Furin sustains tumor-promoting signals in KRAS- and BRAF-mutated colorectal cancer by engaging the TGF-β1–COX-2 axis in a reciprocal regulatory network

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-05 · read from full text

This preprint studies how the proprotein convertase Furin regulates tumor-promoting signaling in colorectal cancer models carrying KRAS or BRAF mutations, using KRAS-mutant and BRAF-mutant tumor-derived cells and organoids, mouse tumor models, and assays of angiogenesis and immune infiltration. Furin silencing or pharmacologic inhibition suppressed tumor growth, reduced angiogenesis, enhanced CD8+ T cell infiltration, and increased organoid sensitivity to chemotherapy, with mechanisms involving blockade of IGF-1 receptor signaling and TGF-β1 precursor maturation, decreased COX-2 expression, and disruption of multiple kinases linked to KRAS/BRAF pathways; the authors also identify a reciprocal feed-forward loop where COX-2 overexpression elevates TGF-β1 and increases Furin. A key limitation explicitly stated is that the work is a preprint and has not been peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 180,325 characters · extracted from preprint-html · click to expand
Furin sustains tumor-promoting signals in KRAS- and BRAF-mutated colorectal cancer by engaging the TGF-β1–COX-2 axis in a reciprocal regulatory network | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Furin sustains tumor-promoting signals in KRAS- and BRAF-mutated colorectal cancer by engaging the TGF-β1–COX-2 axis in a reciprocal regulatory network Abdel-Majid Khatib, Yiyang Liu, Geraldine Siegfried, Zongsheng He, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7633807/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract KRAS and BRAF mutations drive colorectal cancer (CRC) progression by sustaining aberrant signaling and promoting therapeutic resistance. Here, we identify TGF-β1-COX-2 axis as a critical regulatory pathway mediated by Furin in CRC harboring KRAS or BRAF mutation. Genetic silencing or pharmacological inhibition of Furin in KRAS-mutant (KPN) and BRAF-mutant (BPN) tumor-derived cells suppressed tumor growth, reduced angiogenesis, and enhanced CD8⁺ T cell infiltration in mouse tumor models. KRAS- and BRAF-mutant organoids with impaired Furin activity exhibited increased sensitivity to 5-FU, oxaliplatin, and irinotecan. Mechanistically, Furin inhibition via shRNA or the Furin inhibitor MI1148 blocked IGF-1 receptor and TGF-β1 precursor maturation and signaling, which was associated with repressed COX-2 expression. Conversely, COX-2 over-expression elevated TGF-β1 levels, which in turn enhanced Furin expression, establishing a feed-forward loop that promoted tumor progression and angiogenesis. Moreover, Furin inhibition largely disrupted the activity of multiple kinases linked to KRAS and BRAF oncogenic signaling. In CRC patient samples, Furin expression positively correlated with KRAS, BRAF, TGF-β1, and COX-2. Collectively, these findings identify Furin as a pivotal regulator of oncogenic signaling in KRAS- and BRAF-mutant CRC, and highlight the therapeutic potential of targeting the Furin-TGF-β1-COX-2 axis. Biological sciences/Cell biology Biological sciences/Cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Colorectal cancer (CRC) is one of the most prevalent malignancies of the digestive system and is the second leading cause of cancer-related mortality worldwide 1 . Although the exact etiology is not always clear, genetic factors, aging, and lifestyle significantly increase the risk of CRC development 2 . In recent years, experimental and clinical studies have revealed that multiple signaling (over) activation initiates or promotes the progression of CRC 3 – 5 , particularly the MAPK, PI3K, WNT, and COX-2 signaling pathways 3 , 6 . Pharmacological inhibition of these pathways has become a widely used approach to prolong overall survival of patients with CRC 6 . However, these inhibitory strategies are not always effective because of gene mutations in the related signaling pathways. For example, cetuximab, an antibody that targets epidermal growth factor receptor (EGFR), can slow CRC progression in the clinic by inhibiting EGFR-mediated activation of the MAPK and PI3K pathways 7 , 8 . Nonetheless, as with other therapies, the effectiveness of cetuximab is limited across different patient populations 9 . Resistance to treatment has been linked to the presence of KRAS and BRAF mutations in CRC 10 – 12 . Indeed, 40% of CRC tumors exhibit activating mutations in KRAS (e.g., G12D, G13D, and Q61H), leading to the continuous activation of KRAS 13 . This mutant KRAS functions as a molecular switch, persistently triggering downstream RAF/MEK/ERK and PI3K/AKT signaling, which promotes cell proliferation and survival, thereby contributing to tumorigenesis and resistance to therapy 14 , 15 . Although BRAF mutations are less common than KRAS mutations in CRC (occurring in approximately 8–12% of cases 16 ), these mutations, such as the classic V600E mutation, lead to more aggressive tumor behavior 17 , and BRAF mutations are often linked to poor responses to chemotherapy, shorter progression-free survival, and reduced overall survival 18 . Despite these insights, the development of effective targeted drugs for KRAS and BRAF mutations remains a significant challenge 10 , 19 , 20 . Therefore, understanding the molecular complexities of the progression of this CRC subtype is crucial for the development of more effective targeted therapies and personalized treatment strategies that can interfere with the KRAS and/or BRAF mutation activity in cancer cells. Furin, together with other members of the proprotein convertase (PC) family (PC1/3, PC2, PC4, PACE4, PC5/6, and PC7), cleaves proproteins with basic motifs, such as Arg-X-Lys/Arg-Arg 21 – 23 . Within this family, PC1/3, PC2, and PC4 exhibit tissue-specific distribution, whereas Furin is expressed in a broad range of cell lines and tissues. In a steady state, Furin predominantly localizes within the trans-Golgi network, where it engages in a dynamic cycling process involving the sorting compartment, cell surface, and early endosomes 24 . Owing to its ubiquitous expression, Furin has been suggested to cleave more than 100 substrates, ranging from growth factors and their receptors to adhesion molecules and extracellular matrix proteins, although only a few have been confirmed in vivo 21 , 25 – 27 . Many of these protein precursors are involved in initiating and sustaining cancer hallmarks 21 , 22 , 28 , suggesting that Furin is a promising target for therapeutic intervention in various human cancers 21 , 23 , 29 . Using mouse-derived KRAS-mutant colorectal cancer (CRC) cell lines and organoids (KPN: villinCre ER Kras G12D/+ ; Trp53 fl/fl ; Rosa26 N1icd/+ ) and BRAF-mutated CRC cell line and organoids (BPN: villinCre ER BRAF V600E/+ ; Trp53 fl/fl ; Rosa26 N1icd/+ ), we found that Furin repression enhanced the sensitivity of both KRAS - and BRAF-mutant CRC models to standard chemotherapeutic agents. In these CRC models, Furin regulates cyclooxygenase-2 (COX-2) expression through the proteolytic activation of TGF-β1 and its downstream signaling, both in vitro and in vivo. These findings suggest that targeting the Furin-TGF-β1-COX-2 interaction may represent a promising therapeutic strategy for KRAS- and/or BRAF-mutant colorectal cancer, potentially addressing a critical unmet need in this aggressive disease subtype. Materials and Methods Human tumor samples Samples from 25 colorectal cancer patients (both male and female) and adjacent normal regions were collected from frozen tissues. The specimens were clinically and histopathologically diagnosed at the Institut Bergonié, Bordeaux. The tissues acquired after resection were promptly placed on ice post-surgery and snap-frozen in liquid nitrogen for subsequent analysis. For human experiments, ethics approval was obtained from the Bergonié Institute, key projects [PV2024_071]). Patient consent forms were obtained for all samples at the time of tissue acquisition. The biopsies were de-identified. Plasmids and lentiviral transduction The plasmid encoding pLenti-shFurin was generated by amplifying the corresponding cDNA via PCR (shRNA-Furin; Sigma; 11042118MN; forward primer: CGCGAGTCTAGAATGGAGCTGAGGCCCTGG; reverse primer: CGAGTTGTCGACTCAGAGGGCGCTCTGGTC) and ligating the Xbal/Sal1-digested PCR product into Xbal/Sal1-restricted pLenti CMV GFP Puro (Addgene; 17448). The plasmid encoding pLenti-PTGS2 was generated by amplifying the corresponding cDNA via PCR (template: pcDNA3.1-hPTGS2-2flag; addgene;102498; forward primer: CGATGGGATCCACCATGCTCGCCCGCGCC; reverse primer: CGACTTGTCGACCTACAGTTCAGTCGAACGTTC), and the BamHI/Sal1-digested PCR product was ligated into the BamHI/Sal1-restricted pLenti CMV GFP Puro (Addgene;17448). The DH5α coli strain (Thermo Fisher Scientific) was used as the cloning and plasmid amplification host. All plasmids were validated using DNA sequencing (LGC Genomics, Berlin, Germany). To produce lentiviral particles, HEK-293T cells were incubated in DMEM/F12 medium and co-transfected with 1 µg/µL pLenti-shFurin/pLenti-COX-2 construct, 1 µg/µL p-VSVG construct (Addgene; 8454), or 1 µg/µL delta 8.91 (Addgene; 12247) with 7 µL XtremeGene9 transfection reagent (41106502, Sigma). The medium was aspirated after 6 h and replaced with fresh DMEM/F12 supplemented with 10% FCS. The supernatant was harvested after 48 h, centrifuged at 1000 × g at 4°C for 10 min, filtered through a 0.4 µm low protein-binding membrane (UFC905024, Millipore), and used to infect CRC cells in the presence of 8 mg/mL polybrene (107689, Sigma). The virus-containing media were removed 48 h after transduction, and the infected cells were selected with 2 µg/mL puromycin for 7 days (P7255, Sigma). Cell culture, organoid generation, and cell transfection The characteristics of the KRAS- and BRAF-mutated cancer mouse models, in which KPN cells harboring KRAS (G12D) and BPN cells carrying BRAF(V600E) were derived, have been described previously 30 . KRAS-mutant KPN cells were derived from a colon cancer mouse model with villinCre ER Kras G12D/+ ; Trp53 fl/fl ; Rosa26 N1icd/+ phenotype, and BRAF-mutant BPN cells from villinCre ER BRAF V600E/+ ; Trp53 fl/fl ; Rosa26 N1icd/+ mice. KPN and BPN cells were cultured in DMEM/F12 medium (21331, Gibco) supplemented with 10% fetal calf serum (P30-3306, Panbiotech) and 1% penicillin-streptomycin (15140122, Gibco). The cells were transfected with plasmids encoding full-length TGF-β1 using LIPO2000 (11668027, Thermo Fisher) according to the manufacturer’s instructions. After 48 h of transfection, the cells were harvested. To generate stable cell lines, KPN and BPN cells were transduced with GFP, shRNA-Furin, or COX-2 lentivirus particles and these cell lines were named as follows: GFP control (Control), shFurin-expressing (shFurin), COX-2-overexpressing (COX-2), and shFurin- and COX-2-coexpressing (shFurin/COX-2) cells. All cell lines were confirmed to be negative for mycoplasma by PCR. To generate organoids, 5000 cells were cultured in DMEM/F12 supplemented with N2 or B27 supplements (17502048; 17504044, Thermo Fisher), FGF (25 µg/mL, 100-18B-50, Sigma), EGF (10 µg/mL, AF-100-15, Sigma), or 0.4% sterile methylcellulose in a 96-well round-bottom plate that facilitated the production of homogeneous organoids. After culturing for five days, the surface area of each spheroid was measured using the Fiji Macro image program (Version X, National Institutes of Health, USA). To inhibit Furin activity, cells were seeded and treated with 10 µM 4-guanidinomethyl-phenylactyl-Arg-Tle-Arg-4-amidinobenzylamide (MI1148) 31 . To stimulate protein phosphorylation, cells were incubated with 100 ng/mL recombinant IGF1 (ab9573; Abcam) at the indicated time points. To increase TGF-β1 levels, the cells were incubated with 5 ng/mL recombinant TGF-β1 (P01137, Bio-Techne) at the indicated time points. To inhibit COX-2 expression, cells were incubated with 25 µM celecoxib (A0439955, Thermo Fisher) for 24 h. Cell viability and proliferation analysis Cell viability was determined using the WST-1 (11644807001, Roche) assay according to the manufacturer’s guidelines. Briefly, cells were counted and plated at a density of 5000 cells/well in 96-well plates. The WST-1 reagent (25 ng/mL) was added on days 1, 2, and 3, and the plates were incubated for 3.5 hours. The conversion of WST-1 to formazan was quantified at 450 nm using an enzyme-linked immunosorbent assay reader (Infinite 2000 PRO microplate reader, Tecan, Switzerland). Cell proliferation was evaluated by colony formation assay, as previously described 32 . Briefly, 10 3 cells were seeded and cultured for seven days. The colonies were fixed with methanol and stained with 1% crystal violet. Images were collected and counted using ImageJ software (ImageJ, National Institutes of Health, USA). Drug-induced cytotoxicity assay To assess drug-induced cytotoxicity, KPN and BPN derived organoids were treated with 5-FU (500 µM), Oxaliplatin (10 µM), Irinotecan (10 µM), or vehicle (DMSO) for 72 hours and were incubated with Ethidium Bromide (EB, 2 µg/mL; Thermo Fisher) in growth medium for 30 minutes at 37°C. Fluorescent images were captured using Echo Revolution, and EB fluorescence intensity was quantified using ImageJ (NIH). Cytotoxicity was assessed by calculating the average EB signal intensity per spheroid. RNA extraction and real-time PCR Total RNA was extracted from cultured cells using the NucleoSpin RNA Kit (Macherey Nagel), according to the manufacturer’s protocol. RNA was reverse transcribed using the high-capacity cDNA reverse transcription kit iScript cDNA synthesis kit (1708891, Bio-Rad) in a T100 Thermal Cycler (Bio-Rad). Real-time quantitative PCR was performed as previously described 27 using the primers indicated in Supplementary Table S1 , and data were collected using IQ SYBR Green Supermix reagent (1708882, Bio-Rad) on an Agilent AriaMx Real-Time PCR System. Each sample was normalized to the housekeeping gene GAPDH using the Livak‒Schmittgen method (2 − ∆∆CT ). Immunoblotting Sample preparation for immunoblotting was performed as described previously 28 , 32 . Cells and tumor tissues were lysed in RIPA buffer (89900, Sigma) supplemented with a protease inhibitor cocktail (11836170001, Roche) and a phosphatase inhibitor (05892970001, Roche). For tumor tissue preparation, 20 mg of frozen tumor tissue was extracted via homogenization in 480 µL of radioimmunoprecipitation assay (RIPA) buffer supplemented with protease and phosphate inhibitors. After 10 cycles of sonication, the supernatants were collected, and 4X sample buffer was added. Finally, the samples were boiled at 100°C for 10 min before loading. The bands were visualized with the enhanced chemiluminescence substrate SuperSignal (Thermo Fisher), and the images were processed using Image Quant LAS4000 or Odyssey (LI-COR Biosciences, Lincoln, NE, USA). GAPDH served as the loading control. Fluorescence microscopy For cell staining, cells were fixed with cold methanol for 5 min and permeabilized with 0.1% (v/v) Triton X-100 (9036, Sigma) prepared in phosphate-buffered saline (PBS). After blocking with 5% BSA (A788, Sigma) in PBS for 1 h, the cells were incubated with an Ki67 antibody diluted in blocking buffer at 4°C overnight and then conjugated with an Alexa Fluor 586-conjugated secondary antibody. For tissue staining, fresh tumor samples were fixed in 4% paraformaldehyde (sc-281692, Santa Cruz Biotechnology) overnight, washed with running water for 2 h, rehydrated with gradient ethanol, and then embedded in paraffin. Five micron-thick tissue sections were cut, and antigen retrieval (10 mM Tris, 1 mM EDTA, 0.05% Tween 20, pH 9) was performed in a 100°C water bath for 20 min. Following blocking with 5% BSA in PBS for 1 h, the sections were incubated with primary antibodies (Ki67, CST; CD8, Abcam; CD31, Bio-Techne) at 4°C overnight, and a secondary antibody conjugated with Alexa Fluor 488 or Alexa Fluor 647. The cells and tissue sections were stained with DAPI (D1306, Thermo Fisher) before imaging. CellSens Dimension software (version 2.1; Olympus) was used for image acquisition and analysis. Furin activity measurement Cells were seeded in 6-well plates and reached 50–70% confluence at the time of collection. The cell pellets were lysed using RIPA buffer, and 250 µM Furin peptide substrate pERTKR-AMC (ES013, biotechne) was added to the reaction buffer (50 mM Tris, 150 mM NaCl, and 0.2% (v/v) Triton X-100, pH 8.0). The mixtures were incubated at 37°C, and the fluorescence intensity (excitation wavelength: 360 nm; emission wavelength: 465 nm) was measured every 10 min using a spectrofluorometer (Tecan, Switzerland) as previously described 32 . Kinase activity analysis Control, shFurin, and MI1148-treated KPN cells were washed and lysed in M-PER lysis buffer (78501, Thermo Fisher) supplemented with protease and phosphatase inhibitors (87785, 78420, Thermo Fisher). After centrifugation, the supernatant was analyzed using a kinome analysis platform (PamGene® International, Netherlands), as previously described 33 . Statistical significance was tested using unpaired t-tests, and the results were represented by heatmaps, score plots, and volcano plots generated via BN63 (BN63; PamGene® International, the Netherlands). Peptides with a P value < 0.05 were considered significantly different in the degree of phosphorylation of a peptide in the two groups. In vivo tumorigenic assay Black6/J mice (male and female, 6–8 weeks old) were purchased from Jackson Laboratory. All mice were raised under specific pathogen-free conditions in a comfortable environment with a temperature of 20–22°C, humidity of approximately 60%, and a 12-h light–dark cycle. Mice were subcutaneously inoculated in the right flank with 5 × 10 6 control KPN and BPN cells and the same cells expressing shFurin (shFurin/KPN and shFurin/BPN cells). In other experiments, mice were subcutaneously injected with 5 × 10 6 control cells or the same cells expressing COX-2 alone or coexpressing shFurin and COX-2. The tumor size was recorded every 2 or 3 days, and the tumor volume was calculated as 0.5 × length × width × width. All animal experiments were conducted in accordance with the guidelines and approved by the Institutional Animal Care and Use Committee of the University of Bordeaux and complied with the protocol approved by the Ethics Committee under the supervision of a trained veterinarian. (Approval No. [APAFIS #51899-2024102315155381 v8]). Statistics Statistical analysis, as specified in the figure legends, was performed via one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test for multiple comparisons, and Student’s unpaired two-tailed t-test was used to compare two groups. Pearson’s coefficient was calculated to determine the correlation between normally distributed protein expression in human tumors. All statistical analyses were performed using GraphPad Prism 8.1 (GraphPad Software). All measurements were obtained from distinct samples. The indicated sample sizes (n) represent the biological replicates. Data are presented as the mean ± standard deviation (SDs). P < 0.05. Mice (of matched age), tumor samples, and cell line cultures were randomly allocated to the appropriate groups for the experiments. No data or mice were excluded from the analyses. Results Repression of Furin attenuates the malignant phenotype and enhances efficiency of chemotherapy in colorectal cancer cells with KRAS and BRAF mutations In colorectal cancer (CRC), activating mutations in KRAS and BRAF lead to the dysregulation of various signaling cascades, which drives cancer cell proliferation, differentiation, angiogenesis, and resistance to apoptosis and diminishes responsiveness to therapy. To investigate the role of Furin ( PCSK3 ) in KRAS- and BRAF-mutant CRC, we employed lentiviral shRNA targeting PCSK3 to suppress Furin expression in CRC cells derived from mice generated specifically to harbor each of these mutations. These include the KRAS-mutant KPN and BRAF-mutant BPN tumor cells 30 . As