Anticancer effect of Epigallocatechin Gallate Loaded Nanoparticles on Head and Neck Cancer

preprint OA: closed
Full text JSON View at publisher

Abstract

Introduction: Head and neck cancer, as one of the most common cancers, causes the death of many people worldwide every year. The current approaches to treat this cancer have not been successful, and recurrence, drug resistance development, side effects, and high treatment costs are important problems necessitating the need for more effective drugs and treatment approach. Epigallocatechin gallate (EGCG) is the most plentiful and biological-active catechin in green tea with proved anticancer effect. However, the stability, low bioavailability, and short half-life, limits its clinical use. The nanocarrier development may overcome these deficiencies by improving pharmacokinetics and pharmacodynamics. Therefore, this study aimed to examine the polyethylene glycol (PEG) nanoparticles containing EGCG for their anticancer activity. Materials and methods First, PEG nanoparticles loaded with EGCG were prepared, which were then characterized by dynamic light scattering (DLS), zeta potential, and Fourier transform infrared spectroscopy (FTIR). The toxicity of nanoparticles on the TSCC-1 cancer cell line was assessed by MTT and LDH assays. Cell migration rate, colony formation ability, the apoptosis rate, and the expression level of BAX, BCL2, and VEGF genes after treatment of cancer cells with drug-loaded particles were assessed. Moreover, the effect of nanoparticles on the spheroid growth of TSCC-1 cells in three-dimensional (3D) culture was investigated. Results The results of the FTIR assay demonstrate the presence of PEG nanoparticles containing EGCG. The size and zeta potential of the drug-loaded nanoparticles and nanoparticles without EGCG were 1.62 ± 17.53 nm and − 0.166 ± 0.169 mv, and 14 ± 2.3 nm and − 0.266 ± 0.169 mv, respectively. The synthesized nanoparticles showed sustained release of the drug. Moreover, the MTT assay showed the cytotoxicity of the nanoparticles was significant at a concentration of 80 µg/ml on TSCC-1 cells. The colony formation assay showed no colonies in the groups treated with nanoparticles containing EGCG compared to the control group. The scratch test also revealed the ability of the nanoparticles to inhibit cell migration. Furthermore, the induction of delayed apoptosis by 88.3 ± 3.18% was observed in the group treated with nanoparticles at a concentration of 80 µg/ml. In addition, the expression of BCL2 and VEGF gene significantly decreased and BAX gene increased. Furthermore, the study of cultivation in the 3D environment showed a decrease in the size and growth of cell spheroids in the nanoparticle-treated group compared to the control group. Conclusion The results show that PEG nanoparticles containing EGCG have significant anticancer activity (TSCC-1) and may be a suitable treatment option for the management of squamous cell carcinoma of the head and neck.
Full text 126,386 characters · extracted from preprint-html · click to expand
Anticancer effect of Epigallocatechin Gallate Loaded Nanoparticles on Head and Neck Cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Anticancer effect of Epigallocatechin Gallate Loaded Nanoparticles on Head and Neck Cancer Zahra Khatib Zadeh, Samaneh Arab, Sohrab Kazemi, Mohadeseh Arabhalvaee, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3849470/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Introduction: Head and neck cancer, as one of the most common cancers, causes the death of many people worldwide every year. The current approaches to treat this cancer have not been successful, and recurrence, drug resistance development, side effects, and high treatment costs are important problems necessitating the need for more effective drugs and treatment approach. Epigallocatechin gallate (EGCG) is the most plentiful and biological-active catechin in green tea with proved anticancer effect. However, the stability, low bioavailability, and short half-life, limits its clinical use. The nanocarrier development may overcome these deficiencies by improving pharmacokinetics and pharmacodynamics. Therefore, this study aimed to examine the polyethylene glycol (PEG) nanoparticles containing EGCG for their anticancer activity. Materials and methods First, PEG nanoparticles loaded with EGCG were prepared, which were then characterized by dynamic light scattering (DLS), zeta potential, and Fourier transform infrared spectroscopy (FTIR). The toxicity of nanoparticles on the TSCC-1 cancer cell line was assessed by MTT and LDH assays. Cell migration rate, colony formation ability, the apoptosis rate, and the expression level of BAX, BCL2, and VEGF genes after treatment of cancer cells with drug-loaded particles were assessed. Moreover, the effect of nanoparticles on the spheroid growth of TSCC-1 cells in three-dimensional (3D) culture was investigated. Results The results of the FTIR assay demonstrate the presence of PEG nanoparticles containing EGCG. The size and zeta potential of the drug-loaded nanoparticles and nanoparticles without EGCG were 1.62 ± 17.53 nm and − 0.166 ± 0.169 mv, and 14 ± 2.3 nm and − 0.266 ± 0.169 mv, respectively. The synthesized nanoparticles showed sustained release of the drug. Moreover, the MTT assay showed the cytotoxicity of the nanoparticles was significant at a concentration of 80 µg/ml on TSCC-1 cells. The colony formation assay showed no colonies in the groups treated with nanoparticles containing EGCG compared to the control group. The scratch test also revealed the ability of the nanoparticles to inhibit cell migration. Furthermore, the induction of delayed apoptosis by 88.3 ± 3.18% was observed in the group treated with nanoparticles at a concentration of 80 µg/ml. In addition, the expression of BCL2 and VEGF gene significantly decreased and BAX gene increased. Furthermore, the study of cultivation in the 3D environment showed a decrease in the size and growth of cell spheroids in the nanoparticle-treated group compared to the control group. Conclusion The results show that PEG nanoparticles containing EGCG have significant anticancer activity (TSCC-1) and may be a suitable treatment option for the management of squamous cell carcinoma of the head and neck. Head and neck Cancer Epigallocatechin gallate Nanoparticles Green tea 3-dimensional culture Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 1. Introduction The head and neck squamous cell carcinomas (HNSCC) include epithelial malignancies originating in the mucosa of the oral cavity, nose and sinuses, pharynx, and larynx. It has been reported that 37,200 patients are anew diagnosed with HNSCC in the United States (USA) each year [ 1 ]. In developed countries, it is the sixth most common cancer with around 350,000 deaths annually [ 2 ]. The majority (85%) of HNC is oral cavity cancer, mostly oral squamous cell carcinoma [ 2 ]. This malignant disease occurs more frequently in older age [ 3 ]. While a number of patients have long-term survival, especially the ones diagnosed at an early stage, most patients dealt with this cancer have the advanced disease at the diagnosis time. These patients are at the disease recurrence risk, distant metastases, or a second primary tumor, with the median survival less than one year [ 1 ]. The current therapeutic approaches for this cancer include surgery, chemotherapy and radiotherapy. Nevertheless, recurrences, multidrug resistance development, side effects and adverse reaction, and high cost of therapy are substantial problems, indicating that more effective and less toxic drugs and interventions are needed [ 2 ]. The application of natural products, such as phytochemicals, has been shown to be a promising approach for cancer control. These chemicals are of great attention because of their broad range of biological activity, affordable price, and minimal adverse reaction and side effects [ 4 ]. A favored phytochemical with high potential originates from green tea, a globally consumed healthy beverage derived from the Camellia sinensis leaves [ 5 ], which is epigallocatechin gallate (EGCG). The EGCG is the most plentiful and biological-active catechin in green tea, and its role in the treatment of different types of cancer has been extensively studied [ 6 ]. The EGCG has various pharmacological and biological activities, such as antioxidant, antiangiogenic, anti-inflammatory, pro-apoptotic, antiproliferative, and antimetastatic properties [ 7 ]. It has chemopreventive and chemotherapeutic bioactivity, as it acts on a variety of cellular targets involved in cell cycle progression, cell growth and death, invasion, angiogenesis, and metastasis processes by controlling the signaling pathways regulated by various intracellular kinases, proteases, and growth factors [ 7 ]. In spite of the broad advantages as an anticancer agent, EGCG suffers from low stability, and low bioavailability, and has a short half-life, which severely limits its use in the clinical setting [ 4 ]. The most important problem with the oral administration of EGCG is its instability in intestinal fluids, resulting in its very low absorption from the intestinal membrane. In addition, the absorbed drug undergoes extensive presystemic metabolism, resulting in a short plasma half-life and rapid excretion from the systemic circulation [ 8 ]. Consequently, a strategy that can increase the stability and bioavailability of EGCG while targeting cancer cells is required [ 9 ]. Numerous EGCG formulations have been refined recently for increase of its solubility and thus its bioavailability, from which colloidal delivery system based on polymer nanoparticles (NPs) has been the center of focus in many investigations as one of the new nanosuspensions. This is because of the outstanding properties provided by these NPs including non-toxicity, favorable biocompatibility, long-term stability, physiological bioavailability and sustained release. Consequently, these nanoparticles could serve as an efficient delivery vehicle to improve the properties of phytochemical and anticancer agents [ 10 ]. Considering the current limitations in the treatment of squamous cell carcinoma of the head and neck, and the role of epigallocatechin gallate derived from green tea in the treatment of other similar carcinomas, as well as the role of nanoparticles in the high bioavailability of the treatment agent at the tumor site, the aim of the present study is to investigate the effect of polymeric nanoparticles containing epigallocatechin gallate on oral squamous cell carcinoma. 2. Materials and methods 2.1 Preparation of EGCG loaded PEG nanoparticles To prepare a spontaneously formed nanoparticles (NPs) in an oil phase of PEG 400, PEG-40 hydrogenated castor oil and GMO (1:8:1), first 5 mg of epigallocatechin gallate (sigma, E4143) was added to 10 g of the oil phase. This mixture along with surfactant, co-surfactant and oil were stirred at 100 rpm for 2 hours. To complete the mixing process, the sonication was done for 1 hour in a bath sonicator (Elmasonic Med 60). Subsequently, deionized water was inserted to the oil phase (the ratio of 5:1) and stirred mildly to have a nano-emulsion. 2.2. Nanoparticles characterizations The particle size of the nanoparticles with and without EGCG were determined by dynamic light scattering (DLS) (Horiba Company, SZ100). The zeta potential was used to evaluate the surface charge of the particles. Furthermore, the chemical bonds in the prepared nanoparticles were studied by Fourier transform infrared spectroscopy (FTIR, Thermo, Avatar, America) analysis. 2.3. Drug loading EGCG nanoparticles (400 µl) were mixed with 500 µl acetone solution to dissolve the polymer (PEG) and precipitate free EGCG. The free EGCG was totally separated using centrifugation (6500 rpm, 30 min). The resulting pellet was subsequently dissolved in distilled water (1 mL), and the solution absorbance was determined at 373 nm by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA). Using the standard concentration-absorbance diagram, the obtained absorbance values were converted to concentration, and the drug loaded on NPs was determined using the Eq. 1. $$\text{D}\text{r}\text{u}\text{g} \text{l}\text{o}\text{a}\text{d}\text{i}\text{n}\text{g} \left(w/w\right)=\frac{EGCG mass in NPs \left(ng\right)}{Mass of NPs \left(\mu g\right)} \left(1\right)$$ 2.4. Drug release from nanoparticles 0.4 ml of nanoparticles containing EGCG at a concentration of 2.5 mg/ml were placed in dialysis bags filled with 1.6 ml of distilled water. After sealing the bags, they were placed in 200 ml of distilled water, which was kept at 37°C and stirred for 8 days (200 rpm). The solution was separated at time intervals of 1 hour, 3 hours, 6 hours, 24 hours, 48 hours, 72 hours, and up to 8 days. At these time intervals, 500 µl of the release medium was taken out for absorbance measurement and replaced with fresh distilled water (500 µl). The EGCG release from the dialysis bag into the medium was measured by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA) at 373 nm. The cumulative percentage of drug release was calculated as a function of time and plotted graphically. 2.5. 2D Biological tests 2.5.1. Cell culture Two different cell lines (TSCC-1 and HUGU) were obtained from the Iranian Biological Resource Center. The cells were cultured in high-glucose Dulbecco’s Modified Eagle Medium (DMEM, Bio Idea Company) supplemented with 10% fetal bovine serum (FBS) and 100 U/ml antibiotic solution (Gibco, Grand Island, USA) at 37°C, 5% CO 2 , and 95% humidity. 2.5.2. Cell proliferation assay The MTT assay (Cell Growth Determination Kit, Sigma Life Science) determined the cytotoxicity of an anti-proliferative agent. TSCC-1 and HUGU cell lines were seeded in a 96-well plate (10000 cells per well) and then treated with different concentrations (0, 5, 10, 20, 40, 80, and 160 µg/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone. After the 24- and 48-hour treatments, the culture medium in each well was replaced with 100 µl of incomplete culture medium, 10 µl of MTT solution was added to each well, and the cells were further incubated for 4 hours at 37°C in the dark. An acidic alcohol solution (isopropanol with 0.04 N HCl) was used to dissolve the precipitates formed. The absorbance was identified at 570 nm by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA). 