RhoB regulates prostate cancer cell proliferation and docetaxel sensitivity via PI3K-AKT signaling pathway

RhoB regulates prostate cancer cell proliferation and docetaxel sensitivity via PI3K-AKT signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article RhoB regulates prostate cancer cell proliferation and docetaxel sensitivity via PI3K-AKT signaling pathway Tiantian Sheng, Hang Su, Lu Yao, Zhen Qu, Hui Liu, Wenjuan Shao, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5198679/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Feb, 2025 Read the published version in BMC Cancer → Version 1 posted 4 You are reading this latest preprint version Abstract Docetaxel is the first line treatment method for castration-resistant prostate cancer (CRPC). RhoB plays important role in prostate cancer metastasis and PI3K-AKT signaling pathway. RhoB involves in regulation of cytoskeleton reassembly, cell migration, focal adhesion (FA) dynamics. CRISPR/Cas9 gene editing technique was utilized to knock out the RhoB gene in prostate cancer cells, and was confirmed by using T7 endonuclease I (T7EI) and Sanger sequencing. Epithelial–mesenchymal transition (EMT) process was enhanced by RhoB knockout (KO), IC50 value of docetaxel towards PC-3 cells with RhoB KO decreased. Migration and invasion of prostate cancer cells were enhanced when the RhoB gene was knocked out, and these were inhibited when the gene was overexpressed. But, cell cycle of prostate cancer cells was not affected by the RhoB gene status. RNA seq was conducted on PC-3 cells which were overexpressed or knock out RhoB gene. The RNA seq results indicated that RhoB may regulate focal adhesion, ECM receptor interaction, and PI3K-AKT signaling pathway and further influence the EMT process, migration, and invasion of prostate cancer cells. We also found that RhoB overexpression activate PI3K-AKT signaling when PC-3 cells were treated with low concentration of DTXL (50 nM, 72 h), suggesting RhoB overexpression decreased DTXL cytotoxicity towards prostate cancer cells via PI3K-AKT signaling activation. Prostate cancer RhoB CRISPR/Cas9 RNA-Seq Docetaxel Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 1. Introduction Rho GTPase can regulate cancer metastasis, they regulate actin cytoskeleton rearrangements and focal adhesion (FA) dynamics, among Rho subfamily including RhoA, RhoB, RhoC three isoforms, they possess similar sequence but the C-terminus was different, post-translation modifications often occur in C-terminus [1]. The RhoB gene is a member of the Rho GTPase, GTP-bound RhoB is the active form, and the GDP-bound RhoB is the inactive form; it cycles between the GTP- and GDP-bound states. Unlike RAS, there are no studies on the mutated, constitutively active form of RhoB [2]. RhoB distributes at the cell membrane, endosomes, multivesicular bodies and nucleus. RhoB regulates cytoskeleton reassembly, cell migration, FA dynamics [3]. Various stimuli can induce RhoB transient expression, such as ultraviolet ray, cytokines, growth factors, drugs. And RhoB regulates the intracellular EGFR, Ras, and PI3K/Akt signaling pathways to modulate intracellular structure and function [4, 5]. EGFR, Ras, and PI3K-AKT have been shown to downregulate RhoB, which in turn regulates EGFR and AKT in a feedback manner [6, 7]. RhoB is usually downregulated in cancer and is regarded as a tumor suppressor [8]. RhoB is unmutated in various types of cancer, but its altered expression and activity are critical for cancer progression. RhoA and RhoC expressions are correlated positively with metastasis in various cancer types, while RhoB is correlated negatively with metastasis in some cancer types [9]. Meanwhile, Rho GTPases play important roles in regulating the epithelial–mesenchymal transition (EMT) of cancer cells [10]. EMT plays important roles in regulating cancer cell metastasis, which requires several cellular processes including epithelial cell-cell conjunctions disruption, cell polarity loss and cytoskeletal architecture changes. EMT is induced by several transcription factors, such as Snail, Zeb-1, and Slug. Cancer cells that undergo EMT detach themselves from the primary tumor, migrate through the basement membrane, and invade the vasculature [11]. RhoB knockdown can induce the elongated morphology of lung cancer cell and downregulate the E-cadherin but increase Slug expression. RhoB directly interact with PP2A to regulate the AKT1 dephosphorylation [12]. RhoA and RhoC regulate the EMT process in colon cancer, and Rac1 activation can induce EMT [13]. A study has reported that RhoB negatively regulates cell migration and invasion via its influence on Akt activity to regulate EMT [14]. It was reported that RhoB high expression was related to worse overall survival of colorectal cancer patients. Previously, it has been reported that RhoB could regulate the cell cycle, and cell-cycle changes in prostate cancer cells with RhoB knockout or overexpression have been studied, RhoB can interact with cyclin B1 and CDK1 to induce G2/M phase arrest [15]. Among the different phase of cell cycle, S phase possesses the most RhoB while RhoB declines in the S/G2-M transition phase of the cell cycle [16]. While, some studies showed that RhoB deletion cannot affect the cell cycle [17]. Moreover, RhoB is involved in autophagy regulation. RhoB phosphorylation can enhance its interaction with TSC2, and when the RhoB/TSC2 complex translocates to the lysosome, it can effectively inhibit the mTORC1 functions, and autophagy is activated [18]. RhoB can interact with Beclin 1 and HSP90 to enhance the clearance of uropathogenic Escherichia coli mainly by preventing Beclin 1 degradation [19]. RhoB turnover occurs quickly in cells, and its biosynthesis is rapidly regulated by various growth and stress stimuli. RhoB is degraded via lysosomal pathway and not the ubiquitin–proteasome system [20]. RhoB seems to act contextually. A study has showed that RhoB is needed for the transformed cell to undergo apoptosis after encountering DNA damage or Taxol [4]. In this study, we used CRISPR/Cas9 technology to knock out the RhoB gene in PC-3 and DU145 cells. Then, effect of RhoB on cancer cell EMT, cancer cell DTXL sensitivity, cell migration and invasion, and cell cycle of prostate cancer cells was examined. RNA sequencing (RNA-Seq) was performed to determine the differentially expressed genes (DEGs) profiles when RhoB was knocked out or overexpressed in PC-3 prostate cancer cells. RhoB can activate PI3K-AKT signaling when PC-3 cells were treated with DTXL at a concentration of 50 nM for 72 hours. Finally, prostate cancer xenograft was established to evaluate the effect of RhoB gene on cancer growth. 