expected, Furin protein levels were significantly reduced by 4.6-fold in KPN cells and 3.4-fold in BPN cells stably expressing shRNA against PCSK3 (shFurin) ( Fig. 1 A, B ) . To assess the impact of Furin knockdown on enzymatic activity, we performed an in vitro fluorogenic assay using the peptide substrate pERTKR-MCA. Compared with those from the control cells, the lysates from Furin-deficient cells showed a significant reduction in substrate processing ( Fig. 1 C, D ) . Notably, treatment with the Furin inhibitor MI1148 further reduced Furin activity in both KPN and BPN cells, likely due to cross-reactivity with other proprotein convertases ( Fig. 1 C, D ) . Next, we evaluated the role of Furin in the malignant phenotype of colon cancer with KRAS or BRAF mutations, we first employed the WST-1 assay to evaluate the proliferation of control and shFurin-expressing cells. The growth of shFurin-expressing cells was significantly lower than that of control cells ( Fig. 1 E, I ) . Correspondingly, immunofluorescence analysis of the proliferation marker Ki-67 demonstrated markedly lower Ki-67 staining in both KPN- ( Fig. 1 F, G ) and BPN ( Fig. 1 J, K ) shFurin-expressing cells. Furthermore, treatment with the Furin inhibitor, MI1148, resulted in decreased proliferation of KPN ( Fig. 1 F ) and BPN ( Fig. 1 J ) cells, as evidenced by diminished Ki-67 staining. The inhibitory effect of MI1148 on cell growth was more pronounced than that of shFurin alone. Additionally, analysis via a colony formation assay revealed that the expression of shFurin in KPN ( Fig. 1 H ) and BPN ( Fig. 1 L ) cells significantly impaired their ability to form colonies, confirming the pivotal role of Furin in sustaining the tumorigenic potential of these colorectal cancer cells. We next investigated whether Furin depletion could also sensitize KRAS- and BRAF-mutant CRC cells to standard chemotherapeutic agents. Thereby, we established organoid cultures derived from KPN and BPN CRC cells, with or without stable Furin knockdown. Organoids were treated with 5-fluorouracil (5-FU), oxaliplatin, or irinotecan, and cytotoxicity was assessed by ethidium bromide (EB) staining, which marks cell death within the organoid core. As shown in Fig. 1 M-U, treatment with 5-FU alone induced moderate EB uptake in both KPN ( Fig. 1 M, N ) and BPN (Supplementary Fig. S1 A, B) organoids. However, Furin knockdown in combination with 5-FU led to a marked increase in EB signal intensity, indicating enhanced cell death and disruption of spheroid structural integrity, suggestive of increased tissue damage and compromised organoid architecture. A comparable effect was observed with oxaliplatin treatment at 10 µM in KPN organoids ( Fig. 1 Q, R ). Treatment with irinotecan (10 µM) mirrored the response observed with 5-FU, as both KPN and BPN organoids showed significantly increased sensitivity upon Furin silencing, evidenced by elevated EB staining and spheroid disintegration ( Fig. 1 O, P; Supplementary Fig. S1 C, D). In contrast, this sensitizing effect was absent in the BPN model, where Furin depletion did not potentiate oxaliplatin-induced cytotoxicity (Supplementary Fig. S1 E, F). Collectively, these findings suggest that Furin knockdown enhances the cytotoxic effects of several standard CRC chemotherapies in KRAS- and BRAF-mutant CRC. To explore the effect of Furin repression on tumor growth in vivo , control and shFurin-expressing KPN and BPN cells were inoculated into syngeneic Black6/J mice. As shown in Fig. 2 A, F, and consistent with the in vitro results, the expression of shFurin in KPN and BPN cells significantly reduced their ability to mediate tumor growth. Accordingly, immunostaining analysis of tumor sections derived from control, shFurin-expressing KPN ( Fig. 2 B, C ) and BPN ( Fig. 2 G, H ) cells revealed fewer Ki-67-positive cells. Given the role of KRAS signaling in tumor cells, which affects the tumor microenvironment and reduces the function of tumor-infiltrating T cells via a range of mechanisms 34 – 36 , we analyzed the infiltration of CD8 + T cells in control and shFurin-treated mice tumors and found an increase in CD8 + T cells in shFurin KPN ( Fig. 2 D, E ) and BPN ( Fig. 2 I, J) tumors. These findings suggest that Furin inhibition may not only impair tumor cell proliferation, but also enhance the recruitment or activation of cytotoxic T lymphocytes, contributing to the reduction in KRAS- and BRAF-mediated immune evasion and tumor growth. Expression of Furin and other proprotein convertases correlates with KRAS and BRAF mutations in CRC patients Analysis of the expression of all proprotein convertase family members, namely PCSK1, PCSK2, PCSK3, PCSK4, PCSK5, PCSK6, PCSK7, PCSK8, and PCSK9, in public datasets, including The Cancer Genome Atlas (TCGA) and the GEPIA web server ( http://gepia.cancer-pku.cn/ ), revealed that although the expression of several PCs positively correlated with wild-type KRAS or BRAF, only PCSK3 (Furin gene) showed significantly higher expression in tumors harboring KRAS / BRAF mutations compared with wild-type cases ( Fig. 2 M, Supplementary Fig. S2 ). In parallel, immunohistochemical staining of normal human colon tissue and primary colon tumors with BRAF and KRAS mutations revealed Furin expression in the colon crypts. In cancerous tissues, the loss of crypts was associated with an altered Furin expression pattern, with strong expression observed in all analyzed tumor samples ( Fig. 2 N ) . These findings further support a potential role for Furin in colorectal cancer progression associated with KRAS and/or BRAF mutations. Furin inhibition impairs basal and induced multiple signaling pathways associated with KRAS and BRAF oncogenic activity. The RAF/MEK/ERK and PI3K/AKT signaling pathways are commonly activated in association with KRAS and/or BRAF mutations 7 , 8 . To investigate whether Furin repression interferes with these oncogenic signaling cascades potentially by impairing the processing of proprotein convertase (PC) substrates, we focused on the PC substrate IGF-1 receptor (IGF-1R) pathway. We first examined the effect of Furin knockdown on ERK and AKT pathway activation downstream of IGF-1R signaling. To this end, we analyzed the impact of shFurin on IGF-1 receptor cleavage in KPN ( Fig. 3 A, B ) and BPN (Supplementary Fig. S3A, B) cells. Immunoblot analysis of pro-IGF-1R revealed a marked reduction in its conversion into the mature IGF-1R form, as evidenced by the accumulation of a higher-molecular-weight precursor in Furin-knockdown KPN ( Fig. 3 A, B ) and BPN (Fig. Supplementary Fig. S3A, B) cells. This form displayed a characteristic doublet pattern on immunoblots, suggesting the modification of N-linked glycans into complex sugars within late Golgi compartments 28 . We next analyzed ERK and AKT phosphorylation in KPN and BPN cells under both basal and stimulated conditions following IGF-1 activation (100 ng/mL). In cells stably expressing shFurin, we observed a significant reduction in basal ERK and AKT phosphorylation ( Fig. 3 C-H ) . In control KPN and BPN cells, IGF-1 stimulation increased ERK (Fig. 3 C, D ) and (Supplementary Fig. S3C, D) and AKT (Fig. 3 E, F ) and (Supplementary Fig. S3E, F) phosphorylation levels. However, IGF-1-induced activation of ERK and AKT was markedly diminished in shFurin-expressing KPN and BPN cells, indicating that Furin suppression impairs IGF-1-mediated signaling. This effect correlated with a reduction in pro-IGF-1R cleavage, as demonstrated by immunoblotting analysis ( Fig. 3 G, H ) and (Supplementary Fig. S3G, H) , confirming the inhibition of Furin activity in these shFurin cells. Collectively, these findings demonstrate that Furin repression disrupts both basal and stimulated ERK and AKT activation in KRAS- and BRAF-mutant CRC cells. To further investigate the impact of Furin repression on basal and stimulated downstream signaling, we performed a comprehensive screening of kinase activity in KRAS-mutated cells using PamGene technology ( Fig. 4 A-J ) . Substantial differences in basal kinase activity profiles were observed between control and shFurin cells ( Fig. 4 A-D ) . Furin repression markedly downregulated 114 protein tyrosine kinases (PTKs) and 63 serine/threonine kinases (STKs). Only 11 PTK and 10 STK proteins were upregulated ( Fig. 4 A-D, Supplementary Table S2 ) . The most affected PTKs included several SRC family members (LYN, LCK, SRC, FRK, FYN, SRMS, BLK and YES1), Met (MST1R, MET), TEC (TEC, BMX) and AXL (MERTK), whereas the significantly impacted STKs included CAMK4, PKA (PRKACA, PRKACB, PRKX), PKC (PKRCA), and PKG (PRKG1-2) ( Fig. 4 D, Supplementary Table S2 , Supplementary Fig. S4A). Upon stimulation with IGF-1 (100 ng/mL), the control cells showed increased phosphorylation of 111 PTKs and 43 STKs ( Fig. 4 A, B, E, F; Supplementary Table S2 ; Supplementary Fig. S4B) . The most enriched PTKs included the families VEGFR (KDR, FLT4), SRC (FYN, BLK, FRK, LCK, HCK, and SRMS), GSK3B, ROR1, and RYK. The main upregulated STKs were MAPK family members (MAPK11, MAPK12, MAPK1, MAPK3, and MPK7), AKT (AKT1 and AKT2), CDKs (CDK18, CDK 17, and CDK 5), CDKL2, and DYRK1A. In contrast, shFurin cells displayed increased activity of only 3 PTKs (FGFR1, FGFR2, and FGFR3) and 30 STKs ( Fig. 4 G, H; Supplementary Table S3; Supplementary Fig. S4C) . Among the key STKs activated by IGF-1 in shFurin were several PKs, PKAs, and PKG family members ( Fig. 4 G, H; Supplementary Table S3; & S4, Supplementary Fig. S4C) . No MAPK or AKT family members were found to be activated. When non-stimulated and IGF-1-activated cells (control and shFurin KRAS-mutated cells) were compared, dramatic differences in PTK- and STK-activated kinases were also observed (Fig. 4 I, J, Supplementary Table S3, Supplementary Fig. S4D) . These findings highlight the key role of Furin in both basal and stimulated PTK and STK kinases in KRAS-mutated cells. To elucidate the broader impact of Furin suppression on oncogenic signaling, we analyzed mean kinase statistics and scores for branches and nodes in the phylogenetic tree of the human protein kinase family (Supplementary Fig. S6A) . The top upstream kinases among the significantly altered PTK/STK peptides following Furin silencing in the absence or presence of IGF-1, they were mapped to distinct kinase families, including tyrosine kinases (TKs), AGC kinases, and CAMK kinases (Supplementary Fig. S5, Supplementary Fig. S6, Supplementary Table S4) . Collectively, these findings suggest that Furin repression disrupts multiple oncogenic signaling pathways under both basal (Supplementary Fig. S5B) and stimulated (Supplementary Fig. S 5C) conditions in KRAS-mutated cells, highlighting its role in kinase network modulation. These finding suggest that Furin repression in these cells affect the signaling of various KRAS-associated signaling pathways ( Fig. 4 K ). Regulation of COX-2 (cyclooxygenase-2) expression by Furin in colorectal cancer with KRAS and BRAF mutations We previously reported that Furin inhibition leads to a reduction in COX-2 protein levels in HCT116 and KM20 cells, which harbor KRAS and BRAF mutations, respectively, whereas this effect was not observed in HCA7 cells that lack these mutations 28 . To further investigate the role of Furin in regulating COX-2 expression in colorectal cancer (CRC) with KRAS and BRAF mutations, we first analyzed the expression of PTGS2 (COX-2) and its associated receptors in KPN and BPN cells, as well as in their respective Furin-silenced counterparts (KPN/shFurin and BPN/shFurin). Furin repression led to a significant reduction in COX-2 expression in both KPN ( Fig. 5 A ) and BPN (Supplementary Fig. S7A) cells. Consistently, tumors derived from mice injected with KPN/shFurin or BPN/shFurin cells also showed decreased COX-2 expression ( Fig. 5 B, C; Supplementary Fig. S7B, C) . In parallel, the expression of PTGES (prostaglandin E synthase) and prostaglandin E receptors (PTGER1, PTGER3, and PTGER4) was significantly downregulated in both Furin-silenced cell lines and corresponding induced tumor tissues ( Fig. 5 A; Supplementary Fig. S7A) , further supporting Furin’s involvement in the COX-2 regulatory network in CRC. Using publicly available datasets from GEPIA, we observed a weak but statistically significant correlation between FURIN and PTGS2 expression in CRC patient samples ( Fig. 5 D ) . Additionally, the expression levels of PTGER1 ( Fig. 5 E ) , PTGER3 ( Fig. 5 F ) , PTGER4 ( Fig. 5 G ) , and PTGES ( Fig. 5 H ) all showed moderate but significant positive correlations with FURIN. These results reinforce a potential role for Furin in modulating the COX-2 signaling axis in KRAS - and BRAF-mutant CRC. Furin repression abrogates COX-2-mediated tumor growth and angiogenesis induced by colorectal cancer with KRAS and BRAF mutations To investigate the role of Furin in COX-2–mediated growth of cancer cells harboring KRAS and BRAF mutations, we stably overexpressed COX-2 in KPN and BPN cell lines (COX-2 cells) as well as in their corresponding shFurin cells (shFurin/COX-2). As shown in Fig. 5 I and Fig. 5 J, COX-2 overexpression significantly enhanced cell proliferation in both control and shFurin-expressing cells, as measured by the WST-1 assay. This increase in proliferation was less pronounced in KPN/shFurin ( Fig. 5 I ) and BPN/shFurin ( Fig. 5 J ) cells. Colony formation assays revealed that COX-2 overexpression increased the number of colonies in both control and shFurin-expressing cells; however, colony numbers remained lower in shFurin cells compared with controls ( Fig. 5 K; Fig. Supplementary Fig. S7D, E) . Consistent with these observations, organoids derived from KPN ( Fig. 5 L, M ) and BPN (Supplementary Fig. S7F, G) COX-2-expressing cells were larger than controls, whereas shFurin organoids were smaller than their respective controls (Fig. 5 L, M; Supplementary Fig. S7F, G). Injection of COX-2-expressing colon cancer cells into mice showed that control/COX-2 cells induced a marked increase in tumor growth ( Fig. 5 O ) . In contrast, this growth enhancement was attenuated in mice injected with shFurin/COX-2 cells, supporting the notion that Furin repression limits COX-2–mediated tumorigenesis. Previous studies have shown that COX-2 promotes tumor growth by inducing angiogenesis within the tumor microenvironment (Wang & Dubois, 2010). To assess the impact of Furin on COX-2–mediated angiogenesis, we analyzed vessel density in tumors via CD31 immunostaining. Tumors derived from shFurin cells exhibited reduced CD31 expression compared with control tumors ( Fig. 5 P, Q ) . COX-2 expression in both control and shFurin tumors was associated with enhanced angiogenesis, reflected by high vessel density in COX-2–expressing tumors. However, angiogenesis was significantly less pronounced in shFurin/COX-2 tumors, indicating that Furin repression markedly impairs COX-2-mediated angiogenic processes ( Fig. 5 P, Q ) . These results demonstrate that Furin repression suppresses COX-2-mediated tumor growth by limiting COX-2 expression and angiogenic processes in the tumor microenvironment. TGF-β1 activation by Furin enhances COX-2 levels in KRAS- and BRAF-mutant CRC To further investigate the mechanisms linking Furin to COX-2 repression in shFurin cells, we first analyzed the effect of TGF-β1 processing on COX-2 expression. Indeed, TGF-β1 has previously been shown to be processed by Furin 37 and to mediate COX-2 expression in colon cancer cells 38 . As shown in Fig. 6 A-D, stimulation of control KPN and BPN cells with exogenous TGF-β1 (5 ng/ml) significantly induced COX-2 expression at the protein level, as assessed by immunoblotting analysis. Additionally, the expression of proTGF-β1 cDNA in control KPN and BPN cells also induced COX-2 expression ( Fig. 6 E-H ) , with proTGF-β1 being efficiently converted into TGF-β1 in these cells. In contrast, the expression of proTGF-β1 cDNA in KPN and BPN shFurin cells did not significantly increase COX-2 expression compared to that in control cells ( Fig. 6 E-H ) , suggesting the critical importance of TGF-β1 processing by Furin for its functional activity in regulating COX-2 expression. COX-2 mediates TGF-β1 activation and Furin production in KPN and BPN cells TGF-β1 has been previously shown to induce Furin expression via Smad2/3 phosphorylation, thereby promoting the activation and processing of other Furin-dependent proteins 39 . Similarly, treatment of KPN and BPN cells with recombinant TGF-β1 (5 ng/ml) significantly upregulated Furin expression ( Fig. 6 I-L ) . Conversely, Furin repression in KPN and BPN shFurin cells led to a marked reduction in TGF-β1 expression ( Fig. 6 M, N ) , highlighting a positive feedback loop between Furin and the processed TGF-β1. Using the web server GEPIA ( http://gepia.cancer-pku.cn/ ), we identified a positive correlation between TGF-β1 and Furin (R = 0.36) as well as between TGF-β1 and the COX-2 gene (PTGS2) (R = 0.34) in patients with colorectal tumors (Fig. 6 O, P ) . Collectively, these results indicate that COX-2 accumulation in CRC cells with KRAS and BRAF mutations is directly linked to TGF-β1 cleavage by Furin. To explore whether COX-2 modulates TGF-β1 levels, we first assessed basal TGF-β1 expression in control and shFurin cells, and observed a notable reduction in shFurin cells ( Fig. 6 Q-V ) . Overexpression of COX-2 in control KPN ( Fig. 6 Q, R, S ) and BPN ( Fig. 6 T, U, V ) cells significantly increased TGF-β1 levels, whereas this effect was less pronounced in the corresponding shFurin cells. Next, we examined the effect of COX-2 inhibition using celecoxib, a selective COX-2 inhibitor known to suppress inflammation and tumor progression by blocking the production of proinflammatory prostaglandins 40 . Treatment of KPN and BPN cells with celecoxib led to a significant reduction in COX-2 levels ( Fig. 7 A, B ) , which was accompanied by a decreased expression of TGF-β1 ( Fig. 7 A, C ) and phosphorylated Smad2 ( Fig. 7 A, D ). Notably, Furin expression was also reduced by celecoxib treatment ( Fig. 7 A, E ) . Moreover, combined treatment with celecoxib and the Furin inhibitor MI-1148 resulted in more pronounced suppression of COX-2, TGF-β1, and Furin expression ( Fig. 7 A-E ) . These findings revealed a regulatory axis in which COX-2 enhances TGF-β1 activation and Furin expression. Furin and COX-2 interaction in KRAS - and BRAF - mutant mice colorectal tumors To assess the relevance of the Furin and COX-2 interaction in vivo , we injected control KPN, shFurin, COX-2, and shFurin/COX-2 cells into syngeneic mice and monitored the tumor growth over time. As shown in Fig. 7 F, tumors derived from shFurin cells exhibited significantly reduced growth compared to control tumors. This reduction in tumor size was associated with decreased TGF-β1 ( Fig. 7 G, H, Supplementary Fig. S8) and reduced Smad2 activation ( Fig. 7 G, I ). Conversely, tumors derived from COX-2-overexpressing cells exhibited increased tumor growth accompanied by increased TGF-β1 expression ( Fig. 7 G, H ) and Smad2 activation ( Fig. 7 G, I ). Interestingly, tumors derived from shFurin/COX-2 cells showed reduced TGF-β1 expression ( Fig. 7 G, H ) and Smad2 activation ( Fig. 7 G, I ) compared to COX-2 tumors, suggesting that Furin repression dampens COX-2-mediated upregulation of TGF-β1 expression and signaling. These findings further support the role of Furin in regulating COX-2-driven tumor progression and highlight the potential therapeutic benefit of targeting Furin and COX2 interaction in colorectal cancer ( Fig. 8 ) . Discussion An improved understanding of the molecular pathogenesis of mutant BRAF- and KRAS-driven CRCs will inform the development of effective preventative and therapeutic strategies for this aggressive CRC subset. When KRAS is mutated, the downstream signaling pathway MAPK is activated, leading to cellular proliferation and tumor progression. KRAS mutations are predictive markers of colon cancer 41 and resistance to therapy 42 . Similarly, as BRAF is downstream of RAS in the MAPK/ERK signaling pathway, mutated BRAF is assumed to have the same resistance to therapeutic agents, such as