), increases longevity and attenuates rotenone-induced toxicity in Drosophila melanogaster. Pesticide Biochemistry and Physiology , 145 , 39–45. https://doi.org/https://doi.org/10.1016/j.pestbp.2018.01.002 Fischer, E. G. (2020). Nuclear morphology and the biology of cancer cells. Acta cytologica , 64 (6), 511–519. FlyBase. (2024). Stain: Canton S . https://flybase.org/reports/FBsn0000274.htm Frisbie, S. H., & Mitchell, E. J. (2022). Arsenic in drinking water: An analysis of global drinking water regulations and recommendations for updates to protect public health. PloS one , 17 (4), e0263505. Gào, X., Wilsgaard, T., Jansen, E. H., Xuan, Y., Anusruti, A., Brenner, H., & Schöttker, B. (2020). Serum total thiol levels and the risk of lung, colorectal, breast and prostate cancer: A prospective case–cohort study. International journal of cancer , 146 (5), 1261–1267. Garkal, A., Sarode, L., Bangar, P., Mehta, T., Singh, D. P., & Rawal, R. (2023). Understanding arsenic toxicity: Implications for environmental exposure and human health. Journal of Hazardous Materials Letters , 100090. Garza-Lombó, C., Pappa, A., Panayiotidis, M. I., Gonsebatt, M. E., & Franco, R. (2019). Arsenic-induced neurotoxicity: a mechanistic appraisal. JBIC Journal of Biological Inorganic Chemistry , 24 , 1305–1316. Gunderson, J. T., Peppriell, A. E., Vorojeikina, D., & Rand, M. D. (2020). Tissue-specific Nrf2 signaling protects against methylmercury toxicity in Drosophila neuromuscular development. Archives of Toxicology , 94 (12), 4007–4022. https://doi.org/10.1007/s00204-020-02879-z Habig, W. H., & Jakoby, W. B. (1981). [27] Glutathione S-transferases (rat and human). In Methods in Enzymology (Vol. 77, pp. 218–231). Academic Press. https://doi.org/https://doi.org/10.1016/S0076-6879(81)77029-0 Hong, Y., Boiti, A., Vallone, D., & Foulkes, N. S. (2024). Reactive Oxygen Species Signaling and Oxidative Stress: Transcriptional Regulation and Evolution. Antioxidants , 13 (3), 312. https://www.mdpi.com /2076-3921/13/3/312 Hou, J., Zhao, R., Xia, W., Chang, C.-W., You, Y., Hsu, J.-M., Nie, L., Chen, Y., Wang, Y.-C., & Liu, C. (2020). PD-L1-mediated gasdermin C expression switches apoptosis to pyroptosis in cancer cells and facilitates tumour necrosis. Nature cell biology , 22 (10), 1264–1275. Johnson, T. O., Abolaji, A. O., Omale, S., Longdet, I. Y., Kutshik, R. J., Oyetayo, B. O., Adegboyega, A. E., & Sagay, A. (2021). Benzo[a]pyrene and Benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide induced locomotor and reproductive senescence and altered biochemical parameters of oxidative damage in Canton-S Drosophila melanogaster. Toxicology reports , 8 , 571–580. https://doi.org/https://doi.org/10.1016/j.toxrep.2021.03.001 Kasmi, S., Moser, L., Gonvers, S., Dormond, O., Demartines, N., & Labgaa, I. (2023). Carcinogenic effect of arsenic in digestive cancers: a systematic review. Environmental Health , 22 (1), 36. https://doi.org/10.1186/s12940-023-00988-7 Khandayataray, P., Samal, D., & Murthy, M. K. (2024). Arsenic and adipose tissue: an unexplored pathway for toxicity and metabolic dysfunction. Environmental Science and Pollution Research , 31 (6), 8291–8311. https://doi.org/10.1007/s11356-023-31683-2 Lennicke, C., Rahn, J., Lichtenfels, R., Wessjohann, L. A., & Seliger, B. (2015). Hydrogen peroxide – production, fate and role in redox signaling of tumor cells. Cell Communication and Signaling , 13 (1), 39. https://doi.org/10.1186/s12964-015-0118-6 Lundberg, J. O., & Weitzberg, E. (2022). Nitric oxide signaling in health and disease. Cell , 185 (16), 2853–2878. Lykoudi, A., Cardoso, A. P. F., Wise, S. S., Banerjee, M., & States, J. C. (2023). Clonal variability in chromosomal instability as a potential driver in the acquisition of tumorigenic phenotype in chronic arsenic-exposed and hsa-miR-186 overexpressing human keratinocytes. Toxicology and Applied Pharmacology , 116730. Mahajan, L., Verma, P. K., Raina, R., Pankaj, N. K., Sood, S., & Singh, M. (2018). Alteration in thiols homeostasis, protein and lipid peroxidation in renal tissue following subacute oral exposure of imidacloprid and arsenic in Wistar rats. Toxicology reports , 5 , 1114–1119. Manucha, W. (2017). Nitric Oxide Pathways in Neurotoxicity from Glutamate-Induced Apoptosis: Emerging Mitochondrial Role. In P. Á. Gargiulo & H. L. Mesones-Arroyo (Eds.), Psychiatry and Neuroscience Update - Vol. II: A Translational Approach (pp. 151–159). Springer International Publishing. https://doi.org/10.1007/978-3-319-53126-7_12 Mariateresa, A., Sheri, Z., & Paola, B. (2018). The Fruit Fly, Drosophila melanogaster: Modeling of Human Diseases (Part II). In P. Farzana Khan (Ed.), Drosophila melanogaster (pp. Ch. 7). IntechOpen. https://doi.org/10.5772/intechopen.73199 Martínez-Orgado, J., Martínez-Vega, M., Silva, L., Romero, A., de Hoz-Rivera, M., Villa, M., & Del Pozo, A. (2023). Protein Carbonylation as a Biomarker of Oxidative Stress and a Therapeutic Target in Neonatal Brain Damage. Antioxidants (Basel) , 12 (10). https://doi.org/10.3390/antiox12101839 Martorell, Ò., Merlos-Suarez, A., Campbell, K., Barriga, F. M., Christov, C. P., Miguel-Aliaga, I., Batlle, E., Casanova, J., & Casali, A. (2014). Conserved mechanisms of tumorigenesis in the Drosophila adult midgut. PloS one , 9 (2), e88413. Mirey, G., Balakireva, M., L'Hoste, S., Rossé, C., Voegeling, S., & Camonis, J. (2003). A Ral guanine exchange factor-Ral pathway is conserved in Drosophila melanogaster and sheds new light on the connectivity of the Ral, Ras, and Rap pathways. Molecular and cellular biology , 23 (3), 1112–1124. https://doi.org/10.1128/mcb.23.3.1112-1124.2003 Mirzoyan, Z., Sollazzo, M., Allocca, M., Valenza, A. M., Grifoni, D., & Bellosta, P. (2019). Drosophila melanogaster: A Model Organism to Study Cancer. Front Genet , 10 , 51. https://doi.org/10.3389/fgene.2019.00051 Mochizuki, H. (2019). Arsenic Neurotoxicity in Humans. International Journal of Molecular Sciences , 20 (14), 3418. https://www.mdpi.com/1422-0067/20/14/3418 Muñiz Ortiz, J. G., Shang, J., Catron, B., Landero, J., Caruso, J. A., & Cartwright, I. L. (2011). A Transgenic Drosophila Model for Arsenic Methylation Suggests a Metabolic Rationale for Differential Dose-Dependent Toxicity Endpoints. Toxicological Sciences , 121 (2), 303–311. https://doi.org/10.1093/toxsci/kfr074 Musselman, L. P., Fink, J. L., Ramachandran, P. V., Patterson, B. W., Okunade, A. L., Maier, E., Brent, M. R., Turk, J., & Baranski, T. J. (2013). Role of Fat Body Lipogenesis in Protection against the Effects of Caloric Overload in Drosophila*. Journal of biological chemistry , 288 (12), 8028–8042. https://doi.org/https://doi.org/10.1074/jbc.M112.371047 Nail, A. N., Xu, M., Bastick, J. C., Patel, D. P., Rogers, M. N., & States, J. C. (2023). Arsenic and Human Health: New Molecular Mechanisms For Arsenic-Induced Cancers. Current Pollution Reports , 9 (4), 784–797. https://doi.org/10.1007/s40726-023-00278-3 Ojo, O. O., Fatokun, D. I., Ejidike, I. P., Awolope, R. U., & Sanni, S. O. (2022). Quercetin Zinc and Iron Metal Complexes Protect against Sodium Arsenite Intoxication in the Hepato-Renal System of Wistar Rats via the Oxidative Stress Pathway. Journal of Toxicology , 2022 . Oyibo, A., Abolaji, A. O., & Odunola, O. A. (2021). Carcinogen sodium arsenite disrupts antioxidant and redox homeostasis in Drosophila melanogaster. Journal of Basic and Clinical Physiology and Pharmacology (0), 000010151520200235. Page, J. D., & Wilson, I. B. (1985). Acetylcholinesterase: inhibition by tetranitromethane and arsenite. Binding of arsenite by tyrosine residues. Journal of biological chemistry , 260 (3), 1475–1478. Penzo, M., Montanaro, L., Treré, D., & Derenzini, M. (2019). The Ribosome Biogenesis—Cancer Connection. Cells , 8 (1), 55. https://www.mdpi.com/2073-4409/8/1/55 Perker, M. C., Orta Yilmaz, B., Yildizbayrak, N., Aydin, Y., & Erkan, M. (2019). Protective effects of curcumin on biochemical and molecular changes in sodium arsenite-induced oxidative damage in embryonic fibroblast cells. Journal of biochemical and molecular toxicology , 33 (7), e22320. Pitoniak, A., & Bohmann, D. (2015). Mechanisms and functions of Nrf2 signaling in Drosophila. Free Radical Biology and Medicine , 88 , 302–313. Poeck, B., Strauss, R., & Kretzschmar, D. (2012). Analysis of amyloid precursor protein function in Drosophilamelanogaster. Experimental Brain Research , 217 (3), 413–421. https://doi.org/10.1007/s00221-011-2860-3 Prüßing, K., Voigt, A., & Schulz, J. B. (2013). Drosophila melanogaster as a model organism for Alzheimer’s disease. Molecular Neurodegeneration , 8 (1), 35. https://doi.org/10.1186/1750-1326-8-35 Rahman, M., Sohel, N., Yunus, F. M., Alam, N., Nahar, Q., Streatfield, P. K., & Yunus, M. (2019). Arsenic exposure and young adult's mortality risk: A 13-year follow-up study in Matlab, Bangladesh. Environment international , 123 , 358–367. Rahmani, A., Khamutian, S., Doosti-Irani, A., Shokoohizadeh, M. J., Shirmohammadi-Khorram, N., Sahraeei, F., Khodabakhshi, M., & Ahangaran, N. (2023). The association of arsenic exposure with mortality due to cancer, diabetes, Alzheimer's and congenital anomalies using Poisson regression. Scientific reports , 13 (1), 15456. Ran, S., Liu, J., & Li, S. (2020). A systematic review of the various effect of arsenic on glutathione synthesis in vitro and in vivo. BioMed Research International , 2020 (1), 9414196. Rizki, M., Kossatz, E., Velázquez, A., Creus, A., Farina, M., Fortaner, S., Sabbioni, E., & Marcos, R. (2006). Metabolism of arsenic in Drosophila melanogaster and the genotoxicity of dimethylarsinic acid in the Drosophila wing spot test. Environmental and molecular mutagenesis , 47 (3), 162–168. Ro, S.-H., Bae, J., Jang, Y., Myers, J. F., Chung, S., Yu, J., Natarajan, S. K., Franco, R., & Song, H.-S. (2022). Arsenic Toxicity on Metabolism and Autophagy in Adipose and Muscle Tissues. Antioxidants , 11 (4), 689. https://www.mdpi.com /2076-3921/11/4/689 Ruan, Y., Fang, X., Guo, T., Liu, Y., Hu, Y., Wang, X., Hu, Y., Gao, L., Li, Y., & Pi, J. (2022). Metabolic reprogramming in the arsenic carcinogenesis. Ecotoxicology and Environmental Safety , 229 , 113098. Sabe, V. T., Ntombela, T., Jhamba, L. A., Maguire, G. E. M., Govender, T., Naicker, T., & Kruger, H. G. (2021). Current trends in computer aided drug design and a highlight of drugs discovered via computational techniques: A review. European Journal of Medicinal Chemistry , 224 , 113705. https://doi.org/https://doi.org/10.1016/j.ejmech.2021.113705 Şener, M. U., Sönmez, Ö., Keyf, İ. A., Erel, Ö., Alışık, M., Bulut, S., & Erdoğan, Y. (2020). Evaluation of thiol/disulfide homeostasis in lung cancer. Turkish thoracic journal , 21 (4), 255. Seo, J., Lee, J. Y., Sung, M.-S., Byun, C. J., Cho, D.-H., Lee, H.-J., Park, J.-H., Cho, H.-S., Cho, S.-J., & Jo, I. (2014). Arsenite acutely decreases nitric oxide production via the ROS—protein phosphatase 1—endothelial nitric oxide synthase-thr497 signaling cascade. Biomolecules & therapeutics , 22 (6), 510. Shen, S., Li, X. F., Cullen, W. R., Weinfeld, M., & Le, X. C. (2013). Arsenic binding to proteins. Chem Rev , 113 (10), 7769–7792. https://doi.org/10.1021/cr300015c Singh, A. P., Goel, R. K., & Kaur, T. (2011). Mechanisms pertaining to arsenic toxicity. Toxicol Int , 18 (2), 87–93. https://doi.org/10.4103/0971-6580.84258 Singhal, N., & Jaiswal, M. (2018). Pathways to neurodegeneration: lessons learnt from unbiased genetic screens in Drosophila. Journal of Genetics , 97 (3), 773–781. https://doi.org/10.1007/s12041-018-0954-4 Skrzycki, M. (2021). Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers. Open Life Sciences , 16 (1), 1225–1239. Solakhan, M., Çiçek, H., Orhan, N., & Yildirim, M. (2019). Role of native Thiol, total Thiol and dynamic Disulphide in diagnosis of patient with prostate cancer and prostatitis. International braz j urol , 45 (3), 495–502. Stanley, C. E., & Kulathinal, R. J. (2016). Genomic signatures of domestication on neurogenetic genes in Drosophila melanogaster. BMC Evolutionary Biology , 16 (1), 6. https://doi.org/10.1186/s12862-015-0580-1 Sun, H.-J., Ding, S., Guan, D.-X., & Ma, L. Q. (2022). Nrf2/Keap1 pathway in countering arsenic-induced oxidative stress in mice after chronic exposure at environmentally-relevant concentrations. Chemosphere , 303 , 135256. https://doi.org/https://doi.org/10.1016/j.chemosphere.2022.135256 Thakur, M., Rachamalla, M., Niyogi, S., Datusalia, A. K., & Flora, S. J. S. (2021). Molecular mechanism of arsenic-induced neurotoxicity including neuronal dysfunctions. International Journal of Molecular Sciences , 22 (18), 10077. Tramutola, A., Falcucci, S., Brocco, U., Triani, F., Lanzillotta, C., Donati, M., Panetta, C., Luzi, F., Iavarone, F., Vincenzoni, F., Castagnola, M., Perluigi, M., Di Domenico, F., & De Marco, F. (2020). Protein Oxidative Damage in UV-Related Skin Cancer and Dysplastic Lesions Contributes to Neoplastic Promotion and Progression. Cancers , 12 (1), 110. https://www.mdpi.com /2072-6694/12/1/110 Tran, N., Garcia, T., Aniqa, M., Ali, S., Ally, A., & Nauli, S. M. (2022). Endothelial nitric oxide synthase (eNOS) and the cardiovascular system: In physiology and in disease states. American journal of biomedical science & research , 15 (2), 153. Turek, D., Haefliger, S., Ameline, B., Alborelli, I., Calgua, B., Hartmann, W., Harder, D., Flanagan, A. M., Amary, F., & Baumhoer, D. (2022). Brown tumors belong to the spectrum of KRAS-driven neoplasms. The American Journal of Surgical Pathology , 46 (11), 1577–1582. Ugbaja, R. N., Akinhanmi, T. F., James, A. S., Ugwor, E. I., Babalola, A. A., Ezenandu, E. O., Ugbaja, V. C., & Emmanuel, E. A. (2021). Flavonoid-rich fractions from Clerodendrum volubile and Vernonia amygdalina extenuates arsenic-invoked hepato-renal toxicity via augmentation of the antioxidant system in rats. Clinical Nutrition Open Science , 35 , 12–25. https://doi.org/https://doi.org/10.1016/j.nutos.2020.12.003 Vilchis-Landeros, M. M., Matuz-Mares, D., & Vázquez-Meza, H. (2020). Regulation of metabolic processes by hydrogen peroxide generated by NADPH oxidases. Processes , 8 (11), 1424. Wang, C., Niu, Q., Ma, R., Song, G., Hu, Y., Xu, S., Li, Y., Wang, H., Li, S., & Ding, Y. (2019). The variable regulatory effect of arsenic on Nrf2 signaling pathway in mouse: a systematic review and meta-analysis. Biological Trace Element Research , 190 , 362–383. Wehr, N. B., & Levine, R. L. (2013). Quantification of protein carbonylation. Cell Senescence: Methods and Protocols , 265–281. WHO. (2022a). Chemical fact sheets: Arsenic. In WHO (Ed.), Guidelines for drinking-water quality: fourth edition incorporating the first and second addenda (pp. 614). World Health Organisation. WHO. (2022b). Guidelines for drinking-water quality: incorporating the first and second addenda . World Health Organization. Xu, J., Su, X., Burley, S. K., & Zheng, X. S. (2022). Nuclear SOD1 in growth control, oxidative stress response, amyotrophic lateral sclerosis, and cancer. Antioxidants , 11 (2), 427. Yang, M., Zinkgraf, M., Fitzgerald-Cook, C., Harrison, B. R., Putzier, A., Promislow, D. E. L., & Wang, A. M. (2023). Using Drosophila to identify naturally occurring genetic modifiers of amyloid beta 42- and tau-induced toxicity. G3 Genes|Genomes|Genetics , 13 (9). https://doi.org/10.1093/g3journal/jkad132 Yang, N., Xiao, W., Song, X., Wang, W., & Dong, X. (2020). Recent advances in tumor microenvironment hydrogen peroxide-responsive materials for cancer photodynamic therapy. Nano-Micro Letters , 12 , 1–27. Yang, X., & Wu, H. (2024). RAS signaling in carcinogenesis, cancer therapy and resistance mechanisms. Journal of Hematology & Oncology , 17 (1), 108. https://doi.org/10.1186/s13045-024-01631-9 Zasu, A., Hishima, F., Thauvin, M., Yoneyama, Y., Kitani, Y., Hakuno, F., Volovitch, M., Takahashi, S.