2. Materials and methods 2.1. Materials PC-3 cells and DU145 cells were purchased from the Chinese Academy of Typical Culture Collection Cell Bank (Shanghai, China). PC-3 and DU145 cells were cultured in DMEM/F12 and DMEM medium, respectively, and was supplemented with 10% fetal bovine serum (FBS), penicillin, and streptomycin. LentiCRISPR v2 was used for gene knockout, pCDH-CMV-MCS-EF1-copGFP-T2A-Puro was used for gene overexpression, and PCDH-CMV-mRFP-GFP-hLC3B-EF1A-Puro was used to analyze autophagy; all three vectors were obtained from Addgene company. The CRISPR/Cas9-mediated RhoB gene knockout was performed via sgRNA targeting at the exon of RhoB at approximately + 100 bp downstream of the ATG initiation codon. Oligonucleotide sequences were cloned into lentiCRISPR v2. The insert sequences are listed in Table 1 and were synthesized by GENERAL BIOL company (Chuzhou, Anhui, China). NC sgRNA was used as negative control. T7 endonuclease 1 (T7E1) was purchased from Vazyme (Nanjing, China), and the pUCm-T vector from Beyotime (Shanghai, China). The IPTG/X-Gal plate was used to screen the reconstructed amplicon, which was a white bacterial colony. The corresponding white colony was sequenced to assess the gene editing efficiency. Puromycin was purchased from MedChemExpress. Table 1 Insert oligonucleotide sequences used for CRISPR/Cas9 knockdown Primer Forward Reverse NTC CACCG CACCACGGTCCATACATACA AAAC TGTATGTATGGACCGTGGTG C RhoB-1 CACCG CACATAGTTCTCGAAGACGG AAAC CCGTCTTCGAGAACTATGTG C RhoB-2 CACCG CACCGTCTTCGAGAACTATG AAAC CATAGTTCTCGAAGACGGTG C 2.2 Establishment of stable RhoB knockout or overexpressed cell lines Three plasmid systems were used to pack the lentivirus system, and the virus was subsequently purified. The HEK293T cells were transfected with psPAX2, pMD2.G, and lentiCRISPR v2 or pCDH-CMV-MCS-EF1-copGFP-T2A-Puro plasmid to package the lentivirus. The PC-3 and DU145 cells were transfected with the lentivirus, and the successfully transfected cells were selected using puromycin (5 µg/mL). sgRNA1 generates the knockout cells and this cell line was used in subsequent studies. 2.3 T7E I assay RhoB knock-out cancer cells were seeded into six-well plates at a concentration of 5 × 10 5 cells/well, and their genomic DNA was isolated using the Universal Genomic DNA Kit (CWBIO, CW2298) according to the manufacturer’s instructions. The targeted genomic locus was amplified using PCR with the following primers: F: ATGGCGGCCATCCGCAAG, R: TCATAGCACCTTGCAGCA, amplicon sizes of the primers was 591 bp (Table 2 ). The amplicon was purified, and 200 ng of purified amplicons were denatured, reannealed, and digested with T7EI (Vazyme). To determine the DNA sequence of the targeted gene, the PCR product was TA-cloned into the pUCm-T vector. Original gel files are in the Supplementary Fig. 1A, 1B. Table 2 Primer for RhoB full length amplication Primer Forward Reverse RhoB full length ATGGCGGCCATCCGCAAG TCATAGCACCTTGCAGCA 2.4 Western blotting The RhoB gene knockout or overexpressed PC-3 or DU145 cells were seeded in six-well culture plates, or cells were treated with DTXL (50 nM) for 72 h. Total protein was extracted from the cells using Westen blot lysis (Beyotime, China) and protein concentration was determined using BCA kit (Beyotime, China). Cell lysates were separated on 10–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. The membrane was blocked with 5% milk and subsequently incubated with primary antibodies against β-catenin, vimentin, zonula occludens-1 (ZO-1), N-cadherin, E-cadherin, phospho-Akt (Thr308) (13038S, CST), phospho-AKT (Ser473) (80455-1-RR, Proteintech), SRC (11097-1-AP, Proteintech), phospho-Src Family (Tyr416) (6943, CST), phospho-Src (Tyr527) (2105, CST), FAK (12636-1-AP, Proteintech), phospho-FAK (Tyr397) (8556, CST), mTOR( 66888-1-Ig, Proteintech), phospho-mTOR (Ser2448) (67778-1-Ig, Proteintech), NF-κB p65 (10745-1-AP, Proteintech), phospho-p44/42 MAPK (Erk1/2) (4370, CST), p44/42 MAPK (Erk1/2) (4695, CST), PI3 kinase p110 alpha (67071-1-Ig, Proteintech), PI3 kinase p110 beta (20584-1-AP, Proteintech), PI3 kinase p85 alpha (ab191606, Abcam), PI3 kinase p85 beta (ab180967, Abcam), and GAPDH overnight at 4°C. Then, the membrane was incubated with the secondary antibody for 1 h. Images were captured using a Tanon 2500R imaging system. Original gel files are in the Supplementary Fig. 1C, 2, 9. 2.5 RhoB knockout sensitizes the cancer cells to DTXL The PC-3 cells were plated in 96-well plates, different concentrations of DTXL were added, the cells were incubated for 24 h, and the cell viability was determined using the MTT assay. The IC 50 of DTXL was calculated from the cell inhibition rates. A calcein/PI cell viability/cytotoxicity assay kit was used to observe the live and dead cells. The apoptosis of prostate cancer cells with RhoB different expression that treated with DTXL or not was evaluated using Annexin V apoptosis assay. 2.6 The effect of RhoB on cell migration and invasion The effect of RhoB on the migration and invasion of PC-3 or DU145 cells was investigated. Uncoated transwell chambers (8-µm pores, Corning, NY, USA) were used for the migration assay, and Matrigel (356234; Corning Inc.)-coated chambers were used for the invasion assay. For this procedure, 100 µL of diluted Matrigel (mixed with DMEM at 1:8) was added to the upper chamber and incubated for 1 h at 37°C. On the other hand, 5 × 10 3 cells were seeded into the upper chamber, the lower chamber had 500 µL medium containing 10% FBS. Cells on the upper surface of the transwell chamber were removed with cotton swabs, and those on the lower surface were fixed and stained with crystal violet. 2.7 Cell cycle analysis The RhoB gene was successfully knocked out or overexpressed in PC-3 or DU145 cells. Then, the prostate cancer cells were seeded in six-well plates at a concentration of 1 × 10 5 cells/well. The cells were washed with cold PBS and fixed with 70% ethanol at 4°C overnight, treated with RNase A for 30 min, and stained with propidium iodide (PI) for 30 min at 37°C according to the manufacturer’s protocol. The cell cycle was measured using flow cytometry (BD FACS Caton, USA), and the data were analyzed using the FlowJo software (version 10.9). 2.8 RNA-Seq of RhoB knockout and overexpression PC-3 cells The RNA-Seq was performed to evaluate the differentially expressed genes (DEGs) in RhoB knockout (KO group), RhoB overexpressed (OE group), and RhoB normally expressed (CON group) PC-3 cells. The total RNA was extracted from the cells. The expression of each gene was calculated using the mean value of log 2 (TPM + 1). The BGISEQ was used for sequencing, and the sequence length was PE150. The raw reads were filtered to obtain the clean reads, and the HISAT software was used to BLAST the clean reads to the reference genome GCF_000001405.39_GRCh38.p13. “Q value ≤ 0.05, │log2FC│≥1” was used as the threshold to judge the significance of gene expression differences among KO, OE, and CON. The comparison groups were KO vs. CON, OE vs. CON, and OE vs. KO. The Gene Ontology (GO)/ Kyoto Encyclopedia of Genes and Genomes (KEGG) cluster analysis of the DEGs was performed using the Dr. Tom online system provided by BGI. The heatmaps were drawn using the online system. 