anti-EGFR agents, as in RAS-mutated colon tumors 43 . Here, we revealed that Furin repression in cancer cells with KRAS or BRAF mutations, shows low resistance to standard CRC chemotherapy such as 5-FU, Oxaliplatin and/or irinotecan. The study also describes the involvement of the Furin and COX2 interaction through TGF-b1 cleavage in oncogenic BRAF and KRAS mutations that promote tumor progression. Indeed, targeting Furin and its downstream effector COX-2 profoundly disrupted the malignant phenotype of KRAS- and BRAF-mutated CRC cell lines (KPN and BPN). These models, which recapitulate the adenoma-to-metastasis transition 30 , enabled us to elucidate the functional role of Furin in KRAS/BRAF-driven CRC progression. In this CRC, Furin controls COX-2 expression via TGF-β1/Smad signaling and probably other signaling pathways, establishing a positive feedback loop that sustains tumor progression. Furin facilitates the proteolytic activation of TGF-β1, which in turn enhances Smad-mediated COX-2 transcription, reinforcing TGF-β1 expression and further increasing Furin levels. This reciprocal regulation highlights the clinical relevance of the Furin/TGF-β1/COX-2 axis in colorectal cancer, particularly in tumors harboring KRAS or BRAF mutations. By linking oncogenic signaling with pathways involved in angiogenesis and immune modulation, this axis appears to contribute to tumor progression and resistance to therapy. Importantly, analysis of colorectal cancer patient datasets revealed strong co-expression of FURIN, KRAS, BRAF, COX-2, and TGF-β1, further supporting its significance in the clinical setting. Using shRNA-mediated Furin silencing, we repressed multiple signaling pathways linked to KRAS and BRAF oncogenic activity, not only at basal levels but also in response to Furin substrate IGF-1R activation, which is known to stimulate PI3K/MAPK signaling pathways 28 , 44 . This effect is associated with impaired IGF-1 receptor processing. Furthermore, Furin inhibition markedly reduced cell proliferation, colony formation, and tumorigenic potential both in vitro and in vivo . COX-2 overexpression partially rescued the inhibitory effects of Furin silencing and further exacerbated the malignant phenotype of control cells, highlighting its role as a critical downstream effector of Furin in driving tumorigenic properties. Previously, the association between COX-2 expression and colorectal cancer mortality was reported to be stronger in BRAF-mutated tumors than in BRAF-wild-type tumors, supporting the interactive roles of COX-2 expression and BRAF mutation status in the prognostication of patients with colorectal cancer 45 . Similarly, the overexpression of activated RAS isoforms was reported to stimulate COX-2 expression 38 , 46 , and both the presence of mutant KRAS and high-level COX-2 expression were correlated with tumor recurrence after surgery, with metastatic spread to the liver and reduced survival 47 , 48 . Low COX-2 expression has been previously associated with improved survival in patients with colorectal adenocarcinoma harboring KRAS or BRAF mutations, but not in those with wild-type KRAS or BRAF 49 . Suppression of mutant KRAS expression in colon and pancreatic cancer cells was reported to reduce COX-2 levels, suggesting a role for mutant KRAS in modulating prostaglandin accumulation by increasing its biosynthesis and/or attenuating catabolism 49 . Our study advances this understanding by revealing a regulatory axis in which Furin controls TGF-β1 signaling and, in turn, modulates COX-2 expression in BRAF- and KRAS-mutant colon tumors. TGF-β1 plays dual roles in CRC as both a tumor suppressor and a tumor promoter depending on disease progression in advanced stages, particularly in KRAS/BRAF-mutated contexts, and drives epithelial‒mesenchymal transition (EMT), metastasis, and immune evasion 38 . Our findings reveal that Furin regulates COX-2 expression via the TGF-β1/Smad pathway, forming a self-reinforcing feedback loop in which COX-2 amplifies TGF-β1 signaling and further enhances Furin expression. This circuit emerges as a potential critical driver of tumor progression in KRAS/BRAF-mutant CRC, as evidenced by the significantly reduced tumor growth observed in mice upon Furin silencing. In addition, tumors derived from KRAS- and BRAF-mutant cancer cells expressing shRNA targeting Furin exhibited a marked increase in CD8 + T cell infiltration, highlighting a potential immunomodulatory role for this pathway. This observation aligns with previous studies showing that Furin inhibition enhances the presence of CD8 + T cells in the tumor microenvironment, possibly through the regulation of immune checkpoints, such as PD-1 expression in T cells 50 . Together, these findings suggest that targeting the Furin in CRC with KRAS or BRAF mutations may offer dual therapeutic advantages: directly suppressing tumor growth by disrupting oncogenic signaling and reshaping the immune microenvironment to enhance antitumor immunity. Although COX-2 has long been implicated in inflammation-driven tumorigenesis, our findings demonstrate that its integration within the TGF-β1 signaling network is more complex and functionally significant than previously understood 51 . Targeting multiple components of this pathway simultaneously could counteract compensatory mechanisms and improve the therapeutic efficacy. For example, combining Furin and COX-2 inhibitors with novel KRAS G12D inhibitors such as MRTX1133 52,53 may enhance treatment responses by disrupting complementary oncogenic pathways. Notably, therapies targeting KRAS G12D face challenges because of their non-covalent nature, which may result in reversible binding and reduced potency 54 . Integrating these agents with inhibitors of the Furin could provide a more robust therapeutic strategy by simultaneously targeting multiple tumor-promoting pathways. This multibranched approach has the potential to overcome resistance mechanisms frequently observed with single-agent therapies, ultimately improving outcomes in patients with KRAS/BRAF-mutated CRC. Thereby, our findings establish the Furin/TGF-β1/COX-2 axis as a key driver of CRC progression, particularly in KRAS- and BRAF-mutated contexts. This regulatory network represents a promising therapeutic target, offering new opportunities to overcome the limitations of conventional treatment strategies for CRC and advancing precision medicine for patients with KRAS and BRAF mutations. Declarations Acknowledgments This work was supported by the Regional Nouvelle Aquitaine, Foundation Bergonié, and La Ligue Contre le Cancer. Author contributions YL performed the experiments, including data curation, analysis, and validation, and wrote the original draft. GS contributed to investigation and methodology. ZH performed bioinformatics and software analyses. ST contributed to investigation and methodological support. TS provided methodological expertise. JC and AMK conceived and designed the research, acquired funding and resources, curated and analyzed data, supervised the study, and revised the manuscript. Competing Interests: The authors declare that they have no conflict of interest. Data availability Correlation analysis of Furin, KRAS, BRAF, COX-2, PTGER1, PTGER3, PTGER4, PTGES, and TGF-β1 expression was conducted via the Gene Expression Profiling Interactive Analysis (GEPIA) platform (http://gepia.cancer-pku.cn/). Patients with KRAS and BRAF mutations were selected from the TCGA database. References Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024; 74 : 229–263. Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet 2019; 394 : 1467–1480. Li Q, Geng S, Luo H, Wang W, Mo Y-Q, Luo Q et al. Signaling pathways involved in colorectal cancer: pathogenesis and targeted therapy. Sig Transduct Target Ther 2024; 9 : 1–48. Stefani C, Miricescu D, Stanescu-Spinu I-I, Nica RI, Greabu M, Totan AR et al. Growth Factors, PI3K/AKT/mTOR and MAPK Signaling Pathways in Colorectal Cancer Pathogenesis: Where Are We Now? Int J Mol Sci 2021; 22 : 10260. Guo L, Wang Y, Yang W, Wang C, Guo T, Yang J et al. Molecular Profiling Provides Clinical Insights Into Targeted and Immunotherapies as Well as Colorectal Cancer Prognosis. Gastroenterology 2023; 165 : 414-428.e7. Xie Y-H, Chen Y-X, Fang J-Y. Comprehensive review of targeted therapy for colorectal cancer. Sig Transduct Target Ther 2020; 5 : 1–30. Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC et al. Oncogenic Signaling Pathways in The Cancer Genome Atlas. Cell 2018; 173 : 321-337.e10. Gaiani F, Marchesi F, Negri F, Greco L, Malesci A, de’Angelis GL et al. Heterogeneity of Colorectal Cancer Progression: Molecular Gas and Brakes. Int J Mol Sci 2021; 22 : 5246. Santini D, Vincenzi B, Addeo R, Garufi C, Masi G, Scartozzi M et al. Cetuximab rechallenge in metastatic colorectal cancer patients: how to come away from acquired resistance? Ann Oncol 2012; 23 : 2313–2318. Misale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D et al. Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. Nature 2012; 486 : 532–536. De Roock W, Claes B, Bernasconi D, De Schutter J, Biesmans B, Fountzilas G et al. Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol 2010; 11 : 753–762. Zhi J, Jia X-J, Yan J, Wang H-C, Feng B, Xing H-Y et al. BRAFV600E mutant colorectal cancer cells mediate local immunosuppressive microenvironment through exosomal long noncoding RNAs. World J Gastrointest Oncol 2021; 13 : 2129–2148. Ye J, Lin M, Zhang C, Zhu X, Li S, Liu H et al. Tissue gene mutation profiles in patients with colorectal cancer and their clinical implications. Biomed Rep 2020; 13 : 43–48. Simanshu DK, Morrison DK. A Structure is Worth a Thousand Words: New Insights for RAS and RAF Regulation. Cancer Discov 2022; 12 : 899–912. Drosten M, Barbacid M. Targeting the MAPK Pathway in KRAS-Driven Tumors. Cancer Cell 2020; 37 : 543–550. Pai RK, Jayachandran P, Koong AC, Chang DT, Kwok S, Ma L et al. BRAF-mutated, microsatellite-stable adenocarcinoma of the proximal colon: an aggressive adenocarcinoma with poor survival, mucinous differentiation, and adverse morphologic features. Am J Surg Pathol 2012; 36 : 744–752. Roa P, Bremer NV, Foglizzo V, Cocco E. Mutations in the Serine/Threonine Kinase BRAF: Oncogenic Drivers in Solid Tumors. Cancers 2024; 16 : 1215. De Roock W, De Vriendt V, Normanno N, Ciardiello F, Tejpar S. KRAS, BRAF, PIK3CA, and PTEN mutations: implications for targeted therapies in metastatic colorectal cancer. Lancet Oncol 2011; 12 : 594–603. van Grieken NCT, Aoyma T, Chambers PA, Bottomley D, Ward LC, Inam I et al. KRAS and BRAF mutations are rare and related to DNA mismatch repair deficiency in gastric cancer from the East and the West: Results from a large international multicentre study. Br J Cancer 2013; 108 : 1495–1501. Haling JR, Sudhamsu J, Yen I, Sideris S, Sandoval W, Phung W et al. Structure of the BRAF-MEK Complex Reveals a Kinase Activity Independent Role for BRAF in MAPK Signaling. Cancer Cell 2014; 26 : 402–413. He Z, Khatib A-M, Creemers JWM. The proprotein convertase furin in cancer: more than an oncogene. Oncogene 2022; 41 : 1252–1262. Siegfried G, Descarpentrie J, Evrard S, Khatib A-M. Proprotein convertases: Key players in inflammation-related malignancies and metastasis. Cancer Lett 2020; 473 : 50–61. Ng S, A P. The biology and therapeutic targeting of the proprotein convertases. Nature reviews Drug discovery 2012; 11 . doi:10.1038/nrd3699. Teuchert M, Schäfer W, Berghöfer S, Hoflack B, Klenk HD, Garten W. Sorting of furin at the trans-Golgi network. Interaction of the cytoplasmic tail sorting signals with AP-1 Golgi-specific assembly proteins. J Biol Chem 1999; 274 : 8199–8207. Braun E, Sauter D. Furin-mediated protein processing in infectious diseases and cancer. Clinical & Translational Immunology 2019; 8 : e1073. Thomas G. Furin at the cutting edge: From protein traffic to embryogenesis and disease. Nat Rev Mol Cell Biol 2002; 3 : 753–766. Tomé M, Pappalardo A, Soulet F, López JJ, Olaizola J, Leger Y et al. Inactivation of Proprotein Convertases in T Cells Inhibits PD-1 Expression and Creates a Favorable Immune Microenvironment in Colorectal Cancer. Cancer Res 2019; 79 : 5008–5021. He Z, Thorrez L, Siegfried G, Meulemans S, Evrard S, Tejpar S et al. The proprotein convertase furin is a pro-oncogenic driver in KRAS and BRAF driven colorectal cancer. Oncogene 2020; 39 : 3571–3587. Jaaks P, Bernasconi M. The proprotein convertase furin in tumour progression. Int J Cancer 2017; 141 : 654–663. Jackstadt R, Hooff SR van, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA et al. Epithelial NOTCH Signaling Rewires the Tumor Microenvironment of Colorectal Cancer to Drive Poor-Prognosis Subtypes and Metastasis. Cancer Cell 2019; 36 : 319-336.e7. Ivanova T, Hardes K, Kallis S, Dahms SO, Than ME, Künzel S et al. Optimization of Substrate-Analogue Furin Inhibitors. ChemMedChem 2017; 12 : 1953–1968. Scamuffa N, Sfaxi F, Ma J, Lalou C, Seidah N, Calvo F et al. Prodomain of the proprotein convertase subtilisin/kexin Furin (ppFurin) protects from tumor progression and metastasis. Carcinogenesis 2014; 35 : 528–536. Demoures B, Soulet F, Descarpentrie J, Galeano-Otero I, Sanchez Collado J, Casado M et al. Repression of apelin Furin cleavage sites provides antimetastatic strategy in colorectal cancer. EMBO Mol Med 2025. doi:10.1038/s44321-025-00196-5. Zdanov S, Mandapathil M, Abu Eid R, Adamson-Fadeyi S, Wilson W, Qian J et al. Mutant KRAS Conversion of Conventional T Cells into Regulatory T Cells. Cancer Immunol Res 2016; 4 : 354–365. Massagué J, Sheppard D. TGF-β signaling in health and disease. Cell 2023; 186 : 4007–4037. Coelho MA, de Carné Trécesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M et al. Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Immunity 2017; 47 : 1083-1099.e6. Dubois CM, Blanchette F, Laprise MH, Leduc R, Grondin F, Seidah NG. Evidence that furin is an authentic transforming growth factor-beta1-converting enzyme. Am J Pathol 2001; 158 : 305–316. de Araújo WM, Tanaka MN, Lima PHS, de Moraes CF, Leve F, Bastos LG et al. TGF-β acts as a dual regulator of COX-2/PGE2 tumor promotion depending of its cross-interaction with H-Ras and Wnt/β-catenin pathways in colorectal cancer cells. Cell Biol Int 2021; 45 : 662–673. Blanchette F, Rudd P, Grondin F, Attisano L, Dubois CM. Involvement of Smads in TGFbeta1-induced furin (fur) transcription. J Cell Physiol 2001; 188 : 264–273. Koki AT, Masferrer JL. Celecoxib: A Specific COX-2 Inhibitor with Anticancer Properties. Cancer Control 2002; 9 : 28–35. Arrington AK, Heinrich EL, Lee W, Duldulao M, Patel S, Sanchez J et al. Prognostic and predictive roles of KRAS mutation in colorectal cancer. Int J Mol Sci 2012; 13 : 12153–12168. Siddiqui AD, Piperdi B. KRAS mutation in colon cancer: a marker of resistance to EGFR-I therapy. Ann Surg Oncol 2010; 17 : 1168–1176. Huang L, Fu L. Mechanisms of resistance to EGFR tyrosine kinase inhibitors. Acta Pharm Sin B 2015; 5 : 390–401. Scamuffa N, Siegfried G, Bontemps Y, Ma L, Basak A, Cherel G et al. Selective inhibition of proprotein convertases represses the metastatic potential of human colorectal tumor cells. J Clin Invest 2008; 118 : 352–363. Gogas H, Dummer R, Ascierto PA, Arance A, Mandalà M, Liszkay G et al. Corrigendum to ‘Quality of life in patients with BRAF-mutant melanoma receiving the combination encorafenib plus binimetinib: Results from a multicentre, open-label, randomised, phase III study (COLUMBUS)’ [European Journal of Cancer 152 (2021) 116-128]. Eur J Cancer 2022; 160 : 287–288. Sheng H, Shao J, Dubois RN. K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves activation of the protein kinase B1. Cancer Res 2001; 61 : 2670–2675. Kemeny NE, Chou JF, Capanu M, Gewirtz AN, Cercek A, Kingham TP et al. KRAS mutation influences recurrence patterns in patients undergoing hepatic resection of colorectal metastases. Cancer 2014; 120 : 3965–3971. Purnama A, Lukman K, Rudiman R, Prasetyo D, Fuadah Y, Nugraha P et al. The prognostic value of COX-2 in predicting metastasis of patients with colorectal cancer: A systematic review and meta analysis. Heliyon 2023; 9 : e21051. Grabocka E, Bar-Sagi D. Mutant KRAS Enhances Tumor Cell Fitness by Upregulating Stress Granules. Cell 2016; 167 : 1803-1813.e12. He Z, Khatib A-M, Creemers JWM. Loss of the proprotein convertase Furin in T cells represses mammary tumorigenesis in oncogene-driven triple negative breast cancer. Cancer Lett 2020; 484 : 40–49. Ikushima H, Miyazono K. TGFβ signalling: a complex web in cancer progression. Nat Rev Cancer 2010; 10 : 415–424. Wang X, Allen S, Blake JF, Bowcut V, Briere DM, Calinisan A et al. Identification of MRTX1133, a Noncovalent, Potent, and Selective KRASG12D Inhibitor. J Med Chem 2022; 65 : 3123–3133. Wei D, Wang L, Zuo X, Maitra A, Bresalier RS. A Small Molecule with Big Impact: MRTX1133 Targets the KRASG12D Mutation in Pancreatic Cancer. Clin Cancer Res 2024; 30 : 655–662. Singhal A, Styers HC, Rub J, Li Z, Torborg SR, Kim JY et al. A Classical Epithelial State Drives Acute Resistance to KRAS Inhibition in Pancreatic Cancer. Cancer Discov 2024; 14 : 2122–2134. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementaryTableS14.pdf Supplementary Table S1-4. SupplementaryFig18.pdf Supplementary Fig 1-8 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 10 Nov, 2025 Review # 2 received at journal 03 Nov, 2025 Review # 1 received at journal 02 Nov, 2025 Reviewer # 2 agreed at journal 21 Oct, 2025 Reviewer # 1 agreed at journal 19 Oct, 2025 Reviewers invited by journal 06 Oct, 2025 Submission checks completed at journal 17 Sep, 2025 Editor assigned by journal 16 Sep, 2025 First submitted to journal 16 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7633807","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":526235902,"identity":"96a9fede-b8cc-4ea8-bbb5-0352ab87a03d","order_by":0,"name":"Abdel-Majid Khatib","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIie3RsUsDMRTH8V8o1CXlVqF/g/BEEAfh/pUXXE8RXDoKwt1SnCuI/Reuu0NKIA4Gut7gcCLc1CGjg4M5aRfB3OqQ7/jCh8cjQCr1P2MtYRgQJTztZrNhYhljUYrFnrihPRIuEIxHcj+JkaNKv+stmqtseVd+nF+/5dn0lbF+/pucOub1I/zNoRXVSUGderi/rKG7CNHMRsKrWyvKaUGGyU3qkdcRsml70qhlT87I5Hkg0DHS/Gxxqu4JyIhaDpI23EJWrayqjudk1CJs0VGyKS78dmbUk3np2s8vk2fzyaqNkfApDNCvWRQABwPvqVQqlfoGLbdjAQSUDhoAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-6957-0384","institution":"INSERM BRIC U1312","correspondingAuthor":true,"prefix":"","firstName":"Abdel-Majid","middleName":"","lastName":"Khatib","suffix":""},{"id":526235903,"identity":"b138b626-3352-4274-a0c1-f4ceb3c5fb37","order_by":1,"name":"Yiyang Liu","email":"","orcid":"","institution":"INSERM BRIC U1312","correspondingAuthor":false,"prefix":"","firstName":"Yiyang","middleName":"","lastName":"Liu","suffix":""},{"id":526235904,"identity":"0a6a7db9-2687-40c7-b13f-ffe1fa48a5d5","order_by":2,"name":"Geraldine Siegfried","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Geraldine","middleName":"","lastName":"Siegfried","suffix":""},{"id":526235905,"identity":"998b6475-4b81-4dd1-bde7-5de4fb8cf049","order_by":3,"name":"Zongsheng He","email":"","orcid":"","institution":"INSERM BRIC U1312","correspondingAuthor":false,"prefix":"","firstName":"Zongsheng","middleName":"","lastName":"He","suffix":""},{"id":526235906,"identity":"0d5423cb-acef-4f38-a160-c10c2309ac65","order_by":4,"name":"Sabine Tejpar","email":"","orcid":"","institution":"University Hospital Gasthuisberg, 3000 Leuven, Belgium","correspondingAuthor":false,"prefix":"","firstName":"Sabine","middleName":"","lastName":"Tejpar","suffix":""},{"id":526235907,"identity":"55711f67-b148-4a6b-b667-18af92e46167","order_by":5,"name":"Torsten Steinmetzer","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Torsten","middleName":"","lastName":"Steinmetzer","suffix":""},{"id":526235908,"identity":"7e661f23-a688-4c0a-97fa-e070d90a97e3","order_by":6,"name":"John Creemers","email":"","orcid":"https://orcid.org/0000-0003-2518-9295","institution":"KU Leuven","correspondingAuthor":false,"prefix":"","firstName":"John","middleName":"","lastName":"Creemers","suffix":""}],"badges":[],"createdAt":"2025-09-16 21:10:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7633807/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7633807/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94473546,"identity":"a64b1b74-12c6-4ed8-af48-2c7311d06b23","added_by":"auto","created_at":"2025-10-27 15:44:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138135,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/752284c0c3da9cb33771e472.docx"},{"id":94473703,"identity":"d3e10663-65f1-4c0c-9e05-0edad7589c85","added_by":"auto","created_at":"2025-10-27 15:45:17","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8023,"visible":true,"origin":"","legend":"","description":"","filename":"ONC202502816.json","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/84ef141e905b83c004acb65d.json"},{"id":94473671,"identity":"62423340-605f-424b-95c5-3a6d7b5c1d57","added_by":"auto","created_at":"2025-10-27 15:45:10","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2088597,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFig18.