-I., Vriz, S., & Rampon, C. (2022). NADPH-Oxidase Derived Hydrogen Peroxide and Irs2b Facilitate Re-oxygenation-Induced Catch-Up Growth in Zebrafish Embryo. Frontiers in Endocrinology , 13 , 929668. Zhang, Y., Murugesan, P., Huang, K., & Cai, H. (2020). NADPH oxidases and oxidase crosstalk in cardiovascular diseases: novel therapeutic targets. nature reviews cardiology , 17 (3), 170–194. https://doi.org/10.1038/s41569-019-0260-8 Zhang, Z., Zhang, S., Zhang, F., Zhang, Q., Wei, H., Xiu, R., Zhao, Y., & Sui, M. (2024). Clinical Indicators of Hepatotoxicity in Newly Diagnosed Acute Promyelocytic Leukemia Patients Undergoing Arsenic Trioxide Treatment. Biological Trace Element Research , 202 (1), 122–132. https://doi.org/10.1007/s12011-023-03676-2 Zhou, L. (2019). P53 and Apoptosis in the Drosophila Model. In W.-M. Deng (Ed.), The Drosophila Model in Cancer (pp. 105–112). Springer International Publishing. https://doi.org/10.1007/978-3-030-23629-8_6 Zhou, X., Speer, R. M., Volk, L., Hudson, L. G., & Liu, K. J. (2021). Arsenic co-carcinogenesis: Inhibition of DNA repair and interaction with zinc finger proteins. Seminars in cancer biology, Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6932906","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":475852321,"identity":"c9a6c0ec-8811-4ae9-b354-b51ec736e73a","order_by":0,"name":"Jane-Rose I. Oche","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYFACHgYGCQYbBgZmhgQQl7GBSC1ppGphYDgM5xLWws9+9uADi5rzidvZGR4+/MFgI7vhAO/hF/i0SPbkJRtIHLuduLOZIdmYhyHNeMMBvjQLfFoMbvCYSUiw3U7ccJghTRrowsQNB3jMDAhoMf8h8e8cWIvkD4b/RGkxY5BsOwDWIsHDcACkxfgBfr/kGEtI9iUbA7UA/WKQbDzzMNAQfICf/YzhZ4lvdrIbzp9JfPijwk6273iP8Qe8eoCAWQJM8SQA3QniMrBJENLCCDGU/QDcDIK2jIJRMApGwYgCADBmSTjJ1srPAAAAAElFTkSuQmCC","orcid":"","institution":"University of Jos","correspondingAuthor":true,"prefix":"","firstName":"Jane-Rose","middleName":"I.","lastName":"Oche","suffix":""},{"id":475852322,"identity":"304293fa-1dd4-446d-ad5e-aa5114061872","order_by":1,"name":"Jonathan D. Dabak","email":"","orcid":"","institution":"University of Jos","correspondingAuthor":false,"prefix":"","firstName":"Jonathan","middleName":"D.","lastName":"Dabak","suffix":""},{"id":475852323,"identity":"827740c9-4ad9-42d4-a830-3ab84f70da8b","order_by":2,"name":"Titilayo O. Johnson","email":"","orcid":"","institution":"University of Jos","correspondingAuthor":false,"prefix":"","firstName":"Titilayo","middleName":"O.","lastName":"Johnson","suffix":""}],"badges":[],"createdAt":"2025-06-19 16:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6932906/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6932906/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":85499215,"identity":"dc35175e-f728-4862-8570-ff32401c53f7","added_by":"auto","created_at":"2025-06-26 14:21:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":31563,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSurvival rate of flies exposedto varying concentrations of sodium arsenite\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6932906/v1/bdb4d29bea965d760a19c9a3.png"},{"id":85499216,"identity":"b94a29a6-21b2-461f-ade9-159a6d3c0f2b","added_by":"auto","created_at":"2025-06-26 14:21:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1168054,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHistology of the organs of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eDrosophila melanogaster \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eHE x400: (a) Lontitudinalsection of the midgut of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eDrosphila \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eexposed to sodium arsenite; (b) longitudinal section of the midgut of the unexposed \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eDrosophila; \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(c) fat body of the unexposed fly; (d) fat body of the exposed fly. (e) Brain tissue of unexposed flies. (f) Brain tissue of exposed flies\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6932906/v1/28c91046570228f0de3d88a4.png"},{"id":85499217,"identity":"0cbbc878-e47b-420e-be09-e9400a94a1c4","added_by":"auto","created_at":"2025-06-26 14:21:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":582513,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImagesof the organs of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eDrosophila melanogaster:\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e(a) Crop of the normal control,(b) Crop of an arsenite-exposed fly with tumor-like growth, (c) Ovaries of the female normal control, and (c) Ovaries of an arsenite-exposed female fly with ruptured ovaries\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6932906/v1/ec18261b8a07a6bbd254f132.png"},{"id":85500189,"identity":"1eb8df49-b627-4895-9275-875b6cfec32a","added_by":"auto","created_at":"2025-06-26 14:29:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":146941,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of sodium arsenite on oxidative stress markers (a) Hydrogen peroxide level (b) total thiol concentration (c) reduced glutathione concentration (d) nitric oxide concentration (e) protein carbonyl (f) GST activity (g) AChE activity and (h) gene expression\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6932906/v1/0b89e6da3bb4a3760d58f311.png"},{"id":99505124,"identity":"76253655-16d0-42d9-8658-1f7fa22781c2","added_by":"auto","created_at":"2026-01-05 08:26:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3685812,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6932906/v1/9274115c-251b-4188-bd55-9263025c85b4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Modeling Chronic Arsenic Toxicity in Drosophila melanogaster: Insights into Oxidative Stress, Neurotoxicity, and Carcinogenesis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eArsenic (As) is a naturally occurring toxic metalloid that poses significant health risks, including carcinogenesis and organ damage, when ingested through contaminated water or food. As is highly soluble in water, and most plants, such as rice, have the ability to bioaccumulate As in their tissues. The World Health Organization (WHO) classifies arsenic as a major public health concern, with exposure limits set at 10 µg/L in drinking water (WHO, 2022a) Similarly, the US Environmental Protection Agency (EPA) has set the Maximum Contaminant Level (MCL) for arsenic in drinking water at 10 µg/L (Frisbie \u0026amp; Mitchell, 2022). This reduction from an earlier standard of 50 µg/L was implemented in 2001 to address concerns about the role of arsenic as a carcinogen and its other adverse health effects (WHO, 2022b). When disturbed by natural processes, such as weathering, biological activity, and volcanic eruption, arsenic may be released into the environment. Arsenic is released into the environment through both natural processes (e.g., volcanic eruptions, weathering, and earthquakes) and anthropogenic activities such as mining, smelting, well drilling, and fossil fuel combustion (Shen et al., 2013). Increased exposure to arsenic, especially in less developed and emerging nations, is a global issue because of its negative effects, including genetic damage that can lead to diseases (WHO, 2022). Arsenic exposure threatens the health of 230 million people worldwide. These implications include increased risks for cancer, cardiovascular disease, diabetes, skin lesions, neurological disorders, kidney disease, and difficulties related to foetal development and cognition (Bhat et al., 2024).\u003c/p\u003e\n\u003cp\u003eThe toxicity of arsenic is a consequence of its metabolism. When absorbed, As bioaccumulates in the liver, kidneys, heart, and even lungs. The muscles and neural tissues can store lower levels of arsenic. Arsenic accumulation in various tissues has been linked to a variety of diseases, including cancer, diabetes, hepatotoxicity, neurotoxicity, cardiotoxicity (Singh et al., 2011) and dermatological diseases (Sanyal, Bhattacharjee, Paul \u0026amp; Bhattacharjee, 2020). Arsenic promotes chromosomal instability and clonal variability, which mediate arsenic-induced carcinogenesis, as observed in hsa-miR-186-overexpressing human keratinocytes (Lykoudi et al., 2023). Studies have also demonstrated that arsenic exposure leads to metabolic reprogramming, which in turn contributes to carcinogenesis, although the underlying pathways of arsenic carcinogenesis are unknown (Cardoso et al., 2018; Ruan et al., 2022). The International Agency for Research on Cancer (IARC) classifies arsenic as a Class I human carcinogen (Ruan et al., 2022). Prolonged arsenic exposure poses considerable risks to human health, and severe cases can lead to breast, meningeal and brain, stomach, liver, and other digestive organ cancers and leukemia (Rahmani et al., 2023).\u003c/p\u003e\n\u003cp\u003eIn addition to being a carcinogen, arsenic can induce neurotoxicity. Arsenics deactivate some enzymes involved in the cellular energy system, DNA synthesis, and repair, by binding to their active sites (Bibha et al., 2024). Most pathways are involved in arsenic-induced neurotoxicity, including oxidative stress, thiamine shortage, and reduced acetylcholinesterase activity (Mochizuki, 2019). Arsenic neurotoxicity has also been related to alterations in neurotransmitter metabolism, which leads to abnormalities in synaptic transmission (Garza-Lombó et al., 2019). Arsenic readily crosses the blood‒brain barrier and accumulates in the striatum and hippocampus, hence increasing arsenic toxicity and tissue injury (Thakur et al., 2021).\u003c/p\u003e\n\u003cp\u003eOn the basis of the knowledge of arsenic toxicity and how some of the effects are observed in most diseases, such as cancer, the use of a suitable model to express such diseases via the use of arsenic could be explored. The use of mammalian and in vitro models, although offering means of expressing diseases, has limitations (Davis et al., 2014). The human and \u003cem\u003eDrosophila\u003c/em\u003e genomes are similar not only in terms of genetic material but also in terms of their relationships, with several examples of similar biological systems (Calap-Quintana et al., 2017). Approximately 75% of the genes associated with human diseases have homologs in \u003cem\u003eDrosophila\u0026nbsp;\u003c/em\u003e(Mariateresa et al., 2018; Mirzoyan et al., 2019),which presents\u003cem\u003eDrosophila\u003c/em\u003e as a model organism used to investigate a variety of human genetic diseases, including metabolic disorders, cancer and neurodegeneration. Pathways involved in oxidative stress in humans have been found to also exist in \u003cem\u003eDrosophila\u0026nbsp;\u003c/em\u003e(Singhal \u0026amp; Jaiswal, 2018). Additionally, most signalling pathways that are involved in cell growth, proliferation, and apoptosis are also conserved between \u003cem\u003eDrosophila\u003c/em\u003e and humans, including pathways such as the Ras-MAPK, PI3K-Akt, and Hippo pathways\u0026nbsp;(Mirzoyan et al., 2019). These pathways have been found to be vital in understanding tumorigenesis. Pathways known to be involved in neurodegeneration, such as those related to mitochondrial dysfunction, protein aggregation, and neuronal cell death, are also conserved in \u003cem\u003eDrosophila\u003c/em\u003e, as such have been used to study diseases like Parkinson's, Alzheimer's, and Huntington's disease\u0026nbsp;(Bülow et al., 2020; Singhal \u0026amp; Jaiswal, 2018). Also, a study found that methylated arsenic species can induce chromosomal instability and reduce lifespan in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e, mirroring the effects seen in humans\u0026nbsp;(Muñiz Ortiz et al., 2011). The mechanisms by which arsenic induces toxicity are complex and involve genetic factors. In both humans and Drosophila, arsenic exposure can lead to DNA damage, disruption of key signaling pathways, and oxidative stress\u0026nbsp;(Rizki et al., 2006). The antioxidant defense systems of \u003cem\u003eDrosophila melanogaster,\u003c/em\u003e including superoxide dismutase (SOD), catalase, and the Keap1-CncC signaling pathway, are analogous to those in humans, facilitating in vivo investigations into redox imbalance\u0026nbsp;(Hong et al., 2024). Likewise, critical pathways involved in carcinogenesis, such as p53\u0026nbsp;(Chakravarti et al., 2022; Zhou, 2019)\u0026nbsp;and Ras\u0026nbsp;(Mirey et al., 2003), as well as those associated with neurodegeneration, including amyloid precursor\u0026nbsp;(Poeck et al., 2012)\u0026nbsp;and tau proteins\u0026nbsp;(Prüßing et al., 2013; Yang et al., 2023), exhibit significant conservation, offering valuable insights into the mechanistic role of arsenic in disease pathogenesis.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDrosophila melanogaster\u003c/em\u003e possess a short life cycle, which allows simple survival, neural function, and behavioral studies, making them suitable for modelling diseases. Its ease of maintenance, and reduced ethical concerns make it an ideal model for cost-effective, scalable research. Previous studies on arsenic exposure in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e (Oyibo et al., 2021) did not establish any disease conditions induced by arsenic but focused only on oxidative stress. Using \u003cem\u003eDrosophila melanogaster\u003c/em\u003e, long-term effects could be observed and extrapolated to humans since both organisms have conserved pathways.