2.9 Immunofluorescence staining Wildtype PC-3 cells or RhoB KO or RhoB OE PC-3 cells were treated with DTXL (50 nM) for 72 h, and then cells were incubated with phospho-FAK (Tyr397) (8556, CST) primary antibody overnight, then incubated with goat anti-rabbit IgG H&L (Alexa Fluor® 488) at dilution of 1:200 for 2 h at RT, then the cells were incubated with actin-tracker red-rhodamine (Beyotime, Shanghai) at dilution of 1:100 for 30 min at RT, the nuclei was stained using DAPI. Then the distribution of p-FAK and F-actin fiber was observed using fluorescence microscope (BX53, Olympus). 2.10 Tumor xenograft 200 µL of wildtype PC-3 cells or RhoB KO or RhoB OE PC-3 cells were subcutaneously injected into NOD-SCID mice (male, 4 weeks old), the cell concentration was 5×10 6 /mL. Five days later, the long diameter and short diameter of tumor was measured. Then, the long diameter and short diameter of tumor was measured each day until on 14 day after tumor cell injection. Tumor volume was calculated using the following formula: tumor volume (mm 3 ) = 0.5 × L × W 2 , where L is the longest dimension and W is the perpendicular dimension. Mice were euthanized through cervical dislocation and tumor were dissected, and HE staining were conducted to observe the histology changes. Tunnel staining was used to evaluate the cancer cell apoptosis of tumor cells, immunohistochemistry staining was used to evaluate RhoB (14326-1-AP, Proteintech), Cleaved caspase3(GB11532-100), Ki67(GB121141-100) protein expression on the tumor cells. All animal experimental procedures adhered to institutional ethical requirements and were approved by the Ethics Committee of Jining No.1 People’s Hospital (License No. JNRM-2022-DW-062). 2.11 Immunohistochemistry and Tunnel staining Xenograft tumor tissue from mice were embedded in paraffin, paraffin-embedded tumor was sectioned, sections were dewaxed to water. Slides were treated with 3% hydrogen peroxide to 25 min to block endogenous peroxidase. Then 3% BSA was used to block the untargeted protein for 1 hour at room temperature. Then slides were incubated with the corresponding primary antibody at 4°C for overnight incubation. The primary antibodies were RhoB, cleaved caspase3, Ki-67. Washout the primary antibody, and incubated with the secondary antibody and stained with DAB detection kit according to manufacturer’s protocols. Protein expression was scored and quantified. The quantification method was based on a multiplicative index of the average staining intensity (0–3) and extent of staining (0–4) in the tissue, yielding a staining index ranging from 0 to 12. All the analyses were conducted or confirmed by two certified clinical pathologists. As for tunnel staining, the slides were treated with protease K working solution and TDT enzyme, dUTP and buffer in the Tunnel kit according to manufactures’ instructions. DAPI solution was dripped into the slide and incubated at room temperature for 10 min in the dark and observed using fluorescent microscope. 2.12 Statistical analysis GraphPad Prism 9.5 software was used to perform statistical analysis. One-way analysis of variance was used for the comparison of differences among multiple groups, followed by the Student–Newman–Keuls method. A value of P < 0.05 was considered significantly different. 3. Results 3.1 CRISPR/Cas9-mediated knockout of RhoB in prostate cancer cells When the PC-3 cells were treated with sgRNA1 lentiCRISPR v2 or sgRNA2 lentiCRISPR v2 lentivirus, the target genome sequence was effectively cleaved by sgRNA1, sgRNA2, but not NTC sgRNA; the T7E1 assay reflected this phenomenon (Figs. 1 A). Then, the western blot assay was performed to determine the RhoB protein expression level, and sgRNA1 and sgRNA2 were found to mediate the complete knockout of the RhoB protein in PC-3 cells. On the contrary, NTC treatment did not alter the RhoB protein expression, and overexpression lentivirus increased the expression remarkably (Fig. 1 B). To confirm the RhoB gene mutation, the PC-3 cells treated with sgRNA1, sgRNA2, or NTC were used for PCR amplification of the target sequence, subcloned into a T vector, and sequenced. Sequence mutations, including deletions, insertions, and point mutations, were determined using Sanger sequencing (Figs. 1 C, D, E). It was observed that sgRNA1 and sgRNA2 effectively induced DSBs, and the nonhomologous recombination repair (NHEJ) occurred late. The single clone of the RhoB knockout PC-3 cell line was obtained using limited dilution assays, and it was augmented and observed under the microscope (Fig. 1 F). 3.2 EMT of prostate cancer cells after RhoB knockout When RhoB gene was knocked out in the PC-3 and DU145 cells, epithelial markers E-cadherin and ZO-1 decreased and the mesenchymal marker vimentin increased. This result indicated that RhoB knockout effectively induced EMT. On the contrary, when the RhoB gene was overexpressed in PC-3 and DU145 cells, the epithelial marker E-cadherin increased and the mesenchymal marker vimentin decreased. This observation signified that the reverse process named mesenchymal–epithelial transition occurred. N-cadherin expression did not change remarkably when RhoB was knocked out or overexpressed. Furthermore, when RhoB was knocked out, the β-catenin expression level increased. This finding suggests that when RhoB was knocked out, the β-catenin signaling pathway was probably activated (Fig. 2 and Figure S1 ). 3.3 Influence of RhoB on cytotoxicity of DTXL towards PC-3 cell For PC-3 cells, the IC 50 values of DTXL in wildtype, RhoB KO, and RhoB OE cells were 190.8, 74.06, and 374 nM, respectively. These results indicated that RhoB overexpression decreased DTXL sensitivity towards PC-3 cells (Fig. 3 A). PC-3 cells that treated with PBS but not DTXL constituted the control group, and there were almost no dead cells. Some dead cells were present in the control + DTXL group, which signified that DTXL exerted a cell-killing effect toward PC-3 cells. However, when the RhoB gene was knocked out, the dead cells after DTXL treatment increased dramatically compared with the wild-type prostate cancer cells treated with the drug. On the contrary, when the RhoB gene was knockout, DTXL of the same concentration enhanced the cytotoxicity toward the cancer cells compared with the control + DTXL group (Fig. 3 B). Subsequently, the apoptosis of PC-3 cells after treatment with different formulations was measured using the flow cytometry method. The total apoptosis rates (early apoptosis rate plus the late apoptosis rate) of the control, control + DTXL, RhoB OE + DTXL, and RhoB KO + DTXL groups were 0%, 34.29%, 9.90%, and 61.16%, respectively (Fig. 3 C). 