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/ef614607a4818c18af8354b8.pdf"},{"id":94473599,"identity":"a57a5212-fdea-4eba-9f30-124f1fcd36d9","added_by":"auto","created_at":"2025-10-27 15:44:58","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":847195,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTableS14.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/08485ec561510d3ab40327bb.pdf"},{"id":94473597,"identity":"f05b14c9-4cd2-4525-bbd8-ac5dc734ff58","added_by":"auto","created_at":"2025-10-27 15:44:57","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170537,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025028160enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/5e2811fcc64d9ad35fa80af2.xml"},{"id":94473260,"identity":"1363d023-4ad7-4110-b769-28158f902d62","added_by":"auto","created_at":"2025-10-27 15:43:44","extension":"pdf","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":922583,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/c02d43a4fb0bb25d0cb6d223.pdf"},{"id":94473708,"identity":"6e4b23fb-df33-49d2-b88a-0cf24df0db8f","added_by":"auto","created_at":"2025-10-27 15:45:18","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1408053,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/610b4367dd82795f5ac71d98.pdf"},{"id":94473605,"identity":"938cc8a2-6bdd-45ce-9474-527a5181dfcc","added_by":"auto","created_at":"2025-10-27 15:45:01","extension":"pdf","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":575363,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/b1279ef4795a432a7d00efed.pdf"},{"id":94473477,"identity":"bca1d295-2224-44cf-b984-059da3848589","added_by":"auto","created_at":"2025-10-27 15:44:34","extension":"pdf","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":986544,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/2a0223ce95a94d7b7dc4cdf5.pdf"},{"id":94473383,"identity":"78332351-43ac-48e6-ad8f-74fb3e6f7de7","added_by":"auto","created_at":"2025-10-27 15:44:15","extension":"pdf","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1094483,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/fa1121aca04bc830f8a980fe.pdf"},{"id":94473192,"identity":"99729796-9e0f-4d28-860c-f4ba1af95ab8","added_by":"auto","created_at":"2025-10-27 15:43:09","extension":"pdf","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":875255,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/7a0bb8867f111847f54647f8.pdf"},{"id":94473732,"identity":"d32a9317-5789-42a6-b61f-5539dd2f31d1","added_by":"auto","created_at":"2025-10-27 15:45:24","extension":"pdf","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":700540,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/58cc31ecaf34f52e7bfe66fa.pdf"},{"id":94473735,"identity":"97eaddc3-4fd0-45ee-8263-0b0c437f611b","added_by":"auto","created_at":"2025-10-27 15:45:25","extension":"pdf","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":323059,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/26db96288334cfc3dd919d4e.pdf"},{"id":94473054,"identity":"675092ed-186d-482e-ac68-2b0724e17476","added_by":"auto","created_at":"2025-10-27 15:42:28","extension":"xml","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168289,"visible":true,"origin":"","legend":"","description":"","filename":"ONC2025028160structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/a8933ed674a8cc25259e8037.xml"},{"id":94473738,"identity":"b76499d0-f963-4eb5-92ce-4c2c377e2b1f","added_by":"auto","created_at":"2025-10-27 15:45:25","extension":"html","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":186340,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/c4253797ab25f9dcd414f139.html"},{"id":94473596,"identity":"82d2911d-3a5c-4738-b98b-758f99780fd1","added_by":"auto","created_at":"2025-10-27 15:44:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":872094,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin silencing reduces proteolytic activity, proliferation, colony formation, and chemoresistance in KRAS- and BRAF-mutant colon cancer cells.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003eWestern blot analysis of Furin expression in KRAS-mutant (KPN) and BRAF-mutant (BPN) colon cancer cells following lentiviral infection to establish stable shFurin expression.\u003cstrong\u003e(B)\u003c/strong\u003e Quantification of Furin protein levels in control KPN, BPN, and shFurin-expressing cells. \u003cstrong\u003e(C, D)\u003c/strong\u003e Kinetics of Furin activity in control and shFurin-expressing KPN \u003cstrong\u003e(C)\u003c/strong\u003e and BPN \u003cstrong\u003e(D)\u003c/strong\u003ecells measured using the fluorogenic substrate pERTKR-MCA (n = 3). The Furin inhibitor MI1148 was included for comparison. RFU, relative fluorescence units. \u003cstrong\u003e(E, I)\u003c/strong\u003e WST-1 proliferation assay of control KPN (E) and BPN (I) cells and cells stably expressing shFurin at indicated time points (n = 5 independent experiments). \u003cstrong\u003e(F, J)\u003c/strong\u003e Immunostaining for Ki-67 in KPN (F) and BPN (J) cells and corresponding shFurin-expressing cells (n = 3 independent samples). Scale bars, 50 μm. \u003cstrong\u003e(G, K)\u003c/strong\u003e Quantification of Ki-67 staining intensity in KPN (G) and BPN (K) cells with or without shFurin expression (n = 3 independent experiments). \u003cstrong\u003e(H, L)\u003c/strong\u003e Representative images and quantification of colonies formed by control KPN (H) and BPN (L) cells and shFurin-expressing cells (crystal violet staining, n = 3 independent experiments). \u003cstrong\u003e(M, O, Q)\u003c/strong\u003eRepresentative images of control and shFurin-expressing KPN organoids treated with 5-fluorouracil (M, 500 μM), irinotecan (O, 10 μM), or oxaliplatin (Q, 10 μM). Ethidium bromide (EB) staining was used to assess cytotoxicity. Data are representative of 6 organoids per condition from 3 independent experiments. \u003cstrong\u003e(N, R, P)\u003c/strong\u003e Corresponding quantification of EB staining intensity. (R, S, T, U) Quantification of organoid area following indicated treatments. Scale bars, 500 μm. Data represent mean ± SD of three independent experiments. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparisons test for (C, D, E, I, G, H, K, L, N, P, R, S, T, U) and by two-tailed unpaired t test for (B).\u003c/p\u003e","description":"","filename":"Binder11.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/e505a04a8510381f962456ba.png"},{"id":94473358,"identity":"f2de7fde-814f-4df5-a999-91b5f4732031","added_by":"auto","created_at":"2025-10-27 15:44:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2088955,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin knockdown in KRAS- and BRAF-mutant colorectal cancer cells inhibits tumor growth in mice and correlates with dysregulated proprotein convertases in patients.\u003c/strong\u003e \u003cstrong\u003e(A, F)\u003c/strong\u003e Growth curves of subcutaneous tumors derived from control KPN (A) and BPN (F) cells and corresponding shFurin-expressing cells in C57BL/6J mice (n = 7 tumors per group, 3 independent experiments). \u003cstrong\u003e(B, G, D, I)\u003c/strong\u003e Immunofluorescence staining of tumor sections derived from control KPN (\u003cstrong\u003eB, D)\u003c/strong\u003e and BPN \u003cstrong\u003e(G, I)\u003c/strong\u003e cells and shFurin-expressing cells, stained for Ki-67 \u003cstrong\u003e(B, G)\u003c/strong\u003e and CD8 \u003cstrong\u003e(D, I)\u003c/strong\u003e (n = 3 independent experiments). Scale bars, 100 μm. \u003cstrong\u003e(C, H, E, J) \u003c/strong\u003eQuantification of Ki-67 and CD8 staining intensity in KPN (C, H) and BPN (E, J) tumors with or without shFurin expression (n = 3 independent experiments). \u003cstrong\u003e(K, L)\u003c/strong\u003e Scatter plots showing Spearman correlation analysis of KRAS (K) and BRAF (L) expression with indicated members of the convertase family in colorectal adenocarcinoma (COAD and READ; n = 367) derived from GEPIA (\u003ca href=\"http://gepia.cancer-pku.cn/\" target=\"_new\"\u003ehttp://gepia.cancer-pku.cn/\u003c/a\u003e). Significant correlations are highlighted in blue. \u003cstrong\u003e(M)\u003c/strong\u003e Furin expression levels in COAD and READ tissues with KRAS- or BRAF-mutations (n = 17) versus non-mutated tissues (n = 328) from the TCGA dataset. Box plots show median (central band), first and third quartiles (boxes), and minimum and maximum values (whiskers).\u003cbr\u003e\n \u003cstrong\u003e(N)\u003c/strong\u003e Representative immunofluorescence images of colon cancer samples and adjacent normal tissues from patients with KRAS- or BRAF-mutated tumors stained with anti-Furin. Data are presented as mean ± SD. Statistical significance was determined using two-tailed unpaired t test.\u003c/p\u003e","description":"","filename":"Binder12.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/da9cc648d12692a241337886.png"},{"id":94473666,"identity":"faffaf8e-cc33-48aa-811c-4e44fb7a2530","added_by":"auto","created_at":"2025-10-27 15:45:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":166277,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin repression impairs IGF-1 receptor maturation and IGF-1-induced ERK and AKT activation in KRAS- and BRAF-mutant colon cancer cells.(A)\u003c/strong\u003e Western blot analysis of precursor IGF-1 receptor (Pro-IGF-IR) and processed IGF-IRβ in control KRAS-mutated (KPN) cells and corresponding shFurin-expressing cells. \u003cstrong\u003e(B)\u003c/strong\u003eQuantification of Pro-IGF-IR accumulation, calculated as the ratio Pro-IGF-IR / (Pro-IGF-IR + IGF-IRβ), indicating the percentage of pro-IGF-IR accumulation. \u003cstrong\u003e(C-F)\u003c/strong\u003e Immunoblots showing phosphorylated and total ERK1/2 \u003cstrong\u003e(C, D)\u003c/strong\u003e and AKT \u003cstrong\u003e(E, F)\u003c/strong\u003e in control KPN and shFurin-expressing cells following IGF-1 stimulation (100 ng/ml) at the indicated time points. Quantification of phosphorylated protein levels was normalized to total protein levels (D, F).\u003cstrong\u003e (G)\u003c/strong\u003e Western blot analysis of Pro-IGF-IR and mature IGF-IR in control and shFurin-expressing KPN cells. \u003cstrong\u003e(H)\u003c/strong\u003e Quantification of mature IGF-IR accumulation, determined as the ratio IGF-IR / (Pro-IGF-IR + IGF-IR), expressed as a percentage. All data represent three independent experiments (n = 3) and are presented as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparison test \u003cstrong\u003e(D, F, H)\u003c/strong\u003e or two-tailed unpaired t test \u003cstrong\u003e(B)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"Binder13.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/00bd39057ea61b3c15f97bb1.png"},{"id":94473522,"identity":"db1cf106-5d18-4b42-b5a7-6056e39e3f88","added_by":"auto","created_at":"2025-10-27 15:44:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":740645,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBasal and IGF-1-stimulated kinome profiling in control and shFurin-expressing KRAS-mutant colorectal cancer cells.\u003c/strong\u003e \u003cstrong\u003e(A, B)\u003c/strong\u003e Heatmaps showing log₂-transformed signal intensities for 196 PTK \u003cstrong\u003e(A)\u003c/strong\u003e and 144 STK \u003cstrong\u003e(B)\u003c/strong\u003e peptide substrates in control KPN cells and shFurin-expressing cells under basal conditions and after IGF-1 stimulation (100 ng/ml). Signals are color-coded from high (green) to low (blue) phosphorylation intensity. \u003cstrong\u003e(C-I)\u003c/strong\u003e Peptide phosphorylation levels under basal conditions in control and shFurin-expressing cells \u003cstrong\u003e(C, D)\u003c/strong\u003e, in IGF-1-treated control cells \u003cstrong\u003e(E, F)\u003c/strong\u003e, and in IGF-1-treated shFurin-expressing cells \u003cstrong\u003e(G, H)\u003c/strong\u003e. \u003cstrong\u003e(I, J)\u003c/strong\u003e Volcano plots showing two-group comparisons of peptide phosphorylation in control versus shFurin-expressing cells following IGF-1 stimulation (100 ng/ml; n = 3). A significance score (log₂) \u0026gt; 1.3 (dotted line) indicates statistically significant changes. Upstream kinase analysis of PTKs and STKs was performed for: (D) control and IGF-1-treated cells, (F) shFurin-expressing cells under basal and IGF-1-stimulated conditions, (H) control versus shFurin-expressing cells after IGF-1 stimulation, and (J) control versus shFurin-expressing cells activated by IGF-1. The top 20 ranked kinases are shown. A normalized kinase statistic (log₂) \u0026lt; 0 indicates reduced kinase activity, and a specificity score (log₂) \u0026gt; 1.3 (white-to-red bars) denotes statistically significant changes. Statistical significance was determined via ANOVA followed by a post hoc test. \u003cstrong\u003e(K)\u003c/strong\u003e Schematic representation of the proposed mechanism by which shFurin suppresses signaling in IGF-1–activated colorectal cancer (CRC) cells. Under normal conditions, Furin cleaves the precursor form of the IGF-1 receptor (Pro-IGF-1R), enabling its maturation and subsequent activation by the IGF-1 ligand. This leads to IGF-1R signaling, triggering downstream activation of IRS1 and various KRAS-related pathways. These include key effectors such as ERK, RPS6KB, EPHA1, LYN, PI3K, PSKH1, and AKT-commonly implicated in KRAS- and BRAF-mutant CRC. In shFurin-expressing cells, reduced Furin activity limits IGF-1R processing, thereby attenuating IGF-1-induced receptor activation and repressing multiple downstream signaling pathways involved in KRAS- and BRAF-mutant oncogenic signaling.\u003c/p\u003e","description":"","filename":"Binder14.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/ae9f5e22efebad11d0a88c5a.png"},{"id":94473600,"identity":"e179384b-7efe-4152-997f-25172f7691e0","added_by":"auto","created_at":"2025-10-27 15:44:58","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":708852,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin repression in KRAS- and BRAF-mutated cancer cells inhibits COX2 expression and COX2-mediated proliferation, colony formation, and tumor growth and angiogenesis in mice. (A)\u003c/strong\u003eRelative mRNA expression levels of PTGS2, PTGER1, PTGER3, PTGER4, and PTGES in control KPN cells and KPN cells expressing shFurin, measured by qRT‒PCR and normalized to GAPDH (n = 3 independent experiments). \u003cstrong\u003e(B)\u003c/strong\u003e Western blot analysis of COX-2 expression in tumors derived from control KPN cells and shFurin-expressing KPN cells in mice (n = 7). \u003cstrong\u003e(C)\u003c/strong\u003e Quantification of COX-2 protein levels in tumors from control and shFurin KPN cells. \u003cstrong\u003e(D–H)\u003c/strong\u003eSpearman correlation analysis of PTGS2 (D), PTGER1 (E), PTGER3 (F), PTGER4 (G), and PTGES \u003cstrong\u003e(H)\u003c/strong\u003e versus Furin expression in colorectal adenocarcinoma (COAD and READ) based on GEPIA data (n = 367). \u003cstrong\u003e(I, J)\u003c/strong\u003e WST-1 proliferation assay of control KPN (I) and BPN (J) cells, as well as cells stably expressing shFurin, COX-2, or coexpressing shFurin and COX-2, at indicated time points (n = 3 independent experiments). \u003cstrong\u003e(K)\u003c/strong\u003e Representative images and quantification of colonies formed by control and shFurin KPN cells (crystal violet staining, n = 3 independent experiments). \u003cstrong\u003e(L)\u003c/strong\u003e Representative organoid morphologies of control and shFurin KPN cells after 5 days of culture (n = 3–6 organoids, 3 independent experiments). \u003cstrong\u003e(M) \u003c/strong\u003eQuantification of organoid area. Scale bars, 500 µm. \u003cstrong\u003e(O)\u003c/strong\u003e Tumor growth curves of C57BL/6J mice subcutaneously injected with control KPN cells, shFurin-expressing cells, COX-2-expressing cells, or cells coexpressing shFurin and COX-2 (n = 8 tumors per group, 3 independent experiments). \u003cstrong\u003e(P)\u003c/strong\u003e Immunofluorescence staining of tumor sections from \u003cstrong\u003e(O)\u003c/strong\u003e for CD31. Scale bars, 100 µm. \u003cstrong\u003e(Q)\u003c/strong\u003eQuantification of CD31 staining intensity in tumors. Data are shown as mean ± SD. Statistical significance was determined by one-way ANOVA with Tukey’s multiple comparisons test for \u003cstrong\u003e(I, J, K, M, O, Q)\u003c/strong\u003e and by two-tailed unpaired t test for \u003cstrong\u003e(C)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"Binder15.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/39779c7dd9ad73ac641f3aa7.png"},{"id":94473628,"identity":"546acb84-90cc-4335-a2b9-c2c7b2a29cfa","added_by":"auto","created_at":"2025-10-27 15:45:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":316194,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin regulates TGF-β1-induced COX2 expression in KRAS- and BRAF-mutant colorectal cancer cells. (A, C)\u003c/strong\u003e Western blot analysis of COX2 expression in control KPN and BPN cells stimulated with TGF-β1 (5 ng/ml) (n = 4). (\u003cstrong\u003eB, D)\u003c/strong\u003e Quantification of COX2 protein levels in control KPN and BPN cells stimulated with TGF-β1 (5 ng/ml). (\u003cstrong\u003eE-H)\u003c/strong\u003e COX2 expression in control KPN (E) and BPN (BPN) cells expressing shFurin, transfected with TGF-β1 cDNA, and quantified by immunoblotting (\u003cstrong\u003eF\u003c/strong\u003e, \u003cstrong\u003eH). (I-L)\u003c/strong\u003e Furin expression was analyzed by immunoblotting in control KPN and BPN cells stimulated with TGF-β1 \u003cstrong\u003e(I \u003c/strong\u003eand \u003cstrong\u003eK)\u003c/strong\u003e and quantified (\u003cstrong\u003eJ, L\u003c/strong\u003e). (\u003cstrong\u003eM, N)\u003c/strong\u003e Relative expression levels of TGF-β1 in control KPN and BPN cells, as well as in the same cells expressing shFurin, were measured via qRT‒PCR and normalized to the level of GAPDH (n = 3 independent experiments). \u003cstrong\u003e(O, P)\u003c/strong\u003e Scatter plot graphs of data derived from GEPIA illustrating the Spearman correlation analysis of TGF-β1 and Furin and TGF-β1 and PTGS2 expression in colorectal adenocarcinomas (COAD and READ) (n\u003cstrong\u003e = \u003c/strong\u003e367). (\u003cem\u003e\u003cstrong\u003eQ-U) \u003c/strong\u003e\u003c/em\u003eWestern blot analysis of TGF-β1 and COX2 expression in control KPN \u003cem\u003e(\u003c/em\u003e\u003cem\u003e\u003cstrong\u003eQ\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e)\u003c/em\u003e and BPN \u003cem\u003e\u003cstrong\u003e(T)\u003c/strong\u003e\u003c/em\u003e cells, as well as in cells expressing shFurin alone or coexpressing either an empty GFP vector (GFP) or PTGS2 cDNA (\u003cem\u003en\u003c/em\u003e = 3 independent experiments). Quantification of TGF-β1 \u003cem\u003e\u003cstrong\u003e(R, U)\u003c/strong\u003e\u003c/em\u003eand COX2 \u003cem\u003e\u003cstrong\u003e(S, V)\u003c/strong\u003e\u003c/em\u003e protein levels in control KPN and BPN cells, as well as in shRNA-expressing cells or those coexpressing shFurin and COX2. All the data are presented as the means ± SDs. Statistical significance was determined via one-way ANOVA with Tukey’s multiple comparison test for \u003cstrong\u003e(F, H, R, S, U, V)\u003c/strong\u003e and a two-tailed unpaired\u003cstrong\u003e \u003c/strong\u003et test for \u003cstrong\u003e(B, D, J, L, M \u003c/strong\u003eand\u003cstrong\u003eN)\u003c/strong\u003e.