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn summary,\u003cem\u003e\u0026nbsp;Drosophila melanogaster\u0026nbsp;\u003c/em\u003eserves as a versatile and cost-efficient model for elucidating the molecular mechanisms underlying arsenic toxicity and facilitating the development of therapeutic strategies. This study leverages the \u003cem\u003eDrosophila\u003c/em\u003e model to evaluate arsenic-induced disease conditions, providing insights into neurotoxicity, carcinogenesis and other arsenic-related pathologies that could inform human-relevant toxicological research as well as explore its potential as an affordable model for carrying out research.\u0026nbsp;\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003eSodium arsenite was acquired from Oxford Lab Fine Chem LLP Vasai East, Palghar-410210, Maharashtra, India. All the reagents used for this study were obtained commercially and were of analytical grade.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental Flies\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe mixed sex of the Canton-S strain of\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cem\u003eDrosophila melanogaster,\u0026nbsp;\u003c/em\u003ewhich were no older than 3 days, was used for the study. The flies were bred on a medium comprising cornmeal with 1% w/v brewer\u0026apos;s yeast, 1% w/v agar and 0.08% v/w nipagin at constant temperature and humidity (25 \u0026deg;C; 60\u0026ndash;70% relative humidity) under 12 h dark/light cycle conditions at the \u003cem\u003eDrosophila\u003c/em\u003e Laboratory, Department of Biochemistry, College of Medicine, University of Ibadan, Oyo State, Nigeria. The flies were obtained from the Federal University of Santa Maria in Brazil and were originally obtained from the National Stock Centre in Bowling Green, Oklahoma, in the United States of America.\u003c/p\u003e\n\u003cp\u003eThe experimental flies used for the study were grouped as indicated in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eTreatment Groups\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDescription\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGroup 1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003ePositive Control (Distilled water)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGroup 2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003eExposed to 0.03 mM of NaASO\u003csub\u003e2\u003c/sub\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGroup 3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003eExposed to 0.06 mM of NaASO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGroup 4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003eExposed to 0.12 mM of NaASO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGroup 5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 301px;\"\u003e\n \u003cp\u003eExposed to 0.14 mM of NaASO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e(n = 5 vials per group; 50 flies/vial).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of fly samples for biochemical assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll flies were anaesthetized with carbon dioxide, weighed and homogenized at a ratio of 1:10 \u0026ndash; field/volume (\u0026micro;L) in 0.1 M potassium phosphate buffer (pH 7.4), and centrifuged at 4,000 \u0026times; g for 10 min at 4 \u0026deg;C. The resulting supernatants were used to determine the following biochemical parameters: total thiol level, hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) level, reduced glutathione (GSH) level, nitric oxide content, lipid peroxidation, protein carbonyl content and gene expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistology and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emorphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine structural alterations caused by arsenite on selected organs, histology was carried out using the method described by Drobysheva et al. (2008). Bouin solution was used to fix the flies for 24 hours. Phosphate-buffered\u0026nbsp;saline was used to rinse the flies after fixation four times for\u0026nbsp;15 minutes\u0026nbsp;at room temperature. The tissues of the gastrointestinal\u0026nbsp;tract\u0026nbsp;were placed in disposable petri\u0026nbsp;dishes\u0026nbsp;and\u0026nbsp;covered with agarose,\u0026nbsp;and the blocks were chilled at 4\u0026nbsp;\u0026deg;C,\u0026nbsp;followed by sectioning.\u0026nbsp;The images\u0026nbsp;were then viewed and analysed. The morphology of the whole gastrointestinal tract\u0026nbsp;was\u0026nbsp;observed microscopically using Olympus LS compound microscope (100x) following dissection of the flies in phosphate buffer solution. Images were viewed and\u0026nbsp;analysed via ImageJ\u0026nbsp;software (bundled with 64-bit Java 8).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of Sodium Arsenite on the Survival Rate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate the effect of chronic exposure of arsenic on the lifespan of the flies as a measure of cumulative toxicity, the flies were exposed to sodium arsenite (NaAsO\u003csub\u003e2\u003c/sub\u003e) at different doses (0, 0.03, 0.06, 0.12, and 0.14 mM/g diet) for 21-day survival analysis. The flies were observed for survival via the method described by Farombi et al. (2018). The daily death rate of the flies was recorded, and the Kaplan‒Meier survival method was used to assess the survival rate of the flies exposed to sodium arsenite in contrast to the positive control group, which had not been exposed to arsenite.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical analysis of oxidative stress markers\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOxidative stress was evaluated by analysing the markers of oxidative stress. Flies were exposed to 0.03, 0.06, 0.12, and 0.14 mM/g diet concentrations of sodium arsenite (NaAsO\u003csub\u003e2\u003c/sub\u003e) for 10 days to carry out biochemical analysis, gene expression studies, and histology and morphological examinations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein Determination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLowry\u0026rsquo;s method was used to determine the protein concentration. The protein concentrations of the various samples were determined via the modified Lowry method as described by Everette et al. (2010).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Hydrogen Peroxide Level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe hydrogen peroxide level was measured according to the method described by Wolff (1994). After the sample was incubated in the FOX 1 reagent for 30 minutes at room temperature, the absorbance at 560 nm was measured. Protein concentrations in \u0026mu;mole/mg were converted to H2O2 values derived from a standard curve.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Total Thiol Level\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total thiol level was analysed via the method of Ellman (1959). To perform the test, 510 \u0026mu;L of 0.1 M phosphate buffer (pH 7.4) was added to 35 \u0026mu;L of 1 mM DTNB, 35 \u0026mu;L of distilled water, and 20 \u0026mu;L of sample, mixed and allowed to incubate for 30 minutes at room temperature, and the absorbance was read at 412 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination Of Glutathione-S-Transferase Activity\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGlutathione-S-transferase activity was evaluated via the method described by Habig and Jakoby (1981). Solution A was prepared by mixing 0.25 M potassium phosphate buffer (20 \u0026mu;L), 2.5 mM EDTA, 10.5 \u0026mu;L of distilled water and 0.1 M GSH (500 \u0026mu;L) at pH 7.0 and 25 \u0026deg;C. A total of 20 \u0026mu;L of the sample, at a ratio of 1:5 dilution, was added to 270 \u0026mu;L of solution A, followed by the addition of 10 \u0026mu;L of 25 mM CDNB. The absorbance was read at 340 nm for 5 min at intervals of 10 seconds via a spectrophotometer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Reduced Glutathione Level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe method described by Beutler et al. (1963) was used to assess the level of reduced glutathione (GSH). Serial dilutions of GSH stock solutions containing 20\u0026ndash;200 \u0026micro;g of reduced glutathione were prepared in different test tubes and made up to 100 \u0026micro;l with 0.1 M phosphate buffer, pH 7.4. Approximately 900 \u0026micro;l of Ellman\u0026rsquo;s reagent was then added to each sample tube. Readings were taken immediately after the addition of Ellman\u0026rsquo;s reagent, as there could be a loss of 1\u0026ndash;2% color 5\u0026ndash;10 minutes. The GSH concentration in each test tube was determined, and the absorbance was read at 412 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Nitric Oxide Level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe nitric oxide concentration was analysed via the Greiss method as described by Johnson et al. (2021). For 20 min at room temperature, 250 \u0026mu;L of each sample was incubated with 250 \u0026mu;L of Griess reagent. By comparing the absorbance of the sample with that of a standard solution with a known nitrite concentration, the nitrite concentration was determined via spectrophotometric measurement at 550 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Protein Carbonyl Level\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protein carbonyls were evaluated as described previously Wehr and Levine (2013). First, 2.0 g of DNPH (dry weight) was dissolved in 1,000 mL of 2 M HCl and stirred in the dark. Afterwards, it was filtered and concentrated by precipitation in 10% trichloroacetic acid via slow speed centrifugation to form a loose, easily dispersed pellet for 2 min at 2,000 \u0026times; g. 0.5 mL of the solution was added to the sample and vortexed to suspend the sample. The tubes were allowed to stand for 10 min at room temperature, with occasional vortexing. TCA (10%) was added to precipitate the pellets, which were recovered via slow speed centrifugation. The supernatant was removed, and free DNPH was extracted by rinsing with 1 mL of ethanol-ethyl acetate three times, after which the mixture was centrifuged at 5000 \u0026times; g for 2 minutes. The supernatant was discarded, and the pellet was dried. The dried pellet was redissolved in 200 \u0026mu;L of 6.0 M guanidine 500 mM KCl (pH 2.5) and centrifuged. The solution was read at 370 nm and 276 nm.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of Acetylcholinesterase Activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAcetylcholinesterase activity was assayed via the method of Ellman et al. (1961). The process was started by adding 0.8 mM acetylthiocholine to a mixture of 1 mM DTNB and 0.1 M potassium phosphate buffer (pH 7.4). For two minutes, the absorbance was measured at 412 nm every thirty seconds. The AChE activity was measured in \u0026mu;mol of hydrolysed acetylthiocholine per minute per milligram of protein, which was expressed in mmol of hydrolysed acetylthiocholine per minute per milligram of protein.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of Sodium Arsenite on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eExpression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of sodium arsenite on the \u003cem\u003eRas\u003c/em\u003e gene was determined via mRNA expression kits. Extraction of mRNA was carried out via the Quick-RNA\u0026trade; MiniPrep Plus Kit, and cDNA was synthesized via the ProtoScript II First Strand cDNA Synthesis Kit according to the manufacturer\u0026rsquo;s protocols. Quantitative real-time PCR was carried out to evaluate the expression of the identified genes in the flies. RNA isolation and extraction were carried out rapidly on ice to prevent degradation by RNase. The primers used are presented in Table 2:\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Primers\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\u0026nbsp;\u003cstrong\u003eStatistical\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eanalysis\u003c/strong\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003ep53\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003eF 5\u0026rsquo; ATCCAGCCTACGGAGGCAAC 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo; CGACCTCCGTGGAGTCATCC 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003eRAS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003eF 5\u0026rsquo; ACGGCAAATCGAAAACGGAC 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo; TCGGCTTGTTCATTTTGCGG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003eCNC\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003eF 5\u0026rsquo; CGCCAACGAGGTGGAAATCG 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo; CGCCTCCTGGTCCAAACTGA 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 57px;\"\u003e\n \u003cp\u003e\u003cem\u003eSOD1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 293px;\"\u003e\n \u003cp\u003eF 5\u0026rsquo; CATCGGGTGCGGCGTTATT 3\u0026rsquo;\u003c/p\u003e\n \u003cp\u003eR 5\u0026rsquo; AATAACGCCGCACCCGATG 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe data were statistically analysed via GraphPad Prism software (version 9.5.1) from San Diego, CA, USA. The results are presented as the means \u003cu\u003e+\u003c/u\u003e standard deviations (SDs). To assess significant differences, Tukey\u0026apos;s post hoc test was employed. Additionally, the statistical significance of the survival rate was determined via the log-rank (Mantel‒Cox) test.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003eRelative to the control group, arsenite-exposed flies displayed significant physiological and molecular alterations across various parameters, including oxidative stress markers, tissue integrity, and gene expression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of Sodium Arsenite\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eon the\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Survival Rates of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe graph in fig. 1 displays \u003cem\u003eDrosophila melanogaster\u003c/em\u003e survival rates after 21 days of exposure to various doses of sodium arsenite. Exposure to 0.14 mM arsenite reduced fly survival to 12% (p=0.021), indicating significant toxicity relative to the 48% survival observed in controls. This finding suggests that chronic exposure to high concentrations of sodium arsenite is harmful and could reduce longevity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistology and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emorphology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe histology of the digestive tract, fat body, and brain demonstrated that sodium arsenite had a detrimental effect on these tissues. Fig. 2 depicts the histology of the dissected organs, which were stained with haematoxylin and eosin (HE) and viewed via 400x objectives.