2.5.3. Cytotoxicity A lactate dehydrogenase (LDH) cytotoxicity assay kit (Roche Applied Science, Germany) was used to evaluate cell cytotoxicity. TSCC-1 and HUGU cells were seeded in a 96-well plate (10000 cells per well). They were then treated with different concentrations (0, 5, 10, 20, 40, 80 and 160 µg/ml) of nanoparticles containing EGCG, nanoparticles without EGCG and EGCG alone, and incubated for 72 hours. The cells were centrifuged, and 100 µl of the supernatant from each well was transferred to a new 96-well culture plate and incubated with LDH detection solution for 30 minutes at room temperature. After addition of 50 µl of stop solution to avoid further reaction, absorbance at 490 nm was recorded by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA), and the level of cytotoxicity and cell viability were determined by Eqs. 2 and 3. $$cytotoxicity\left(\%\right)=\frac{experiment value-low control}{high control-low control}\times 100 \left(2\right)$$ $$viability\%=100-cytotoxicity \left(3\right)$$ 2.5.4. Wound healing assay Cells (50000/well) were seeded in 24-well plates, and allowed to attach by incubation for 24 hours. Cell monolayers were wounded by scratching with 100-µl pipette tips (sterile yellow micropipette tip) and then washed twice with PBS to remove floating cells. Cells in each well were treated with different concentrations (0, 40, 80 and 160 µg/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone for up to 24 h. The cells were imaged at ×100 magnification with a microscope at 0 and 24 hours. Wound healing width were measured at different time points using ImageJ software, and the extent of wound closure was determined using Eq. 4. $$wound closure \left(\%\right)= \frac{Secondary distance-Initial distance }{Initial distance}\times 100 \left(4\right)$$ 2.5.5. Colony formation assay TSCC-1 cells were seeded at a density of 1000 cells per well. The Cells were treated with different concentrations (0, 40, 80 and 160 µg/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone and incubated for 72 h. At the end of the incubation time, the medium was replaced with fresh DMEM containing 10% FBS. They were kept at 37°C, 5% CO 2 incubator and monitored for colony formation. Afterward, the medium was removed and the cells were washed with PBS, fixed with 4% paraformaldehyde at 4°C, and stained with 0.1% crystal violet for 15 minutes at room temperature. The cell colonies (cell numbers greater than 30) were then washed in PBS to remove excess dye and air dried for 30 minutes. The wells were, finally, photographed using a light microscope. 2.5.6. Apoptosis Quantitative assessment of apoptosis was performed using the Annexin V and PI Apoptosis Detection Kit (BioLegend, cat 40914:NO). The cells were cultured in 12-well plates (100000 cells) and then treated with nanoparticles containing 0 and 80 µg/ml EGCG for 72 hours. After the incubation period, the supernatant was removed, and the cells were stained with propidium iodide (PI) solution and Annexin V and analyzed using a flow cytometer (BD Fax facfcalibur, USA). 2.5.7. Gene expression To compare the level of gene expression in the cells after exposure to nanoparticles containing EGCG, the real-time PCR technique was used. 100000 cells from the control groups and the group with EGCG-containing nanoparticles at a concentration of 80 µg/ml were incubated in a 6-well culture plate for 3 days. Total RNA from the cells was isolated using TRIzol reagent (Kiazist, Iran). The cDNA was prepared using the Easy cDNA Synthesis Kit (Parstous, Iran). The expression of VEGF, BAX, and BCL2 were quantified by real-time polymerase chain reaction (PCR) using SYBR Green Master Mix (Addbio, Korea) and ABI detection system (Applied Biosystems). Relative mRNA levels were determined by the ΔCt method. GAPDH was the endogenous control used to normalize of mRNA expression levels. The primer sequences are listed in Table 1 . Table 1 Primer's sequence was used in RT- PCR Sequence Name BAX F: 5′- CGCCCTTTTCTACTTTGACA-3′ R: 5′- GTGACGAGGCTTGAGGAG-3′ bcl2 F: 5′- TGGTCTTCTTTGAGTTCGG-3′ R: 5′- GGCTGTACAGTTCCACAA-3′ vegf F:5′- CGGCGAAGAGAAGAGACACA − 3′ R: 5′- GGAGGAAGGTCAACCACTCA-3′ gapdh F:5′- CTTTGGTATCGTGGAAGGAC − 3′ R: 5′- GCAGGGATGATGTTCTGG − 3′ 2.6. 3D Biological tests For three-dimensional culture, 0.2 g of agarose was first completely dissolved in 10 ml of distilled water in an autoclave and sterilized. Then, 700 µl of the solution was added to the bottom of the 24-well plate, and after it turned into a solid state, 1500 cells were seeded into each well along with 1 ml of culture medium. After 8 days, when cell aggregates or spheroids were formed, the drug was added to the culture medium at a concentration of 80 µg/ml. After 2 days, the formed spheroids were photographed with a light microscope, and the size of the spheroids was measured using ImageJ software. Alamar Blue (resazurin) assay was also used to evaluate the viability of the cells. After the addition of resazurin, incubation was performed for 3 hours and fluorescence measurements were performed at excitation and emission wavelengths of 560 and 590 nm, respectively, using a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA). In addition, the spheroids and cell viability were examined by phalloidin staining. First, the cells were fixed using 4% paraformaldehyde for 15 minutes at 4°C. In the next step, the paraformaldehyde was removed and triton 0.1% was used for 15 minutes to permeabilize the cells. Finally, the dye phalloidin (Sigma Aldrich, Germany) was added to them at a concentration of 1.3 µM, and the stained cells were imaged using an epifluorescence microscope (leica DMI6000B, Germany). 2.7 Statistical analysis The statistical analyses were performed through analysis of variance (ANOVA) using Minitab V17 software. The α = 0.05 was considered for determining the significance of the factors (confidence level of 95%) in all analyses. Furthermore, the pairwise comparisons were done using Tukey analysis. 3. Results 3.1. Nanoparticles characterizations The results of DLS showed that the nanoparticles loaded with and without EGCG had an average size of 17.53 ± 1.62 nm and 14.00 ± 2.3 nm (Fig. 1 a), respectively. The zeta measurement is an important measure of the stability of colloidal dispersions, which results from the degree of electrostatic repulsion between charged particles. The zeta value of the nanoparticles containing EGCG was − 0.166 ± 0.169 mv and that of the NPs without EGCG was − 0.266 ± 0.169mv (Fig. 1 b). The electrophoretic mobility, that is the response of the solute to the applied electric field, was − 0.000001 cm 2 /Vs for nanoparticles containing EGCG and − 0.0000013 cm 2 /Vs for nanoparticles without EGCG. FTIR analysis was carried out in the range 400–4000 cm − 1 , as shown in Fig. 2 . In the FTIR of nanoparticles without EGCG (PEG, Fig. 2 a), the OH stretching vibration was observed at 3446 cm − 1 . The peak at a wavenumber of 2925 cm − 1 indicates the presence of a methylene group. The absorption around 1541 cm − 1 is due to the bond vibration of –CH2. The C = O group in polyethylene glycol produced a peak at 1095 cm − 1 . The C = O stretching vibration, a strong band around 1637 cm − 1 was also observed and the sharp strong band detected at 949 cm − 1 is due to the C-C stretching vibration [ 11 – 14 ]. The FTIR spectrum of EGCG-containing nanoparticles is shown in Fig. 2 b. In the FTIR pattern of the nanoparticles wih EGCG, the peak recorded in the range of 3200–3650 cm − 1 indicates the OH group in the aromatic ring of EGCG and the structure of PEG. It seems due to the removal of some OH groups as a result of the inteaction between the drug and nanoparticles, the intensity of this peak decreased. The absorption bonds in the range of 1500–1700 cm − 1 indicates the C = C groups in the aromatic ring and the peak at the wavenumber of 1100 cm − 1 is related to the C = O group in EGCG. As shown in the Fig. 2 b, the intensity of the peak at the wavelengths of 1100 cm − 1 and 2915 cm − 1 in nanoparticles containing EGCG increased due to the presence of C = O and C-H groups in both PEG and EGCG [ 15 , 16 ]. 3.2. Drug loading The loading capacity was calculated by the total amount of drug entrapped in NPs divided by the total weight of the NPs. The loading of EGCG in PEG was calculated using the standard curve based on different concentrations of EGCG which was 13.97 ± 1.23 ng/µg. 3.3. Drug release from nanoparticles The release profile of EGCG from the nanoparticles is shown in Fig. 3 . The results of the release test, which were carried out at different time intervals showed that about 15% of the active substance was released into the environment within the first 6 hours, and thereafter the release rate became very slow. By day 8, about 25% of the drug was released. 3.4. 2D Biological tests 3.4.1. Cell proliferation assay The MTT test is a colorimetric method for quantifying cellular metabolic activity indicating the cell viability, proliferation and indirect cytotoxicity. The results of the MTT test on TSCC-1 and HUGU cells were analyzed at two time points of 48 hours and 72 hours. Figure 4 a shows the effect of materials on TSCC-1 cells in two time periods. The results indicated that the EGCG extract group generally has a higher proliferation than the other two groups (In 48 hours the proliferation in all concentrations was over 100% and in 72 hours it was over 73%), while the NPs without EGCG in 48 hours and the NPs with EGCG in 72 hours show a very low cell proliferation. Nanoparticles without EGCG at concentrations of 40, 80 and 160 µg/ml showed a proliferation of 47.3%, 26.8% and 8.5%, and nanoparticles containing EGCG at concentrations of 40, 80 and 160 µg/ml in 72 hours showed proliferation of 19.5%, 16.5% and 23.2%. Therefore, it was concluded that both the type of treatment and the time were influential factors on the rate of cell proliferation (P-value < 0.05). For better comparison and for post hoc pairwise analysis, these 3 concentrations are separately shown in Fig. 4 b. The results of the MTT test on normal cells (HUGU) (Fig. 5 ) show that there is no significant difference in cell proliferation between the group with EGCG extract, the NPs without EGCG and the NPs with EGCG at different concentrations (P-value = 0.83). In addition, a general decrease in cell proliferation was observed over the 72-hour period compared to 48 hours (P-value < 0.05). The strongest reduction was seen in the nanoparticles without EGCG, but in the group of EGCG-containing NPs and the EGCG group, this reduction was much lower. Thus, the vitality was more than 77.8% in the EGCG group and more than 42.1% (42.1%-68.4%) in the EGCG-containing nanoparticles for concentrations of 40, 80 and 160 mg/ml in 72 hours. The lack of a statistically significant difference between the 48- and 72-hour effects of NPs containing EGCG on gingival fibroblast cells (HUGU) suggests that this formulation has no effect on normal cells despite its toxic effect on oral cancer cells. It appears that in clinical use, NPs containing EGCG may cause minimal side effects on healthy oral cells, which may express the selective toxicity of the drug to cancer cells. 3.4.2. Cytotoxicity The LDH cytotoxicity test is a colorimetric evaluation that offers a simple and reliable way for identifying cellular cytotoxicity. DH, a cytosolic enzyme, occurs in various cell types and is released into the cell culture medium when the plasma membrane is damaged. To investigate the effect of EGCG, nanoparticles without EGCG and nanoparticles with EGCG on the TSCC-1 cell death, the cells were treated with different concentrations and the changes in the viability were measured using the LDH assay. This test, which was carried out after 72 hours of incubation, showed that the type of treatment influences the death of the cancer cells (P-value < 0.05) (Fig. 6 ). The results revealed that there was no significant difference between the groups of EGCG extract, nanoparticles without EGCG and nanoparticles with EGCG at concentrations of 5, 10, 20, 40 µg/ml. At concentrations of 80 and 160 µg/ml, cell viability was lower in the NPs containing EGCG than in the NPs without EGCG, similarly it was also lower in the NPs without EGCG than in the EGCG extract. The highest toxicity of nanoparticles containing EGCG on TSCC-1 cells was at a concentration of 160 µg/ml followed by that at 80 µg/ml. The level of toxicity and viability was almost similar in the other groups tested. The results of the MTT and LDH tests on TSCC cells and the proliferation of normal cells (HUGU) showed that the concentrations of 80 and 160 and then 40 µg/ml were more effective than the other concentrations tested. Therefore, these three concentrations were further investigated to study the colony formation and wound healing. 3.4.3. Wound healing assay The wound healing test is a standard in vitro technique for investigating cell migration in two dimensions. Light microscopy photographs of the wound healing taken with 40X magnification at time intervals of 0 and 24 hours are shown in Fig. 7. The images showed that after 24 hours in the control group (without treatment), the scratch created by the pipette tip was completely filled by the migrated cells (arrows in Fig. 7 identifies the closed edge). However, in the other groups treated with EGCG (E) extract, NPs without EGCG (N) and NPs with EGCG (NE) at concentrations of 40, 80 and 160 µg/ml, the gap was not closed. As it can be seen from the microscopic images, the cells in the control group and in the concentrations of 40 and 80 µg/ml EGCG retained their shape (spindle shape), but in the other groups tested, a change in the original shape was observed. To quantitatively compare the wound closure in the different groups, the distance between the two edges of the scratch was measured 0 and 24 hours after treatment using ImageJ software, as shown in Fig. 8 . It was shown that in the groups exposed to EGCG and NPs without EGCG, the wound closure rate decreased with increasing concentration of the substance. In the cells exposed to NPs containing EGCG, there was no wound closure. As the concentration increased in this group, the width of the wound increased, but this increase was not statistically significant. In general, it is believed that NPs containing EGCG can play an effective role in inhibiting the migration of TSCC-1 cells, and that the inhibitory effect is not significantly related to the concentration of the substance. 