\u003c/p\u003e","description":"","filename":"Binder16.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/01366bb55bd5f4e5acd7ca57.png"},{"id":94473458,"identity":"8b467d3d-09e9-409d-ab6a-59cbe2fc2e51","added_by":"auto","created_at":"2025-10-27 15:44:23","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":383062,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFurin, COX2 and TGF-β1 interaction during tumor growth induced by KRAS- and BRAF-mutant colorectal cancer cells. (\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA)\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e,\u003c/em\u003e Western blot analysis of COX2, TGF-β1, p-Smad2, Smad2, and Furin expression in control KPN and BPN cells treated with or without the COX2 inhibitor (celecoxib, 75 μM) and/or the Furin inhibitor MI1148 (10 μM). (\u003cem\u003e\u003cstrong\u003eB-E),\u003c/strong\u003e\u003c/em\u003e Quantification of COX2 \u003cem\u003e\u003cstrong\u003e(B)\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e,\u003c/strong\u003e\u003c/em\u003e TGF-β1 \u003cem\u003e\u003cstrong\u003e(C)\u003c/strong\u003e\u003c/em\u003e, p-Smad2 \u003cem\u003e\u003cstrong\u003e(D)\u003c/strong\u003e\u003c/em\u003e, and Furin \u003cem\u003e\u003cstrong\u003e(E)\u003c/strong\u003e\u003c/em\u003eexpression in control KPN and BPN cells in the absence or presence of celecoxib and/or MI1148 (\u003cem\u003en\u003c/em\u003e = 3 independent experiments). (\u003cem\u003e\u003cstrong\u003eF), \u003c/strong\u003e\u003c/em\u003eTumor growth on day 40 in Black6/J mice subcutaneously injected with control KPN cells or KPN cells expressing shFurin or COX2 or coexpressing shFurin and COX2 (\u003cem\u003en\u003c/em\u003e = 6 tumors per group, 3 independent experiments). (\u003cem\u003e\u003cstrong\u003eG),\u003c/strong\u003e\u003c/em\u003e Western blot analysis of TGF-β1, p-Smad2, Smad2, and GAPDH expression in tumors derived from mice injected with control KPN cells or KPN cells expressing COX2, shFurin, or coexpressing shFurin and COX2. (\u003cem\u003e\u003cstrong\u003eH) \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eand\u003c/em\u003e\u003cem\u003e\u003cstrong\u003e(I), \u003c/strong\u003e\u003c/em\u003eQuantification of TGF-β1 \u003cem\u003e\u003cstrong\u003e(H)\u003c/strong\u003e\u003c/em\u003e and p-Smad2 \u003cem\u003e\u003cstrong\u003e(I)\u003c/strong\u003e\u003c/em\u003e in tumors derived from the same conditions (\u003cem\u003en\u003c/em\u003e = 3 independent experiments). The data are representative of three independent experiments and are shown as the means ± SDs. Statistical significance was determined via one-way ANOVA with Tukey’s multiple comparison test.\u003c/p\u003e","description":"","filename":"Binder17.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/1a1405fd79e5e44ec515bc5e.png"},{"id":94473595,"identity":"8e70ada9-4e07-4519-b7c6-d6ad44526192","added_by":"auto","created_at":"2025-10-27 15:44:55","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":935801,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of Furin-mediated signaling pathways and their role in promoting tumor progression in KRAS- and BRAF-mutated colorectal cancer cells.\u003c/strong\u003e In colorectal cancer (CRC) cells harboring KRAS and BRAF mutations, Furin mediates the cleavage of the IGF-1 receptor, TGF-β, and other protein precursors (1). Interaction with their ligands or receptors (2) leads to activation of signaling pathways such as ERK, AKT, and MAPK (3), all of which are linked to KRAS and BRAF mutation-driven activity (4). These pathways promote tumorigenic effects, including increased proliferation, resistance to chemotherapy, suppressed T cell infiltration, angiogenesis, and tumor growth (5). TGF-β1 stimulates the expression of both COX2 (6) and Furin (7), establishing a positive feedback loop that intensifies tumor progression. Suppression of Furin expression disrupts KRAS- and BRAF-associated signaling pathways, ultimately impairing these tumor-promoting processes (8).\u003c/p\u003e","description":"","filename":"Binder18.png","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/1932b1d7afed7ef746b5f37a.png"},{"id":94490291,"identity":"33d84cd7-2ab9-414f-b2ef-d62ff838af23","added_by":"auto","created_at":"2025-10-27 17:08:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8016239,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/1aceb96f-7c45-4ad5-aad8-a56aca45613d.pdf"},{"id":94473705,"identity":"c646aae0-5f5b-46ca-9286-fe37da2f8fe4","added_by":"auto","created_at":"2025-10-27 15:45:18","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":847195,"visible":true,"origin":"","legend":"Supplementary Table S1-4.","description":"","filename":"SupplementaryTableS14.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/fc0b36fceb90ce865b80a9cf.pdf"},{"id":94473306,"identity":"2540ff0f-97ff-48e1-a5ff-e13a18e3736e","added_by":"auto","created_at":"2025-10-27 15:43:55","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2088597,"visible":true,"origin":"","legend":"Supplementary Fig 1-8","description":"","filename":"SupplementaryFig18.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7633807/v1/6873061365648de67380f485.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Furin sustains tumor-promoting signals in KRAS- and BRAF-mutated colorectal cancer by engaging the TGF-β1–COX-2 axis in a reciprocal regulatory network","fulltext":[{"header":"Introduction","content":"\u003cp\u003eColorectal cancer (CRC) is one of the most prevalent malignancies of the digestive system and is the second leading cause of cancer-related mortality worldwide \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Although the exact etiology is not always clear, genetic factors, aging, and lifestyle significantly increase the risk of CRC development \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. In recent years, experimental and clinical studies have revealed that multiple signaling (over) activation initiates or promotes the progression of CRC \u003csup\u003e\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e, particularly the MAPK, PI3K, WNT, and COX-2 signaling pathways \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Pharmacological inhibition of these pathways has become a widely used approach to prolong overall survival of patients with CRC \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. However, these inhibitory strategies are not always effective because of gene mutations in the related signaling pathways. For example, cetuximab, an antibody that targets epidermal growth factor receptor (EGFR), can slow CRC progression in the clinic by inhibiting EGFR-mediated activation of the MAPK and PI3K pathways \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Nonetheless, as with other therapies, the effectiveness of cetuximab is limited across different patient populations \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eResistance to treatment has been linked to the presence of KRAS and BRAF mutations in CRC \u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Indeed, 40% of CRC tumors exhibit activating mutations in KRAS (e.g., G12D, G13D, and Q61H), leading to the continuous activation of KRAS \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. This mutant KRAS functions as a molecular switch, persistently triggering downstream RAF/MEK/ERK and PI3K/AKT signaling, which promotes cell proliferation and survival, thereby contributing to tumorigenesis and resistance to therapy \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Although BRAF mutations are less common than KRAS mutations in CRC (occurring in approximately 8\u0026ndash;12% of cases \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e), these mutations, such as the classic V600E mutation, lead to more aggressive tumor behavior \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and BRAF mutations are often linked to poor responses to chemotherapy, shorter progression-free survival, and reduced overall survival \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Despite these insights, the development of effective targeted drugs for KRAS and BRAF mutations remains a significant challenge \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Therefore, understanding the molecular complexities of the progression of this CRC subtype is crucial for the development of more effective targeted therapies and personalized treatment strategies that can interfere with the KRAS and/or BRAF mutation activity in cancer cells.\u003c/p\u003e\u003cp\u003eFurin, together with other members of the proprotein convertase (PC) family (PC1/3, PC2, PC4, PACE4, PC5/6, and PC7), cleaves proproteins with basic motifs, such as Arg-X-Lys/Arg-Arg \u003csup\u003e\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Within this family, PC1/3, PC2, and PC4 exhibit tissue-specific distribution, whereas Furin is expressed in a broad range of cell lines and tissues. In a steady state, Furin predominantly localizes within the trans-Golgi network, where it engages in a dynamic cycling process involving the sorting compartment, cell surface, and early endosomes \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Owing to its ubiquitous expression, Furin has been suggested to cleave more than 100 substrates, ranging from growth factors and their receptors to adhesion molecules and extracellular matrix proteins, although only a few have been confirmed \u003cem\u003ein vivo\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Many of these protein precursors are involved in initiating and sustaining cancer hallmarks \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e, suggesting that Furin is a promising target for therapeutic intervention in various human cancers \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Using mouse-derived KRAS-mutant colorectal cancer (CRC) cell lines and organoids (KPN: villinCre\u003csup\u003eER\u003c/sup\u003e Kras\u003csup\u003eG12D/+\u003c/sup\u003e; Trp53\u003csup\u003efl/fl\u003c/sup\u003e; Rosa26\u003csup\u003eN1icd/+\u003c/sup\u003e) and BRAF-mutated CRC cell line and organoids (BPN: villinCre\u003csup\u003eER\u003c/sup\u003e BRAF\u003csup\u003eV600E/+\u003c/sup\u003e; Trp53\u003csup\u003efl/fl\u003c/sup\u003e; Rosa26\u003csup\u003eN1icd/+\u003c/sup\u003e), we found that Furin repression enhanced the sensitivity of both KRAS\u003cem\u003e-\u003c/em\u003e and BRAF-mutant CRC models to standard chemotherapeutic agents. In these CRC models, Furin regulates cyclooxygenase-2 (COX-2) expression through the proteolytic activation of TGF-β1 and its downstream signaling, both in vitro and in vivo. These findings suggest that targeting the Furin-TGF-β1-COX-2 interaction may represent a promising therapeutic strategy for KRAS- and/or BRAF-mutant colorectal cancer, potentially addressing a critical unmet need in this aggressive disease subtype.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eHuman tumor samples\u003c/h2\u003e\u003cp\u003eSamples from 25 colorectal cancer patients (both male and female) and adjacent normal regions were collected from frozen tissues. The specimens were clinically and histopathologically diagnosed at the Institut Bergoni\u0026eacute;, Bordeaux. The tissues acquired after resection were promptly placed on ice post-surgery and snap-frozen in liquid nitrogen for subsequent analysis. For human experiments, ethics approval was obtained from the Bergoni\u0026eacute; Institute, key projects [PV2024_071]). Patient consent forms were obtained for all samples at the time of tissue acquisition. The biopsies were de-identified.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePlasmids and lentiviral transduction\u003c/h3\u003e\n\u003cp\u003eThe plasmid encoding pLenti-shFurin was generated by amplifying the corresponding cDNA via PCR (shRNA-Furin; Sigma; 11042118MN; forward primer: CGCGAGTCTAGAATGGAGCTGAGGCCCTGG; reverse primer: CGAGTTGTCGACTCAGAGGGCGCTCTGGTC) and ligating the Xbal/Sal1-digested PCR product into Xbal/Sal1-restricted pLenti CMV GFP Puro (Addgene; 17448). The plasmid encoding pLenti-PTGS2 was generated by amplifying the corresponding cDNA via PCR (template: pcDNA3.1-hPTGS2-2flag; addgene;102498; forward primer: CGATGGGATCCACCATGCTCGCCCGCGCC; reverse primer: CGACTTGTCGACCTACAGTTCAGTCGAACGTTC), and the BamHI/Sal1-digested PCR product was ligated into the BamHI/Sal1-restricted pLenti CMV GFP Puro (Addgene;17448). The DH5α coli strain (Thermo Fisher Scientific) was used as the cloning and plasmid amplification host. All plasmids were validated using DNA sequencing (LGC Genomics, Berlin, Germany). To produce lentiviral particles, HEK-293T cells were incubated in DMEM/F12 medium and co-transfected with 1 \u0026micro;g/\u0026micro;L pLenti-shFurin/pLenti-COX-2 construct, 1 \u0026micro;g/\u0026micro;L p-VSVG construct (Addgene; 8454), or 1 \u0026micro;g/\u0026micro;L delta 8.91 (Addgene; 12247) with 7 \u0026micro;L XtremeGene9 transfection reagent (41106502, Sigma). The medium was aspirated after 6 h and replaced with fresh DMEM/F12 supplemented with 10% FCS. The supernatant was harvested after 48 h, centrifuged at 1000 \u0026times; g at 4\u0026deg;C for 10 min, filtered through a 0.4 \u0026micro;m low protein-binding membrane (UFC905024, Millipore), and used to infect CRC cells in the presence of 8 mg/mL polybrene (107689, Sigma). The virus-containing media were removed 48 h after transduction, and the infected cells were selected with 2 \u0026micro;g/mL puromycin for 7 days (P7255, Sigma).\u003c/p\u003e\n\u003ch3\u003eCell culture, organoid generation, and cell transfection\u003c/h3\u003e\n\u003cp\u003eThe characteristics of the KRAS- and BRAF-mutated cancer mouse models, in which KPN cells harboring KRAS (G12D) and BPN cells carrying BRAF(V600E) were derived, have been described previously \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. KRAS-mutant KPN cells were derived from a colon cancer mouse model with villinCre\u003csup\u003eER\u003c/sup\u003e Kras\u003csup\u003eG12D/+\u003c/sup\u003e; Trp53\u003csup\u003efl/fl\u003c/sup\u003e; Rosa26\u003csup\u003eN1icd/+\u003c/sup\u003e phenotype, and BRAF-mutant BPN cells from villinCre\u003csup\u003eER\u003c/sup\u003e BRAF \u003csup\u003eV600E/+\u003c/sup\u003e; Trp53\u003csup\u003efl/fl\u003c/sup\u003e; Rosa26\u003csup\u003eN1icd/+\u003c/sup\u003e mice. KPN and BPN cells were cultured in DMEM/F12 medium (21331, Gibco) supplemented with 10% fetal calf serum (P30-3306, Panbiotech) and 1% penicillin-streptomycin (15140122, Gibco). The cells were transfected with plasmids encoding full-length TGF-β1 using LIPO2000 (11668027, Thermo Fisher) according to the manufacturer\u0026rsquo;s instructions. After 48 h of transfection, the cells were harvested. To generate stable cell lines, KPN and BPN cells were transduced with GFP, shRNA-Furin, or COX-2 lentivirus particles and these cell lines were named as follows: GFP control (Control), shFurin-expressing (shFurin), COX-2-overexpressing (COX-2), and shFurin- and COX-2-coexpressing (shFurin/COX-2) cells. All cell lines were confirmed to be negative for mycoplasma by PCR. To generate organoids, 5000 cells were cultured in DMEM/F12 supplemented with N2 or B27 supplements (17502048; 17504044, Thermo Fisher), FGF (25 \u0026micro;g/mL, 100-18B-50, Sigma), EGF (10 \u0026micro;g/mL, AF-100-15, Sigma), or 0.4% sterile methylcellulose in a 96-well round-bottom plate that facilitated the production of homogeneous organoids. After culturing for five days, the surface area of each spheroid was measured using the Fiji Macro image program (Version X, National Institutes of Health, USA). To inhibit Furin activity, cells were seeded and treated with 10 \u0026micro;M 4-guanidinomethyl-phenylactyl-Arg-Tle-Arg-4-amidinobenzylamide (MI1148) \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. To stimulate protein phosphorylation, cells were incubated with 100 ng/mL recombinant IGF1 (ab9573; Abcam) at the indicated time points. To increase TGF-β1 levels, the cells were incubated with 5 ng/mL recombinant TGF-β1 (P01137, Bio-Techne) at the indicated time points. To inhibit COX-2 expression, cells were incubated with 25 \u0026micro;M celecoxib (A0439955, Thermo Fisher) for 24 h.\u003c/p\u003e\n\u003ch3\u003eCell viability and proliferation analysis\u003c/h3\u003e\n\u003cp\u003eCell viability was determined using the WST-1 (11644807001, Roche) assay according to the manufacturer\u0026rsquo;s guidelines. Briefly, cells were counted and plated at a density of 5000 cells/well in 96-well plates. The WST-1 reagent (25 ng/mL) was added on days 1, 2, and 3, and the plates were incubated for 3.5 hours. The conversion of WST-1 to formazan was quantified at 450 nm using an enzyme-linked immunosorbent assay reader (Infinite 2000 PRO microplate reader, Tecan, Switzerland). Cell proliferation was evaluated by colony formation assay, as previously described \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Briefly, 10\u003csup\u003e3\u003c/sup\u003e cells were seeded and cultured for seven days. The colonies were fixed with methanol and stained with 1% crystal violet. Images were collected and counted using ImageJ software (ImageJ, National Institutes of Health, USA).\u003c/p\u003e\n\u003ch3\u003eDrug-induced cytotoxicity assay\u003c/h3\u003e\n\u003cp\u003eTo assess drug-induced cytotoxicity, KPN and BPN derived organoids were treated with 5-FU (500 \u0026micro;M), Oxaliplatin (10 \u0026micro;M), Irinotecan (10 \u0026micro;M), or vehicle (DMSO) for 72 hours and were incubated with Ethidium Bromide (EB, 2 \u0026micro;g/mL; Thermo Fisher) in growth medium for 30 minutes at 37\u0026deg;C. Fluorescent images were captured using Echo Revolution, and EB fluorescence intensity was quantified using ImageJ (NIH). Cytotoxicity was assessed by calculating the average EB signal intensity per spheroid.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eRNA extraction and real-time PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted from cultured cells using the NucleoSpin RNA Kit (Macherey Nagel), according to the manufacturer\u0026rsquo;s protocol. RNA was reverse transcribed using the high-capacity cDNA reverse transcription kit iScript cDNA synthesis kit (1708891, Bio-Rad) in a T100 Thermal Cycler (Bio-Rad). Real-time quantitative PCR was performed as previously described \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e using the primers indicated in \u003cb\u003eSupplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e, and data were collected using IQ SYBR Green Supermix reagent (1708882, Bio-Rad) on an Agilent AriaMx Real-Time PCR System. Each sample was normalized to the housekeeping gene GAPDH using the Livak‒Schmittgen method (2\u003csup\u003e\u0026minus; ∆∆CT\u003c/sup\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eImmunoblotting\u003c/h3\u003e\n\u003cp\u003eSample preparation for immunoblotting was performed as described previously \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Cells and tumor tissues were lysed in RIPA buffer (89900, Sigma) supplemented with a protease inhibitor cocktail (11836170001, Roche) and a phosphatase inhibitor (05892970001, Roche). For tumor tissue preparation, 20 mg of frozen tumor tissue was extracted via homogenization in 480 \u0026micro;L of radioimmunoprecipitation assay (RIPA) buffer supplemented with protease and phosphate inhibitors. After 10 cycles of sonication, the supernatants were collected, and 4X sample buffer was added. Finally, the samples were boiled at 100\u0026deg;C for 10 min before loading. The bands were visualized with the enhanced chemiluminescence substrate SuperSignal (Thermo Fisher), and the images were processed using Image Quant LAS4000 or Odyssey (LI-COR Biosciences, Lincoln, NE, USA). GAPDH served as the loading control.