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHistology of the Intestine of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the control (Fig. 2a), the intestinal structure appears normal, with clear and intact cell boundaries. Coagulative necrosis was observed in the intestine of the fly exposed to sodium arsenite (Fig. 2b), as well as hyperchromacia and hypertrophy (HE x400) compared with those in the unexposed \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Dysplastic cells, characterised by disorganized cells, were also observed. Hyperchromatic nuclei, marked by intense purple staining, were visible in arsenite-exposed tissues, suggesting nuclear activity associated with pre-cancerous transformation. Compared with the control, the enterocytes of the sodium arsenite-exposed flies appeared disrupted, as indicated by the stars. \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFat\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ebody\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe fat body in the control (Fig. 2c) shows a uniform, healthy structure without lesions, whereas the arsenite-exposed group (Fig. 2d) exhibits atrophy, with shrunken and irregularly shaped cells. \u0026nbsp; Compared with unexposed flies, exposed flies presented significantly altered tissue structure, demonstrating that sodium arsenite exposure causes negative changes in fat body morphology. These findings suggest that As can affect energy storage and metabolism in flies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBrain\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe control brain (Fig. 2e) shows intact gray matter and white matter structures. In the arsenite-exposed group (Fig. 2f), loss of gray matter neurons, deformation of white matter, and disorganized tissue architecture are apparent, suggesting possible nuclear and cytoplasmic damage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorphological Alterations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere were no physiological changes observed in the flies, although arsenic toxicity was observed in the movement of the flies. The flies exhibited extreme weakness; therefore, male and female flies were dissected to observe whether there were any change(s) within the internal organs. Tumor-like structures are visible in the gastrointestinal crop of arsenite-exposed male flies (Fig. 3b) compared to the normal control (Fig. 3a). This suggests carcinogenic changes, which could be linked to oxidative stress and oncogene activation. This was measured via ImageJ software, and the size of the tumor-like growth was 0.18 mm \u0026times; 0.28 mm. In the dissected female fly, the control ovary (Fig. 3c) appears intact, while the ovary in the arsenite-exposed female fly (Fig. 3d) shows signs of rupture, indicating ovotoxicity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBiochemical\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eanalyses\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emarkers of oxidative stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of the biochemical analysis of the oxidative stress markers are shown in Fig. 4.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHydrogen Peroxide Levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bar chart in Fig. 4a shows the concentrations of hydrogen peroxide in the various treatment groups. Compared with the control group (24.84 \u0026plusmn; 0.46 mmol/mL), the group exposed to 0.14 mM/g of sodium arsenite presented a significant increase in hydrogen peroxide levels (35.08 \u0026plusmn; 3.14 mmol/mL) (p = 0.0007). These findings indicate that arsenic exposure promotes increased oxidative stress, as demonstrated by increased hydrogen peroxide generation, which may overwhelm cellular antioxidant defenses, leading to the development of degenerative diseases.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTotal\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ethiol concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe total thiol content was measured because arsenite is known to have high affinity for thiol groups. At relatively low concentrations, the thiol content was not affected, which could imply that the concentration of arsenite was not high enough to cause a decrease in the thiol pool of the system. However, as the concentration increased, the thiol content decreased significantly (p = 0.029) at 0.14 mM/g diet of arsenite. This was an indication of a compromised antioxidant system (Fig. 4b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReduced Glutathione\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eConcentrations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReduced glutathione (GSH) is a nonenzyme antioxidant. It is responsible for the detoxification of arsenite. However, owing to the thiol groups present in GSH, arsenite tends to bind to the thiol groups, thereby depleting the concentration of GSH due to the formation of the arsenite-GSH complex. The results in Fig. 4c show that at low concentrations, GSH was not depleted, but there was a significant decline (p = 0.0003) in the GSH level of the group exposed to 0.14 mM/g diet of sodium arsenite.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNitric\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eoxide concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn Fig. 4d, following exposure to sodium arsenite, nitric oxide levels increased in the groups exposed to lower concentrations. At higher concentrations (0.12 mM/g diet and 0.14 mM/g diet), there was decreased nitric oxide in a dose-dependent manner, with p values of 0.00017 and 0.0088, respectively.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProtein\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ecarbonyl concentration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the presence of oxidative stress, free radicals, which can bind randomly to macromolecules, are produced. Binding of these free radicals to amino acids in the protein components of the cell leads to the production of protein carbonyls via protein oxidation. Amino acids are oxidized by free radicals. The results of the present study (Fig. 4e) revealed that, at lower concentrations, the protein carbonyl levels were low. However, there was a corresponding increase in arsenite concentration with increasing protein carbonyl content (p= 0.0009).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGlutathione-S-Transferase Activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe antioxidant system is composed of enzyme and nonenzyme components. Glutathione-S-transferase (GST) is an antioxidant enzyme involved in the detoxification of arsenic. Owing to the presence of thiol-containing amino acids, arsenic tends to have high affinity for proteins. The results of this study in Fig. 4f show that at low concentrations, arsenite does not affect the activity of the protein, but an increase in the concentration of sodium arsenite leads to decreased enzyme activity (p=0.013).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcetylcholinesterase\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eactivity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAcetylcholinesterase (AChE) is a hydrolase involved in neurotransmission. It degrades acetylcholine to acetic acid and choline. Inhibition of its activity can lead to the development of neurodegenerative diseases. At a relatively high concentration of sodium arsenite (0.14 mM), the activity of AChE decreased significantly, p=0.01 (Fig. 4g).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eexpression of sodium arsenite-\u003c/strong\u003e\u003cstrong\u003eexposed \u003cem\u003eDrosophila melanogaster\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effects of sodium arsenite on genes were also observed. The results (Fig. 4h) revealed that \u003cem\u003ep53\u003c/em\u003e was downregulated in the exposed group. The \u003cem\u003eRas\u003c/em\u003e oncogene was overexpressed. SOD1 was downregulated, and \u003cem\u003eCNC\u003c/em\u003e was also overexpressed.\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eIn this study, toxic effects of sodium arsenite were observed in flies. Chronic arsenic exposure in \u003cem\u003eDrosophila melanogaster\u0026nbsp;\u003c/em\u003eprovides a valuable framework for studying disease mechanisms relevant to human health. Its ability to mimic long-term toxicity pathways, including carcinogenesis, neurotoxicity, and systemic organ damage, offers critical insights that complement acute exposure studies. By examining cumulative and progressive biological impacts, this approach addresses real-world scenarios of prolonged arsenic exposure, advancing the understanding of its insidious health risks. The Canton-S strain was used due to the genetic makeup that may include mutations or genetic variations which could make it more susceptible to carcinogens compared to other strains (FlyBase, 2024). Their reduced genetic diversity, accumulation of deleterious alleles, relaxed selection pressures, metabolic changes, and altered behaviors, can collectively increase their susceptibility to oxidative stress and other environmental insults (Stanley \u0026amp; Kulathinal, 2016).\u003c/p\u003e\n\u003cp\u003eDifferent studies have shown that arsenic has a negative effect on the lifespan of individuals, reducing their lifespan and reducing their quality of health as a result of chronic exposure. In this study, the survival rate of the flies decreased upon exposure to arsenic. Flies exposed to relatively high concentrations of sodium arsenite for 21 days presented a relatively high mortality rate, possibly due to arsenic accumulation. This cumulative damage arsenic inflicts on cellular and systemic processes, underscores its potential to disrupt homeostasis over time in the flies. This finding is consistent with a prior study by Rahman et al. (2019), which indicated that arsenic exposure can increase mortality in humans. The observed decline in the survival of the flies may be attributed to arsenic accumulation in flies due to their overwhelmed system, resulting in a shorter survival rate of the flies (Anushree et al., 2023). Epidemiological studies have also shown that arsenic exposure can have negative health consequences, including mortality, depending on the quantity and duration of exposure (Garkal et al., 2023). Chronic exposure or acute exposure to high levels of inorganic arsenic over time can result in mortality.\u003c/p\u003e\n\u003cp\u003eThe histological evidence of cellular dysplasia and structural disorganization, especially in the cells of the small intestine, suggests genomic instability, potentially caused by the interference of arsenic with DNA repair mechanisms. These changes align with the ability for chronic arsenic exposure to induce mutagenesis and promote malignant transformation (Cardoso et al., 2018; Nail et al., 2023), bridging findings from acute studies with long-term cancer development. Hyperchromacia observed suggests increased nuclear activity, often associated with uncontrolled cell division, a hallmark of cancer (Fischer, 2020). The hypertrophy, observed in the enterocytes of the intestinal sections was characterized by enlarged cells with an abnormal structure. The hypertrophic cells appear swollen and irregularly shaped compared to the uniform cell size in the control group. Cellular hypertrophy can indicate pre-cancerous or cancerous conditions due to changes in cellular growth and metabolism (Penzo et al., 2019). The dark-stained nuclei likely represent hyperchromatic features associated with DNA damage or increased mitotic activity. These findings align with the mechanisms of arsenite-induced mutagenesis. Oxidative stress in neuronal tissues of the brain suggests that arsenic impairs neurotransmission and neuronal survival, reflecting mechanisms linked to neurodegenerative diseases in humans. Additionally, the histology of fat bodies revealed arsenic toxicity, which led to atrophy of fat body cells. This finding corroborates the findings of Zhang et al. (2024) that arsenite trioxide induces hepatotoxicity. Atrophy and necrosis can be indicative of metabolic stress caused by developing tumors, which can induce necrosis in surrounding tissues by outcompeting them for resources, leading to a lack of blood flow (ischemia) and subsequent cell death (Cui et al., 2021). Tumors create a high demand for nutrients and oxygen, which can lead to metabolic stress in the surrounding tissues. This stress can cause cells to undergo atrophy and eventually necrosis if the deprivation is severe enough (Hou et al., 2020). The fat body in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e performs functions similar to those of the human liver, making it a suitable model for studying liver-related conditions. The \u003cem\u003eDrosophila\u003c/em\u003e fat body is an organ that resembles liver and adipose tissue, storing fat and acting as a detoxifying and immunological response system (Musselman et al., 2013). On the other hand, the atrophied fat body cells highlight disrupted energy metabolism and storage, which can be extrapolated to metabolic impairments seen in arsenite toxicity in humans (Khandayataray et al., 2024; Ro et al., 2022). The results of this study suggest that sodium arsenite could be used to induce toxicity in these organs in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e to develop therapeutic strategies.\u003c/p\u003e\n\u003cp\u003eThe histological changes observed in these results provide compelling evidence for the systemic damage caused by chronic arsenite exposure.\u003c/p\u003e\n\u003cp\u003eIn Fig. 3b (crop of arsenite-exposed flies), a tumor-like growth is observed as a dense, irregular mass protruding from the crop tissue. It appears larger and more compact compared to the smooth and normal structure in the control. Tumor-like growth indicates localized proliferation of cells, a characteristic of neoplasia (Turek et al., 2022). These growths are often precursors to invasive cancer, though they are not always cancerous. However, if the cells acquire additional mutations, they may invade surrounding tissues and spread to other parts of the body. Tumor-like growth observed in \u003cem\u003eDrosophila\u003c/em\u003e suggests that arsenite can induce gastrointestinal tract cancer. This finding supports the findings of the study carried out by Kasmi et al. (2023). The ovarian toxicity of arsenic was also observed in this study. A previous study confirmed that exposure to arsenic leads to an overall decline in ovarian functions, such as disruption of steroidogenesis, where the effect of arsenic exposure leads to decreased levels of estradiol (E2) and other steroid hormones (Chen et al., 2022).