3.4 Migration and invasion assays The results demonstrated that the overexpression of RhoB significantly inhibited cancer cell migration when compared with the control group, and the number of migrated PC-3 or DU145 cells was less compared with the control group (Fig. 4 A). Knockout of RhoB enhanced prostate cancer cell migration, and the number of cells that migrated to the lower surface of the transwell membrane increased significantly when compared with the control group (Fig. 4 A). Overexpression of RhoB significantly decreased the number of invading PC-3 or DU145 cells across the transwell membrane compared with the control group (Fig. 4 B). 3.5 Cell-cycle analysis Knockout or overexpression of RhoB in PC-3 cells or DU145 cells did not alter the cell distribution in the G1, S, or G2/M phase relative to the respective control groups (Fig. 5 A). The experiment was performed in triplicate, and the proportions of cells in the G1, S, and G2/M phases were analyzed statistically. There were no significant differences among the control group, RhoB knockout group, and RhoB overexpression group (Fig. 5 B). 3.6 RNA-Seq results of RhoB gene manipulation in PC-3 prostate cancer cells In KO vs. CON, 201 genes were upregulated and 62 were downregulated. In OE vs. CON, 243 genes were upregulated and 249 were downregulated. Finally, in OE vs. KO, 151 genes were upregulated and 346 were downregulated (Figs. 6 A, B). GO enrichment analysis was performed to identify the significant enrichment terms in the DEGs. The results revealed that focal adhesion, adherens junction, cell–cell junction, and collagen-containing extracellular matrix were enriched in the DEGs of KO vs. CON; focal adhesion, adherens junction, lamellipodium, extracellular exosome, and cell junction were enriched in the DEGs of OE vs. CON; and focal adhesion, adherens junction, cell junction, extracellular exosome, and endoplasmic reticulum were enriched in the DEGs of OE vs. KO. These results indicated focal adhesion of PC-3 cells was changed after RhoB gene knockout or overexpression (Fig. 6 C). In KEGG enrichment analysis, the signaling pathway of PI3K-AKT, ECM–receptor interaction, focal adhesion, proteoglycans in cancer, cell adhesion molecules, and oxidative phosphorylation was enriched in the DEGs of KO vs. CON; proteoglycans in cancer, focal adhesion, pathways in cancer, oxidative phosphorylation, and adherens junction were enriched in the DEGs of OE vs. CON; and PI3K-AKT signaling pathway, adherens junction, focal adhesion, proteoglycans in cancer, and pathways in cancer were enriched in the DEGs of OE vs. KO. These results indicated that PI3K-AKT signaling pathway was changed after RhoB gene knockout or overexpression (Fig. 6 D). The focal adhesion signaling pathway was enriched in the DEGs of OE vs. CON, and the genes ITGA2, EGFR, VEGFC, PPP1CB, LAMC2, TNC, VEGFA, LAMA3, THBS1, and LAMB3 were differentially expressed in OE and CON (Fig. 7 A). The PI3K-AKT signaling pathway was enriched in the DEGs of OE vs. CON, and the genes THBS1, AREG, ITGA2, EGFR, VEGFC, JAK1, ITGA5, LAMB2, COL6A3, TGFA, ERBB3, IL4R, CDKN1A, and IL6 were differentially expressed (Fig. 7 B). ECM–receptor interaction signaling pathway was enriched in the DEGs of KO vs. CON, and the genes included NPNT, COL6A3, ITGAV, COL4A1, ITGA5, COL4A2, COL1A1, and DAG1 (Fig. 7 C). Pathways in cancer signaling were enriched in the DEGs of KO vs. CON, and the genes included TGFB2, IL6, MSH2, COL4A2, NOTCH2, MSH6, IL4R, NCOA3, EGLN1, RUNX1, STAT2, NOTCH3, and AKT3 (Fig. 7 D). 3.7 RhoB activate PI3K-AKT signaling upon low concentration of DTXL In order to study the underlying mechanism of RhoB on DTXL sensitivity, we selected the DTXL concentration of 50 nM, which is below the IC50 values of DTXL towards PC-3 cells with RhoB KO or RhoB OE. PC-3 cells were treated with DTXL (50 nM) for 72 days. It was found that overexpressed RhoB can enhance the phosphorylation of AKT at T308, p-T308-AKT was increased in PC-3 cells treated with DTXL (50nM, 72 h), while p-S473-AKT did not increase. p-Y527-Src did not change in DTXL treated cells, and RhoB cannot regulate it. p-Y416-Src decreased in the RhoB overexpressed cancer cells, this indicated that RhoB can downregulate it no matter whether the cancer cells were treated with DTXL. p-FAK level increased after PC-3 cells treated with DTXL. p110α, p110β, p85α and p85β did not change remarkably no matter RhoB gene expression and DTXL treatment. And it was shown that RhoB activated PI3K-AKT signaling pathway upon DTXL treatment, but RhoB did not affect Src activity (Fig. 8 A). Immunofluorescent results indicated that p-FAK in the cytoplasm increased when the three types of cells treated with DTXL (50 nM) for 72 days. And F-actin of cancer cells decreased upon DTXL treatment in wild type and RhoB KO group, but did not decrease in RhoB OE group. This indicated that DTXL did not affect F-actin dramatically in RhoB OE group, when compared with wild type and RhoB KO group (Fig. 8 B). 3.8 RhoB knockout decreases tumor growth in prostate cancer xenografts Prostate cancer xenografts were established to study RhoB in vivo effects. The tumor growth curve showed that RhoB OE can decrease the in vivo tumor growth (Fig. 9 A, B), cancer cell morphology did not show changes (Fig. 9 E). Tunnel staining of cancer tissues indicated that much more apoptosis occurred in RhoB OE cells than control cells or knockout cells (Fig. 9 F), and IHC results also showed that cleaved caspase 3 expressed much more in RhoB OE cells while Ki67 index was much lower in this group (Fig. 9 G-J). These results indicated that RhoB overexpression can decrease the proliferation of cancer cells and induce apoptosis. TCGA database showed that RhoB expression decreased in prostate adenocarcinoma (PRAD) tissues compared with normal prostate tissues (Fig. 9 C). And prostate cancer patients with RhoB overexpression correlates with a much better prognosis compared with RhoB low/medium expression (Fig. 9 D). 