3.4.4. Colony formation assay The clonogenic test is an in vitro cell survival assay determining a single cell ability to grow into a colony. This analysis examines the ability of a single cell to grow into a large colony by clonal expansion. The images taken with a normal camera and a microscope with 40x magnification after 10 days are shown in Fig. 9. The results show that despite the proliferation and formation of cell aggregates in the control group and to a lesser extent in the EGCG group at a concentration of 40 µg/ml, no colonies, proliferation and accumulation of the cells were seen in the other groups. This demonstrates the efficacy of EGCG, NPs with and without EGCG at all concentrations tested. 3.4.5. Apoptosis Based on the results obtained from the scratch test and colony assay, the concentration of 80 µg/ml was chosen as the optimal concentration and used for apoptosis tests, gene analysis and 3D culture. Labeling cells with annexin V and propidium iodide (PI) is a technique for identifying cell death and distinguishing between its different pathways; Apoptosis (programmed cell death) and necrosis. The results of the test in the control group and the cells treated with a concentration of 80 µg/ml EGCG-containing NPs show that the viability rate of the treated cells decreased significantly (0.37%) and delayed apoptosis (88.3%) was induced in this group compared to the control group. The rate of early apoptosis also increased significantly in this group (Figs. 10 and 11 ). 3.4.6. Gene expression The expression levels of the BAX, BCL2 and VEGF genes were measured in the control group and in the cells treated with a concentration of 80 µg/ml EGCG-containing NPs. The BAX gene was the first identified pro-apoptotic member of the Bcl-2 protein family. The majority of BAX is located in the cytosol of the healthy mammalian cells, but once the apoptotic signaling is initiated, BAX undergoes a conformational change. BAX expression is upregulated by the tumor suppressor protein p53, and it has been revealed to be involved in p53-mediated apoptosis. Drugs that activate BAX are promising for the treatment of cancers as they induce the apoptosis. The real-time PCR results showed that the relative BAX level was 1.07 ± 0.50 in the control group and 1.86 ± 0.59 in the group treated with NPs containing EGCG at a concentration of 80 µg/ml, indicating an increase in gene expression in the group treated with EGCG-containing NPs, but this value showed no statistically significant difference with that of the control group (Fig. 12 a). The BCL2 gene, a founding member of the Bcl-2 family of regulator proteins, is bounded to the mitochondria outer membrane. It has a key role in enhancing cellular survival, inhibiting the activities of pro-apoptotic proteins, and regulating cell death, by either inhibiting or inducing apoptosis, The results of the test showed that the relative level of gene expression in the control group was 1.00 ± 0.08 and in the group treated with NPs containing EGCG with a concentration of 80 µg/ml was 0.54 ± 0.23, which showed a statistically significant decrease in BCL2 gene expression (Fig. 12 b). Vascular endothelial growth factor (VEGF) is a signaling protein promoting the growth of new blood vessels. Angiogenesis is higher in tumor cells than in healthy cells, and its inhibition by therapeutic agents is of importance. The relative expression of this gene was 1.00 ± 0.08 in the control group and 0.63 ± 0.16 in the group treated with NPs containing EGCG at the concentration of 80 µg/ml, indicating a significant decrease in the expression of the VEGF gene in the group treated with drug-containing nanoparticles (Fig. 12 c). 3.5. 3D Biological tests Alamar Blue is a reagent for the determination of cell viability containing resazurin that is a cell-permeable, non-toxic and weakly fluorescent blue indicator dye. The Alamar Blue assay was used to examine cell viability or proliferation in the 3D spheroids of the control group and the cells exposed to EGCG-containing NPs at the concentration of 80 µg/ml. The result of the Alamar Blue fluorescence measurement of the two groups showed that the survival of the cells in the spheroids exposed to EGCG-containing NPs decreased significantly compared to the control group (Fig. 13a). To quantitatively examine the difference in spheroid size between the control group and the cells treated with NPs containing EGCG, the light microscope images were taken and the average diameter of the spheroids was measured before and after treatment with NPs containing EGCG using the ImageJ software. The results (Figs. 13b and 13c) showed that the size of the spheroids in the treated group decreased significantly compared to the spheroids of the control group. To further assess the living cells in the 3D spheroids, the cells were stained green with phalloidin-fluorescein isothiocyanate solution and examined with an epifluorescence microscope. As shown in Fig. 14, the size of spheroids in the nanoparticle-treated group decreased compared to the control group, indicating the inhibitory effect of NPs with EGCG on the growth of spheroids. 4. Discussion Oral cancer which is the 6th most common cancer in the world, has a high incidence in South Asia [ 17 ]. Oral squamous cell carcinoma (OSCC) is the most frequent malignancy and accounts for more than 90% of all head and neck cancers [ 18 ]. The etiology of oral cavity cancer is well understood in most cases, with tobacco use in any form and alcohol being the most common etiologic factors [ 19 ]. While a number of patients have long-term survival, especially the ones diagnosed at an early stage, most patients dealt with this cancer have the advanced disease at the diagnosis time [ 1 ]. The current treatment approaches for this cancer include surgery, chemotherapy and radiotherapy. Nevertheless, recurrence, the multidrug resistance development, side effects and adverse reaction, and high cost of therapy are substantial problems that point to the need for more efficient and less toxic drugs and interventions [ 2 ]. Tea is one of the most consumed beverages worldwide. Epigallocatechin3-gallate or EGCG is the amplest catechin and accounts for 48–55% of total catechins. EGCG has attracted much attention owing to its antioxidant, anti-tumor, anti-inflammatory and anti-angiogenic properties. It has been shown that EGCG has a strong chemopreventive effect on various types of cancer, including breast cancer [ 20 ]. However, poor biopharmaceutical and pharmacokinetic properties including poor stability in the gastrointestinal tract, low intestinal permeability and short half-life in plasma, have obstructed the clinical development of EGCG [ 8 ]. Moreover, PEGylation confers several useful characteristics to the native molecule, leading to improved pharmacokinetic and pharmacodynamic properties, which sequentially allow the native molecule to attain maximum clinical efficacy [ 21 ]. Furthermore, nanocarriers can increase the drug absorption, protect premature degradation of the drugs, lengthen the circulation time of drugs, show high differential uptake efficiency in target cells versus normal cells, reduce toxicity by avoiding the drug from early interacting with the biological environment, and boost the intracellular penetration, to name a few [ 20 ]. Despite various studies on the anti-cancer effect of EGCG, the effect of nanoparticles containing EGCG on the TSCC-1 cell line has not been investigated yet. This study was conducted with the aim of examining the effect of polyethylene glycol nanoparticles containing epigallocatechin gallate on TSCC-1 cells. In this study, after the preparation of the nanoparticles, the properties of these particles were evaluated by DLS, zeta potential, FTIR, release and drug loading tests. Subsequently, its effect on cancer cells was investigated by MTT, LDH, colony formation, wound healing and apoptosis (PI and Annexine V) tests, and the expression of BAX, BCL2 and VEGF genes was measured by PCR analysis. In addition, the effects of the drug on cell spheroids (3D culture) were also studied. Instead of using animal model to extend the results obtained, in our research we applied the 3D culture of cells which more precisely mimic the in vivo cancer conditions. The study by Yoshimura et al. which examined the effect of EGCG extract on oral SCC cells, showed a decrease in cell proliferation depending on concentration and time as well as a decrease in apoptosis by the Tunnel test, similar to our study [ 22 ]. The study by Lee et al. also investigated the effect of EGCG extract on SCC cells in the tongue. A reduction in cell proliferation, cell migration, wound healing time and protein concentrations of TAZ, 1 LATS, 1 MOB and JNK as well as a promotion of apoptosis were observed [ 23 ]. In addition, in the study by Lin et al. in which the effect of EGCG extract on SCC cells in the head and neck region (HNSCC) was tested, a reduction in cell proliferation, a reduction in BCL2 and VEGF gene expression and the induction of apoptosis with arrest in G1 of the cell cycle were observed in parallel to the present study [ 24 ]. In the study by Barani et al. the anti-cancer effect of green tea extract loaded in PEG-coated niosomes was discussed. The extraction of the green tea extract and its evaluation were carried out using gas chromatography. The particle size was 9.8 ± 241 nm determined by DLS test and the zeta potential was − 24.3 ± 1.9 mv. The results of this study, similar to the current study, showed a decrease in cell proliferation in the MCF-7, Hep G2 and HL-60 cell lines [ 25 ]. Green tea leaves contain polyphenols and various compounds such as caffeine, theobromine, theophylline and other methylxanthines, lignin, organic acids, etc [ 26 ]. In contrast to their research, our study investigated the specific effect of the most abundant and potent phenol in the green tea extract rather than examining the whole compounds. The other difference was the smaller particle size (17.53 ± 1.62 nm) and a zeta potential of -0.169 ± 0.169 mv, which may support its penetration into the bulk of cancer cells possibly providing greater effect. The study by Chen et al. investigated the effect of EGCG and EGCG-nanoemulsion on lung cancer cells. In their study, similar to the present paper, it was found that the viability of cancer cells decreases in a dose- and time-dependent manner, with EGCG-containing nanoparticles being more effective than EGCG alone. Furthermore, the drugs at the concentration of less than 5 µM did not affect normal lung epithelial cells, but at the concentrations of 5 and 10 µM over a 72-hour period, decreased the cell viability. Moreover, similar to the current study, colony formation and cell migration were inhibited in a dose-dependent manner, and the nanoparticles were more effective [ 27 ]. In their study the molecular cellular signaling pathways were also examined using the Matrigel invasion assay and the gelatin zymography assay, and the changes in the AMP-activated protein kinase signaling pathway were studied using Western blot analysis. According to the results, nanoparticles containing the drug could inhibit lung cancer cell invasion by mechanisms independent of matrix metalloproteinase (MMP-2) and MMP-9, and modulate the expression of several key regulatory proteins in the AMPK signaling pathway by nano-EGCG. In addition, EGCG nanoparticles could prevent proliferation, colony formation, migration and invasion of lung cancer cells by activating the AMPK signaling pathway [ 27 ]. In the present study, the expression of the genes including BAX, BCL-2 and VEGF as well as apoptosis were examined using Annexin V and PI tests, and the most effective concentration of nanoparticles tested was 80 µg/ml which resulted in efficient changes compared to control group. 5. Conclusions The results of the nanoparticle characterization tests indicate that the particles were composed of epigallocatechin gallate loaded in PEG nanoparticles, which had a stable and suitable surface, and that the loading rate of EGCG in the nanoparticles and the release of the drug into the medium were efficient. Moreover, cell viability was significantly reduced in response to EGCG loaded nanoparticle treatment in a dose-dependent manner, while their effect on the normal gingival fibroblast cells (HUGU) was small, indicating the selective toxicity of nanoparticles to cancer cells and causing minimal side effects. Considering the cytotoxicity to normal gum cells, the best effective concentration tested in this study was 80 µg/ml, at which the expression of BCL2 and VEGF genes significantly decreased and the expression of BAX gene also increased, although the expression of this gene was not statistically significant. In addition, the rate of delayed apoptosis of the cells increased significantly at this concentration. The results showed that the ability of nanoparticles to inhibit colony formation and cell migration. Furthermore, the results of 3D cell culture revealed the efficiency of nanoparticles in inhibiting the growth of spheroids of TSCC-1 cells. Therefore, with the continuation of studies in this field, polyethylene glycol nanoparticles containing epigallocatechin gallate may become one of the options for the clinical treatment of SCC. Declarations Ethical Approval All assays were confirmed by the Ethics Committee of the Semnan Medical University Faculty of Medicine, Iran with IR.SEMUMS.REC.1401.144 certificate number. Declaration of conflicting interests The author(s) declared no potential conflicts of interest concerning the research, authorship, and/or publication of this article. Availability of data and material The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare no competing interests. Funding This study was supported by a grant from Semnan University of Medical Sciences (Grant No. 2017). Authors' contributions Zahra Khatib Zadeh conducted experiments, performed analyses, prepared the figures, and wrote the first draft of the manuscript Samaneh Arab consulted the project, designed the experiments, and wrote the first draft of the manuscript Sohrab Kazemi performed experiments, and consulted the project Mohadeseh Arabhalvaee conducted experiments Elham Sadat Afraz supervised the project and provided the materials Marjan Bahraminasab designed the experiments, conducted data analyses, wrote the first draft of the manuscript and supervised the project All authors discussed the results of experiments, edited and approved the final version of the manuscript. Acknowledgments The authors would like to thank Semnan University of medical sciences for fining this research. Consent to participate Not applicable. References Lim YC, Lee SH, Song MH, Yamaguchi K, Yoon JH, Choi EC, Baek SJ. Growth inhibition and apoptosis by (−)-epicatechin gallate are mediated by cyclin D1 suppression in head and neck squamous carcinoma cells. European Journal of Cancer. 