\u003c/p\u003e\n\u003ch3\u003eFluorescence microscopy\u003c/h3\u003e\n\u003cp\u003eFor cell staining, cells were fixed with cold methanol for 5 min and permeabilized with 0.1% (v/v) Triton X-100 (9036, Sigma) prepared in phosphate-buffered saline (PBS). After blocking with 5% BSA (A788, Sigma) in PBS for 1 h, the cells were incubated with an Ki67 antibody diluted in blocking buffer at 4\u0026deg;C overnight and then conjugated with an Alexa Fluor 586-conjugated secondary antibody. For tissue staining, fresh tumor samples were fixed in 4% paraformaldehyde (sc-281692, Santa Cruz Biotechnology) overnight, washed with running water for 2 h, rehydrated with gradient ethanol, and then embedded in paraffin. Five micron-thick tissue sections were cut, and antigen retrieval (10 mM Tris, 1 mM EDTA, 0.05% Tween 20, pH 9) was performed in a 100\u0026deg;C water bath for 20 min. Following blocking with 5% BSA in PBS for 1 h, the sections were incubated with primary antibodies (Ki67, CST; CD8, Abcam; CD31, Bio-Techne) at 4\u0026deg;C overnight, and a secondary antibody conjugated with Alexa Fluor 488 or Alexa Fluor 647. The cells and tissue sections were stained with DAPI (D1306, Thermo Fisher) before imaging. CellSens Dimension software (version 2.1; Olympus) was used for image acquisition and analysis.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eFurin activity measurement\u003c/h2\u003e\u003cp\u003eCells were seeded in 6-well plates and reached 50\u0026ndash;70% confluence at the time of collection. The cell pellets were lysed using RIPA buffer, and 250 \u0026micro;M Furin peptide substrate pERTKR-AMC (ES013, biotechne) was added to the reaction buffer (50 mM Tris, 150 mM NaCl, and 0.2% (v/v) Triton X-100, pH 8.0). The mixtures were incubated at 37\u0026deg;C, and the fluorescence intensity (excitation wavelength: 360 nm; emission wavelength: 465 nm) was measured every 10 min using a spectrofluorometer (Tecan, Switzerland) as previously described \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eKinase activity analysis\u003c/h2\u003e\u003cp\u003eControl, shFurin, and MI1148-treated KPN cells were washed and lysed in M-PER lysis buffer (78501, Thermo Fisher) supplemented with protease and phosphatase inhibitors (87785, 78420, Thermo Fisher). After centrifugation, the supernatant was analyzed using a kinome analysis platform (PamGene\u0026reg; International, Netherlands), as previously described \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Statistical significance was tested using unpaired t-tests, and the results were represented by heatmaps, score plots, and volcano plots generated via BN63 (BN63; PamGene\u0026reg; International, the Netherlands). Peptides with a P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered significantly different in the degree of phosphorylation of a peptide in the two groups.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eIn vivo tumorigenic assay\u003c/h2\u003e\u003cp\u003eBlack6/J mice (male and female, 6\u0026ndash;8 weeks old) were purchased from Jackson Laboratory. All mice were raised under specific pathogen-free conditions in a comfortable environment with a temperature of 20\u0026ndash;22\u0026deg;C, humidity of approximately 60%, and a 12-h light\u0026ndash;dark cycle. Mice were subcutaneously inoculated in the right flank with 5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e control KPN and BPN cells and the same cells expressing shFurin (shFurin/KPN and shFurin/BPN cells). In other experiments, mice were subcutaneously injected with 5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e control cells or the same cells expressing COX-2 alone or coexpressing shFurin and COX-2. The tumor size was recorded every 2 or 3 days, and the tumor volume was calculated as 0.5 \u0026times; length \u0026times; width \u0026times; width. All animal experiments were conducted in accordance with the guidelines and approved by the Institutional Animal Care and Use Committee of the University of Bordeaux and complied with the protocol approved by the Ethics Committee under the supervision of a trained veterinarian. (Approval No. [APAFIS #51899-2024102315155381 v8]).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eStatistics\u003c/h2\u003e\u003cp\u003eStatistical analysis, as specified in the figure legends, was performed via one-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post hoc test for multiple comparisons, and Student\u0026rsquo;s unpaired two-tailed t-test was used to compare two groups. Pearson\u0026rsquo;s coefficient was calculated to determine the correlation between normally distributed protein expression in human tumors. All statistical analyses were performed using GraphPad Prism 8.1 (GraphPad Software). All measurements were obtained from distinct samples. The indicated sample sizes (n) represent the biological replicates. Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SDs). \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Mice (of matched age), tumor samples, and cell line cultures were randomly allocated to the appropriate groups for the experiments. No data or mice were excluded from the analyses.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eRepression of Furin attenuates the malignant phenotype and enhances efficiency of chemotherapy in colorectal cancer cells with KRAS and BRAF mutations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn colorectal cancer (CRC), activating mutations in KRAS and BRAF lead to the dysregulation of various signaling cascades, which drives cancer cell proliferation, differentiation, angiogenesis, and resistance to apoptosis and diminishes responsiveness to therapy. To investigate the role of Furin (\u003cem\u003ePCSK3\u003c/em\u003e) in KRAS- and BRAF-mutant CRC, we employed lentiviral shRNA targeting PCSK3 to suppress Furin expression in CRC cells derived from mice generated specifically to harbor each of these mutations. These include the KRAS-mutant KPN and BRAF-mutant BPN tumor cells \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. As expected, Furin protein levels were significantly reduced by 4.6-fold in KPN cells and 3.4-fold in BPN cells stably expressing shRNA against PCSK3 (shFurin) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, B\u003cb\u003e)\u003c/b\u003e. To assess the impact of Furin knockdown on enzymatic activity, we performed an \u003cem\u003ein vitro\u003c/em\u003e fluorogenic assay using the peptide substrate pERTKR-MCA. Compared with those from the control cells, the lysates from Furin-deficient cells showed a significant reduction in substrate processing \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D\u003cb\u003e)\u003c/b\u003e. Notably, treatment with the Furin inhibitor MI1148 further reduced Furin activity in both KPN and BPN cells, likely due to cross-reactivity with other proprotein convertases \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D\u003cb\u003e)\u003c/b\u003e. Next, we evaluated the role of Furin in the malignant phenotype of colon cancer with KRAS or BRAF mutations, we first employed the WST-1 assay to evaluate the proliferation of control and shFurin-expressing cells. The growth of shFurin-expressing cells was significantly lower than that of control cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, I\u003cb\u003e)\u003c/b\u003e. Correspondingly, immunofluorescence analysis of the proliferation marker Ki-67 demonstrated markedly lower Ki-67 staining in both KPN- \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, G\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ, K\u003cb\u003e)\u003c/b\u003e shFurin-expressing cells. Furthermore, treatment with the Furin inhibitor, MI1148, resulted in decreased proliferation of KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ\u003cb\u003e)\u003c/b\u003e cells, as evidenced by diminished Ki-67 staining. The inhibitory effect of MI1148 on cell growth was more pronounced than that of shFurin alone. Additionally, analysis via a colony formation assay revealed that the expression of shFurin in KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL\u003cb\u003e)\u003c/b\u003e cells significantly impaired their ability to form colonies, confirming the pivotal role of Furin in sustaining the tumorigenic potential of these colorectal cancer cells. We next investigated whether Furin depletion could also sensitize KRAS- and BRAF-mutant CRC cells to standard chemotherapeutic agents. Thereby, we established organoid cultures derived from KPN and BPN CRC cells, with or without stable Furin knockdown. Organoids were treated with 5-fluorouracil (5-FU), oxaliplatin, or irinotecan, and cytotoxicity was assessed by ethidium bromide (EB) staining, which marks cell death within the organoid core. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM-U, treatment with 5-FU alone induced moderate EB uptake in both KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM, N\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B)\u003c/b\u003e organoids. However, Furin knockdown in combination with 5-FU led to a marked increase in EB signal intensity, indicating enhanced cell death and disruption of spheroid structural integrity, suggestive of increased tissue damage and compromised organoid architecture. A comparable effect was observed with oxaliplatin treatment at 10 \u0026micro;M in KPN organoids \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eQ, R\u003cb\u003e).\u003c/b\u003e Treatment with irinotecan (10 \u0026micro;M) mirrored the response observed with 5-FU, as both KPN and BPN organoids showed significantly increased sensitivity upon Furin silencing, evidenced by elevated EB staining and spheroid disintegration \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eO, P; \u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC, D).\u003c/b\u003e In contrast, this sensitizing effect was absent in the BPN model, where Furin depletion did not potentiate oxaliplatin-induced cytotoxicity \u003cb\u003e(Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE, F).\u003c/b\u003e Collectively, these findings suggest that Furin knockdown enhances the cytotoxic effects of several standard CRC chemotherapies in KRAS- and BRAF-mutant CRC.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo explore the effect of Furin repression on tumor growth \u003cem\u003ein vivo\u003c/em\u003e, control and shFurin-expressing KPN and BPN cells were inoculated into syngeneic Black6/J mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, F, and consistent with the \u003cem\u003ein vitro\u003c/em\u003e results, the expression of shFurin in KPN and BPN cells significantly reduced their ability to mediate tumor growth. Accordingly, immunostaining analysis of tumor sections derived from control, shFurin-expressing KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, H\u003cb\u003e)\u003c/b\u003e cells revealed fewer Ki-67-positive cells. Given the role of KRAS signaling in tumor cells, which affects the tumor microenvironment and reduces the function of tumor-infiltrating T cells via a range of mechanisms \u003csup\u003e\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, we analyzed the infiltration of CD8\u0026thinsp;+\u0026thinsp;T cells in control and shFurin-treated mice tumors and found an increase in CD8\u0026thinsp;+\u0026thinsp;T cells in shFurin KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI, J) tumors. These findings suggest that Furin inhibition may not only impair tumor cell proliferation, but also enhance the recruitment or activation of cytotoxic T lymphocytes, contributing to the reduction in KRAS- and BRAF-mediated immune evasion and tumor growth.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eExpression of Furin and other proprotein convertases correlates with KRAS and BRAF mutations in CRC patients\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAnalysis of the expression of all proprotein convertase family members, namely PCSK1, PCSK2, PCSK3, PCSK4, PCSK5, PCSK6, PCSK7, PCSK8, and PCSK9, in public datasets, including The Cancer Genome Atlas (TCGA) and the GEPIA web server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), revealed that although the expression of several PCs positively correlated with wild-type KRAS or BRAF, only PCSK3 (Furin gene) showed significantly higher expression in tumors harboring KRAS\u003cb\u003e/\u003c/b\u003eBRAF mutations compared with wild-type cases \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM, \u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/b\u003e In parallel, immunohistochemical staining of normal human colon tissue and primary colon tumors with BRAF and KRAS mutations revealed Furin expression in the colon crypts. In cancerous tissues, the loss of crypts was associated with an altered Furin expression pattern, with strong expression observed in all analyzed tumor samples \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eN\u003cb\u003e)\u003c/b\u003e. These findings further support a potential role for Furin in colorectal cancer progression associated with KRAS and/or BRAF mutations.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFurin inhibition impairs basal and induced multiple signaling pathways associated with KRAS and BRAF oncogenic activity.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe RAF/MEK/ERK and PI3K/AKT signaling pathways are commonly activated in association with KRAS and/or BRAF mutations \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. To investigate whether Furin repression interferes with these oncogenic signaling cascades potentially by impairing the processing of proprotein convertase (PC) substrates, we focused on the PC substrate IGF-1 receptor (IGF-1R) pathway. We first examined the effect of Furin knockdown on ERK and AKT pathway activation downstream of IGF-1R signaling. To this end, we analyzed the impact of shFurin on IGF-1 receptor cleavage in KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(Supplementary Fig. S3A, B)\u003c/b\u003e cells. Immunoblot analysis of pro-IGF-1R revealed a marked reduction in its conversion into the mature IGF-1R form, as evidenced by the accumulation of a higher-molecular-weight precursor in Furin-knockdown KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(Fig. Supplementary Fig. S3A, B)\u003c/b\u003e cells. This form displayed a characteristic doublet pattern on immunoblots, suggesting the modification of N-linked glycans into complex sugars within late Golgi compartments \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. We next analyzed ERK and AKT phosphorylation in KPN and BPN cells under both basal and stimulated conditions following IGF-1 activation (100 ng/mL). In cells stably expressing shFurin, we observed a significant reduction in basal ERK and AKT phosphorylation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-H\u003cb\u003e)\u003c/b\u003e. In control KPN and BPN cells, IGF-1 stimulation increased ERK (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D\u003cb\u003e)\u003c/b\u003e and \u003cb\u003e(Supplementary Fig. S3C, D)\u003c/b\u003e and AKT (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F\u003cb\u003e)\u003c/b\u003e and \u003cb\u003e(Supplementary Fig. S3E, F)\u003c/b\u003e phosphorylation levels. However, IGF-1-induced activation of ERK and AKT was markedly diminished in shFurin-expressing KPN and BPN cells, indicating that Furin suppression impairs IGF-1-mediated signaling. This effect correlated with a reduction in pro-IGF-1R cleavage, as demonstrated by immunoblotting analysis \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, H\u003cb\u003e)\u003c/b\u003e and \u003cb\u003e(Supplementary Fig. S3G, H)\u003c/b\u003e, confirming the inhibition of Furin activity in these shFurin cells. Collectively, these findings demonstrate that Furin repression disrupts both basal and stimulated ERK and AKT activation in KRAS- and BRAF-mutant CRC cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo further investigate the impact of Furin repression on basal and stimulated downstream signaling, we performed a comprehensive screening of kinase activity in KRAS-mutated cells using PamGene technology \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-J\u003cb\u003e)\u003c/b\u003e. Substantial differences in basal kinase activity profiles were observed between control and shFurin cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D\u003cb\u003e)\u003c/b\u003e. Furin repression markedly downregulated 114 protein tyrosine kinases (PTKs) and 63 serine/threonine kinases (STKs). Only 11 PTK and 10 STK proteins were upregulated \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-D, \u003cb\u003eSupplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e)\u003c/b\u003e. The most affected PTKs included several SRC family members (LYN, LCK, SRC, FRK, FYN, SRMS, BLK and YES1), Met (MST1R, MET), TEC (TEC, BMX) and AXL (MERTK), whereas the significantly impacted STKs included CAMK4, PKA (PRKACA, PRKACB, PRKX), PKC (PKRCA), and PKG (PRKG1-2) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, \u003cb\u003eSupplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e, Supplementary Fig. S4A).\u003c/b\u003e Upon stimulation with IGF-1 (100 ng/mL), the control cells showed increased phosphorylation of 111 PTKs and 43 STKs \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B, E, F; \u003cb\u003eSupplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e; Supplementary Fig. S4B)\u003c/b\u003e. The most enriched PTKs included the families VEGFR (KDR, FLT4), SRC (FYN, BLK, FRK, LCK, HCK, and SRMS), GSK3B, ROR1, and RYK. The main upregulated STKs were MAPK family members (MAPK11, MAPK12, MAPK1, MAPK3, and MPK7), AKT (AKT1 and AKT2), CDKs (CDK18, CDK 17, and CDK 5), CDKL2, and DYRK1A. In contrast, shFurin cells displayed increased activity of only 3 PTKs (FGFR1, FGFR2, and FGFR3) and 30 STKs \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, H; \u003cb\u003eSupplementary Table S3; Supplementary Fig. S4C)\u003c/b\u003e. Among the key STKs activated by IGF-1 in shFurin were several PKs, PKAs, and PKG family members \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, H; \u003cb\u003eSupplementary Table S3; \u0026amp; S4, Supplementary Fig. S4C)\u003c/b\u003e. No MAPK or AKT family members were found to be activated. When non-stimulated and IGF-1-activated cells (control and shFurin KRAS-mutated cells) were compared, dramatic differences in PTK- and STK-activated kinases were also observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI, J, \u003cb\u003eSupplementary Table S3, Supplementary Fig. S4D)\u003c/b\u003e. These findings highlight the key role of Furin in both basal and stimulated PTK and STK kinases in KRAS-mutated cells. To elucidate the broader impact of Furin suppression on oncogenic signaling, we analyzed mean kinase statistics and scores for branches and nodes in the phylogenetic tree of the human protein kinase family \u003cb\u003e(Supplementary Fig. S6A)\u003c/b\u003e. The top upstream kinases among the significantly altered PTK/STK peptides following Furin silencing in the absence or presence of IGF-1, they were mapped to distinct kinase families, including tyrosine kinases (TKs), AGC kinases, and CAMK kinases \u003cb\u003e(Supplementary Fig. S5, Supplementary Fig. S6, Supplementary Table S4)\u003c/b\u003e. Collectively, these findings suggest that Furin repression disrupts multiple oncogenic signaling pathways under both basal \u003cb\u003e(Supplementary Fig. S5B)\u003c/b\u003e and stimulated \u003cb\u003e(Supplementary Fig. S 5C)\u003c/b\u003e conditions in KRAS-mutated cells, highlighting its role in kinase network modulation. These finding suggest that Furin repression in these cells affect the signaling of various KRAS-associated signaling pathways \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eRegulation of COX-2 (cyclooxygenase-2) expression by Furin in colorectal cancer with KRAS and BRAF mutations\u003c/h2\u003e\u003cp\u003eWe previously reported that Furin inhibition leads to a reduction in COX-2 protein levels in HCT116 and KM20 cells, which harbor KRAS and BRAF mutations, respectively, whereas this effect was not observed in HCA7 cells that lack these mutations \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. To further investigate the role of Furin in regulating COX-2 expression in colorectal cancer (CRC) with KRAS and BRAF mutations, we first analyzed the expression of PTGS2 (COX-2) and its associated receptors in KPN and BPN cells, as well as in their respective Furin-silenced counterparts (KPN/shFurin and BPN/shFurin). Furin repression led to a significant reduction in COX-2 expression in both KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(Supplementary Fig. S7A)\u003c/b\u003e cells. Consistently, tumors derived from mice injected with KPN/shFurin or BPN/shFurin cells also showed decreased COX-2 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C; \u003cb\u003eSupplementary Fig. S7B, C)\u003c/b\u003e. In parallel, the expression of PTGES (prostaglandin E synthase) and prostaglandin E receptors (PTGER1, PTGER3, and PTGER4) was significantly downregulated in both Furin-silenced cell lines and corresponding induced tumor tissues \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA; \u003cb\u003eSupplementary Fig. S7A)\u003c/b\u003e, further supporting Furin\u0026rsquo;s involvement in the COX-2 regulatory network in CRC. Using publicly available datasets from GEPIA, we observed a weak but statistically significant correlation between FURIN and PTGS2 expression in CRC patient samples \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Additionally, the expression levels of PTGER1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e, PTGER3 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e, PTGER4 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG\u003cb\u003e)\u003c/b\u003e, and PTGES \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH\u003cb\u003e)\u003c/b\u003e all showed moderate but significant positive correlations with FURIN. These results reinforce a potential role for Furin in modulating the COX-2 signaling axis in KRAS\u003cem\u003e-\u003c/em\u003e and BRAF-mutant CRC.