4. Discussion EMT is one important reason of prostate cancer metastasis, and this was regulated by various molecular mechanism [21]. The incidence of prostate cancer is increasing every year in China, especially in developed regions, which could be due to the PSA screening and improved biopsy techniques [22]. Furthermore, RhoB is involved in Taxol-induced apoptosis of transformed cells. RhoB probably activates apoptosis when prostate cancer cells are treated with Taxol [23]. Some studies have shown that EMT is closely related to cancer cell migration and invasion, and plays important role in cancer metastasis [24, 25]. In this study, the CRISPR/Cas9 gene editing method was used to knock out the RhoB gene in PC-3 and DU145 cells. RhoB was successfully knocked out, which was verified at the gene level and protein level. The sgRNA was designed to target the exon of the RhoB gene at approximately + 100 bp downstream of the ATG initiation codon, which effectively induced INDEL in the RhoB gene, as confirmed via Sanger sequencing. We did not observe the off-target effects, off-target effects are cell type-specific and depend on the DSB repair pathway of the specific cell type [26]. In this study, RhoB knockout was demonstrated to decrease E-cadherin expression and increase vimentin expression. In addition, RhoB knockout increased the expression of β-catenin and decreased the ZO-1 protein expression. Therefore, RhoB knockout was speculated to induce EMT in prostate cancer cells, which agreed with the findings from a previous study [27]. However, the N-cadherin expression did not change remarkably in our study. On the contrary, RhoB overexpression inhibited EMT-related proteins in prostate cancer cells. The migration and invasion properties of prostate cancer cells were enhanced when the RhoB gene was knocked out. In a previous study on lung cancer cells, when RhoB was knocked out, the migration and invasion of lung cancer cells increased. RhoB change the morphology of bronchial, RhoB knockout induced the elongation of bronchial cells, and RhoB overexpression induced the round-shaped cells [27–29]. Therefore, RhoB knockout can induce the mesenchymal phenotype of cancer cells and enhance motility. The RNA-Seq results signified these genes pertaining to focal adhesion, adherens junction, and cell–cell junction were enriched in the DEGs of KO vs. CON. This observation indicated the involvement of RhoB in the regulation of cell focal adhesion and adherens junction. One study showed that RhoB acted as an oncogenic gene in breast cancer and phosphorylated the AKT protein and upregulated the expression of hypoxia-inducible factor-1α (HIF1α) under hypoxic conditions. The difference between this study and ours lies in the hypoxic conditions [30]. Some studies have shown that the tumor microenvironment plays a pertinent role in determining whether RhoB functions as an oncogene or as a tumor suppressor [4]. DTXL is the most commonly used chemotherapeutic agent in prostate cancer treatment. However, drug resistance occurs upon prolonged therapy [31]. Our in vitro cell viability assay results implied that the knockout of RhoB can enhance the cytotoxicity of DTXL toward PC-3 cells. The IC50 of DTXL decreased in RhoB knockout cancer cells when compared with the wild-type cells. Calcein AM/PI assay exhibited that dead cells were high in the RhoB knockout groups. Hence, RhoB knockout appears to sensitize the prostate cancer cells to DTXL, thereby resulting in apoptosis. In contrast, RhoB overexpression increased DTXL resistance in PC-3 cells. And the underlying mechanism was PI3K-AKT signaling pathway activation, we find that RhoB can activate p-T308-AKT at low dose DTXL (50 nM) and incubate for 72 h, RhoB cannot activate p-S473-AKT in RhoB overexpressed PC-3 cells. RhoB overexpression can downregulate p-Y416-Src but did not change p-Y527-Src. Low dose DTXL can increase the p-FAK level, and RhoB knockout can downregulate the p85α level. The immunofluorescent results also indicated that RhoB overexpression can activate the p-FAK and increase the F-actin when cells treated with DTXL (50 nM, 72h). When cancer cells were not treated with DTXL, RhoB loss seems to increase the F-actin, and this was consistent with Transwell and EMT results. RhoB exert obviously different effects on AKT when cancer cells treated with DTXL or not. This is very interesting, may be DTXL reversed the RhoB effect on AKT. And one previous study showed that RhoB overexpression endow lung cancer cell resistance to erlotinib through activation of AKT, the RhoB/AKT axis was very important in inducing erlotinib resistance of lung cancer cell [32]. Another study showed that RhoB overexpression was related to worse survival of colorectal cancer patients who received chemotherapy [33]. It seems that RhoB overexpression could induce drug resistance of chemotherapeutic agents. And our results also indicated that RhoB overexpression can induce DTXL resistance in PC-3 cells. One study showed that RhoB degradation increased focal adhesion (FA) formation and thereby increase cell invasion, when RhoB interact with ARF6, this was consistent with our results showing RhoB KO enhance F-actin activity. In conclusion, RhoB was involved in the regulation of prostate cancer cell EMT, DTXL sensitivity towards PC-3 cells, migration and invasion of prostate cancer cells. When RhoB was knocked out using the CRISPR/Cas9 technique, the cancer cells lost their intercellular junctions and basal–apical polarity. Moreover, the actin cytoskeleton was rearranged to facilitate cell elongation and motility. These results were verified using RNA-Seq, which also indicated that RhoB was involved in the cell focal adhesion and adherens junction. However, the gene did not affect the cell cycle. Furthermore, when PC-3 cells were treated with low dose DTXL (50 nM, 72h), we find that RhoB overexpression can activate p-T308-AKT and inhibit p-Y416-Src, this is interesting, and the concrete mechanism needs to be elucidated in future study. In prostate cancer xenograft, RhoB OE seems to inhibit caner growth and more cancer cell undergo apoptosis. Our study shed some light on prostate cancer patients chemotherapeutic, combination use of AKT inhibitor and DTXL in RhoB overexpressing prostate cancer will be much more effective than single use of DTXL. Declarations Funding Information This work was financially supported through grants from the Natural Science Foundation of Shandong Province (Nos. ZR2023MH260 and ZR2017QH005), the National Natural Science Foundation of China (Grant No. 81803097), Doctoral Fund of Jining No.1 People’s Hospital (2022-BS-002) and Key Research and Development Plan of Jining (2022YXNS113). Conflict of interest The authors declare that they have no competing interests. Ethics Statement All experiments including animal experiments were approved by the Ethics Committee of Jining No.1 People’s Hospital approved this study (License No. JNRM-2022-DW-062). No human experiments were conducted in this study. Informed Consent N/A. Registry and the Registration No. of the study/trial. N/A. Animal Studies. Yes. Consent to Publication All authors have consented to publication of this manuscript. All authors have read and approved the manuscript Data Availability statement FASTQ files will be uploaded to Genome Sequence Archive (GSA) in BIG Data Center (http://bigd.big.ac.cn/gsa), Being Institute of Genomics (BIG), Chinese Academy of Science, with an accession number HRA005103. And the BioProject number is PRJCA018403. Acknowledgment NA. Author contribution Tiantian Sheng and Hang Su did most of the experiment, and Lu Yao collected the data, Zhen Qu analyzed the data, Xiaoran Chen, Hui Liu and Yuetian Li prepared the Figures, Xiangyu Zhang and Wenjuan Shao wrote the main manuscript text. All authors have read and approved the manuscript. References Jansen S, Gosens R, Wieland T, Schmidt M. Paving the Rho in cancer metastasis: Rho GTPases and beyond. Pharmacol Ther. 2018, 183:1–21. Hodge RG, Schaefer A, Howard SV, Der CJ. RAS and RHO family GTPase mutations in cancer: twin sons of different mothers? Crit Rev Biochem Mol Biol. 2020, 55(4):386–407. Zaoui K, Smith HW, Park M, Duhamel S. ARF6 controls RHOB targeting to endosomes regulating cancer cell invasion. Mol Cell Oncol. 