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eLike in humans and other living organisms, arsenic can induce oxidative stress in flies. The results of the markers of oxidative stress revealed that exposure to arsenite triggered oxidative stress in flies similar to that in higher organisms, including humans. Oxidative stress has been proposed as a possible mechanism for arsenite toxicity. Increased oxidative stress owing to an imbalance in the antioxidative system caused by excessive ROS might overwhelm the system, leading to different disease conditions.\u003c/p\u003e\n\u003cp\u003eThis study demonstrated that arsenic-induced toxicity in flies increased hydrogen peroxide production, which could be associated with the activities of NADPH oxidase, a transmembrane protein that metabolizes oxygen and water to form hydrogen peroxide. This enzyme, present in both phagocytic and nonphagocytic cells, is usually overexpressed in response to arsenite (Zhou et al., 2021). It produces superoxide anion radicals (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e) by reducing oxygen via NADPH or NADH. Electrons are transferred from NADPH in the cytosol to FAD, the inner and outer heme, and O\u003csub\u003e2\u003c/sub\u003e outside the cell, resulting in reactive and short-lived O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e. These reactive O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e can dismutate spontaneously into H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e or via SOD (Zasu et al., 2022). These findings indicate that arsenic exposure can induce ROS production via NADPH oxidase activity. Hydrogen peroxide is diffusible, crosses membranes via aquaporins (AQPs), and initiates cell signalling (Vilchis-Landeros et al., 2020). It is also known to cause cellular damage at extremely high concentrations. A high level of hydrogen peroxide is one of the hallmarks of the tumor microenvironment including the transformation, proliferation, and survival of cancer cells, as well as angiogenesis and metastasis (Ali et al., 2024). The increased production of H₂O₂ in cancer cells compared to normal cells is a significant factor in the altered redox balance within the tumor microenvironment (Lennicke et al., 2015). Hydrogen peroxide accumulation can lead to the development of numerous diseases, making it a potential cancer diagnostic marker (Ali et al., 2024; Yang et al., 2020).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBy increasing the concentration of sodium arsenite, there was a decrease in the level of reduced glutathione (GSH), an important antioxidant in cells that decreases arsenic-induced ROS and increases arsenic excretion. GSH is responsible for detoxifying arsenite and converting pentavalent arsenic to trivalent arsenic in cells. However, the propensity of arsenic to form a complex with thiol-containing compounds contributes to its toxicity since it depletes the antioxidant pool in mitochondria by complexing with reduced glutathione. This increases the vulnerability of the cell to oxidative stress-induced damage and death. When arsenic exposure increases, the activity is overwhelmed, resulting in a decrease in GSH synthesis. In addition, arsenite reduces glutamate levels, which in turn leads to a decrease in GSH synthesis (Ran et al., 2020).\u003c/p\u003e\n\u003cp\u003eThis study revealed that total thiol levels decreased after exposure to high concentration of arsenite, which is consistent with earlier researches (Mahajan et al., 2018; Ugbaja et al., 2021). Inorganic As III binds to thiol-containing compounds and protein-cysteine thiols, which can inhibit enzyme activity. Exporting inorganic arsenic-GSH adducts from the cell is crucial for detoxification because of their ability to bind to protein thiols. Dithiol molecules and proteins with surrounding cysteine molecules have been shown to bind inorganic As III (Garza-Lomb\u0026oacute; et al., 2019). Low thiol levels are associated with cancer. A study on the native and total thiol levels of lung cancer patients revealed that the progression and risk of lung cancer can be associated with reduced total thiol levels (Şener et al., 2020), as can prostate (Solakhan et al., 2019) and breast (G\u0026agrave;o et al., 2020) cancers.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThere was increased protein carbonyl production, following increased sodium arsenite concentration. Protein oxidation, which leads to the production of protein carbonyls, perturbs the cellular redox balance, altering the cell cycle and possibly causing neuronal death. Protein carbonylation is a defining feature of oxidative stress and involves the direct oxidation of lysine, arginine, proline, and threonine side chains, resulting in reactive ketones or aldehydes that react with 2,4-dinitrophenylhydrazine to produce hydrazones (Mart\u0026iacute;nez-Orgado et al., 2023). In addition to the known oxidation of essential proteins involved in DNA damage repair, oxidatively damaged proteins specifically impair DNA repair processes. Oxidative proteome damage is an independent cause of DNA damage and a separate inducer of DNA damage repair dysfunction. As a result, genetic modifications typically continue longer, increasing the likelihood of generating oncogenic mutations (Tramutola et al., 2020). These oncogenic mutations give rise to carcinogenesis.\u003c/p\u003e\n\u003cp\u003eThe activity of GST decreased significantly with increasing concentrations of sodium arsenite, which could be due to inhibition of the enzyme by arsenite, as observed in other studies (Ojo et al., 2022; Oyibo et al., 2021; Wang et al., 2019). The production of ROS when exposed to arsenic results in the formation of GSH complexes containing trivalent arsenicals. This process promotes arsenite methylation or membrane transfer, which results in the detoxification of arsenite and its metabolites. However, GST activity is usually inhibited in the presence of arsenite, which prevents GST conjugation with GSH (Sabe et al., 2021). Increased ROS levels deactivate antioxidant enzymes, resulting in lower antioxidant enzyme levels and cell toxicity. Decreased GST activity can result in the accumulation of reactive oxygen species (ROS), which can damage DNA and initiate or promote carcinogenesis. Carcinogens are generally detoxified by GST, but decreasing activity might lead to the accumulation of carcinogens, potentially initiating or promoting cancer. As a result, GST plays an important role in antioxidant activity.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn this investigation, there was a decrease in the concentration of nitric oxide in the flies as the concentration of the arsenic was increased. However, this finding contradicts the findings of the study conducted by Oyibo et al. (2021). This could be due to the differences in the genetic makeup and other features of the Canton S strain of \u003cem\u003eD. melanogaster\u003c/em\u003e, compared to the Harwich strain used in the other study (Oyibo \u003cem\u003eet al\u003c/em\u003e., 2021). The effect of arsenite on NO generation varies with cell type, increasing in some and decreasing or even having no effect on others. Nitric oxide (NO) is a well-known autocrine and paracrine signalling agent that performs pleiotropic functions, including the modulation of blood flow and circulation, thrombosis, inflammation, immunological control, and brain activity (Tran et al., 2022). However, in investigations where NO production is reduced by exposure to arsenite, it was postulated that the decline could be related to lower endothelial NO synthase (eNOS) expression and/or its phosphorylation at serine, which is associated with an increased risk of vascular disorders (Seo et al., 2014). Nitric oxide synthase (NOS) is important for the production of NO and L-citrulline from L-arginine, molecular oxygen, and NADPH. It exists in various isoforms, including endothelial NOS (eNOS), neuronal NOS (nNOS), and inducible NOS (iNOS). These isoforms play vital roles in various physiological and pathological processes. Endothelial dysfunction is caused primarily by oxidative stress, which has been linked to endothelial NO synthase dysfunction caused by eNOS uncoupling. This uncoupling occurs when NOS activity releases superoxide or hydrogen peroxide, negatively impacting NO bioavailability and potentially destroying NO generated elsewhere (Lundberg \u0026amp; Weitzberg, 2022). eNOS uncoupling may occur when NADPH oxidase is activated, which is sustained when exposed to arsenite, thus releasing ROS (Zhang et al., 2020). When NO activity is disrupted, it leads to disease conditions such as atherosclerosis. Overwhelming ROS production surpasses antioxidant defences, and oxidative stress results, which compromises endothelial function.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAChE activity declined following exposure to high concentration of arsenite. Decreased AChE activity leads to acetylcholine accumulation in the synaptic cleft, leading to prolonged stimulation of neurons. This can cause excessive neuronal firing, disrupt normal neurotransmission, and potentially lead to neurotoxicity and neuronal damage (Akaike et al., 2010). Arsenite binds to AChE to inhibit its activity. This has been attributed to its ability to form diester bonds with the tyrosine residue of the protein (Page \u0026amp; Wilson, 1985). Inhibition of protein activity leads to the accumulation of acetylcholine, which can eventually lead to neurodegeneration. Most routinely used compounds can cause neurotoxicity by inhibiting acetylcholinesterase (AChE) activity. Acetylcholine facilitates neurotransmission at neuromuscular junctions and numerous synapses in the central nervous system. Thus, arsenite could be linked to neurotoxicity, as \u003cem\u003eDrosophila melanogaster\u003c/em\u003e can be used as a model to study and understand the mechanism of neurotoxicity induced by arsenite. The toxicity of trivalent arsenicals is caused by their interaction with sulfhydryl groups in proteins. This binding can cause changes in the conformation of proteins, their functions, and even interactions with other functional proteins. As a result, research on arsenic binding to proteins is critical for understanding arsenic toxicity (Shen et al., 2013).\u003c/p\u003e\n\u003cp\u003eIn addition to antioxidant systems, the effects of sodium arsenite on genes also underscore the use of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e as a model to induce diseases related to these genes via the use of arsenite. ROS-mediated damage to lipids, proteins, and DNA is a well-known mechanism underlying both neurotoxicity and carcinogenesis. In this study, we observed tumor-like growth, with distorted enterocytes characterized by hypertrophy and hyperchromacia, alongside the overexpression of \u003cem\u003eRas,\u003c/em\u003e which corroborates the findings of Martorell et al. (2014) that these features of colorectal cancer are expressed in the gastrointestinal tract of \u003cem\u003eDrosophila melanogaster.\u003c/em\u003e Observations of histological alterations and potential hyperplasia imply DNA damage or genomic instability. \u003cem\u003eRas\u003c/em\u003e activation is a cancer-specific characteristic in \u003cem\u003eDrosophila\u003c/em\u003e and humans that regulates both growth and cancer. It is associated with Hpo activity in \u003cem\u003eDrosophila\u003c/em\u003e epithelial cells, which causes tissues to shift from pro-differentiative to pro-growth processes (Dillard et al., 2021). \u003cem\u003eRas\u003c/em\u003e also promotes cell proliferation by regulating the transcription of growth factors and their receptors, which influences \u003cem\u003eDrosophila\u003c/em\u003e growth and may cause cancer (Mirzoyan et al., 2019).The overexpression of \u003cem\u003eRas\u003c/em\u003e has been implicated in a wide range of cancers and is currently being explored for targeted therapy in cancer research (Chen et al., 2021; Yang \u0026amp; Wu, 2024).\u003c/p\u003e\n\u003cp\u003eIn this study, \u003cem\u003eSOD1\u003c/em\u003e was downregulated after exposure to sodium arsenite, which is consistent with the findings of Perker et al. (2019) and Sun et al. (2022), who reported that arsenite exposure causes \u003cem\u003eSOD1\u003c/em\u003e downregulation. \u003cem\u003eSOD1\u003c/em\u003e downregulation has been associated with a range of pathologies, including amyotrophic lateral sclerosis (ALS), cancer, accelerated ageing and age-related diseases (Xu et al., 2022). The downregulation of \u003cem\u003eSOD1\u003c/em\u003e is critical for cancer development because it decreases detoxification, accumulating reactive oxygen species. This oxidative stress affects DNA, proteins, and lipids, resulting in mutations and genome instability. Low SOD levels reduce cell antioxidant defence, increasing the vulnerability of cells to harm. This downregulation can also affect cell signalling pathways, which help cancer cells grow and survive (Skrzycki, 2021).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe result of gene expression showed that\u003cem\u003eDrosophila\u003c/em\u003e \u003cem\u003eCNC\u003c/em\u003e (CNcC) was over expressed in flies exposed to the highest concentration of sodium arsenite. CNcC provides a practical and accessible model for studying the structure, function, and biology of Nrf2 transcription factors at different levels, utilizing the extensive genetic, genomic, and biochemical processes found in \u003cem\u003eDrosophila\u003c/em\u003e (Pitoniak \u0026amp; Bohmann, 2015). CncC collaborates with the \u003cem\u003eDrosophila\u003c/em\u003e Keap1 (dKeap1) protein to modulate the expression of genes associated with detoxification and antioxidant defense (Deng \u0026amp; Kerppola, 2013). This interaction parallels the Nrf2-Keap1 signaling pathway in mammals, wherein Keap1 suppresses Nrf2 activity under basal conditions but dissociates from Nrf2 during oxidative stress, enabling the activation of protective gene expression (Gunderson et al., 2020). The result of the CNcC could be translated to effect of arsenic on Nrf2, as it is the human homologue of CNcC. When Nrf2 activity is elevated, cancer cells become more resistant to radiation and chemotherapy. Furthermore, Nrf2 is essential for metabolic reprogramming during the development of cancer stem cells (Bi et al., 2021).