2006 Dec 1; 42(18):3260-6. Lazarević M, Milošević M, Petrović N, Petrović S, Damante G, Milašin J, Milovanović B. Cytotoxic effects of different aromatic plants essential oils on oral squamous cell carcinoma: An in vitro study. Balkan Journal of Dental Medicine. 2019; 23(2):73-9. H Hoseinpour J, SA AD. Evaluation of some of the SCC risk factors in patients referring to dental school and Omid hospital in Mashhad from September 2002 to September 2003.jmds 2006 Granja A, Pinheiro M, Reis S. Epigallocatechin gallate nanodelivery systems for cancer therapy. Nutrients. 2016 May 20; 8(5):307. Xiao L, Mertens M, Wortmann L, Kremer S, Valldor M, Lammers T, Kiessling F, Mathur S. Enhanced in vitro and in vivo cellular imaging with green tea coated water-soluble iron oxide nanocrystals. ACS applied materials & interfaces. 2015 Apr 1; 7(12):6530-40. Mukherjee S, Ghosh S, Das DK, Chakraborty P, Choudhury S, Gupta P, Adhikary A, Dey S, Chattopadhyay S. Gold-conjugated green tea nanoparticles for enhanced anti-tumor activities and hepatoprotection—Synthesis, characterization and in vitro evaluation. The Journal of nutritional biochemistry. 2015 Nov 1; 26(11):1283-97. Aggarwal V, Tuli HS, Tania M, Srivastava S, Ritzer EE, Pandey A, Aggarwal D, Barwal TS, Jain A, Kaur G, Sak K. Molecular mechanisms of action of epigallocatechin gallate in cancer: Recent trends and advancement. InSeminars in cancer biology 2022 May 1 (Vol. 80, pp. 256-275). Academic Press. Italia J, Datta P, Ankola D, Kumar M. Nanoparticles enhance per oral bioavailability of poorly available molecules: epigallocatechin gallate nanoparticles ameliorates cyclosporine induced nephrotoxicity in rats at three times lower dose than oral solution. Journal of biomedical nanotechnology 2008; 4: 304-12. Siddiqui IA, Adhami VM, Bharali DJ, Hafeez BB, Asim M, Khwaja SI, Ahmad N, Cui H, Mousa SA, Mukhtar H. Introducing nanochemoprevention as a novel approach for cancer control: proof of principle with green tea polyphenol epigallocatechin-3-gallate. Cancer research. 2009 Mar 1;69(5):1712-6. Gohulkumar M, Gurushankar K, Prasad NR, Krishnakumar N. Enhanced cytotoxicity and apoptosis-induced anticancer effect of silibinin-loaded nanoparticles in oral carcinoma (KB) cells. Materials Science and Engineering: C. 2014 Aug 1;41:274-82. Kolhe P, Kannan RM. Improvement in ductility of chitosan through blending and copolymerization with PEG: FTIR investigation of molecular interactions. Biomacromolecules 2003; 4: 173-80 Elmarzugi NA, Adali T, Bentaleb AM, Keleb EI, Mohamed AT, Hamza AM. Spectroscopic characterization of PEG-DNA biocomplexes by FTIR. J. Appl. Pharm. Sci 2014; 4: 006-10. Pramono E, Utomo S, Wulandari V, Clegg F, editors. FTIR studies on the effect of concentration of polyethylene glycol on polimerization of Shellac. J.Phys. Conf.Ser; 2016: IOP Publishing Reddy Polu A, Kumar R. Impedance spectroscopy and FTIR studies of PEG-based polymer electrolytes. E-J.Chem 2011; 8: 347-53. Icart L, Dos Santos E, Pereira E, Ferreira S, Saez V, Ramon J, Nele M, Pinto J, Toledo R, Silva D. PLA-b-PEG/magnetite hyperthermic agent prepared by Ugi four component condensation. Express Polym. Lett. 2016; 10: 188. Moreno-Vásquez MJ, Plascencia-Jatomea M, Sánchez-Valdes S, Tanori-Córdova JC, Castillo-Yañez FJ, Quintero-Reyes IE, Graciano-Verdugo AZ. Characterization of epigallocatechin-gallate-grafted chitosan nanoparticles and evaluation of their antibacterial and antioxidant potential. Polym.J. 2021; 13: 1375. Shah JP, Gil Z. Current concepts in management of oral cancer–surgery. Oral Oncol 2009; 45: 394-401. Calcaterra TC, Juillard GJ. Oral cavity and hypopharynx-head and neck cancer. In: Haskell CM, Berek JS, editors. Cancer treatment. Philadelphia: WB Saunders Co; 1995. pp. 726–32. . Sankaranarayanan R. Oral cancer in India: a clinical and epidemiological review. Oral Surg Oral Med Oral Pathol 1990;69:325–30 De Pace RC, Liu X, Sun M, Nie S, Zhang J, Cai Q, Gao W, Pan X, Fan Z, Wang S. Anticancer activities of (−)-epigallocatechin-3-gallate encapsulated nanoliposomes in MCF7 breast cancer cells. Journal of liposome research. 2013 Sep 1;23(3):187-96. Bailon P, Won CY. PEG-modified biopharmaceuticals. Expert opinion on drug delivery. 2009 Jan 1;6(1):1-6. Yoshimura H, Yoshida H, Matsuda S, Ryoke T, Ohta K, Ohmori M,Yamamoto S, Kiyoshima T, Kobayashi M, Sano K. The therapeutic potential of epigallocatechin‑3‑gallate against human oral squamous cell carcinoma through inhibition of cell proliferation and induction of apoptosis: In vitro and in vivo murine xenograft study. Mol.Med.Rep. 2019; 20: 1139-48. Li A, Gu K, Wang Q, Chen X, Fu X, Wang Y, Wen Y. Epigallocatechin-3-gallate affects the proliferation, apoptosis, migration and invasion of tongue 83 squamous cell carcinoma through the hippo-TAZ signaling pathway. Int. J.Mol. Med 2018; 42: 2615-27. Lin H-Y, Hou S-C, Chen S-C, Kao M-C, Yu C-C, Funayama S, Ho C-T, Way T-D. (−)-Epigallocatechin gallate induces Fas/CD95-mediated apoptosis through inhibiting constitutive and IL-6-induced JAK/STAT3 signaling in head and neck squamous cell carcinoma cells. J. Agric.Food Chem. 2012; 60: 2480-9 Baranei M, Taheri RA, Tirgar M, Saeidi A, Oroojalian F, Uzun L, Asefnejad A, Wurm FR, Goodarzi V. Anticancer effect of green tea extract (GTE)-Loaded pHresponsive niosome Coated with PEG against different cell lines. Mater.Today Commun. 2021; 26: 101751 Senanayake SN. Green tea extract: Chemistry, antioxidant properties and food applications–A review. J.Funct.Foods 2013; 5: 1529-41. Chen B-H, Hsieh C-H, Tsai S-Y, Wang C-Y, Wang C-C. Anticancer effects of epigallocatechin-3-gallate nanoemulsion on lung cancer cells through the activation of AMP-activated protein kinase signaling pathway. Sci Rep 2020; 10:5163. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3849470","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":266313139,"identity":"1c5611d1-462f-4d8e-83fd-7be35ff502b8","order_by":0,"name":"Zahra Khatib Zadeh","email":"","orcid":"","institution":"Semnan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"Khatib","lastName":"Zadeh","suffix":""},{"id":266313140,"identity":"b2e823d1-c30b-44d6-b372-77b54026ed93","order_by":1,"name":"Samaneh Arab","email":"","orcid":"","institution":"Semnan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Samaneh","middleName":"","lastName":"Arab","suffix":""},{"id":266313141,"identity":"a78a137e-d27c-42d9-a71b-805a2ffb85d5","order_by":2,"name":"Sohrab Kazemi","email":"","orcid":"","institution":"Babol University of Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Sohrab","middleName":"","lastName":"Kazemi","suffix":""},{"id":266313142,"identity":"70d81704-2c8a-45f2-986a-ea41a2845954","order_by":3,"name":"Mohadeseh Arabhalvaee","email":"","orcid":"","institution":"Semnan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohadeseh","middleName":"","lastName":"Arabhalvaee","suffix":""},{"id":266313143,"identity":"d810ac96-51b8-4984-9005-f610ea136646","order_by":4,"name":"Elham Sadat Afraz","email":"","orcid":"","institution":"Semnan University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Elham","middleName":"Sadat","lastName":"Afraz","suffix":""},{"id":266313144,"identity":"1a45b1db-1118-42d6-99f5-c8aa6f445484","order_by":5,"name":"Marjan Bahraminasab","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYFACHgZmEMUGIhgbbBgYJEjUkkaCFgaIlsOEteg28B78XLjHLppPuvnxh587zif2z24++IChxiYalxazA3zJ0jOeJee2yRwzk+w9cztxxp1jyQYMx9JyG3Bq4TGQ5jnAnNsmkWDGwNt2O7HhRo6ZBNCF+LQY/+Y5UA/Ukv7549+2c4nzidBiBrTlMFBLjoE0b9uBxA0EtRzmS7PmOXAcpKVMWvZMsvHGG2nJBgn4/HK89/BtngPVufNnpG/++HaHney8G8kHH3yoscGpBSlSIMARrDIBl3JswJ4UxaNgFIyCUTAyAAD6mF4tP0JhWAAAAABJRU5ErkJggg==","orcid":"","institution":"Semnan University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Marjan","middleName":"","lastName":"Bahraminasab","suffix":""}],"badges":[],"createdAt":"2024-01-10 05:15:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3849470/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3849470/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49523227,"identity":"50228d85-8b70-4d73-b3af-a9601d583fc9","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":463591,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(a and c) Size and zeta potential distributions of NPs without EGCG, and (b and d) Size and zeta potential distributions of NPs with EGCG\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/dd0303c8c4e0c08adec5c617.png"},{"id":49523738,"identity":"8345bb27-613a-4826-9e17-cc5567aae5fc","added_by":"auto","created_at":"2024-01-12 10:46:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":152946,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFTIR spectra of (a) NPs without EGCG, and (b) NPs with EGCG\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/35aaf34a75c0acd9e2fab9b2.png"},{"id":49523228,"identity":"282bb3a4-0314-47fa-8fac-1fbd71f8f816","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":17744,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDrug release test results\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/fab977002f94de762e3149fc.png"},{"id":49523739,"identity":"892f2bed-7d9e-43f4-aeaf-6bcd96b61c70","added_by":"auto","created_at":"2024-01-12 10:46:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":76599,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMTT test results for TSCC-1 cells; (a) the whole studied groups, and (b) post hoc pairwise of the three effective concentrations (EGCG extract (E), NPs without EGCG (N), and NPs with EGCG (NE)). The means without a common letter are statistically significantly different.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/f65c86f16facfe445ec188df.png"},{"id":49523230,"identity":"20004695-80d5-4866-8d2d-fbb6357d0796","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":79780,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMTT test results for HUGU cells; (a) the whole studied groups, and (b) post hoc pairwise of the three effective concentrations (EGCG extract (E), NPs without EGCG (N), and NPs with EGCG (NE)). The means without a common letter are statistically significantly different.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/56a52822cee80310088273ca.png"},{"id":49524658,"identity":"b528b6d8-5fdc-4b55-8b90-4ab8421c765c","added_by":"auto","created_at":"2024-01-12 11:02:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":282256,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLDH test results on TSCC-1 cells (EGCG extract (E), NPs without EGCG (N), and NPs with EGCG (NE)). There was no statistically significantly different among the groups.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/d908b970c3a096d38dfa2851.png"},{"id":49523233,"identity":"2bf6e079-9684-4bbb-8671-3ebd1949f6f7","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":779190,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImages of wound healing test (EGCG extract (E), NPs without EGCG (N), and NPs with EGCG (NE))\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/c60d3f6b4078ab02f97eca92.png"},{"id":49523740,"identity":"0c08f9d7-1508-4c81-b6d4-b28920d59dfa","added_by":"auto","created_at":"2024-01-12 10:46:03","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":22018,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuantitative results of wound healing test\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/07f3fc94c66c18fcf808459f.png"},{"id":49523236,"identity":"e7e49122-98e3-4ab4-ab64-f6e99ed79eb1","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":650100,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eColony formation test results (EGCG extract (E), NPs without EGCG (N), and NPs with EGCG (NE))\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/69de984e9d6c6edf93df57c7.png"},{"id":49524185,"identity":"133beb2c-bd89-418a-8a07-fdcb66d09c9c","added_by":"auto","created_at":"2024-01-12 10:54:03","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":162912,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eApoptosis test result,\u003c/strong\u003e \u003cstrong\u003ethe right image shows the results obtained from the control group and the left side image is related to the group treated with NPs containing EGCG\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/a73573c687f5a6e3ff438735.png"},{"id":49523743,"identity":"9c0482c0-facb-4211-9d69-a8c8ddee7810","added_by":"auto","created_at":"2024-01-12 10:46:03","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":91424,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eQuantitative results of apoptosis; (a) Q1 (P-value=0.002), (b) Q2 (P-value=0.000), (c) Q3 (P-value=0.015), and (d) Q4 (P-value= 0.000)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/52f9652a0cd846e5201fc52a.png"},{"id":49523238,"identity":"471df6a3-6761-46cd-8607-515b561f6f53","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":205088,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR test result; (a) BAX, (b) BCL2, and (c) VEGF\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"122.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/e4c2f866db9066bb84e9c17d.png"},{"id":49523239,"identity":"f5275f52-3cc6-443b-9606-80c3ecd5709b","added_by":"auto","created_at":"2024-01-12 10:38:03","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":234004,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(a) 3D spheroid viability using Alamar Blue assay (P-value=0.007), (b) Light microscope images at 100x magnification (left: spheroids 8 days after formation, middle: spheroids of the control group on day 10 (after 48 h), and right spheroids treated with NPs containing EGCG after 48 hours), and (c) The difference in the size of spheroids (P-value=0.000, positive value indicates decrease in spheroid size and negative value signifies increase in spheroid size, because the final size was subtracted from the initial size)\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/5be91d6585f951a912e246b3.png"},{"id":49523744,"identity":"25fcae99-4796-45ae-9e9a-c319659f2d70","added_by":"auto","created_at":"2024-01-12 10:46:03","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":529236,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(a and c) Light microscope image of the spheroid, respectively, in the control group and in the treated group, and (b and d) Epifluorescence microscope image of the spheroid respectively, in the control group and in the treated group\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"14.png","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/4b988cca925b4dabf8a7c22b.png"},{"id":49822558,"identity":"45a4402d-dbc9-4353-b76f-b74791795487","added_by":"auto","created_at":"2024-01-18 15:22:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4314755,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3849470/v1/2de1d387-abf5-4a38-b1b3-9fa03bcac2cc.