2020, 7(5): 1766932. Prendergast GC. Actin' up: RhoB in cancer and apoptosis. Nat Rev Cancer. 2001, 1(2): 162-8. Gutierrez E, Cahatol I, Bailey CAR, Lafargue A, Zhang N, Song Y, Tian H, Zhang Y, Chan R, Gu K, Zhang ACC, Tang J, Liu C, Connis N, Dennis P, Zhang C. Regulation of RhoB Gene Expression during Tumorigenesis and Aging Process and Its Potential Applications in These Processes. Cancers (Basel). 2019, 11(6): 818. Jiang K, Delarue FL, Sebti SM. EGFR, ErbB2 and Ras but not Src suppress RhoB expression while ectopic expression of RhoB antagonizes oncogene-mediated transformation. Oncogene. 2004, 23(5): 1136-45. Gu J, Huang W, Wang X, Zhang J, Tao T, Zheng Y, Liu S, Yang J, Chen ZS, Cai CY, Li J, Wang H, Fan Y. Hsa-miR-3178/RhoB/PI3K/Akt, a novel signaling pathway regulates ABC transporters to reverse gemcitabine resistance in pancreatic cancer. Mol Cancer. 2022; 21(1):112. Ju JA, Gilkes DM. RhoB: Team Oncogene or Team Tumor Suppressor? Genes (Basel). 2018, 9(2):67. Ridley AJ. RhoA, RhoB and RhoC have different roles in cancer cell migration. J Microsc. 2013, 251(3): 242-9. Crosas-Molist E, Samain R, Kohlhammer L, Orgaz JL, George SL, Maiques O, Barcelo J, Sanz-Moreno V. Rho GTPase signaling in cancer progression and dissemination. Physiol Rev. 2022, 102(1): 455–510. Brabletz T, Kalluri R, Nieto MA, Weinberg RA. EMT in cancer. Nat Rev Cancer. 2018,18(2): 128–134. Bousquet E, Calvayrac O, Mazières J, Lajoie-Mazenc I, Boubekeur N, Favre G, Pradines A. RhoB loss induces Rac1-dependent mesenchymal cell invasion in lung cells through PP2A inhibition. Oncogene. 2016, 35(14): 1760-9. Zacharopoulou N, Tsapara A, Kallergi G, Schmid E, Alkahtani S, Alarifi S, Tsichlis PN, Kampranis SC, Stournaras C. The Epigenetic Factor KOM2B Regulates EMT and Small GTPases in Colon Tumor Cells. Cell Physiol Biochem. 2018;47(1):368–377. Calvayrac O, Pradines A, Favre G. RHOB expression controls the activity of serine/threonine protein phosphatase PP2A to modulate mesenchymal phenotype and invasion in non-small cell lung cancers. Small GTPases. 2018, 9(4): 339–344. Chen W, Niu S, Ma X, Zhang P, Gao Y, Fan Y, Pang H, Gong H, Shen D, Gu L, Zhang Y, Zhang X. RhoB Acts as a Tumor Suppressor That Inhibits Malignancy of Clear Cell Renal Cell Carcinoma. PLoS One. 2016, 11(7): e0157599. Zalcman G, Closson V, Linarès-Cruz G, Lerebours F, Honoré N, Tavitian A, Olofsson B. Regulation of Ras-related RhoB protein expression during the cell cycle. Oncogene. 1995, 10(10): 1935-45. Liu AX, Cerniglia GJ, Bernhard EJ, Prendergast GC. RhoB is required to mediate apoptosis in neoplastically transformed cells after DNA damage. Proc Natl Acad Sci U S A. 2001, 98(11): 6192-7. Liu M, Zeng T, Zhang X, Liu C, Wu Z, Yao L, Xie C, Xia H, Lin Q, Xie L, Zhou D, Deng X, Chan HL, Zhao TJ, Wang HR. ATR/Chk1 signaling induces autophagy through sumoylated RhoB-mediated lysosomal translocation of TSC2 after DNA damage. Nat Commun. 2018, 9(1): 4139. Miao C, Yu M, Pei G, Ma Z, Zhang L, Yang J, Lv J, Zhang ZS, Keller ET, Yao Z, Wang Q. An infection-induced RhoB-Beclin 1-Hsp90 complex enhances clearance of uropathogenic Escherichia coli. Nat Commun. 2021, 12(1): 2587. Pérez-Sala D, Boya P, Ramos I, Herrera M, Stamatakis K. The C-terminal sequence of RhoB directs protein degradation through an endo-lysosomal pathway. PLoS One. 2009, 4(12): e8117. Siegel RL, Miller KO, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023, 73(1): 17–48. Ju W, Zheng R, Zhang S, Zeng H, Sun K, Wang S, Chen R, Li L, Wei W, He J. Cancer statistics in Chinese older people, 2022: current burden, time trends, and comparisons with the US, Japan, and the Republic of Korea. Sci China Life Sci. 2023, 66(5): 1079–1091. Liu Ax, Cerniglia GJ, Bernhard EJ, Prendergast GC. RhoB is required to mediate apoptosis in neoplastically transformed cells after DNA damage. Proc Natl Acad Sci U S A. 2001, 98(11): 6192-7. Zhang B, Li Y, Wu Q, Xie L, Barwick B, Fu C, Li X, Wu D, Xia S, Chen J, Qian WP, Yang L, Osunkoya AO, Boise L, Vertino PM, Zhao Y, Li M, Chen HR, Kowalski J, Kucuk O, Zhou W, Dong JT. Acetylation of KLF5 maintains EMT and tumorigenicity to cause chemoresistant bone metastasis in prostate cancer. Nat Commun. 2021, 12(1): 1714. Zheng Y, Li P, Huang H, Ye X, Chen W, Xu G, Zhang F. Androgen receptor regulates eIF5A2 expression and promotes prostate cancer metastasis via EMT. Cell Death Discov. 2021, 7(1): 373. Duan J, Lu G, Xie Z, Lou M, Luo J, Guo L, Zhang Y. Genome-wide identification of CRISPR/Cas9 off-targets in human genome. Cell Res. 2014, 24(8): 1009-12. Bousquet E, Mazières J, Privat M, Rizzati V, Casanova A, Ledoux A, Mery E, Couderc B, Favre G, Pradines A. Loss of RhoB expression promotes migration and invasion of human bronchial cells via activation of AKT1. Cancer Res. 2009, 69(15): 6092-9. Bousquet E, Calvayrac O, Mazières J, Lajoie-Mazenc I, Boubekeur N, Favre G, Pradines A. RhoB loss induces Rac1-dependent mesenchymal cell invasion in lung cells through PP2A inhibition. Oncogene. 2016, 35(14): 1760-9. Sun M, Nie FQ, Zang C, Wang Y, Hou J, Wei C, Li W, He X, Lu KH. The Pseudogene DUXAP8 Promotes Non-small-cell Lung Cancer Cell Proliferation and Invasion by Epigenetically Silencing EGR1 and RHOB. Mol Ther. 2017, 25(3): 739–751. Ju JA, Godet I, DiGiacomo JW, GilkesDM. RhoB is regulated by hypoxia and modulates metastasis inbreast cancer.Cancer Reports. 2020;3:e1164. Hashemi M, Zandieh MA, Talebi Y, Rahmanian P, Shafiee SS, Nejad MM, Babaei R, Sadi FH, Rajabi R, Abkenar ZO, Rezaei S, Ren J, Nabavi N, Khorrami R, Rashidi M, Hushmandi K, Entezari M, Taheriazam A. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies. Biomed Pharmacother. 