\u003c/p\u003e\n\u003cp\u003eNeurotoxicity can also be modelled in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e using arsenite, based on the results of this study. AChE, \u003cem\u003eSOD1\u003c/em\u003e and NO have direct implications for neurotoxicity. \u003cem\u003eSOD1\u003c/em\u003e, for example, is important for cytoprotection, gene transcription, and physiological regulation since it modulates signal transduction pathways in response to neurotoxic stimuli (Damiano et al., 2020), leading to the release of reactive oxygen species, and can serve as a target for modifying or developing therapies for neurodegenerative disorders. Acetylcholinesterase inhibitors cause acetylcholine to accumulate, leading to overstimulation of parasympathetic nervous system symptoms such as hypermotility, hypersecretion, bradycardia, miosis, diarrhoea, and hypotension (Colovic et al., 2013). Involuntary movements at neuromuscular junctions and muscle fibrillation, fasciculation, and paralysis could be indicators of acetylcholine toxicity. Nitric oxide, on the other hand, is involved in brain injuries, which leads to neurological conditions, which leads to neurological conditions. Nitric oxide (NO) contributes to oxidative damage by reacting with superoxide to form peroxynitrite, which damages lipids, proteins, and DNA, while also playing a role in glutamate-induced excitotoxicity by overactivating NMDA receptors, leading to neuronal injury (Manucha, 2017). Additionally, NO impairs mitochondrial function by inhibiting cytochrome c oxidase, reduces ATP production, promotes ROS generation (Manucha, 2017), and exacerbates neuroinflammation through microglial and astrocytic activation (Brunt et al., 2022).\u003c/p\u003e\n\u003cp\u003eThis study offers significant insights into the toxicological impacts of arsenite exposure, emphasizing the use of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e as a powerful model organism for examining disease mechanisms linked to arsenic toxicity. Physiological and molecular disruptions reported, following arsenite exposure, establishes \u003cem\u003eD. melanogaster\u003c/em\u003e as an effective system for investigating pathways associated with oxidative stress, DNA damage, and metabolic dysregulation. The findings highlight the capacity of the organism to mimic human disease phenotypes, thus providing a valuable framework for exploring arsenic-induced pathologies, including carcinogenesis, diabetes, and neurodegenerative disorders. Furthermore, this study lays a foundation for using \u003cem\u003eD. melanogaster\u003c/em\u003e in the screening and development of therapeutic agents to ameliorate arsenic toxicity. Integrating advanced genetic tools and omics-based approaches in future studies could further enhance the understanding of the involvement of arsenic in human health conditions, thereby advancing translational research efforts.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAChE – Acetylcholinesterase\u003c/p\u003e\n\u003cp\u003eGST – Glutathione-S-Transferase\u003c/p\u003e\n\u003cp\u003eGSH – Reduced glutathione\u003c/p\u003e\n\u003cp\u003eH\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e – Hydrogen Peroxide\u003c/p\u003e\n\u003cp\u003eSA – Sodium Arsenite\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCredit\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Authorship Contribution Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: T.O.J.; Methodology: T.O.J., J-R. I.O.; Formal analysis and investigation: J-R. I.O.; Writing - original draft preparation: J-R.I.O,. Writing - review and editing: J.D.D., T.O.J.; Funding acquisition: not applicable; Resources: J-R.I.O., J.D.D., T.O.J.; Supervision: T.O.J.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis manuscript does not report data generation or analysis\u003c/p\u003e\n\u003cp\u003eJane-Rose I. Oche has to be contacted in case of any queries or requirement of data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to the \u003cem\u003eDrosophila\u003c/em\u003e Research and Training Center (DRTC) University of Ibadan for providing their facilities and the fly stocks to carry out this research. We also appreciate Prof. Amos O. Abolaji for his technical help and support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAkaike, A., Takada-Takatori, Y., Kume, T., \u0026amp; Izumi, Y. (2010). Mechanisms of Neuroprotective Effects of Nicotine and Acetylcholinesterase Inhibitors: Role of α4 and α7 Receptors in Neuroprotection. \u003cem\u003eJournal of Molecular Neuroscience\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(1), 211\u0026ndash;216. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12031-009-9236-1\u003c/span\u003e\u003cspan address=\"10.1007/s12031-009-9236-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAli, T., Li, D., Ponnamperumage, T. N. F., Peterson, A. K., Pandey, J., Fatima, K., Brzezinski, J., Jakusz, J. A. R., Gao, H., Koelsch, G. E., Murugan, D. S., \u0026amp; Peng, X. (2024). Generation of Hydrogen Peroxide in Cancer Cells: Advancing Therapeutic Approaches for Cancer Treatment. \u003cem\u003eCancers\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(12), 2171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e/2072-6694/16/12/2171\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnushree, Ali, M. Z., Bilgrami, A. L., \u0026amp; Ahsan, J. (2023). Acute Exposure to Arsenic Affects Pupal Development and Neurological Functions in Drosophila melanogaster. \u003cem\u003eToxics\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(4), 327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeutler, E., Duron, O., \u0026amp; Kelly, B. M. (1963). Improved method for determination of blood glutathione.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhat, A., Ravi, K., Tian, F., \u0026amp; Singh, B. (2024). Arsenic Contamination Needs Serious Attention: An Opinion and Global Scenario. \u003cem\u003ePollutants\u003c/em\u003e, \u003cem\u003e4\u003c/em\u003e(2), 196\u0026ndash;211. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e2673-4672/4/2/13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBi, Z., Zhang, Q., Fu, Y., Seno, A., Wadgaonkar, P., Qiu, Y., Almutairy, B., Xu, L., Zhang, W., Thakur, C., \u0026amp; Chen, F. (2021). Cooperation between NRF2-mediated transcription and MDIG-dependent epigenetic modifications in arsenic-induced carcinogenesis and cancer stem cells. \u003cem\u003eSeminars in Cancer Biology\u003c/em\u003e, \u003cem\u003e76\u003c/em\u003e, 310\u0026ndash;318. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.semcancer.2021.03.030\u003c/span\u003e\u003cspan address=\"10.1016/j.semcancer.2021.03.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBibha, K., Akhigbe, T. M., Hamed, M. A., \u0026amp; Akhigbe, R. E. (2024). Metabolic Derangement by Arsenic: a Review of the Mechanisms. \u003cem\u003eBiological Trace Element Research\u003c/em\u003e, \u003cem\u003e202\u003c/em\u003e(5), 1972\u0026ndash;1982. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12011-023-03828-4\u003c/span\u003e\u003cspan address=\"10.1007/s12011-023-03828-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrunt, T. M., van den Brink, W., \u0026amp; van Amsterdam, J. (2022). Mechanisms Involved in the Neurotoxicity and Abuse Liability of Nitrous Oxide: A Narrative Review. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(23), 14747. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e1422-0067/23/23/14747\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026uuml;low, M. H., Parsons, B. D., \u0026amp; Di Cara, F. (2020). The Drosophila melanogaster as Genetic Model System to Dissect the Mechanisms of Disease that Lead to Neurodegeneration in Adrenoleukodystrophy. In G. Lizard (Ed.), \u003cem\u003ePeroxisome Biology: Experimental Models, Peroxisomal Disorders and Neurological Diseases\u003c/em\u003e (pp. 145\u0026ndash;159). Springer International Publishing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-60204-8_11\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-60204-8_11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCalap-Quintana, P., Gonz\u0026aacute;lez-Fern\u0026aacute;ndez, J., Sebasti\u0026aacute;-Ortega, N., Llorens, J. V., \u0026amp; Molt\u0026oacute;, M. D. (2017). Drosophila melanogaster Models of Metal-Related Human Diseases and Metal Toxicity. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(7), 1456. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e1422-0067/18/7/1456\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCardoso, A. P. F., Al-Eryani, L., \u0026amp; States, J. C. (2018). Arsenic-Induced Carcinogenesis: The Impact of miRNA Dysregulation. \u003cem\u003eToxicological Sciences\u003c/em\u003e, \u003cem\u003e165\u003c/em\u003e(2), 284\u0026ndash;290. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/toxsci/kfy128\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfy128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChakravarti, A., Thirimanne, H. N., Brown, S., \u0026amp; Calvi, B. R. (2022). Drosophila p53 isoforms have overlapping and distinct functions in germline genome integrity and oocyte quality control. \u003cem\u003eElife\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e, e61389. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7554/eLife.61389\u003c/span\u003e\u003cspan address=\"10.7554/eLife.61389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, K., Zhang, Y., Qian, L., \u0026amp; Wang, P. (2021). Emerging strategies to target RAS signaling in human cancer therapy. \u003cem\u003eJournal of Hematology \u0026amp; Oncology\u003c/em\u003e, \u003cem\u003e14\u003c/em\u003e(1), 116. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13045-021-01127-w\u003c/span\u003e\u003cspan address=\"10.1186/s13045-021-01127-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, Y., Sun, Y., Zhao, A., Cai, X., Yu, A., Xu, Q., Wang, P., Yao, J., Wang, Q., \u0026amp; Wang, W. (2022). Arsenic exposure diminishes ovarian follicular reserve and induces abnormal steroidogenesis by DNA methylation. \u003cem\u003eEcotoxicology and Environmental Safety\u003c/em\u003e, \u003cem\u003e241\u003c/em\u003e, 113816.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColovic, M. B., Krstic, D. Z., Lazarevic-Pasti, T. D., Bondzic, A. M., \u0026amp; Vasic, V. M. (2013). Acetylcholinesterase inhibitors: pharmacology and toxicology. \u003cem\u003eCurrent neuropharmacology\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(3), 315\u0026ndash;335.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui, J., Zhao, S., Li, Y., Zhang, D., Wang, B., Xie, J., \u0026amp; Wang, J. (2021). Regulated cell death: discovery, features and implications for neurodegenerative diseases. \u003cem\u003eCell Communication and Signaling\u003c/em\u003e, \u003cem\u003e19\u003c/em\u003e(1), 120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12964-021-00799-8\u003c/span\u003e\u003cspan address=\"10.1186/s12964-021-00799-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDamiano, S., Sozio, C., La Rosa, G., Guida, B., Faraonio, R., Santillo, M., \u0026amp; Mondola, P. (2020). Metabolism Regulation and Redox State: Insight into the Role of Superoxide Dismutase 1. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(18), 6606. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e1422-0067/21/18/6606\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDavis, E. E., Frangakis, S., \u0026amp; Katsanis, N. (2014). Interpreting human genetic variation with in vivo zebrafish assays. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Molecular Basis of Disease\u003c/em\u003e, \u003cem\u003e1842\u003c/em\u003e(10), 1960\u0026ndash;1970. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bbadis.2014.05.024\u003c/span\u003e\u003cspan address=\"10.1016/j.bbadis.2014.05.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng, H., \u0026amp; Kerppola, T. K. (2013). Regulation of Drosophila metamorphosis by xenobiotic response regulators. \u003cem\u003ePLoS genetics\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(2), e1003263.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDillard, C., Reis, J. G. T., \u0026amp; Rusten, T. E. (2021). RasV12; scrib\u0026ndash;/\u0026ndash; Tumors: A Cooperative Oncogenesis Model Fueled by Tumor/Host Interactions. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(16), 8873. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e1422-0067/22/16/8873\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrobysheva, D., Ameel, K., Welch, B., Ellison, E., Chaichana, K., Hoang, B., Sharma, S., Neckameyer, W., Srinakevitch, I., Murphy, K. J., \u0026amp; Schmid, A. (2008). An optimized method for histological detection of dopaminergic neurons in Drosophila melanogaster. \u003cem\u003eJ Histochemistry Cytochemistry\u003c/em\u003e, \u003cem\u003e56\u003c/em\u003e(12), 1049\u0026ndash;1063. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1369/jhc.2008.951137\u003c/span\u003e\u003cspan address=\"10.1369/jhc.2008.951137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEllman, G. L. (1959). Tissue sulfhydryl groups. \u003cem\u003eArchives of biochemistry and biophysics\u003c/em\u003e, \u003cem\u003e82\u003c/em\u003e(1), 70\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEllman, G. L., Courtney, K. D., Andres Jr, V., \u0026amp; Featherstone, R. M. (1961). A new and rapid colorimetric determination of acetylcholinesterase activity. \u003cem\u003eBiochemical pharmacology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(2), 88\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEverette, J. D., Bryant, Q. M., Green, A. M., Abbey, Y. A., Wangila, G. W., \u0026amp; Walker, R. B. (2010). Thorough study of reactivity of various compound classes toward the Folin\u0026thinsp;\u0026ndash;\u0026thinsp;Ciocalteu reagent. \u003cem\u003eJournal of agricultural and food chemistry\u003c/em\u003e, \u003cem\u003e58\u003c/em\u003e(14), 8139\u0026ndash;8144.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarombi, E. O., Abolaji, A. O., Farombi, T. H., Oropo, A. S., Owoje, O. A., \u0026amp; Awunah, M. T. (2018). Garcinia kola seed biflavonoid fraction (Kolaviron), increases longevity and attenuates rotenone-induced toxicity in Drosophila melanogaster. \u003cem\u003ePesticide Biochemistry and Physiology\u003c/em\u003e, \u003cem\u003e145\u003c/em\u003e, 39\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.pestbp.2018.01.002\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2018.01.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFischer, E. G. (2020). Nuclear morphology and the biology of cancer cells. \u003cem\u003eActa cytologica\u003c/em\u003e, \u003cem\u003e64\u003c/em\u003e(6), 511\u0026ndash;519.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFlyBase. (2024). \u003cem\u003eStain: Canton S\u003c/em\u003e. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://flybase.org/reports/FBsn0000274.htm\u003c/span\u003e\u003cspan address=\"https://flybase.org/reports/FBsn0000274.htm\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrisbie, S. H., \u0026amp; Mitchell, E. J. (2022). Arsenic in drinking water: An analysis of global drinking water regulations and recommendations for updates to protect public health. \u003cem\u003ePloS one\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(4), e0263505.