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anticancer effect of Epigallocatechin Gallate Loaded Nanoparticles on Head and Neck Cancer","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe head and neck squamous cell carcinomas (HNSCC) include epithelial malignancies originating in the mucosa of the oral cavity, nose and sinuses, pharynx, and larynx. It has been reported that 37,200 patients are anew diagnosed with HNSCC in the United States (USA) each year [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In developed countries, it is the sixth most common cancer with around 350,000 deaths annually [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The majority (85%) of HNC is oral cavity cancer, mostly oral squamous cell carcinoma [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This malignant disease occurs more frequently in older age [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. While a number of patients have long-term survival, especially the ones diagnosed at an early stage, most patients dealt with this cancer have the advanced disease at the diagnosis time. These patients are at the disease recurrence risk, distant metastases, or a second primary tumor, with the median survival less than one year [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The current therapeutic approaches for this cancer include surgery, chemotherapy and radiotherapy. Nevertheless, recurrences, multidrug resistance development, side effects and adverse reaction, and high cost of therapy are substantial problems, indicating that more effective and less toxic drugs and interventions are needed [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe application of natural products, such as phytochemicals, has been shown to be a promising approach for cancer control. These chemicals are of great attention because of their broad range of biological activity, affordable price, and minimal adverse reaction and side effects [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. A favored phytochemical with high potential originates from green tea, a globally consumed healthy beverage derived from the Camellia sinensis leaves [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], which is epigallocatechin gallate (EGCG). The EGCG is the most plentiful and biological-active catechin in green tea, and its role in the treatment of different types of cancer has been extensively studied [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The EGCG has various pharmacological and biological activities, such as antioxidant, antiangiogenic, anti-inflammatory, pro-apoptotic, antiproliferative, and antimetastatic properties [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It has chemopreventive and chemotherapeutic bioactivity, as it acts on a variety of cellular targets involved in cell cycle progression, cell growth and death, invasion, angiogenesis, and metastasis processes by controlling the signaling pathways regulated by various intracellular kinases, proteases, and growth factors [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In spite of the broad advantages as an anticancer agent, EGCG suffers from low stability, and low bioavailability, and has a short half-life, which severely limits its use in the clinical setting [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The most important problem with the oral administration of EGCG is its instability in intestinal fluids, resulting in its very low absorption from the intestinal membrane. In addition, the absorbed drug undergoes extensive presystemic metabolism, resulting in a short plasma half-life and rapid excretion from the systemic circulation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Consequently, a strategy that can increase the stability and bioavailability of EGCG while targeting cancer cells is required [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNumerous EGCG formulations have been refined recently for increase of its solubility and thus its bioavailability, from which colloidal delivery system based on polymer nanoparticles (NPs) has been the center of focus in many investigations as one of the new nanosuspensions. This is because of the outstanding properties provided by these NPs including non-toxicity, favorable biocompatibility, long-term stability, physiological bioavailability and sustained release. Consequently, these nanoparticles could serve as an efficient delivery vehicle to improve the properties of phytochemical and anticancer agents [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConsidering the current limitations in the treatment of squamous cell carcinoma of the head and neck, and the role of epigallocatechin gallate derived from green tea in the treatment of other similar carcinomas, as well as the role of nanoparticles in the high bioavailability of the treatment agent at the tumor site, the aim of the present study is to investigate the effect of polymeric nanoparticles containing epigallocatechin gallate on oral squamous cell carcinoma.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Preparation of EGCG loaded PEG nanoparticles\u003c/h2\u003e \u003cp\u003eTo prepare a spontaneously formed nanoparticles (NPs) in an oil phase of PEG 400, PEG-40 hydrogenated castor oil and GMO (1:8:1), first 5 mg of epigallocatechin gallate (sigma, E4143) was added to 10 g of the oil phase. This mixture along with surfactant, co-surfactant and oil were stirred at 100 rpm for 2 hours. To complete the mixing process, the sonication was done for 1 hour in a bath sonicator (Elmasonic Med 60). Subsequently, deionized water was inserted to the oil phase (the ratio of 5:1) and stirred mildly to have a nano-emulsion.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Nanoparticles characterizations\u003c/h2\u003e \u003cp\u003eThe particle size of the nanoparticles with and without EGCG were determined by dynamic light scattering (DLS) (Horiba Company, SZ100). The zeta potential was used to evaluate the surface charge of the particles. Furthermore, the chemical bonds in the prepared nanoparticles were studied by Fourier transform infrared spectroscopy (FTIR, Thermo, Avatar, America) analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Drug loading\u003c/h2\u003e \u003cp\u003eEGCG nanoparticles (400 \u0026micro;l) were mixed with 500 \u0026micro;l acetone solution to dissolve the polymer (PEG) and precipitate free EGCG. The free EGCG was totally separated using centrifugation (6500 rpm, 30 min). The resulting pellet was subsequently dissolved in distilled water (1 mL), and the solution absorbance was determined at 373 nm by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA). Using the standard concentration-absorbance diagram, the obtained absorbance values were converted to concentration, and the drug loaded on NPs was determined using the Eq.\u0026nbsp;1.\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\text{D}\\text{r}\\text{u}\\text{g} \\text{l}\\text{o}\\text{a}\\text{d}\\text{i}\\text{n}\\text{g} \\left(w/w\\right)=\\frac{EGCG mass in NPs \\left(ng\\right)}{Mass of NPs \\left(\\mu g\\right)} \\left(1\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Drug release from nanoparticles\u003c/h2\u003e \u003cp\u003e0.4 ml of nanoparticles containing EGCG at a concentration of 2.5 mg/ml were placed in dialysis bags filled with 1.6 ml of distilled water. After sealing the bags, they were placed in 200 ml of distilled water, which was kept at 37\u0026deg;C and stirred for 8 days (200 rpm). The solution was separated at time intervals of 1 hour, 3 hours, 6 hours, 24 hours, 48 hours, 72 hours, and up to 8 days. At these time intervals, 500 \u0026micro;l of the release medium was taken out for absorbance measurement and replaced with fresh distilled water (500 \u0026micro;l). The EGCG release from the dialysis bag into the medium was measured by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA) at 373 nm. The cumulative percentage of drug release was calculated as a function of time and plotted graphically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. 2D Biological tests\u003c/h2\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.5.1. Cell culture\u003c/h2\u003e \u003cp\u003eTwo different cell lines (TSCC-1 and HUGU) were obtained from the Iranian Biological Resource Center. The cells were cultured in high-glucose Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM, Bio Idea Company) supplemented with 10% fetal bovine serum (FBS) and 100 U/ml antibiotic solution (Gibco, Grand Island, USA) at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e, and 95% humidity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.5.2. Cell proliferation assay\u003c/h2\u003e \u003cp\u003eThe MTT assay (Cell Growth Determination Kit, Sigma Life Science) determined the cytotoxicity of an anti-proliferative agent. TSCC-1 and HUGU cell lines were seeded in a 96-well plate (10000 cells per well) and then treated with different concentrations (0, 5, 10, 20, 40, 80, and 160 \u0026micro;g/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone. After the 24- and 48-hour treatments, the culture medium in each well was replaced with 100 \u0026micro;l of incomplete culture medium, 10 \u0026micro;l of MTT solution was added to each well, and the cells were further incubated for 4 hours at 37\u0026deg;C in the dark. An acidic alcohol solution (isopropanol with 0.04 N HCl) was used to dissolve the precipitates formed. The absorbance was identified at 570 nm by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.5.3. Cytotoxicity\u003c/h2\u003e \u003cp\u003eA lactate dehydrogenase (LDH) cytotoxicity assay kit (Roche Applied Science, Germany) was used to evaluate cell cytotoxicity. TSCC-1 and HUGU cells were seeded in a 96-well plate (10000 cells per well). They were then treated with different concentrations (0, 5, 10, 20, 40, 80 and 160 \u0026micro;g/ml) of nanoparticles containing EGCG, nanoparticles without EGCG and EGCG alone, and incubated for 72 hours. The cells were centrifuged, and 100 \u0026micro;l of the supernatant from each well was transferred to a new 96-well culture plate and incubated with LDH detection solution for 30 minutes at room temperature. After addition of 50 \u0026micro;l of stop solution to avoid further reaction, absorbance at 490 nm was recorded by a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA), and the level of cytotoxicity and cell viability were determined by Eqs.\u0026nbsp;2 and 3.\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$cytotoxicity\\left(\\%\\right)=\\frac{experiment value-low control}{high control-low control}\\times 100 \\left(2\\right)$$\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equc\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equc\" name=\"EquationSource\"\u003e\n$$viability\\%=100-cytotoxicity \\left(3\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.5.4. Wound healing assay\u003c/h2\u003e \u003cp\u003eCells (50000/well) were seeded in 24-well plates, and allowed to attach by incubation for 24 hours. Cell monolayers were wounded by scratching with 100-\u0026micro;l pipette tips (sterile yellow micropipette tip) and then washed twice with PBS to remove floating cells. Cells in each well were treated with different concentrations (0, 40, 80 and 160 \u0026micro;g/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone for up to 24 h. The cells were imaged at \u0026times;100 magnification with a microscope at 0 and 24 hours. Wound healing width were measured at different time points using ImageJ software, and the extent of wound closure was determined using Eq.\u0026nbsp;4.\u003cdiv id=\"Equd\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equd\" name=\"EquationSource\"\u003e\n$$wound closure \\left(\\%\\right)= \\frac{Secondary distance-Initial distance }{Initial distance}\\times 100 \\left(4\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.5.5. Colony formation assay\u003c/h2\u003e \u003cp\u003eTSCC-1 cells were seeded at a density of 1000 cells per well. The Cells were treated with different concentrations (0, 40, 80 and 160 \u0026micro;g/ml) of nanoparticles containing EGCG, nanoparticles without EGCG, and EGCG alone and incubated for 72 h. At the end of the incubation time, the medium was replaced with fresh DMEM containing 10% FBS. They were kept at 37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e incubator and monitored for colony formation. Afterward, the medium was removed and the cells were washed with PBS, fixed with 4% paraformaldehyde at 4\u0026deg;C, and stained with 0.1% crystal violet for 15 minutes at room temperature. The cell colonies (cell numbers greater than 30) were then washed in PBS to remove excess dye and air dried for 30 minutes. The wells were, finally, photographed using a light microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.5.6. Apoptosis\u003c/h2\u003e \u003cp\u003eQuantitative assessment of apoptosis was performed using the Annexin V and PI Apoptosis Detection Kit (BioLegend, cat 40914:NO). The cells were cultured in 12-well plates (100000 cells) and then treated with nanoparticles containing 0 and 80 \u0026micro;g/ml EGCG for 72 hours. After the incubation period, the supernatant was removed, and the cells were stained with propidium iodide (PI) solution and Annexin V and analyzed using a flow cytometer (BD Fax facfcalibur, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.5.7. Gene expression\u003c/h2\u003e \u003cp\u003eTo compare the level of gene expression in the cells after exposure to nanoparticles containing EGCG, the real-time PCR technique was used. 100000 cells from the control groups and the group with EGCG-containing nanoparticles at a concentration of 80 \u0026micro;g/ml were incubated in a 6-well culture plate for 3 days. Total RNA from the cells was isolated using TRIzol reagent (Kiazist, Iran). The cDNA was prepared using the Easy cDNA Synthesis Kit (Parstous, Iran). The expression of VEGF, BAX, and BCL2 were quantified by real-time polymerase chain reaction (PCR) using SYBR Green Master Mix (Addbio, Korea) and ABI detection system (Applied Biosystems). Relative mRNA levels were determined by the ΔCt method. GAPDH was the endogenous control used to normalize of mRNA expression levels. The primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer's sequence was used in RT- PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026prime;- CGCCCTTTTCTACTTTGACA-3\u0026prime;\u003c/p\u003e \u003cp\u003eR: 5\u0026prime;- GTGACGAGGCTTGAGGAG-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ebcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: 5\u0026prime;- TGGTCTTCTTTGAGTTCGG-3\u0026prime;\u003c/p\u003e \u003cp\u003eR: 5\u0026prime;- GGCTGTACAGTTCCACAA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003evegf\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:5\u0026prime;- CGGCGAAGAGAAGAGACACA \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eR: 5\u0026prime;- GGAGGAAGGTCAACCACTCA-3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003egapdh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF:5\u0026prime;- CTTTGGTATCGTGGAAGGAC \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003cp\u003eR: 5\u0026prime;- GCAGGGATGATGTTCTGG \u0026minus;\u0026thinsp;3\u0026prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.6. 