2023, 160: 114392. Calvayrac O, Mazières J, Figarol S, Marty-Detraves C, Raymond-Letron I, Bousquet E, Farella M, Clermont-Taranchon E, Milia J, Rouquette I, Guibert N, Lusque A, Cadranel J, Mathiot N, Savina A, Pradines A, Favre G. The RAS-related GTPase RHOB confers resistance to EGFR-tyrosine kinase inhibitors in non-small-cell lung cancer via an AKT-dependent mechanism. EMBO Mol Med. 2017, 9(2): 238–250. Kopsida M, Liu N, Kotti A, Wang J, Jensen L, Jothimani G, Hildesjo C, Haapaniemi S, Zhong W, Pathak S, Sun XF. RhoB expression associated with chemotherapy response and prognosis in colorectal cancer. Cancer Cell Int. 2024, 24(1):75. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif Figure S1. EMT-related protein expression in DU145 cells with RhoB KO or RhoB OE. β-catenin, Vimentin, ZO-1, N-cadherin, and E-cadherin protein expressions were evaluated using Western blotting (A) and signal densities of EMT-related proteins were normalized to that of GAPDH (B). Data were expressed as the mean ±SD (n=3), *P < 0.05, one way ANOVA. SupplementaryInformation.xlsx The raw gel blot image data of PCR and Western blots in the manuscript in an Excel file named Supplementary Information. Cite Share Download PDF Status: Published Journal Publication published 26 Feb, 2025 Read the published version in BMC Cancer → Version 1 posted Editorial decision: Revision requested 07 Oct, 2024 Editor assigned by journal 04 Oct, 2024 Submission checks completed at journal 04 Oct, 2024 First submitted to journal 03 Oct, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5198679","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":363024743,"identity":"816282d2-ccc2-4c7a-b4a7-95a0d5e163fe","order_by":0,"name":"Tiantian Sheng","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tiantian","middleName":"","lastName":"Sheng","suffix":""},{"id":363024744,"identity":"18c8ca64-ce56-41c8-9fcd-470241fce46b","order_by":1,"name":"Hang Su","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Su","suffix":""},{"id":363024745,"identity":"e302cd27-061b-4bff-afb4-ea52ab7a3aea","order_by":2,"name":"Lu Yao","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Yao","suffix":""},{"id":363024746,"identity":"ff1333dc-56ff-48f7-b5a4-7b5daa62dbee","order_by":3,"name":"Zhen Qu","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Qu","suffix":""},{"id":363024747,"identity":"7199f331-d08d-4a2b-940f-ddf8e88d5d54","order_by":4,"name":"Hui Liu","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Liu","suffix":""},{"id":363024752,"identity":"ed31f47e-91e4-4216-ac37-2d82b0aaa348","order_by":5,"name":"Wenjuan Shao","email":"","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenjuan","middleName":"","lastName":"Shao","suffix":""},{"id":363024754,"identity":"58d2c980-cc97-430b-b33a-c7d2210d5016","order_by":6,"name":"Xiangyu Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDElEQVRIiWNgGAWjYDACCSSS4UOFjRwbe/MB4rUwzjiTZszHcyyBGC0QwMzZcihxnkSOAl4d8rObnz382mYhb86/xkyaseFAehtDDgPDj4ptOLUwzjlmbixzRsJw54w3ZtKFO+7ktjGcPcDYc+Y2Ti3MEglm0hIVEowbbpwxk5555lluG2NfAjNjG24tbBLp36QlDCTswVp42w6nszHzGODVwiORYyb5oUIiccP5HrCWBDY2AlokJHLKpBnOSCRvuMFWbAkMZMM2HraEg/j8Ij8jfZvkz7Y62w3nD2+8AYxKefn5jw8++FGBWws4CHjA9mUYwEUO4FUPBIw/QCT/8QeEFI6CUTAKRsEIBQBbeVlNsq9D/AAAAABJRU5ErkJggg==","orcid":"","institution":"Shandong First Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xiangyu","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-10-03 13:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5198679/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5198679/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12885-025-13762-4","type":"published","date":"2025-02-26T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":68547552,"identity":"6d232fb1-4cd6-4df7-874b-c1c01e2150c2","added_by":"auto","created_at":"2024-11-08 11:55:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6935026,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eRhoB\u003c/em\u003e knockout with CRISPR/Cas9 and evaluation of the knockout efficiency in PC-3. (A) T7E1 assay was performed to determine the knockout efficiency of CRISPR/Cas9 in PC-3 cells. (B) The RhoB protein expression after gene editing with CRISPR/Cas9 in PC-3 cells, while OE indicated the cells overexpressed in RhoB. (C) Sanger sequencing of the target region of the genome after editing with sgRNA1 CRSISPR-Cas9 in PC-3 cells. (D) Sanger sequencing of the target region of the genome after editing with sgRNA2 CRSISPR-Cas9 in PC-3 cells. (E) Sanger sequencing of the target region of the genome after editing with NTC sgRNA CRSISPR-Cas9 in PC-3 cells. (F) PC-3 cells after \u003cem\u003eRhoB\u003c/em\u003eknockout with CRISPR/Cas9, and the stably transient cells after being treated with puromycin.\u003c/p\u003e","description":"","filename":"Figure1.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/81a9f93b659443f8b0344729.png"},{"id":68546217,"identity":"838a97f4-2f2d-4a95-a3be-50d08131f814","added_by":"auto","created_at":"2024-11-08 11:39:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":528374,"visible":true,"origin":"","legend":"\u003cp\u003eEMT-related protein expression in PC-3 cells with \u003cem\u003eRhoB\u003c/em\u003e KO or RhoB OE. β-catenin, Vimentin, ZO-1, N-cadherin, and E-cadherin protein expressions were evaluated using Western blotting (A) and signal densities of EMT-related proteins were normalized to that of GAPDH (B). Data were expressed as the mean ±SD (n=3), *P \u0026lt; 0.05, when compared with indicated group, one way ANOVA.\u003c/p\u003e","description":"","filename":"Figure2.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/d58656b25ba40497b65e15fc.png"},{"id":68546657,"identity":"65d23de9-9013-4b49-83ef-ece02e732dc9","added_by":"auto","created_at":"2024-11-08 11:47:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3440502,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e anti-tumor ability of DTXL in \u003cem\u003eRhoB\u003c/em\u003eknockout or overexpression in prostate cancer cells. (A) Cell viability and IC50 value of PC-3 cells towards DTXL treatment. (B) Calcein AM and PI double staining of PC-3 cells for live and dead cell visualization after \u003cem\u003eRhoB\u003c/em\u003eknockout or overexpression in cancer cells treated with DTXL, green indicated live cells and red indicated dead cells. (C) PC-3 cell apoptosis was evaluated by flow cytometry after \u003cem\u003eRhoB\u003c/em\u003e knockout or overexpressed cancer cells were treated with DTXL. Data were expressed as the mean ±SD, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, when compared with indicated group, one way ANOVA.\u003c/p\u003e","description":"","filename":"Figure3.