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026agrave;o, X., Wilsgaard, T., Jansen, E. H., Xuan, Y., Anusruti, A., Brenner, H., \u0026amp; Sch\u0026ouml;ttker, B. (2020). Serum total thiol levels and the risk of lung, colorectal, breast and prostate cancer: A prospective case\u0026ndash;cohort study. \u003cem\u003eInternational journal of cancer\u003c/em\u003e, \u003cem\u003e146\u003c/em\u003e(5), 1261\u0026ndash;1267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarkal, A., Sarode, L., Bangar, P., Mehta, T., Singh, D. P., \u0026amp; Rawal, R. (2023). Understanding arsenic toxicity: Implications for environmental exposure and human health. \u003cem\u003eJournal of Hazardous Materials Letters\u003c/em\u003e, 100090.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarza-Lomb\u0026oacute;, C., Pappa, A., Panayiotidis, M. I., Gonsebatt, M. E., \u0026amp; Franco, R. (2019). Arsenic-induced neurotoxicity: a mechanistic appraisal. \u003cem\u003eJBIC Journal of Biological Inorganic Chemistry\u003c/em\u003e, \u003cem\u003e24\u003c/em\u003e, 1305\u0026ndash;1316.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunderson, J. T., Peppriell, A. E., Vorojeikina, D., \u0026amp; Rand, M. D. (2020). Tissue-specific Nrf2 signaling protects against methylmercury toxicity in Drosophila neuromuscular development. \u003cem\u003eArchives of Toxicology\u003c/em\u003e, \u003cem\u003e94\u003c/em\u003e(12), 4007\u0026ndash;4022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00204-020-02879-z\u003c/span\u003e\u003cspan address=\"10.1007/s00204-020-02879-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHabig, W. H., \u0026amp; Jakoby, W. B. (1981). [27] Glutathione S-transferases (rat and human). In \u003cem\u003eMethods in Enzymology\u003c/em\u003e (Vol. 77, pp. 218\u0026ndash;231). Academic Press. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/S0076-6879(81)77029-0\u003c/span\u003e\u003cspan address=\"10.1016/S0076-6879(81)77029-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong, Y., Boiti, A., Vallone, D., \u0026amp; Foulkes, N. S. (2024). Reactive Oxygen Species Signaling and Oxidative Stress: Transcriptional Regulation and Evolution. \u003cem\u003eAntioxidants\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(3), 312. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e/2076-3921/13/3/312\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou, J., Zhao, R., Xia, W., Chang, C.-W., You, Y., Hsu, J.-M., Nie, L., Chen, Y., Wang, Y.-C., \u0026amp; Liu, C. (2020). PD-L1-mediated gasdermin C expression switches apoptosis to pyroptosis in cancer cells and facilitates tumour necrosis. \u003cem\u003eNature cell biology\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(10), 1264\u0026ndash;1275.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson, T. O., Abolaji, A. O., Omale, S., Longdet, I. Y., Kutshik, R. J., Oyetayo, B. O., Adegboyega, A. E., \u0026amp; Sagay, A. (2021). Benzo[a]pyrene and Benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide induced locomotor and reproductive senescence and altered biochemical parameters of oxidative damage in Canton-S Drosophila melanogaster. \u003cem\u003eToxicology reports\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e, 571\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.toxrep.2021.03.001\u003c/span\u003e\u003cspan address=\"10.1016/j.toxrep.2021.03.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKasmi, S., Moser, L., Gonvers, S., Dormond, O., Demartines, N., \u0026amp; Labgaa, I. (2023). Carcinogenic effect of arsenic in digestive cancers: a systematic review. \u003cem\u003eEnvironmental Health\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(1), 36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12940-023-00988-7\u003c/span\u003e\u003cspan address=\"10.1186/s12940-023-00988-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhandayataray, P., Samal, D., \u0026amp; Murthy, M. K. (2024). Arsenic and adipose tissue: an unexplored pathway for toxicity and metabolic dysfunction. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e, \u003cem\u003e31\u003c/em\u003e(6), 8291\u0026ndash;8311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-023-31683-2\u003c/span\u003e\u003cspan address=\"10.1007/s11356-023-31683-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLennicke, C., Rahn, J., Lichtenfels, R., Wessjohann, L. A., \u0026amp; Seliger, B. (2015). Hydrogen peroxide \u0026ndash; production, fate and role in redox signaling of tumor cells. \u003cem\u003eCell Communication and Signaling\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(1), 39. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12964-015-0118-6\u003c/span\u003e\u003cspan address=\"10.1186/s12964-015-0118-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLundberg, J. O., \u0026amp; Weitzberg, E. (2022). Nitric oxide signaling in health and disease. \u003cem\u003eCell\u003c/em\u003e, \u003cem\u003e185\u003c/em\u003e(16), 2853\u0026ndash;2878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLykoudi, A., Cardoso, A. P. F., Wise, S. S., Banerjee, M., \u0026amp; States, J. C. (2023). Clonal variability in chromosomal instability as a potential driver in the acquisition of tumorigenic phenotype in chronic arsenic-exposed and hsa-miR-186 overexpressing human keratinocytes. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, 116730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahajan, L., Verma, P. K., Raina, R., Pankaj, N. K., Sood, S., \u0026amp; Singh, M. (2018). Alteration in thiols homeostasis, protein and lipid peroxidation in renal tissue following subacute oral exposure of imidacloprid and arsenic in Wistar rats. \u003cem\u003eToxicology reports\u003c/em\u003e, \u003cem\u003e5\u003c/em\u003e, 1114\u0026ndash;1119.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManucha, W. (2017). Nitric Oxide Pathways in Neurotoxicity from Glutamate-Induced Apoptosis: Emerging Mitochondrial Role. In P. \u0026Aacute;. Gargiulo \u0026amp; H. L. Mesones-Arroyo (Eds.), \u003cem\u003ePsychiatry and Neuroscience Update - Vol. II: A Translational Approach\u003c/em\u003e (pp. 151\u0026ndash;159). Springer International Publishing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-319-53126-7_12\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-53126-7_12\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMariateresa, A., Sheri, Z., \u0026amp; Paola, B. (2018). The Fruit Fly, Drosophila melanogaster: Modeling of Human Diseases (Part II). In P. Farzana Khan (Ed.), \u003cem\u003eDrosophila melanogaster\u003c/em\u003e (pp. Ch. 7). IntechOpen. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5772/intechopen.73199\u003c/span\u003e\u003cspan address=\"10.5772/intechopen.73199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Orgado, J., Mart\u0026iacute;nez-Vega, M., Silva, L., Romero, A., de Hoz-Rivera, M., Villa, M., \u0026amp; Del Pozo, A. (2023). Protein Carbonylation as a Biomarker of Oxidative Stress and a Therapeutic Target in Neonatal Brain Damage. \u003cem\u003eAntioxidants (Basel)\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(10). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox12101839\u003c/span\u003e\u003cspan address=\"10.3390/antiox12101839\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartorell, \u0026Ograve;., Merlos-Suarez, A., Campbell, K., Barriga, F. M., Christov, C. P., Miguel-Aliaga, I., Batlle, E., Casanova, J., \u0026amp; Casali, A. (2014). Conserved mechanisms of tumorigenesis in the Drosophila adult midgut. \u003cem\u003ePloS one\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(2), e88413.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirey, G., Balakireva, M., L'Hoste, S., Ross\u0026eacute;, C., Voegeling, S., \u0026amp; Camonis, J. (2003). A Ral guanine exchange factor-Ral pathway is conserved in Drosophila melanogaster and sheds new light on the connectivity of the Ral, Ras, and Rap pathways. \u003cem\u003eMolecular and cellular biology\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(3), 1112\u0026ndash;1124. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mcb.23.3.1112-1124.2003\u003c/span\u003e\u003cspan address=\"10.1128/mcb.23.3.1112-1124.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMirzoyan, Z., Sollazzo, M., Allocca, M., Valenza, A. M., Grifoni, D., \u0026amp; Bellosta, P. (2019). Drosophila melanogaster: A Model Organism to Study Cancer. \u003cem\u003eFront Genet\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e, 51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fgene.2019.00051\u003c/span\u003e\u003cspan address=\"10.3389/fgene.2019.00051\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMochizuki, H. (2019). Arsenic Neurotoxicity in Humans. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e20\u003c/em\u003e(14), 3418. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/1422-0067/20/14/3418\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/1422-0067/20/14/3418\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMu\u0026ntilde;iz Ortiz, J. G., Shang, J., Catron, B., Landero, J., Caruso, J. A., \u0026amp; Cartwright, I. L. (2011). A Transgenic Drosophila Model for Arsenic Methylation Suggests a Metabolic Rationale for Differential Dose-Dependent Toxicity Endpoints. \u003cem\u003eToxicological Sciences\u003c/em\u003e, \u003cem\u003e121\u003c/em\u003e(2), 303\u0026ndash;311. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/toxsci/kfr074\u003c/span\u003e\u003cspan address=\"10.1093/toxsci/kfr074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMusselman, L. P., Fink, J. L., Ramachandran, P. V., Patterson, B. W., Okunade, A. L., Maier, E., Brent, M. R., Turk, J., \u0026amp; Baranski, T. J. (2013). Role of Fat Body Lipogenesis in Protection against the Effects of Caloric Overload in Drosophila*. \u003cem\u003eJournal of biological chemistry\u003c/em\u003e, \u003cem\u003e288\u003c/em\u003e(12), 8028\u0026ndash;8042. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1074/jbc.M112.371047\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M112.371047\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNail, A. N., Xu, M., Bastick, J. C., Patel, D. P., Rogers, M. N., \u0026amp; States, J. C. (2023). Arsenic and Human Health: New Molecular Mechanisms For Arsenic-Induced Cancers. \u003cem\u003eCurrent Pollution Reports\u003c/em\u003e, \u003cem\u003e9\u003c/em\u003e(4), 784\u0026ndash;797. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s40726-023-00278-3\u003c/span\u003e\u003cspan address=\"10.1007/s40726-023-00278-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOjo, O. O., Fatokun, D. I., Ejidike, I. P., Awolope, R. U., \u0026amp; Sanni, S. O. (2022). Quercetin Zinc and Iron Metal Complexes Protect against Sodium Arsenite Intoxication in the Hepato-Renal System of Wistar Rats via the Oxidative Stress Pathway. \u003cem\u003eJournal of Toxicology\u003c/em\u003e, \u003cem\u003e2022\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOyibo, A., Abolaji, A. O., \u0026amp; Odunola, O. A. (2021). Carcinogen sodium arsenite disrupts antioxidant and redox homeostasis in Drosophila melanogaster. \u003cem\u003eJournal of Basic and Clinical Physiology and Pharmacology\u003c/em\u003e(0), 000010151520200235.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePage, J. D., \u0026amp; Wilson, I. B. (1985). Acetylcholinesterase: inhibition by tetranitromethane and arsenite. Binding of arsenite by tyrosine residues. \u003cem\u003eJournal of biological chemistry\u003c/em\u003e, \u003cem\u003e260\u003c/em\u003e(3), 1475\u0026ndash;1478.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePenzo, M., Montanaro, L., Trer\u0026eacute;, D., \u0026amp; Derenzini, M. (2019). The Ribosome Biogenesis\u0026mdash;Cancer Connection. \u003cem\u003eCells\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), 55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com/2073-4409/8/1/55\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com/2073-4409/8/1/55\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerker, M. C., Orta Yilmaz, B., Yildizbayrak, N., Aydin, Y., \u0026amp; Erkan, M. (2019). Protective effects of curcumin on biochemical and molecular changes in sodium arsenite-induced oxidative damage in embryonic fibroblast cells. \u003cem\u003eJournal of biochemical and molecular toxicology\u003c/em\u003e, \u003cem\u003e33\u003c/em\u003e(7), e22320.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePitoniak, A., \u0026amp; Bohmann, D. (2015). Mechanisms and functions of Nrf2 signaling in Drosophila. \u003cem\u003eFree Radical Biology and Medicine\u003c/em\u003e, \u003cem\u003e88\u003c/em\u003e, 302\u0026ndash;313.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoeck, B., Strauss, R., \u0026amp; Kretzschmar, D. (2012). Analysis of amyloid precursor protein function in Drosophilamelanogaster. \u003cem\u003eExperimental Brain Research\u003c/em\u003e, \u003cem\u003e217\u003c/em\u003e(3), 413\u0026ndash;421. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00221-011-2860-3\u003c/span\u003e\u003cspan address=\"10.1007/s00221-011-2860-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePr\u0026uuml;\u0026szlig;ing, K., Voigt, A., \u0026amp; Schulz, J. B. (2013). Drosophila melanogaster as a model organism for Alzheimer\u0026rsquo;s disease. \u003cem\u003eMolecular Neurodegeneration\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(1), 35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1750-1326-8-35\u003c/span\u003e\u003cspan address=\"10.1186/1750-1326-8-35\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman, M., Sohel, N., Yunus, F. M., Alam, N., Nahar, Q., Streatfield, P. K., \u0026amp; Yunus, M. (2019). Arsenic exposure and young adult's mortality risk: A 13-year follow-up study in Matlab, Bangladesh. \u003cem\u003eEnvironment international\u003c/em\u003e, \u003cem\u003e123\u003c/em\u003e, 358\u0026ndash;367.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahmani, A., Khamutian, S., Doosti-Irani, A., Shokoohizadeh, M. J., Shirmohammadi-Khorram, N., Sahraeei, F., Khodabakhshi, M., \u0026amp; Ahangaran, N. (2023). The association of arsenic exposure with mortality due to cancer, diabetes, Alzheimer's and congenital anomalies using Poisson regression. \u003cem\u003eScientific reports\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(1), 15456.