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eFurin repression abrogates COX-2-mediated tumor growth and angiogenesis induced by colorectal cancer with KRAS and BRAF mutations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the role of Furin in COX-2\u0026ndash;mediated growth of cancer cells harboring KRAS and BRAF mutations, we stably overexpressed COX-2 in KPN and BPN cell lines (COX-2 cells) as well as in their corresponding shFurin cells (shFurin/COX-2). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ, COX-2 overexpression significantly enhanced cell proliferation in both control and shFurin-expressing cells, as measured by the WST-1 assay. This increase in proliferation was less pronounced in KPN/shFurin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI\u003cb\u003e)\u003c/b\u003e and BPN/shFurin \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ\u003cb\u003e)\u003c/b\u003e cells. Colony formation assays revealed that COX-2 overexpression increased the number of colonies in both control and shFurin-expressing cells; however, colony numbers remained lower in shFurin cells compared with controls \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK; \u003cb\u003eFig. Supplementary Fig. S7D, E)\u003c/b\u003e. Consistent with these observations, organoids derived from KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL, M\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(Supplementary Fig. S7F, G)\u003c/b\u003e COX-2-expressing cells were larger than controls, whereas shFurin organoids were smaller than their respective controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL, M; \u003cb\u003eSupplementary Fig. S7F, G).\u003c/b\u003e Injection of COX-2-expressing colon cancer cells into mice showed that control/COX-2 cells induced a marked increase in tumor growth \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eO\u003cb\u003e)\u003c/b\u003e. In contrast, this growth enhancement was attenuated in mice injected with shFurin/COX-2 cells, supporting the notion that Furin repression limits COX-2\u0026ndash;mediated tumorigenesis.\u003c/p\u003e\u003cp\u003ePrevious studies have shown that COX-2 promotes tumor growth by inducing angiogenesis within the tumor microenvironment (Wang \u0026amp; Dubois, 2010). To assess the impact of Furin on COX-2\u0026ndash;mediated angiogenesis, we analyzed vessel density in tumors via CD31 immunostaining. Tumors derived from shFurin cells exhibited reduced CD31 expression compared with control tumors \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eP, Q\u003cb\u003e)\u003c/b\u003e. COX-2 expression in both control and shFurin tumors was associated with enhanced angiogenesis, reflected by high vessel density in COX-2\u0026ndash;expressing tumors. However, angiogenesis was significantly less pronounced in shFurin/COX-2 tumors, indicating that Furin repression markedly impairs COX-2-mediated angiogenic processes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eP, Q\u003cb\u003e)\u003c/b\u003e. These results demonstrate that Furin repression suppresses COX-2-mediated tumor growth by limiting COX-2 expression and angiogenic processes in the tumor microenvironment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eTGF-β1 activation by Furin enhances COX-2 levels in KRAS- and BRAF-mutant CRC\u003c/h2\u003e\u003cp\u003eTo further investigate the mechanisms linking Furin to COX-2 repression in shFurin cells, we first analyzed the effect of TGF-β1 processing on COX-2 expression. Indeed, TGF-β1 has previously been shown to be processed by Furin \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e and to mediate COX-2 expression in colon cancer cells \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-D, stimulation of control KPN and BPN cells with exogenous TGF-β1 (5 ng/ml) significantly induced COX-2 expression at the protein level, as assessed by immunoblotting analysis. Additionally, the expression of proTGF-β1 cDNA in control KPN and BPN cells also induced COX-2 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-H\u003cb\u003e)\u003c/b\u003e, with proTGF-β1 being efficiently converted into TGF-β1 in these cells. In contrast, the expression of proTGF-β1 cDNA in KPN and BPN shFurin cells did not significantly increase COX-2 expression compared to that in control cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-H\u003cb\u003e)\u003c/b\u003e, suggesting the critical importance of TGF-β1 processing by Furin for its functional activity in regulating COX-2 expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eCOX-2 mediates TGF-β1 activation and Furin production in KPN and BPN cells\u003c/h2\u003e\u003cp\u003eTGF-β1 has been previously shown to induce Furin expression via Smad2/3 phosphorylation, thereby promoting the activation and processing of other Furin-dependent proteins \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Similarly, treatment of KPN and BPN cells with recombinant TGF-β1 (5 ng/ml) significantly upregulated Furin expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI-L\u003cb\u003e)\u003c/b\u003e. Conversely, Furin repression in KPN and BPN shFurin cells led to a marked reduction in TGF-β1 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eM, N\u003cb\u003e)\u003c/b\u003e, highlighting a positive feedback loop between Furin and the processed TGF-β1. Using the web server GEPIA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/\u003c/span\u003e\u003cspan address=\"http://gepia.cancer-pku.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), we identified a positive correlation between TGF-β1 and Furin (R\u0026thinsp;=\u0026thinsp;0.36) as well as between TGF-β1 and the COX-2 gene (PTGS2) (R\u0026thinsp;=\u0026thinsp;0.34) in patients with colorectal tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eO, P\u003cb\u003e)\u003c/b\u003e. Collectively, these results indicate that COX-2 accumulation in CRC cells with KRAS and BRAF mutations is directly linked to TGF-β1 cleavage by Furin.\u003c/p\u003e\u003cp\u003eTo explore whether COX-2 modulates TGF-β1 levels, we first assessed basal TGF-β1 expression in control and shFurin cells, and observed a notable reduction in shFurin cells \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eQ-V\u003cb\u003e)\u003c/b\u003e. Overexpression of COX-2 in control KPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eQ, R, S\u003cb\u003e)\u003c/b\u003e and BPN \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eT, U, V\u003cb\u003e)\u003c/b\u003e cells significantly increased TGF-β1 levels, whereas this effect was less pronounced in the corresponding shFurin cells.\u003c/p\u003e\u003cp\u003eNext, we examined the effect of COX-2 inhibition using celecoxib, a selective COX-2 inhibitor known to suppress inflammation and tumor progression by blocking the production of proinflammatory prostaglandins \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Treatment of KPN and BPN cells with celecoxib led to a significant reduction in COX-2 levels \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B\u003cb\u003e)\u003c/b\u003e, which was accompanied by a decreased expression of TGF-β1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, C\u003cb\u003e)\u003c/b\u003e and phosphorylated Smad2 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, D\u003cb\u003e).\u003c/b\u003e Notably, Furin expression was also reduced by celecoxib treatment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, E\u003cb\u003e)\u003c/b\u003e. Moreover, combined treatment with celecoxib and the Furin inhibitor MI-1148 resulted in more pronounced suppression of COX-2, TGF-β1, and Furin expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-E\u003cb\u003e)\u003c/b\u003e. These findings revealed a regulatory axis in which COX-2 enhances TGF-β1 activation and Furin expression.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eFurin and COX-2 interaction in KRAS\u003c/b\u003e\u003cb\u003e-\u003c/b\u003e \u003cb\u003eand BRAF\u003c/b\u003e\u003cb\u003e-\u003c/b\u003e\u003cb\u003emutant mice colorectal tumors\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo assess the relevance of the Furin and COX-2 interaction \u003cem\u003ein vivo\u003c/em\u003e, we injected control KPN, shFurin, COX-2, and shFurin/COX-2 cells into syngeneic mice and monitored the tumor growth over time. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF, tumors derived from shFurin cells exhibited significantly reduced growth compared to control tumors. This reduction in tumor size was associated with decreased TGF-β1 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, H, \u003cb\u003eSupplementary Fig. S8)\u003c/b\u003e and reduced Smad2 activation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, I\u003cb\u003e).\u003c/b\u003e Conversely, tumors derived from COX-2-overexpressing cells exhibited increased tumor growth accompanied by increased TGF-β1 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, H\u003cb\u003e)\u003c/b\u003e and Smad2 activation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, I\u003cb\u003e).\u003c/b\u003e Interestingly, tumors derived from shFurin/COX-2 cells showed reduced TGF-β1 expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, H\u003cb\u003e)\u003c/b\u003e and Smad2 activation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, I\u003cb\u003e)\u003c/b\u003e compared to COX-2 tumors, suggesting that Furin repression dampens COX-2-mediated upregulation of TGF-β1 expression and signaling. These findings further support the role of Furin in regulating COX-2-driven tumor progression and highlight the potential therapeutic benefit of targeting Furin and COX2 interaction in colorectal cancer \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAn improved understanding of the molecular pathogenesis of mutant BRAF- and KRAS-driven CRCs will inform the development of effective preventative and therapeutic strategies for this aggressive CRC subset. When KRAS is mutated, the downstream signaling pathway MAPK is activated, leading to cellular proliferation and tumor progression. KRAS mutations are predictive markers of colon cancer \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e and resistance to therapy \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Similarly, as BRAF is downstream of RAS in the MAPK/ERK signaling pathway, mutated BRAF is assumed to have the same resistance to therapeutic agents, such as anti-EGFR agents, as in RAS-mutated colon tumors \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Here, we revealed that Furin repression in cancer cells with KRAS or BRAF mutations, shows low resistance to standard CRC chemotherapy such as 5-FU, Oxaliplatin and/or irinotecan. The study also describes the involvement of the Furin and COX2 interaction through TGF-b1 cleavage in oncogenic BRAF and KRAS mutations that promote tumor progression. Indeed, targeting Furin and its downstream effector COX-2 profoundly disrupted the malignant phenotype of KRAS- and BRAF-mutated CRC cell lines (KPN and BPN). These models, which recapitulate the adenoma-to-metastasis transition \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, enabled us to elucidate the functional role of Furin in KRAS/BRAF-driven CRC progression. In this CRC, Furin controls COX-2 expression via TGF-β1/Smad signaling and probably other signaling pathways, establishing a positive feedback loop that sustains tumor progression. Furin facilitates the proteolytic activation of TGF-β1, which in turn enhances Smad-mediated COX-2 transcription, reinforcing TGF-β1 expression and further increasing Furin levels. This reciprocal regulation highlights the clinical relevance of the Furin/TGF-β1/COX-2 axis in colorectal cancer, particularly in tumors harboring KRAS or BRAF mutations. By linking oncogenic signaling with pathways involved in angiogenesis and immune modulation, this axis appears to contribute to tumor progression and resistance to therapy. Importantly, analysis of colorectal cancer patient datasets revealed strong co-expression of FURIN, KRAS, BRAF, COX-2, and TGF-β1, further supporting its significance in the clinical setting.\u003c/p\u003e\u003cp\u003eUsing shRNA-mediated Furin silencing, we repressed multiple signaling pathways linked to KRAS and BRAF oncogenic activity, not only at basal levels but also in response to Furin substrate IGF-1R activation, which is known to stimulate PI3K/MAPK signaling pathways \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. This effect is associated with impaired IGF-1 receptor processing. Furthermore, Furin inhibition markedly reduced cell proliferation, colony formation, and tumorigenic potential both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. COX-2 overexpression partially rescued the inhibitory effects of Furin silencing and further exacerbated the malignant phenotype of control cells, highlighting its role as a critical downstream effector of Furin in driving tumorigenic properties. Previously, the association between COX-2 expression and colorectal cancer mortality was reported to be stronger in BRAF-mutated tumors than in BRAF-wild-type tumors, supporting the interactive roles of COX-2 expression and BRAF mutation status in the prognostication of patients with colorectal cancer \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Similarly, the overexpression of activated RAS isoforms was reported to stimulate COX-2 expression \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e, and both the presence of mutant KRAS and high-level COX-2 expression were correlated with tumor recurrence after surgery, with metastatic spread to the liver and reduced survival \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Low COX-2 expression has been previously associated with improved survival in patients with colorectal adenocarcinoma harboring KRAS or BRAF mutations, but not in those with wild-type KRAS or BRAF \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Suppression of mutant KRAS expression in colon and pancreatic cancer cells was reported to reduce COX-2 levels, suggesting a role for mutant KRAS in modulating prostaglandin accumulation by increasing its biosynthesis and/or attenuating catabolism \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Our study advances this understanding by revealing a regulatory axis in which Furin controls TGF-β1 signaling and, in turn, modulates COX-2 expression in BRAF- and KRAS-mutant colon tumors. TGF-β1 plays dual roles in CRC as both a tumor suppressor and a tumor promoter depending on disease progression in advanced stages, particularly in KRAS/BRAF-mutated contexts, and drives epithelial‒mesenchymal transition (EMT), metastasis, and immune evasion \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Our findings reveal that Furin regulates COX-2 expression via the TGF-β1/Smad pathway, forming a self-reinforcing feedback loop in which COX-2 amplifies TGF-β1 signaling and further enhances Furin expression. This circuit emerges as a potential critical driver of tumor progression in KRAS/BRAF-mutant CRC, as evidenced by the significantly reduced tumor growth observed in mice upon Furin silencing. In addition, tumors derived from KRAS- and BRAF-mutant cancer cells expressing shRNA targeting Furin exhibited a marked increase in CD8\u0026thinsp;+\u0026thinsp;T cell infiltration, highlighting a potential immunomodulatory role for this pathway. This observation aligns with previous studies showing that Furin inhibition enhances the presence of CD8\u0026thinsp;+\u0026thinsp;T cells in the tumor microenvironment, possibly through the regulation of immune checkpoints, such as PD-1 expression in T cells \u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Together, these findings suggest that targeting the Furin in CRC with KRAS or BRAF mutations may offer dual therapeutic advantages: directly suppressing tumor growth by disrupting oncogenic signaling and reshaping the immune microenvironment to enhance antitumor immunity.\u003c/p\u003e\u003cp\u003eAlthough COX-2 has long been implicated in inflammation-driven tumorigenesis, our findings demonstrate that its integration within the TGF-β1 signaling network is more complex and functionally significant than previously understood \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. Targeting multiple components of this pathway simultaneously could counteract compensatory mechanisms and improve the therapeutic efficacy. For example, combining Furin and COX-2 inhibitors with novel KRAS G12D inhibitors such as MRTX1133 \u003csup\u003e52,53\u003c/sup\u003e may enhance treatment responses by disrupting complementary oncogenic pathways. Notably, therapies targeting KRAS G12D face challenges because of their non-covalent nature, which may result in reversible binding and reduced potency \u003csup\u003e\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Integrating these agents with inhibitors of the Furin could provide a more robust therapeutic strategy by simultaneously targeting multiple tumor-promoting pathways. This multibranched approach has the potential to overcome resistance mechanisms frequently observed with single-agent therapies, ultimately improving outcomes in patients with KRAS/BRAF-mutated CRC. Thereby, our findings establish the Furin/TGF-β1/COX-2 axis as a key driver of CRC progression, particularly in KRAS- and BRAF-mutated contexts. This regulatory network represents a promising therapeutic target, offering new opportunities to overcome the limitations of conventional treatment strategies for CRC and advancing precision medicine for patients with KRAS and BRAF mutations.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Regional Nouvelle Aquitaine, Foundation Bergoni\u0026eacute;, and La Ligue Contre le Cancer.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYL performed the experiments, including data curation, analysis, and validation, and wrote the original draft. GS contributed to investigation and methodology. ZH performed bioinformatics and software analyses. ST contributed to investigation and methodological support. TS provided methodological expertise. JC and AMK conceived and designed the research, acquired funding and resources, curated and analyzed data, supervised the study, and revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrelation analysis of Furin, KRAS, BRAF, COX-2, PTGER1, PTGER3, PTGER4, PTGES, and TGF-\u0026beta;1 expression was conducted via the Gene Expression Profiling Interactive Analysis (GEPIA) platform (http://gepia.cancer-pku.cn/). Patients with KRAS and BRAF mutations were selected from the TCGA database.