3D Biological tests\u003c/h2\u003e \u003cp\u003eFor three-dimensional culture, 0.2 g of agarose was first completely dissolved in 10 ml of distilled water in an autoclave and sterilized. Then, 700 \u0026micro;l of the solution was added to the bottom of the 24-well plate, and after it turned into a solid state, 1500 cells were seeded into each well along with 1 ml of culture medium. After 8 days, when cell aggregates or spheroids were formed, the drug was added to the culture medium at a concentration of 80 \u0026micro;g/ml. After 2 days, the formed spheroids were photographed with a light microscope, and the size of the spheroids was measured using ImageJ software. Alamar Blue (resazurin) assay was also used to evaluate the viability of the cells. After the addition of resazurin, incubation was performed for 3 hours and fluorescence measurements were performed at excitation and emission wavelengths of 560 and 590 nm, respectively, using a microplate reader (Synergy H1 Hybrid Multi-Mode Microplate Reader, Bio Tek Company, USA). In addition, the spheroids and cell viability were examined by phalloidin staining. First, the cells were fixed using 4% paraformaldehyde for 15 minutes at 4\u0026deg;C. In the next step, the paraformaldehyde was removed and triton 0.1% was used for 15 minutes to permeabilize the cells. Finally, the dye phalloidin (Sigma Aldrich, Germany) was added to them at a concentration of 1.3 \u0026micro;M, and the stained cells were imaged using an epifluorescence microscope (leica DMI6000B, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe statistical analyses were performed through analysis of variance (ANOVA) using Minitab V17 software. The α\u0026thinsp;=\u0026thinsp;0.05 was considered for determining the significance of the factors (confidence level of 95%) in all analyses. Furthermore, the pairwise comparisons were done using Tukey analysis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. Nanoparticles characterizations\u003c/h2\u003e\n \u003cp\u003eThe results of DLS showed that the nanoparticles loaded with and without EGCG had an average size of 17.53\u0026thinsp;\u0026plusmn;\u0026thinsp;1.62 nm and 14.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3 nm (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea), respectively. The zeta measurement is an important measure of the stability of colloidal dispersions, which results from the degree of electrostatic repulsion between charged particles. The zeta value of the nanoparticles containing EGCG was \u0026minus;\u0026thinsp;0.166\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169 mv and that of the NPs without EGCG was \u0026minus;\u0026thinsp;0.266\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169mv (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). The electrophoretic mobility, that is the response of the solute to the applied electric field, was \u0026minus;\u0026thinsp;0.000001 cm\u003csup\u003e2\u003c/sup\u003e/Vs for nanoparticles containing EGCG and \u0026minus;\u0026thinsp;0.0000013 cm\u003csup\u003e2\u003c/sup\u003e/Vs for nanoparticles without EGCG.\u003c/p\u003e\n \u003cp\u003eFTIR analysis was carried out in the range 400\u0026ndash;4000 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. In the FTIR of nanoparticles without EGCG (PEG, Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea), the OH stretching vibration was observed at 3446 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The peak at a wavenumber of 2925 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicates the presence of a methylene group. The absorption around 1541 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is due to the bond vibration of \u0026ndash;CH2. The C\u0026thinsp;=\u0026thinsp;O group in polyethylene glycol produced a peak at 1095 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. The C\u0026thinsp;=\u0026thinsp;O stretching vibration, a strong band around 1637 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was also observed and the sharp strong band detected at 949 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is due to the C-C stretching vibration [\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\n \u003cp\u003eThe FTIR spectrum of EGCG-containing nanoparticles is shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb. In the FTIR pattern of the nanoparticles wih EGCG, the peak recorded in the range of 3200\u0026ndash;3650 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicates the OH group in the aromatic ring of EGCG and the structure of PEG. It seems due to the removal of some OH groups as a result of the inteaction between the drug and nanoparticles, the intensity of this peak decreased. The absorption bonds in the range of 1500\u0026ndash;1700 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e indicates the C\u0026thinsp;=\u0026thinsp;C groups in the aromatic ring and the peak at the wavenumber of 1100 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e is related to the C\u0026thinsp;=\u0026thinsp;O group in EGCG. As shown in the Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb, the intensity of the peak at the wavelengths of 1100 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 2915 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e in nanoparticles containing EGCG increased due to the presence of C\u0026thinsp;=\u0026thinsp;O and C-H groups in both PEG and EGCG [\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.2. Drug loading\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe loading capacity was calculated by the total amount of drug entrapped in NPs divided by the total weight of the NPs. The loading of EGCG in PEG was calculated using the standard curve based on different concentrations of EGCG which was 13.97\u0026thinsp;\u0026plusmn;\u0026thinsp;1.23 ng/\u0026micro;g.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Drug release from nanoparticles\u003c/h2\u003e\n \u003cp\u003eThe release profile of EGCG from the nanoparticles is shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e. The results of the release test, which were carried out at different time intervals showed that about 15% of the active substance was released into the environment within the first 6 hours, and thereafter the release rate became very slow. By day 8, about 25% of the drug was released.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. 2D Biological tests\u003c/h2\u003e\n \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.1. Cell proliferation assay\u003c/h2\u003e\n \u003cp\u003eThe MTT test is a colorimetric method for quantifying cellular metabolic activity indicating the cell viability, proliferation and indirect cytotoxicity. The results of the MTT test on TSCC-1 and HUGU cells were analyzed at two time points of 48 hours and 72 hours. Figure \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea shows the effect of materials on TSCC-1 cells in two time periods. The results indicated that the EGCG extract group generally has a higher proliferation than the other two groups (In 48 hours the proliferation in all concentrations was over 100% and in 72 hours it was over 73%), while the NPs without EGCG in 48 hours and the NPs with EGCG in 72 hours show a very low cell proliferation. Nanoparticles without EGCG at concentrations of 40, 80 and 160 \u0026micro;g/ml showed a proliferation of 47.3%, 26.8% and 8.5%, and nanoparticles containing EGCG at concentrations of 40, 80 and 160 \u0026micro;g/ml in 72 hours showed proliferation of 19.5%, 16.5% and 23.2%. Therefore, it was concluded that both the type of treatment and the time were influential factors on the rate of cell proliferation (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05). For better comparison and for post hoc pairwise analysis, these 3 concentrations are separately shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb.\u003c/p\u003e\n \u003cp\u003eThe results of the MTT test on normal cells (HUGU) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e) show that there is no significant difference in cell proliferation between the group with EGCG extract, the NPs without EGCG and the NPs with EGCG at different concentrations (P-value\u0026thinsp;=\u0026thinsp;0.83). In addition, a general decrease in cell proliferation was observed over the 72-hour period compared to 48 hours (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The strongest reduction was seen in the nanoparticles without EGCG, but in the group of EGCG-containing NPs and the EGCG group, this reduction was much lower. Thus, the vitality was more than 77.8% in the EGCG group and more than 42.1% (42.1%-68.4%) in the EGCG-containing nanoparticles for concentrations of 40, 80 and 160 mg/ml in 72 hours. The lack of a statistically significant difference between the 48- and 72-hour effects of NPs containing EGCG on gingival fibroblast cells (HUGU) suggests that this formulation has no effect on normal cells despite its toxic effect on oral cancer cells. It appears that in clinical use, NPs containing EGCG may cause minimal side effects on healthy oral cells, which may express the selective toxicity of the drug to cancer cells.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.2. Cytotoxicity\u003c/h2\u003e\n \u003cp\u003eThe LDH cytotoxicity test is a colorimetric evaluation that offers a simple and reliable way for identifying cellular cytotoxicity. DH, a cytosolic enzyme, occurs in various cell types and is released into the cell culture medium when the plasma membrane is damaged. To investigate the effect of EGCG, nanoparticles without EGCG and nanoparticles with EGCG on the TSCC-1 cell death, the cells were treated with different concentrations and the changes in the viability were measured using the LDH assay. This test, which was carried out after 72 hours of incubation, showed that the type of treatment influences the death of the cancer cells (P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). The results revealed that there was no significant difference between the groups of EGCG extract, nanoparticles without EGCG and nanoparticles with EGCG at concentrations of 5, 10, 20, 40 \u0026micro;g/ml. At concentrations of 80 and 160 \u0026micro;g/ml, cell viability was lower in the NPs containing EGCG than in the NPs without EGCG, similarly it was also lower in the NPs without EGCG than in the EGCG extract. The highest toxicity of nanoparticles containing EGCG on TSCC-1 cells was at a concentration of 160 \u0026micro;g/ml followed by that at 80 \u0026micro;g/ml. The level of toxicity and viability was almost similar in the other groups tested. The results of the MTT and LDH tests on TSCC cells and the proliferation of normal cells (HUGU) showed that the concentrations of 80 and 160 and then 40 \u0026micro;g/ml were more effective than the other concentrations tested. Therefore, these three concentrations were further investigated to study the colony formation and wound healing.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.3. Wound healing assay\u003c/h2\u003e\n \u003cp\u003eThe wound healing test is a standard in vitro technique for investigating cell migration in two dimensions. Light microscopy photographs of the wound healing taken with 40X magnification at time intervals of 0 and 24 hours are shown in Fig.\u0026nbsp;7. The images showed that after 24 hours in the control group (without treatment), the scratch created by the pipette tip was completely filled by the migrated cells (arrows in Fig.\u0026nbsp;7 identifies the closed edge). However, in the other groups treated with EGCG (E) extract, NPs without EGCG (N) and NPs with EGCG (NE) at concentrations of 40, 80 and 160 \u0026micro;g/ml, the gap was not closed. As it can be seen from the microscopic images, the cells in the control group and in the concentrations of 40 and 80 \u0026micro;g/ml EGCG retained their shape (spindle shape), but in the other groups tested, a change in the original shape was observed.\u003c/p\u003e\n \u003cp\u003eTo quantitatively compare the wound closure in the different groups, the distance between the two edges of the scratch was measured 0 and 24 hours after treatment using ImageJ software, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e. It was shown that in the groups exposed to EGCG and NPs without EGCG, the wound closure rate decreased with increasing concentration of the substance. In the cells exposed to NPs containing EGCG, there was no wound closure. As the concentration increased in this group, the width of the wound increased, but this increase was not statistically significant. In general, it is believed that NPs containing EGCG can play an effective role in inhibiting the migration of TSCC-1 cells, and that the inhibitory effect is not significantly related to the concentration of the substance.