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRan, S., Liu, J., \u0026amp; Li, S. (2020). A systematic review of the various effect of arsenic on glutathione synthesis in vitro and in vivo. \u003cem\u003eBioMed Research International\u003c/em\u003e, \u003cem\u003e2020\u003c/em\u003e(1), 9414196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRizki, M., Kossatz, E., Vel\u0026aacute;zquez, A., Creus, A., Farina, M., Fortaner, S., Sabbioni, E., \u0026amp; Marcos, R. (2006). Metabolism of arsenic in Drosophila melanogaster and the genotoxicity of dimethylarsinic acid in the Drosophila wing spot test. \u003cem\u003eEnvironmental and molecular mutagenesis\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(3), 162\u0026ndash;168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRo, S.-H., Bae, J., Jang, Y., Myers, J. F., Chung, S., Yu, J., Natarajan, S. K., Franco, R., \u0026amp; Song, H.-S. (2022). Arsenic Toxicity on Metabolism and Autophagy in Adipose and Muscle Tissues. \u003cem\u003eAntioxidants\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(4), 689. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e/2076-3921/11/4/689\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuan, Y., Fang, X., Guo, T., Liu, Y., Hu, Y., Wang, X., Hu, Y., Gao, L., Li, Y., \u0026amp; Pi, J. (2022). Metabolic reprogramming in the arsenic carcinogenesis. \u003cem\u003eEcotoxicology and Environmental Safety\u003c/em\u003e, \u003cem\u003e229\u003c/em\u003e, 113098.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSabe, V. T., Ntombela, T., Jhamba, L. A., Maguire, G. E. M., Govender, T., Naicker, T., \u0026amp; Kruger, H. G. (2021). Current trends in computer aided drug design and a highlight of drugs discovered via computational techniques: A review. \u003cem\u003eEuropean Journal of Medicinal Chemistry\u003c/em\u003e, \u003cem\u003e224\u003c/em\u003e, 113705. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.ejmech.2021.113705\u003c/span\u003e\u003cspan address=\"10.1016/j.ejmech.2021.113705\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŞener, M. U., S\u0026ouml;nmez, \u0026Ouml;., Keyf, İ. A., Erel, \u0026Ouml;., Alışık, M., Bulut, S., \u0026amp; Erdoğan, Y. (2020). Evaluation of thiol/disulfide homeostasis in lung cancer. \u003cem\u003eTurkish thoracic journal\u003c/em\u003e, \u003cem\u003e21\u003c/em\u003e(4), 255.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeo, J., Lee, J. Y., Sung, M.-S., Byun, C. J., Cho, D.-H., Lee, H.-J., Park, J.-H., Cho, H.-S., Cho, S.-J., \u0026amp; Jo, I. (2014). Arsenite acutely decreases nitric oxide production via the ROS\u0026mdash;protein phosphatase 1\u0026mdash;endothelial nitric oxide synthase-thr497 signaling cascade. \u003cem\u003eBiomolecules \u0026amp; therapeutics\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(6), 510.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen, S., Li, X. F., Cullen, W. R., Weinfeld, M., \u0026amp; Le, X. C. (2013). Arsenic binding to proteins. \u003cem\u003eChem Rev\u003c/em\u003e, \u003cem\u003e113\u003c/em\u003e(10), 7769\u0026ndash;7792. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/cr300015c\u003c/span\u003e\u003cspan address=\"10.1021/cr300015c\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh, A. P., Goel, R. K., \u0026amp; Kaur, T. (2011). Mechanisms pertaining to arsenic toxicity. \u003cem\u003eToxicol Int\u003c/em\u003e, \u003cem\u003e18\u003c/em\u003e(2), 87\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/0971-6580.84258\u003c/span\u003e\u003cspan address=\"10.4103/0971-6580.84258\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSinghal, N., \u0026amp; Jaiswal, M. (2018). Pathways to neurodegeneration: lessons learnt from unbiased genetic screens in Drosophila. \u003cem\u003eJournal of Genetics\u003c/em\u003e, \u003cem\u003e97\u003c/em\u003e(3), 773\u0026ndash;781. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12041-018-0954-4\u003c/span\u003e\u003cspan address=\"10.1007/s12041-018-0954-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkrzycki, M. (2021). Superoxide dismutase and the sigma1 receptor as key elements of the antioxidant system in human gastrointestinal tract cancers. \u003cem\u003eOpen Life Sciences\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(1), 1225\u0026ndash;1239.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolakhan, M., \u0026Ccedil;i\u0026ccedil;ek, H., Orhan, N., \u0026amp; Yildirim, M. (2019). Role of native Thiol, total Thiol and dynamic Disulphide in diagnosis of patient with prostate cancer and prostatitis. \u003cem\u003eInternational braz j urol\u003c/em\u003e, \u003cem\u003e45\u003c/em\u003e(3), 495\u0026ndash;502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStanley, C. E., \u0026amp; Kulathinal, R. J. (2016). Genomic signatures of domestication on neurogenetic genes in Drosophila melanogaster. \u003cem\u003eBMC Evolutionary Biology\u003c/em\u003e, \u003cem\u003e16\u003c/em\u003e(1), 6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12862-015-0580-1\u003c/span\u003e\u003cspan address=\"10.1186/s12862-015-0580-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun, H.-J., Ding, S., Guan, D.-X., \u0026amp; Ma, L. Q. (2022). Nrf2/Keap1 pathway in countering arsenic-induced oxidative stress in mice after chronic exposure at environmentally-relevant concentrations. \u003cem\u003eChemosphere\u003c/em\u003e, \u003cem\u003e303\u003c/em\u003e, 135256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.chemosphere.2022.135256\u003c/span\u003e\u003cspan address=\"10.1016/j.chemosphere.2022.135256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThakur, M., Rachamalla, M., Niyogi, S., Datusalia, A. K., \u0026amp; Flora, S. J. S. (2021). Molecular mechanism of arsenic-induced neurotoxicity including neuronal dysfunctions. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, \u003cem\u003e22\u003c/em\u003e(18), 10077.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTramutola, A., Falcucci, S., Brocco, U., Triani, F., Lanzillotta, C., Donati, M., Panetta, C., Luzi, F., Iavarone, F., Vincenzoni, F., Castagnola, M., Perluigi, M., Di Domenico, F., \u0026amp; De Marco, F. (2020). Protein Oxidative Damage in UV-Related Skin Cancer and Dysplastic Lesions Contributes to Neoplastic Promotion and Progression. \u003cem\u003eCancers\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e(1), 110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.mdpi.com\u003c/span\u003e\u003cspan address=\"https://www.mdpi.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e/2072-6694/12/1/110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTran, N., Garcia, T., Aniqa, M., Ali, S., Ally, A., \u0026amp; Nauli, S. M. (2022). Endothelial nitric oxide synthase (eNOS) and the cardiovascular system: In physiology and in disease states. \u003cem\u003eAmerican journal of biomedical science \u0026amp; research\u003c/em\u003e, \u003cem\u003e15\u003c/em\u003e(2), 153.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurek, D., Haefliger, S., Ameline, B., Alborelli, I., Calgua, B., Hartmann, W., Harder, D., Flanagan, A. M., Amary, F., \u0026amp; Baumhoer, D. (2022). Brown tumors belong to the spectrum of KRAS-driven neoplasms. \u003cem\u003eThe American Journal of Surgical Pathology\u003c/em\u003e, \u003cem\u003e46\u003c/em\u003e(11), 1577\u0026ndash;1582.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUgbaja, R. N., Akinhanmi, T. F., James, A. S., Ugwor, E. I., Babalola, A. A., Ezenandu, E. O., Ugbaja, V. C., \u0026amp; Emmanuel, E. A. (2021). Flavonoid-rich fractions from Clerodendrum volubile and Vernonia amygdalina extenuates arsenic-invoked hepato-renal toxicity via augmentation of the antioxidant system in rats. \u003cem\u003eClinical Nutrition Open Science\u003c/em\u003e, \u003cem\u003e35\u003c/em\u003e, 12\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.nutos.2020.12.003\u003c/span\u003e\u003cspan address=\"10.1016/j.nutos.2020.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVilchis-Landeros, M. M., Matuz-Mares, D., \u0026amp; V\u0026aacute;zquez-Meza, H. (2020). Regulation of metabolic processes by hydrogen peroxide generated by NADPH oxidases. \u003cem\u003eProcesses\u003c/em\u003e, \u003cem\u003e8\u003c/em\u003e(11), 1424.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, C., Niu, Q., Ma, R., Song, G., Hu, Y., Xu, S., Li, Y., Wang, H., Li, S., \u0026amp; Ding, Y. (2019). The variable regulatory effect of arsenic on Nrf2 signaling pathway in mouse: a systematic review and meta-analysis. \u003cem\u003eBiological Trace Element Research\u003c/em\u003e, \u003cem\u003e190\u003c/em\u003e, 362\u0026ndash;383.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWehr, N. B., \u0026amp; Levine, R. L. (2013). Quantification of protein carbonylation. \u003cem\u003eCell Senescence: Methods and Protocols\u003c/em\u003e, 265\u0026ndash;281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO. (2022a). Chemical fact sheets: Arsenic. In WHO (Ed.), \u003cem\u003eGuidelines for drinking-water quality: fourth edition incorporating the first and second addenda\u003c/em\u003e (pp. 614). World Health Organisation.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO. (2022b). \u003cem\u003eGuidelines for drinking-water quality: incorporating the first and second addenda\u003c/em\u003e. World Health Organization.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, J., Su, X., Burley, S. K., \u0026amp; Zheng, X. S. (2022). Nuclear SOD1 in growth control, oxidative stress response, amyotrophic lateral sclerosis, and cancer. \u003cem\u003eAntioxidants\u003c/em\u003e, \u003cem\u003e11\u003c/em\u003e(2), 427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, M., Zinkgraf, M., Fitzgerald-Cook, C., Harrison, B. R., Putzier, A., Promislow, D. E. L., \u0026amp; Wang, A. M. (2023). Using Drosophila to identify naturally occurring genetic modifiers of amyloid beta 42- and tau-induced toxicity. \u003cem\u003eG3 Genes|Genomes|Genetics\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e(9). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/g3journal/jkad132\u003c/span\u003e\u003cspan address=\"10.1093/g3journal/jkad132\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, N., Xiao, W., Song, X., Wang, W., \u0026amp; Dong, X. (2020). Recent advances in tumor microenvironment hydrogen peroxide-responsive materials for cancer photodynamic therapy. \u003cem\u003eNano-Micro Letters\u003c/em\u003e, \u003cem\u003e12\u003c/em\u003e, 1\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang, X., \u0026amp; Wu, H. (2024). RAS signaling in carcinogenesis, cancer therapy and resistance mechanisms. \u003cem\u003eJournal of Hematology \u0026amp; Oncology\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(1), 108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13045-024-01631-9\u003c/span\u003e\u003cspan address=\"10.1186/s13045-024-01631-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZasu, A., Hishima, F., Thauvin, M., Yoneyama, Y., Kitani, Y., Hakuno, F., Volovitch, M., Takahashi, S.-I., Vriz, S., \u0026amp; Rampon, C. (2022). NADPH-Oxidase Derived Hydrogen Peroxide and Irs2b Facilitate Re-oxygenation-Induced Catch-Up Growth in Zebrafish Embryo. \u003cem\u003eFrontiers in Endocrinology\u003c/em\u003e, \u003cem\u003e13\u003c/em\u003e, 929668.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y., Murugesan, P., Huang, K., \u0026amp; Cai, H. (2020). NADPH oxidases and oxidase crosstalk in cardiovascular diseases: novel therapeutic targets. \u003cem\u003enature reviews cardiology\u003c/em\u003e, \u003cem\u003e17\u003c/em\u003e(3), 170\u0026ndash;194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41569-019-0260-8\u003c/span\u003e\u003cspan address=\"10.1038/s41569-019-0260-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Z., Zhang, S., Zhang, F., Zhang, Q., Wei, H., Xiu, R., Zhao, Y., \u0026amp; Sui, M. (2024). Clinical Indicators of Hepatotoxicity in Newly Diagnosed Acute Promyelocytic Leukemia Patients Undergoing Arsenic Trioxide Treatment. \u003cem\u003eBiological Trace Element Research\u003c/em\u003e, \u003cem\u003e202\u003c/em\u003e(1), 122\u0026ndash;132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12011-023-03676-2\u003c/span\u003e\u003cspan address=\"10.1007/s12011-023-03676-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, L. (2019). P53 and Apoptosis in the Drosophila Model. In W.-M. Deng (Ed.), \u003cem\u003eThe Drosophila Model in Cancer\u003c/em\u003e (pp. 105\u0026ndash;112). Springer International Publishing. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-23629-8_6\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-23629-8_6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou, X., Speer, R. M., Volk, L., Hudson, L. G., \u0026amp; Liu, K. J. (2021). Arsenic co-carcinogenesis: Inhibition of DNA repair and interaction with zinc finger proteins. Seminars in cancer biology,\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Arsenic toxicity, Drosophila melanogaster, oxidative stress, neurotoxicity, carcinogenesis, gene expression","lastPublishedDoi":"10.21203/rs.3.rs-6932906/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6932906/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eArsenic, a pervasive environmental toxin, is implicated in carcinogenesis, neurotoxicity, and metabolic disorders. This study investigates chronic sodium arsenite toxicity in Drosophila melanogaster, evaluating its impact on survival, oxidative stress, tissue integrity, and gene expression to model neurotoxicity and carcinogenesis. Flies were exposed to graded concentrations of sodium arsenite (0.03\u0026ndash;0.14 mM) over 21 days. We assessed survival rates, oxidative stress biomarkers, gene expression, and histological changes in key tissues including the brain, gastrointestinal tract, and fat body. Results revealed dose-dependent reductions in survival, elevated oxidative stress markers, and significant tissue damage. Notably, tumor-like growths and disrupted enterocyte architecture were observed, alongside altered expression of genes such as Ras, p53, SOD1, and CncC. These findings underscore the utility of Drosophila as a translational model for studying arsenic-induced pathologies and provide mechanistic insights into its role in disease development.\u003c/p\u003e","manuscriptTitle":"Modeling Chronic Arsenic Toxicity in Drosophila melanogaster: Insights into Oxidative Stress, Neurotoxicity, and Carcinogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-26 14:21:02","doi":"10.21203/rs.3.rs-6932906/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7a2c3dc8-59d7-4ba5-9a0d-ce6c29f86abb","owner":[],"postedDate":"June 26th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-05T08:25:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-26 14:21:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6932906","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6932906","identity":"rs-6932906","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.