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I \u003cem\u003eet al.\u003c/em\u003e Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e 2024; \u003cstrong\u003e74\u003c/strong\u003e: 229\u0026ndash;263.\u003c/li\u003e\n\u003cli\u003eDekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. \u003cem\u003eLancet\u003c/em\u003e 2019; \u003cstrong\u003e394\u003c/strong\u003e: 1467\u0026ndash;1480.\u003c/li\u003e\n\u003cli\u003eLi Q, Geng S, Luo H, Wang W, Mo Y-Q, Luo Q \u003cem\u003eet al.\u003c/em\u003e Signaling pathways involved in colorectal cancer: pathogenesis and targeted therapy. \u003cem\u003eSig Transduct Target Ther\u003c/em\u003e 2024; \u003cstrong\u003e9\u003c/strong\u003e: 1\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eStefani C, Miricescu D, Stanescu-Spinu I-I, Nica RI, Greabu M, Totan AR \u003cem\u003eet al.\u003c/em\u003e Growth Factors, PI3K/AKT/mTOR and MAPK Signaling Pathways in Colorectal Cancer Pathogenesis: Where Are We Now? \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2021; \u003cstrong\u003e22\u003c/strong\u003e: 10260.\u003c/li\u003e\n\u003cli\u003eGuo L, Wang Y, Yang W, Wang C, Guo T, Yang J \u003cem\u003eet al.\u003c/em\u003e Molecular Profiling Provides Clinical Insights Into Targeted and Immunotherapies as Well as Colorectal Cancer Prognosis. \u003cem\u003eGastroenterology\u003c/em\u003e 2023; \u003cstrong\u003e165\u003c/strong\u003e: 414-428.e7.\u003c/li\u003e\n\u003cli\u003eXie Y-H, Chen Y-X, Fang J-Y. Comprehensive review of targeted therapy for colorectal cancer. \u003cem\u003eSig Transduct Target Ther\u003c/em\u003e 2020; \u003cstrong\u003e5\u003c/strong\u003e: 1\u0026ndash;30.\u003c/li\u003e\n\u003cli\u003eSanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC \u003cem\u003eet al.\u003c/em\u003e Oncogenic Signaling Pathways in The Cancer Genome Atlas. \u003cem\u003eCell\u003c/em\u003e 2018; \u003cstrong\u003e173\u003c/strong\u003e: 321-337.e10.\u003c/li\u003e\n\u003cli\u003eGaiani F, Marchesi F, Negri F, Greco L, Malesci A, de\u0026rsquo;Angelis GL \u003cem\u003eet al.\u003c/em\u003e Heterogeneity of Colorectal Cancer Progression: Molecular Gas and Brakes. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2021; \u003cstrong\u003e22\u003c/strong\u003e: 5246.\u003c/li\u003e\n\u003cli\u003eSantini D, Vincenzi B, Addeo R, Garufi C, Masi G, Scartozzi M \u003cem\u003eet al.\u003c/em\u003e Cetuximab rechallenge in metastatic colorectal cancer patients: how to come away from acquired resistance? \u003cem\u003eAnn Oncol\u003c/em\u003e 2012; \u003cstrong\u003e23\u003c/strong\u003e: 2313\u0026ndash;2318.\u003c/li\u003e\n\u003cli\u003eMisale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D \u003cem\u003eet al.\u003c/em\u003e Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. \u003cem\u003eNature\u003c/em\u003e 2012; \u003cstrong\u003e486\u003c/strong\u003e: 532\u0026ndash;536.\u003c/li\u003e\n\u003cli\u003eDe Roock W, Claes B, Bernasconi D, De Schutter J, Biesmans B, Fountzilas G \u003cem\u003eet al.\u003c/em\u003e Effects of KRAS, BRAF, NRAS, and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. \u003cem\u003eLancet Oncol\u003c/em\u003e 2010; \u003cstrong\u003e11\u003c/strong\u003e: 753\u0026ndash;762.\u003c/li\u003e\n\u003cli\u003eZhi J, Jia X-J, Yan J, Wang H-C, Feng B, Xing H-Y \u003cem\u003eet al.\u003c/em\u003e BRAFV600E mutant colorectal cancer cells mediate local immunosuppressive microenvironment through exosomal long noncoding RNAs. \u003cem\u003eWorld J Gastrointest Oncol\u003c/em\u003e 2021; \u003cstrong\u003e13\u003c/strong\u003e: 2129\u0026ndash;2148.\u003c/li\u003e\n\u003cli\u003eYe J, Lin M, Zhang C, Zhu X, Li S, Liu H \u003cem\u003eet al.\u003c/em\u003e Tissue gene mutation profiles in patients with colorectal cancer and their clinical implications. \u003cem\u003eBiomed Rep\u003c/em\u003e 2020; \u003cstrong\u003e13\u003c/strong\u003e: 43\u0026ndash;48.\u003c/li\u003e\n\u003cli\u003eSimanshu DK, Morrison DK. A Structure is Worth a Thousand Words: New Insights for RAS and RAF Regulation. \u003cem\u003eCancer Discov\u003c/em\u003e 2022; \u003cstrong\u003e12\u003c/strong\u003e: 899\u0026ndash;912.\u003c/li\u003e\n\u003cli\u003eDrosten M, Barbacid M. Targeting the MAPK Pathway in KRAS-Driven Tumors. \u003cem\u003eCancer Cell\u003c/em\u003e 2020; \u003cstrong\u003e37\u003c/strong\u003e: 543\u0026ndash;550.\u003c/li\u003e\n\u003cli\u003ePai RK, Jayachandran P, Koong AC, Chang DT, Kwok S, Ma L \u003cem\u003eet al.\u003c/em\u003e BRAF-mutated, microsatellite-stable adenocarcinoma of the proximal colon: an aggressive adenocarcinoma with poor survival, mucinous differentiation, and adverse morphologic features. \u003cem\u003eAm J Surg Pathol\u003c/em\u003e 2012; \u003cstrong\u003e36\u003c/strong\u003e: 744\u0026ndash;752.\u003c/li\u003e\n\u003cli\u003eRoa P, Bremer NV, Foglizzo V, Cocco E. Mutations in the Serine/Threonine Kinase BRAF: Oncogenic Drivers in Solid Tumors. \u003cem\u003eCancers\u003c/em\u003e 2024; \u003cstrong\u003e16\u003c/strong\u003e: 1215.\u003c/li\u003e\n\u003cli\u003eDe Roock W, De Vriendt V, Normanno N, Ciardiello F, Tejpar S. KRAS, BRAF, PIK3CA, and PTEN mutations: implications for targeted therapies in metastatic colorectal cancer. \u003cem\u003eLancet Oncol\u003c/em\u003e 2011; \u003cstrong\u003e12\u003c/strong\u003e: 594\u0026ndash;603.\u003c/li\u003e\n\u003cli\u003evan Grieken NCT, Aoyma T, Chambers PA, Bottomley D, Ward LC, Inam I \u003cem\u003eet al.\u003c/em\u003e KRAS and BRAF mutations are rare and related to DNA mismatch repair deficiency in gastric cancer from the East and the West: Results from a large international multicentre study. \u003cem\u003eBr J Cancer\u003c/em\u003e 2013; \u003cstrong\u003e108\u003c/strong\u003e: 1495\u0026ndash;1501.\u003c/li\u003e\n\u003cli\u003eHaling JR, Sudhamsu J, Yen I, Sideris S, Sandoval W, Phung W \u003cem\u003eet al.\u003c/em\u003e Structure of the BRAF-MEK Complex Reveals a Kinase Activity Independent Role for BRAF in MAPK Signaling. \u003cem\u003eCancer Cell\u003c/em\u003e 2014; \u003cstrong\u003e26\u003c/strong\u003e: 402\u0026ndash;413.\u003c/li\u003e\n\u003cli\u003eHe Z, Khatib A-M, Creemers JWM. The proprotein convertase furin in cancer: more than an oncogene. \u003cem\u003eOncogene\u003c/em\u003e 2022; \u003cstrong\u003e41\u003c/strong\u003e: 1252\u0026ndash;1262.\u003c/li\u003e\n\u003cli\u003eSiegfried G, Descarpentrie J, Evrard S, Khatib A-M. Proprotein convertases: Key players in inflammation-related malignancies and metastasis. \u003cem\u003eCancer Lett\u003c/em\u003e 2020; \u003cstrong\u003e473\u003c/strong\u003e: 50\u0026ndash;61.\u003c/li\u003e\n\u003cli\u003eNg S, A P. The biology and therapeutic targeting of the proprotein convertases. \u003cem\u003eNature reviews Drug discovery\u003c/em\u003e 2012; \u003cstrong\u003e11\u003c/strong\u003e. doi:10.1038/nrd3699.\u003c/li\u003e\n\u003cli\u003eTeuchert M, Sch\u0026auml;fer W, Bergh\u0026ouml;fer S, Hoflack B, Klenk HD, Garten W. Sorting of furin at the trans-Golgi network. Interaction of the cytoplasmic tail sorting signals with AP-1 Golgi-specific assembly proteins. \u003cem\u003eJ Biol Chem\u003c/em\u003e 1999; \u003cstrong\u003e274\u003c/strong\u003e: 8199\u0026ndash;8207.\u003c/li\u003e\n\u003cli\u003eBraun E, Sauter D. Furin-mediated protein processing in infectious diseases and cancer. \u003cem\u003eClinical \u0026amp; Translational Immunology\u003c/em\u003e 2019; \u003cstrong\u003e8\u003c/strong\u003e: e1073.\u003c/li\u003e\n\u003cli\u003eThomas G. Furin at the cutting edge: From protein traffic to embryogenesis and disease. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 2002; \u003cstrong\u003e3\u003c/strong\u003e: 753\u0026ndash;766.\u003c/li\u003e\n\u003cli\u003eTom\u0026eacute; M, Pappalardo A, Soulet F, L\u0026oacute;pez JJ, Olaizola J, Leger Y \u003cem\u003eet al.\u003c/em\u003e Inactivation of Proprotein Convertases in T Cells Inhibits PD-1 Expression and Creates a Favorable Immune Microenvironment in Colorectal Cancer. \u003cem\u003eCancer Res\u003c/em\u003e 2019; \u003cstrong\u003e79\u003c/strong\u003e: 5008\u0026ndash;5021.\u003c/li\u003e\n\u003cli\u003eHe Z, Thorrez L, Siegfried G, Meulemans S, Evrard S, Tejpar S \u003cem\u003eet al.\u003c/em\u003e The proprotein convertase furin is a pro-oncogenic driver in KRAS and BRAF driven colorectal cancer. \u003cem\u003eOncogene\u003c/em\u003e 2020; \u003cstrong\u003e39\u003c/strong\u003e: 3571\u0026ndash;3587.\u003c/li\u003e\n\u003cli\u003eJaaks P, Bernasconi M. The proprotein convertase furin in tumour progression. \u003cem\u003eInt J Cancer\u003c/em\u003e 2017; \u003cstrong\u003e141\u003c/strong\u003e: 654\u0026ndash;663.\u003c/li\u003e\n\u003cli\u003eJackstadt R, Hooff SR van, Leach JD, Cortes-Lavaud X, Lohuis JO, Ridgway RA \u003cem\u003eet al.\u003c/em\u003e Epithelial NOTCH Signaling Rewires the Tumor Microenvironment of Colorectal Cancer to Drive Poor-Prognosis Subtypes and Metastasis. \u003cem\u003eCancer Cell\u003c/em\u003e 2019; \u003cstrong\u003e36\u003c/strong\u003e: 319-336.e7.\u003c/li\u003e\n\u003cli\u003eIvanova T, Hardes K, Kallis S, Dahms SO, Than ME, K\u0026uuml;nzel S \u003cem\u003eet al.\u003c/em\u003e Optimization of Substrate-Analogue Furin Inhibitors. \u003cem\u003eChemMedChem\u003c/em\u003e 2017; \u003cstrong\u003e12\u003c/strong\u003e: 1953\u0026ndash;1968.\u003c/li\u003e\n\u003cli\u003eScamuffa N, Sfaxi F, Ma J, Lalou C, Seidah N, Calvo F \u003cem\u003eet al.\u003c/em\u003e Prodomain of the proprotein convertase subtilisin/kexin Furin (ppFurin) protects from tumor progression and metastasis. \u003cem\u003eCarcinogenesis\u003c/em\u003e 2014; \u003cstrong\u003e35\u003c/strong\u003e: 528\u0026ndash;536.\u003c/li\u003e\n\u003cli\u003eDemoures B, Soulet F, Descarpentrie J, Galeano-Otero I, Sanchez Collado J, Casado M \u003cem\u003eet al.\u003c/em\u003e Repression of apelin Furin cleavage sites provides antimetastatic strategy in colorectal cancer. \u003cem\u003eEMBO Mol Med\u003c/em\u003e 2025. doi:10.1038/s44321-025-00196-5.\u003c/li\u003e\n\u003cli\u003eZdanov S, Mandapathil M, Abu Eid R, Adamson-Fadeyi S, Wilson W, Qian J \u003cem\u003eet al.\u003c/em\u003e Mutant KRAS Conversion of Conventional T Cells into Regulatory T Cells. \u003cem\u003eCancer Immunol Res\u003c/em\u003e 2016; \u003cstrong\u003e4\u003c/strong\u003e: 354\u0026ndash;365.\u003c/li\u003e\n\u003cli\u003eMassagu\u0026eacute; J, Sheppard D. TGF-\u0026beta; signaling in health and disease. \u003cem\u003eCell\u003c/em\u003e 2023; \u003cstrong\u003e186\u003c/strong\u003e: 4007\u0026ndash;4037.\u003c/li\u003e\n\u003cli\u003eCoelho MA, de Carn\u0026eacute; Tr\u0026eacute;cesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M \u003cem\u003eet al.\u003c/em\u003e Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. \u003cem\u003eImmunity\u003c/em\u003e 2017; \u003cstrong\u003e47\u003c/strong\u003e: 1083-1099.e6.\u003c/li\u003e\n\u003cli\u003eDubois CM, Blanchette F, Laprise MH, Leduc R, Grondin F, Seidah NG. Evidence that furin is an authentic transforming growth factor-beta1-converting enzyme. \u003cem\u003eAm J Pathol\u003c/em\u003e 2001; \u003cstrong\u003e158\u003c/strong\u003e: 305\u0026ndash;316.\u003c/li\u003e\n\u003cli\u003ede Ara\u0026uacute;jo WM, Tanaka MN, Lima PHS, de Moraes CF, Leve F, Bastos LG \u003cem\u003eet al.\u003c/em\u003e TGF-\u0026beta; acts as a dual regulator of COX-2/PGE2 tumor promotion depending of its cross-interaction with H-Ras and Wnt/\u0026beta;-catenin pathways in colorectal cancer cells. \u003cem\u003eCell Biol Int\u003c/em\u003e 2021; \u003cstrong\u003e45\u003c/strong\u003e: 662\u0026ndash;673.\u003c/li\u003e\n\u003cli\u003eBlanchette F, Rudd P, Grondin F, Attisano L, Dubois CM. Involvement of Smads in TGFbeta1-induced furin (fur) transcription. \u003cem\u003eJ Cell Physiol\u003c/em\u003e 2001; \u003cstrong\u003e188\u003c/strong\u003e: 264\u0026ndash;273.\u003c/li\u003e\n\u003cli\u003eKoki AT, Masferrer JL. Celecoxib: A Specific COX-2 Inhibitor with Anticancer Properties. \u003cem\u003eCancer Control\u003c/em\u003e 2002; \u003cstrong\u003e9\u003c/strong\u003e: 28\u0026ndash;35.\u003c/li\u003e\n\u003cli\u003eArrington AK, Heinrich EL, Lee W, Duldulao M, Patel S, Sanchez J \u003cem\u003eet al.\u003c/em\u003e Prognostic and predictive roles of KRAS mutation in colorectal cancer. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2012; \u003cstrong\u003e13\u003c/strong\u003e: 12153\u0026ndash;12168.\u003c/li\u003e\n\u003cli\u003eSiddiqui AD, Piperdi B. KRAS mutation in colon cancer: a marker of resistance to EGFR-I therapy. \u003cem\u003eAnn Surg Oncol\u003c/em\u003e 2010; \u003cstrong\u003e17\u003c/strong\u003e: 1168\u0026ndash;1176.\u003c/li\u003e\n\u003cli\u003eHuang L, Fu L. Mechanisms of resistance to EGFR tyrosine kinase inhibitors. \u003cem\u003eActa Pharm Sin B\u003c/em\u003e 2015; \u003cstrong\u003e5\u003c/strong\u003e: 390\u0026ndash;401.\u003c/li\u003e\n\u003cli\u003eScamuffa N, Siegfried G, Bontemps Y, Ma L, Basak A, Cherel G \u003cem\u003eet al.\u003c/em\u003e Selective inhibition of proprotein convertases represses the metastatic potential of human colorectal tumor cells. \u003cem\u003eJ Clin Invest\u003c/em\u003e 2008; \u003cstrong\u003e118\u003c/strong\u003e: 352\u0026ndash;363.\u003c/li\u003e\n\u003cli\u003eGogas H, Dummer R, Ascierto PA, Arance A, Mandal\u0026agrave; M, Liszkay G \u003cem\u003eet al.\u003c/em\u003e Corrigendum to \u0026lsquo;Quality of life in patients with BRAF-mutant melanoma receiving the combination encorafenib plus binimetinib: Results from a multicentre, open-label, randomised, phase III study (COLUMBUS)\u0026rsquo; [European Journal of Cancer 152 (2021) 116-128]. \u003cem\u003eEur J Cancer\u003c/em\u003e 2022; \u003cstrong\u003e160\u003c/strong\u003e: 287\u0026ndash;288.\u003c/li\u003e\n\u003cli\u003eSheng H, Shao J, Dubois RN. K-Ras-mediated increase in cyclooxygenase 2 mRNA stability involves activation of the protein kinase B1. \u003cem\u003eCancer Res\u003c/em\u003e 2001; \u003cstrong\u003e61\u003c/strong\u003e: 2670\u0026ndash;2675.\u003c/li\u003e\n\u003cli\u003eKemeny NE, Chou JF, Capanu M, Gewirtz AN, Cercek A, Kingham TP \u003cem\u003eet al.\u003c/em\u003e KRAS mutation influences recurrence patterns in patients undergoing hepatic resection of colorectal metastases. \u003cem\u003eCancer\u003c/em\u003e 2014; \u003cstrong\u003e120\u003c/strong\u003e: 3965\u0026ndash;3971.\u003c/li\u003e\n\u003cli\u003ePurnama A, Lukman K, Rudiman R, Prasetyo D, Fuadah Y, Nugraha P \u003cem\u003eet al.\u003c/em\u003e The prognostic value of COX-2 in predicting metastasis of patients with colorectal cancer: A systematic review and meta analysis. \u003cem\u003eHeliyon\u003c/em\u003e 2023; \u003cstrong\u003e9\u003c/strong\u003e: e21051.\u003c/li\u003e\n\u003cli\u003eGrabocka E, Bar-Sagi D. Mutant KRAS Enhances Tumor Cell Fitness by Upregulating Stress Granules. \u003cem\u003eCell\u003c/em\u003e 2016; \u003cstrong\u003e167\u003c/strong\u003e: 1803-1813.e12.\u003c/li\u003e\n\u003cli\u003eHe Z, Khatib A-M, Creemers JWM. Loss of the proprotein convertase Furin in T cells represses mammary tumorigenesis in oncogene-driven triple negative breast cancer. \u003cem\u003eCancer Lett\u003c/em\u003e 2020; \u003cstrong\u003e484\u003c/strong\u003e: 40\u0026ndash;49.\u003c/li\u003e\n\u003cli\u003eIkushima H, Miyazono K. TGF\u0026beta; signalling: a complex web in cancer progression. \u003cem\u003eNat Rev Cancer\u003c/em\u003e 2010; \u003cstrong\u003e10\u003c/strong\u003e: 415\u0026ndash;424.\u003c/li\u003e\n\u003cli\u003eWang X, Allen S, Blake JF, Bowcut V, Briere DM, Calinisan A \u003cem\u003eet al.\u003c/em\u003e Identification of MRTX1133, a Noncovalent, Potent, and Selective KRASG12D Inhibitor. \u003cem\u003eJ Med Chem\u003c/em\u003e 2022; \u003cstrong\u003e65\u003c/strong\u003e: 3123\u0026ndash;3133.\u003c/li\u003e\n\u003cli\u003eWei D, Wang L, Zuo X, Maitra A, Bresalier RS. A Small Molecule with Big Impact: MRTX1133 Targets the KRASG12D Mutation in Pancreatic Cancer. \u003cem\u003eClin Cancer Res\u003c/em\u003e 2024; \u003cstrong\u003e30\u003c/strong\u003e: 655\u0026ndash;662.\u003c/li\u003e\n\u003cli\u003eSinghal A, Styers HC, Rub J, Li Z, Torborg SR, Kim JY \u003cem\u003eet al.\u003c/em\u003e A Classical Epithelial State Drives Acute Resistance to KRAS Inhibition in Pancreatic Cancer. \u003cem\u003eCancer Discov\u003c/em\u003e 2024; \u003cstrong\u003e14\u003c/strong\u003e: 2122\u0026ndash;2134.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7633807/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7633807/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eKRAS and BRAF mutations drive colorectal cancer (CRC) progression by sustaining aberrant signaling and promoting therapeutic resistance. Here, we identify TGF-β1-COX-2 axis as a critical regulatory pathway mediated by Furin in CRC harboring KRAS or BRAF mutation. Genetic silencing or pharmacological inhibition of Furin in KRAS-mutant (KPN) and BRAF-mutant (BPN) tumor-derived cells suppressed tumor growth, reduced angiogenesis, and enhanced CD8⁺ T cell infiltration in mouse tumor models. KRAS- and BRAF-mutant organoids with impaired Furin activity exhibited increased sensitivity to 5-FU, oxaliplatin, and irinotecan. Mechanistically, Furin inhibition via shRNA or the Furin inhibitor MI1148 blocked IGF-1 receptor and TGF-β1 precursor maturation and signaling, which was associated with repressed COX-2 expression. Conversely, COX-2 over-expression elevated TGF-β1 levels, which in turn enhanced Furin expression, establishing a feed-forward loop that promoted tumor progression and angiogenesis. Moreover, Furin inhibition largely disrupted the activity of multiple kinases linked to KRAS and BRAF oncogenic signaling. In CRC patient samples, Furin expression positively correlated with KRAS, BRAF, TGF-β1, and COX-2. Collectively, these findings identify Furin as a pivotal regulator of oncogenic signaling in KRAS- and BRAF-mutant CRC, and highlight the therapeutic potential of targeting the Furin-TGF-β1-COX-2 axis.\u003c/p\u003e","manuscriptTitle":"Furin sustains tumor-promoting signals in KRAS- and BRAF-mutated colorectal cancer by engaging the TGF-β1–COX-2 axis in a reciprocal regulatory network","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-27 14:28:34","doi":"10.21203/rs.3.rs-7633807/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-11-10T15:38:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-11-03T18:39:11+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-11-03T02:26:40+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-10-21T06:06:55+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-10-20T01:59:53+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-10-06T23:48:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-17T13:40:53+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-16T21:07:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Oncogene","date":"2025-09-16T21:07:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"oncogene","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"onc","sideBox":"Learn more about [Oncogene](http://www.nature.com/onc/)","snPcode":"41388","submissionUrl":"https://mts-onc.nature.com/cgi-bin/main.plex","title":"Oncogene","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"dbc44780-62b0-4b40-9654-fe15000c6859","owner":[],"postedDate":"October 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":55930783,"name":"Biological sciences/Cell biology"},{"id":55930784,"name":"Biological sciences/Cancer"}],"tags":[],"updatedAt":"2026-04-23T14:16:09+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-27 14:28:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7633807","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7633807","identity":"rs-7633807","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00