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\n \u003ch2\u003e3.4.4. Colony formation assay\u003c/h2\u003e\n \u003cp\u003eThe clonogenic test is an in vitro cell survival assay determining a single cell ability to grow into a colony. This analysis examines the ability of a single cell to grow into a large colony by clonal expansion. The images taken with a normal camera and a microscope with 40x magnification after 10 days are shown in Fig. 9. The results show that despite the proliferation and formation of cell aggregates in the control group and to a lesser extent in the EGCG group at a concentration of 40 \u0026micro;g/ml, no colonies, proliferation and accumulation of the cells were seen in the other groups. This demonstrates the efficacy of EGCG, NPs with and without EGCG at all concentrations tested.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.4.5. Apoptosis\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eBased on the results obtained from the scratch test and colony assay, the concentration of 80 \u0026micro;g/ml was chosen as the optimal concentration and used for apoptosis tests, gene analysis and 3D culture. Labeling cells with annexin V and propidium iodide (PI) is a technique for identifying cell death and distinguishing between its different pathways; Apoptosis (programmed cell death) and necrosis. The results of the test in the control group and the cells treated with a concentration of 80 \u0026micro;g/ml EGCG-containing NPs show that the viability rate of the treated cells decreased significantly (0.37%) and delayed apoptosis (88.3%) was induced in this group compared to the control group. The rate of early apoptosis also increased significantly in this group (Figs. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.4.6. Gene expression\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eThe expression levels of the BAX, BCL2 and VEGF genes were measured in the control group and in the cells treated with a concentration of 80 \u0026micro;g/ml EGCG-containing NPs. The BAX gene was the first identified pro-apoptotic member of the Bcl-2 protein family. The majority of BAX is located in the cytosol of the healthy mammalian cells, but once the apoptotic signaling is initiated, BAX undergoes a conformational change. BAX expression is upregulated by the tumor suppressor protein p53, and it has been revealed to be involved in p53-mediated apoptosis. Drugs that activate BAX are promising for the treatment of cancers as they induce the apoptosis. The real-time PCR results showed that the relative BAX level was 1.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50 in the control group and 1.86\u0026thinsp;\u0026plusmn;\u0026thinsp;0.59 in the group treated with NPs containing EGCG at a concentration of 80 \u0026micro;g/ml, indicating an increase in gene expression in the group treated with EGCG-containing NPs, but this value showed no statistically significant difference with that of the control group (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003ea).\u003c/p\u003e\n \u003cp\u003eThe BCL2 gene, a founding member of the Bcl-2 family of regulator proteins, is bounded to the mitochondria outer membrane. It has a key role in enhancing cellular survival, inhibiting the activities of pro-apoptotic proteins, and regulating cell death, by either inhibiting or inducing apoptosis, The results of the test showed that the relative level of gene expression in the control group was 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 and in the group treated with NPs containing EGCG with a concentration of 80 \u0026micro;g/ml was 0.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23, which showed a statistically significant decrease in BCL2 gene expression (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003eb).\u003c/p\u003e\n \u003cp\u003eVascular endothelial growth factor (VEGF) is a signaling protein promoting the growth of new blood vessels. Angiogenesis is higher in tumor cells than in healthy cells, and its inhibition by therapeutic agents is of importance. The relative expression of this gene was 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 in the control group and 0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16 in the group treated with NPs containing EGCG at the concentration of 80 \u0026micro;g/ml, indicating a significant decrease in the expression of the VEGF gene in the group treated with drug-containing nanoparticles (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003ec).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec28\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e3.5. 3D Biological tests\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eAlamar Blue is a reagent for the determination of cell viability containing resazurin that is a cell-permeable, non-toxic and weakly fluorescent blue indicator dye. The Alamar Blue assay was used to examine cell viability or proliferation in the 3D spheroids of the control group and the cells exposed to EGCG-containing NPs at the concentration of 80 \u0026micro;g/ml. The result of the Alamar Blue fluorescence measurement of the two groups showed that the survival of the cells in the spheroids exposed to EGCG-containing NPs decreased significantly compared to the control group (Fig.\u0026nbsp;13a).\u003c/p\u003e\n \u003cp\u003eTo quantitatively examine the difference in spheroid size between the control group and the cells treated with NPs containing EGCG, the light microscope images were taken and the average diameter of the spheroids was measured before and after treatment with NPs containing EGCG using the ImageJ software. The results (Figs. 13b and 13c) showed that the size of the spheroids in the treated group decreased significantly compared to the spheroids of the control group.\u003c/p\u003e\n \u003cp\u003eTo further assess the living cells in the 3D spheroids, the cells were stained green with phalloidin-fluorescein isothiocyanate solution and examined with an epifluorescence microscope. As shown in Fig. 14, the size of spheroids in the nanoparticle-treated group decreased compared to the control group, indicating the inhibitory effect of NPs with EGCG on the growth of spheroids.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOral cancer which is the 6th most common cancer in the world, has a high incidence in South Asia [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Oral squamous cell carcinoma (OSCC) is the most frequent malignancy and accounts for more than 90% of all head and neck cancers [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The etiology of oral cavity cancer is well understood in most cases, with tobacco use in any form and alcohol being the most common etiologic factors [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. While a number of patients have long-term survival, especially the ones diagnosed at an early stage, most patients dealt with this cancer have the advanced disease at the diagnosis time [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The current treatment approaches for this cancer include surgery, chemotherapy and radiotherapy. Nevertheless, recurrence, the multidrug resistance development, side effects and adverse reaction, and high cost of therapy are substantial problems that point to the need for more efficient and less toxic drugs and interventions [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTea is one of the most consumed beverages worldwide. Epigallocatechin3-gallate or EGCG is the amplest catechin and accounts for 48\u0026ndash;55% of total catechins. EGCG has attracted much attention owing to its antioxidant, anti-tumor, anti-inflammatory and anti-angiogenic properties. It has been shown that EGCG has a strong chemopreventive effect on various types of cancer, including breast cancer [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. However, poor biopharmaceutical and pharmacokinetic properties including poor stability in the gastrointestinal tract, low intestinal permeability and short half-life in plasma, have obstructed the clinical development of EGCG [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Moreover, PEGylation confers several useful characteristics to the native molecule, leading to improved pharmacokinetic and pharmacodynamic properties, which sequentially allow the native molecule to attain maximum clinical efficacy [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Furthermore, nanocarriers can increase the drug absorption, protect premature degradation of the drugs, lengthen the circulation time of drugs, show high differential uptake efficiency in target cells versus normal cells, reduce toxicity by avoiding the drug from early interacting with the biological environment, and boost the intracellular penetration, to name a few [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite various studies on the anti-cancer effect of EGCG, the effect of nanoparticles containing EGCG on the TSCC-1 cell line has not been investigated yet. This study was conducted with the aim of examining the effect of polyethylene glycol nanoparticles containing epigallocatechin gallate on TSCC-1 cells. In this study, after the preparation of the nanoparticles, the properties of these particles were evaluated by DLS, zeta potential, FTIR, release and drug loading tests. Subsequently, its effect on cancer cells was investigated by MTT, LDH, colony formation, wound healing and apoptosis (PI and Annexine V) tests, and the expression of BAX, BCL2 and VEGF genes was measured by PCR analysis. In addition, the effects of the drug on cell spheroids (3D culture) were also studied. Instead of using animal model to extend the results obtained, in our research we applied the 3D culture of cells which more precisely mimic the in vivo cancer conditions.\u003c/p\u003e \u003cp\u003eThe study by Yoshimura et al. which examined the effect of EGCG extract on oral SCC cells, showed a decrease in cell proliferation depending on concentration and time as well as a decrease in apoptosis by the Tunnel test, similar to our study [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The study by Lee et al. also investigated the effect of EGCG extract on SCC cells in the tongue. A reduction in cell proliferation, cell migration, wound healing time and protein concentrations of TAZ, 1 LATS, 1 MOB and JNK as well as a promotion of apoptosis were observed [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In addition, in the study by Lin et al. in which the effect of EGCG extract on SCC cells in the head and neck region (HNSCC) was tested, a reduction in cell proliferation, a reduction in BCL2 and VEGF gene expression and the induction of apoptosis with arrest in G1 of the cell cycle were observed in parallel to the present study [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the study by Barani et al. the anti-cancer effect of green tea extract loaded in PEG-coated niosomes was discussed. The extraction of the green tea extract and its evaluation were carried out using gas chromatography. The particle size was 9.8\u0026thinsp;\u0026plusmn;\u0026thinsp;241 nm determined by DLS test and the zeta potential was \u0026minus;\u0026thinsp;24.3\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9 mv. The results of this study, similar to the current study, showed a decrease in cell proliferation in the MCF-7, Hep G2 and HL-60 cell lines [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Green tea leaves contain polyphenols and various compounds such as caffeine, theobromine, theophylline and other methylxanthines, lignin, organic acids, etc [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In contrast to their research, our study investigated the specific effect of the most abundant and potent phenol in the green tea extract rather than examining the whole compounds. The other difference was the smaller particle size (17.53\u0026thinsp;\u0026plusmn;\u0026thinsp;1.62 nm) and a zeta potential of -0.169\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169 mv, which may support its penetration into the bulk of cancer cells possibly providing greater effect. The study by Chen et al. investigated the effect of EGCG and EGCG-nanoemulsion on lung cancer cells. In their study, similar to the present paper, it was found that the viability of cancer cells decreases in a dose- and time-dependent manner, with EGCG-containing nanoparticles being more effective than EGCG alone. Furthermore, the drugs at the concentration of less than 5 \u0026micro;M did not affect normal lung epithelial cells, but at the concentrations of 5 and 10 \u0026micro;M over a 72-hour period, decreased the cell viability. Moreover, similar to the current study, colony formation and cell migration were inhibited in a dose-dependent manner, and the nanoparticles were more effective [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In their study the molecular cellular signaling pathways were also examined using the Matrigel invasion assay and the gelatin zymography assay, and the changes in the AMP-activated protein kinase signaling pathway were studied using Western blot analysis. According to the results, nanoparticles containing the drug could inhibit lung cancer cell invasion by mechanisms independent of matrix metalloproteinase (MMP-2) and MMP-9, and modulate the expression of several key regulatory proteins in the AMPK signaling pathway by nano-EGCG. In addition, EGCG nanoparticles could prevent proliferation, colony formation, migration and invasion of lung cancer cells by activating the AMPK signaling pathway [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In the present study, the expression of the genes including BAX, BCL-2 and VEGF as well as apoptosis were examined using Annexin V and PI tests, and the most effective concentration of nanoparticles tested was 80 \u0026micro;g/ml which resulted in efficient changes compared to control group.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eThe results of the nanoparticle characterization tests indicate that the particles were composed of epigallocatechin gallate loaded in PEG nanoparticles, which had a stable and suitable surface, and that the loading rate of EGCG in the nanoparticles and the release of the drug into the medium were efficient.\u003c/p\u003e \u003cp\u003eMoreover, cell viability was significantly reduced in response to EGCG loaded nanoparticle treatment in a dose-dependent manner, while their effect on the normal gingival fibroblast cells (HUGU) was small, indicating the selective toxicity of nanoparticles to cancer cells and causing minimal side effects. Considering the cytotoxicity to normal gum cells, the best effective concentration tested in this study was 80 \u0026micro;g/ml, at which the expression of BCL2 and VEGF genes significantly decreased and the expression of BAX gene also increased, although the expression of this gene was not statistically significant. In addition, the rate of delayed apoptosis of the cells increased significantly at this concentration. The results showed that the ability of nanoparticles to inhibit colony formation and cell migration. Furthermore, the results of 3D cell culture revealed the efficiency of nanoparticles in inhibiting the growth of spheroids of TSCC-1 cells. Therefore, with the continuation of studies in this field, polyethylene glycol nanoparticles containing epigallocatechin gallate may become one of the options for the clinical treatment of SCC.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll assays were confirmed by the Ethics Committee of the Semnan Medical University Faculty of Medicine, Iran with IR.SEMUMS.REC.1401.144 certificate number.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of conflicting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) declared no potential conflicts of interest concerning the research, authorship, and/or publication of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by a grant from Semnan University of Medical Sciences (Grant No. 2017).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cul\u003e\n \u003cli\u003e\u003cstrong\u003eZahra Khatib Zadeh\u003c/strong\u003e conducted experiments, performed analyses, prepared the figures, and wrote the first draft of the manuscript\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eSamaneh Arab\u003c/strong\u003e consulted the project, designed the experiments, and wrote the first draft of the manuscript\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eSohrab Kazemi\u003c/strong\u003e performed experiments, and consulted the project \u0026nbsp;\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eMohadeseh Arabhalvaee\u003c/strong\u003e conducted experiments\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eElham Sadat Afraz\u003c/strong\u003e supervised the project and provided the materials\u003c/li\u003e\n \u003cli\u003e\u003cstrong\u003eMarjan Bahraminasab\u003c/strong\u003e designed the experiments, conducted data analyses, wrote the first draft of the manuscript and supervised the project\u003c/li\u003e\n \u003cli\u003eAll authors discussed the results of experiments, edited and approved the final version of the manuscript.\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to thank Semnan University of medical sciences for fining this research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eLim YC, Lee SH, Song MH, Yamaguchi K, Yoon JH, Choi EC, Baek SJ. Growth inhibition and apoptosis by (\u0026minus;)-epicatechin gallate are mediated by cyclin D1 suppression in head and neck squamous carcinoma cells. European Journal of Cancer. 2006 Dec 1; 42(18):3260-6.\u003c/li\u003e\n \u003cli\u003eLazarević M, Milo\u0026scaron;ević M, Petrović N, Petrović S, Damante G, Mila\u0026scaron;in J, Milovanović B. Cytotoxic effects of different aromatic plants essential oils on oral squamous cell carcinoma: An in vitro study. Balkan Journal of Dental Medicine. 2019; 23(2):73-9.\u003c/li\u003e\n \u003cli\u003eH Hoseinpour J, SA AD. Evaluation of some of the SCC risk factors in patients referring to dental school and Omid hospital in Mashhad from September 2002 to September 2003.jmds 2006\u003c/li\u003e\n \u003cli\u003eGranja A, Pinheiro M, Reis S. Epigallocatechin gallate nanodelivery systems for cancer therapy. Nutrients. 2016 May 20; 8(5):307.\u003c/li\u003e\n \u003cli\u003eXiao L, Mertens M, Wortmann L, Kremer S, Valldor M, Lammers T, Kiessling F, Mathur S. Enhanced in vitro and in vivo cellular imaging with green tea coated water-soluble iron oxide nanocrystals. ACS applied materials \u0026amp; interfaces. 2015 Apr 1; 7(12):6530-40.\u003c/li\u003e\n \u003cli\u003eMukherjee S, Ghosh S, Das DK, Chakraborty P, Choudhury S, Gupta P, Adhikary A, Dey S, Chattopadhyay S. Gold-conjugated green tea nanoparticles for enhanced anti-tumor activities and hepatoprotection\u0026mdash;Synthesis, characterization and in vitro evaluation. The Journal of nutritional biochemistry. 2015 Nov 1; 26(11):1283-97.\u003c/li\u003e\n \u003cli\u003eAggarwal V, Tuli HS, Tania M, Srivastava S, Ritzer EE, Pandey A, Aggarwal D, Barwal TS, Jain A, Kaur G, Sak K. Molecular mechanisms of action of epigallocatechin gallate in cancer: Recent trends and advancement. InSeminars in cancer biology 2022 May 1 (Vol. 80, pp. 256-275). Academic Press.\u003c/li\u003e\n \u003cli\u003eItalia J, Datta P, Ankola D, Kumar M. Nanoparticles enhance per oral bioavailability of poorly available molecules: epigallocatechin gallate nanoparticles ameliorates cyclosporine induced nephrotoxicity in rats at three times lower dose than oral solution. Journal of biomedical nanotechnology 2008; 4: 304-12.\u003c/li\u003e\n \u003cli\u003eSiddiqui IA, Adhami VM, Bharali DJ, Hafeez BB, Asim M, Khwaja SI, Ahmad N, Cui H, Mousa SA, Mukhtar H. Introducing nanochemoprevention as a novel approach for cancer control: proof of principle with green tea polyphenol epigallocatechin-3-gallate. Cancer research. 2009 Mar 1;69(5):1712-6.\u003c/li\u003e\n \u003cli\u003eGohulkumar M, Gurushankar K, Prasad NR, Krishnakumar N. Enhanced cytotoxicity and apoptosis-induced anticancer effect of silibinin-loaded nanoparticles in oral carcinoma (KB) cells. Materials Science and Engineering: C. 2014 Aug 1;41:274-82.\u003c/li\u003e\n \u003cli\u003eKolhe P, Kannan RM. Improvement in ductility of chitosan through blending and copolymerization with PEG: FTIR investigation of molecular interactions. Biomacromolecules \u0026nbsp; 2003; 4: 173-80\u003c/li\u003e\n \u003cli\u003eElmarzugi NA, Adali T, Bentaleb AM, Keleb EI, Mohamed AT, Hamza AM. Spectroscopic characterization of PEG-DNA biocomplexes by FTIR. J. Appl. Pharm. Sci \u0026nbsp;2014; 4: 006-10.\u003c/li\u003e\n \u003cli\u003ePramono E, Utomo S, Wulandari V, Clegg F, editors. FTIR studies on the effect of concentration of polyethylene glycol on polimerization of Shellac. J.Phys. Conf.Ser; 2016: IOP Publishing\u003c/li\u003e\n \u003cli\u003eReddy Polu A, Kumar R. Impedance spectroscopy and FTIR studies of PEG-based polymer electrolytes. E-J.Chem \u0026nbsp; 2011; 8: 347-53.\u003c/li\u003e\n \u003cli\u003eIcart L, Dos Santos E, Pereira E, Ferreira S, Saez V, Ramon J, Nele M, Pinto J, Toledo R, Silva D. PLA-b-PEG/magnetite hyperthermic agent prepared by Ugi four component condensation. Express Polym. Lett. \u0026nbsp;2016; 10: 188.\u003c/li\u003e\n \u003cli\u003eMoreno-V\u0026aacute;squez MJ, Plascencia-Jatomea M, S\u0026aacute;nchez-Valdes S, Tanori-C\u0026oacute;rdova JC, Castillo-Ya\u0026ntilde;ez FJ, Quintero-Reyes IE, Graciano-Verdugo AZ. Characterization of epigallocatechin-gallate-grafted chitosan nanoparticles and evaluation of their antibacterial and antioxidant potential. Polym.J. \u0026nbsp;2021; 13: 1375.\u003c/li\u003e\n \u003cli\u003eShah JP, Gil Z. Current concepts in management of oral cancer\u0026ndash;surgery. Oral Oncol 2009; 45: 394-401.\u003c/li\u003e\n \u003cli\u003eCalcaterra TC, Juillard GJ. Oral cavity and hypopharynx-head and neck cancer. In: Haskell CM, Berek JS, editors. Cancer treatment. Philadelphia: WB Saunders Co; 1995. pp. 726\u0026ndash;32.\u003c/li\u003e\n \u003cli\u003e. Sankaranarayanan R. Oral cancer in India: a clinical and epidemiological review. Oral Surg Oral Med Oral Pathol 1990;69:325\u0026ndash;30\u003c/li\u003e\n \u003cli\u003eDe Pace RC, Liu X, Sun M, Nie S, Zhang J, Cai Q, Gao W, Pan X, Fan Z, Wang S. Anticancer activities of (\u0026minus;)-epigallocatechin-3-gallate encapsulated nanoliposomes in MCF7 breast cancer cells. Journal of liposome research. 2013 Sep 1;23(3):187-96.\u003c/li\u003e\n \u003cli\u003eBailon P, Won CY. PEG-modified biopharmaceuticals. Expert opinion on drug delivery. 2009 Jan 1;6(1):1-6.\u003c/li\u003e\n \u003cli\u003eYoshimura H, Yoshida H, Matsuda S, Ryoke T, Ohta K, Ohmori M,Yamamoto S, Kiyoshima T, Kobayashi M, Sano K. The therapeutic potential of\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eepigallocatechin‑3‑gallate against human oral squamous cell carcinoma through\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003einhibition of cell proliferation and induction of apoptosis: In vitro and in vivo murine\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003exenograft study. Mol.Med.Rep. 2019; 20: 1139-48.\u003c/li\u003e\n \u003cli\u003eLi A, Gu K, Wang Q, Chen X, Fu X, Wang Y, Wen Y. Epigallocatechin-3-gallate affects the proliferation, apoptosis, migration and invasion of tongue 83 squamous cell carcinoma through the hippo-TAZ signaling pathway. Int. J.Mol. Med 2018; 42: 2615-27.\u003c/li\u003e\n \u003cli\u003eLin H-Y, Hou S-C, Chen S-C, Kao M-C, Yu C-C, Funayama S, Ho C-T, Way T-D. (\u0026minus;)-Epigallocatechin gallate induces Fas/CD95-mediated apoptosis through inhibiting constitutive and IL-6-induced JAK/STAT3 signaling in head and neck squamous cell carcinoma cells. J. Agric.Food Chem. 2012; 60: 2480-9\u003c/li\u003e\n \u003cli\u003eBaranei M, Taheri RA, Tirgar M, Saeidi A, Oroojalian F, Uzun L, Asefnejad\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eA, Wurm FR, Goodarzi V. Anticancer effect of green tea extract (GTE)-Loaded pHresponsive\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eniosome Coated with PEG against different cell lines. Mater.Today\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eCommun. 2021; 26: 101751\u003c/li\u003e\n \u003cli\u003eSenanayake SN. Green tea extract: Chemistry, antioxidant properties and food applications\u0026ndash;A review. J.Funct.Foods 2013; 5: 1529-41.\u003c/li\u003e\n \u003cli\u003eChen B-H, Hsieh C-H, Tsai S-Y, Wang C-Y, Wang C-C. Anticancer effects\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eof epigallocatechin-3-gallate nanoemulsion on lung cancer cells through the\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eactivation of AMP-activated protein kinase signaling pathway. Sci Rep 2020; 10:5163.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Head and neck Cancer, Epigallocatechin gallate, Nanoparticles, Green tea, 3-dimensional culture","lastPublishedDoi":"10.21203/rs.3.rs-3849470/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3849470/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eIntroduction:\u003c/h2\u003e \u003cp\u003eHead and neck cancer, as one of the most common cancers, causes the death of many people worldwide every year. The current approaches to treat this cancer have not been successful, and recurrence, drug resistance development, side effects, and high treatment costs are important problems necessitating the need for more effective drugs and treatment approach. Epigallocatechin gallate (EGCG) is the most plentiful and biological-active catechin in green tea with proved anticancer effect. However, the stability, low bioavailability, and short half-life, limits its clinical use. The nanocarrier development may overcome these deficiencies by improving pharmacokinetics and pharmacodynamics. Therefore, this study aimed to examine the polyethylene glycol (PEG) nanoparticles containing EGCG for their anticancer activity.\u003c/p\u003e\u003ch2\u003eMaterials and methods\u003c/h2\u003e \u003cp\u003eFirst, PEG nanoparticles loaded with EGCG were prepared, which were then characterized by dynamic light scattering (DLS), zeta potential, and Fourier transform infrared spectroscopy (FTIR). The toxicity of nanoparticles on the TSCC-1 cancer cell line was assessed by MTT and LDH assays. Cell migration rate, colony formation ability, the apoptosis rate, and the expression level of BAX, BCL2, and VEGF genes after treatment of cancer cells with drug-loaded particles were assessed. Moreover, the effect of nanoparticles on the spheroid growth of TSCC-1 cells in three-dimensional (3D) culture was investigated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results of the FTIR assay demonstrate the presence of PEG nanoparticles containing EGCG. The size and zeta potential of the drug-loaded nanoparticles and nanoparticles without EGCG were 1.62\u0026thinsp;\u0026plusmn;\u0026thinsp;17.53 nm and \u0026minus;\u0026thinsp;0.166\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169 mv, and 14\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3 nm and \u0026minus;\u0026thinsp;0.266\u0026thinsp;\u0026plusmn;\u0026thinsp;0.169 mv, respectively. The synthesized nanoparticles showed sustained release of the drug. Moreover, the MTT assay showed the cytotoxicity of the nanoparticles was significant at a concentration of 80 \u0026micro;g/ml on TSCC-1 cells. The colony formation assay showed no colonies in the groups treated with nanoparticles containing EGCG compared to the control group. The scratch test also revealed the ability of the nanoparticles to inhibit cell migration. Furthermore, the induction of delayed apoptosis by 88.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.18% was observed in the group treated with nanoparticles at a concentration of 80 \u0026micro;g/ml. In addition, the expression of BCL2 and VEGF gene significantly decreased and BAX gene increased. Furthermore, the study of cultivation in the 3D environment showed a decrease in the size and growth of cell spheroids in the nanoparticle-treated group compared to the control group.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results show that PEG nanoparticles containing EGCG have significant anticancer activity (TSCC-1) and may be a suitable treatment option for the management of squamous cell carcinoma of the head and neck.\u003c/p\u003e","manuscriptTitle":"Anticancer effect of Epigallocatechin Gallate Loaded Nanoparticles on Head and Neck Cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-12 10:37:57","doi":"10.21203/rs.3.rs-3849470/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"c6e2d2ad-1892-4a14-bcc4-1af9f0659e7b","owner":[],"postedDate":"January 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-01-18T15:14:17+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-12 10:37:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3849470","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3849470","identity":"rs-3849470","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00