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/289ab454a01654785d06c8de.png"},{"id":68547937,"identity":"1b51eab4-690b-47c4-8638-4f21fe9e25b5","added_by":"auto","created_at":"2024-11-08 12:03:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":12732640,"visible":true,"origin":"","legend":"\u003cp\u003ePC-3 cell and DU145 cell migration (A) and invasion (B) were analyzed by transwell methods after \u003cem\u003eRhoB\u003c/em\u003e knockout or overexpression in cancer cells. Data were expressed as the mean ±SD (n = 3). *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, when compared with indicated group, one way ANOVA.\u003c/p\u003e","description":"","filename":"Figure4.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/7e813d0c128ac363a3410106.png"},{"id":68546223,"identity":"01809ff7-6b56-4012-be58-fe377e48711d","added_by":"auto","created_at":"2024-11-08 11:39:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1261611,"visible":true,"origin":"","legend":"\u003cp\u003eCell cycle analysis of prostate cancer cells treated with DTXL. \u003cem\u003eRhoB\u003c/em\u003e was knockout or overexpressed in prostate cancer cells. (A)The G1 phase, S phase, and G2/M phase did not show significant differences. (B) Data were expressed as the mean ±SD (n = 3). N.S no significant. *P\u0026lt;0.05, when compared with indicated group, one way ANOVA.\u003c/p\u003e","description":"","filename":"Figure5.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/43bb059e5d84622c7969ec90.png"},{"id":68546652,"identity":"ae0e8823-53d4-4b3d-8de6-ccfe114473f0","added_by":"auto","created_at":"2024-11-08 11:47:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1885111,"visible":true,"origin":"","legend":"\u003cp\u003eRNA-seq analysis of RhoB knockout cells (KO), RhoB overexpressed cells (OE), and control cells (CON). (A) The number of differentially expressed genes among KO, OE, and CON groups. (B) Venn diagram depicting the number of the differentially expressed genes in the KO/CON, OE/KO, and OE/CON groups. (C) GO cellular component enrichment analyses of differentially expressed genes (DEGs) among KO/CON, OE/CON, and OE/KO. (D) KEGG pathway enrichment analysis of DEGs among KO/CON, OE/CON, and OE/KO.\u003c/p\u003e","description":"","filename":"Figure6.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/e3f818dbdf58677c4d89ca75.png"},{"id":68546220,"identity":"f50921f1-587b-4a33-902a-9bc5c7e83346","added_by":"auto","created_at":"2024-11-08 11:39:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1425354,"visible":true,"origin":"","legend":"\u003cp\u003eHeatmap of RNA-seq analysis of RhoB KO cells, RhoB OE cells, and the control cells. (A) The differentially expressed gene is enriched from the focal adhesion pathway between the OE and CON groups. (B) The differentially expressed gene enriched from the PI3K-AKT pathway between the OE and CON groups. (C) The differentially expressed gene is enriched from the ECM receptor interaction pathway between the KO and CON groups. (D) The differentially expressed gene enriched from the cancer pathway between the KO and CON groups.\u003c/p\u003e","description":"","filename":"Figure7.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/532dccc87ff47411e7f1cafa.png"},{"id":68546654,"identity":"917273ca-f5c0-4c20-8349-e765b654ff9a","added_by":"auto","created_at":"2024-11-08 11:47:56","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":5829197,"visible":true,"origin":"","legend":"\u003cp\u003eRhoB activate PI3K-AKT signaling pathway upon DTXL treatment in prostate cancer cells. (A) In the presence of DTXL, RhoB OE can activate AKT (p-308) while in the absence of DTXL, RhoB OE can inhibit AKT (p-308). (B) Immunofluorescence co-staining of p-FAK and F-actin in prostate cancer cells with RhoB different expression status after DTXL treatment. F-actin and p-FAK immunostaining. Representative microphotographs are shown, objective 20x, F-actin (red), p-FAK (green), nucleus staining (blue).\u003c/p\u003e","description":"","filename":"Figure8.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/6755eedd64604d173b8aa21d.png"},{"id":68546228,"identity":"0e071d57-ca8e-4971-935e-3bf242cd26da","added_by":"auto","created_at":"2024-11-08 11:39:57","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":89303047,"visible":true,"origin":"","legend":"\u003cp\u003eProstate cancer xenograft to study RhoB effects on cancer progression. (A, B) Growth curve showed that RhoB OE could inhibit cancer growth. (C, D) TCGA data showed RhoB expression level in normal prostate tissue and prostate adenocarcinoma (PRAD) tissue, and survival curve showed RhoB expression affect survival time of prostate cancer patients. (E) H\u0026amp;E staining of tumor tissue dissected from the prostate cancer xenograft. (F) Tunnel staining of tumor tissue with RhoB overexpression or knockout. (G, H, I) IHC staining of Ki67, cleaved caspase 3 and RhoB proteins in tumor tissue with RhoB overexpression or knockout. (J) Quantification of IHC staining for Ki67, cleaved caspase 3 and RhoB proteins in prostate cancer xenograft. *P\u0026lt;0.05, when compared with indicated group, one way ANOVA.\u003c/p\u003e","description":"","filename":"Figure9.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/f79be01ad4db11fbde2bd0c3.png"},{"id":77622877,"identity":"a6a4d49b-f16d-49f7-b526-58000c95f6da","added_by":"auto","created_at":"2025-03-03 16:10:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":112514144,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/77652876-a93d-4316-8096-38efaecc1c33.pdf"},{"id":68546226,"identity":"a082f7b6-0f78-4e06-925a-cb309f9f7c60","added_by":"auto","created_at":"2024-11-08 11:39:56","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16467484,"visible":true,"origin":"","legend":"\u003cp\u003eFigure S1. EMT-related protein expression in DU145 cells with RhoB KO or RhoB OE. β-catenin, Vimentin, ZO-1, N-cadherin, and E-cadherin protein expressions were evaluated using Western blotting (A) and signal densities of EMT-related proteins were normalized to that of GAPDH (B). Data were expressed as the mean ±SD (n=3), *P \u0026lt; 0.05, one way ANOVA.\u003c/p\u003e","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/bbe0f9dcdf358a6e2de70052.tif"},{"id":68547553,"identity":"5b74aeba-cb05-4836-b0f9-722aa4556c24","added_by":"auto","created_at":"2024-11-08 11:55:56","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":5015480,"visible":true,"origin":"","legend":"\u003cp\u003eThe raw gel blot image data of PCR and Western blots in the manuscript in an Excel file named Supplementary Information.\u003c/p\u003e","description":"","filename":"SupplementaryInformation.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-5198679/v1/02ed8a64c6a3a0a4e23dd332.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"RhoB regulates prostate cancer cell proliferation and docetaxel sensitivity via PI3K-AKT signaling pathway","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eRho GTPase can regulate cancer metastasis, they regulate actin cytoskeleton rearrangements and focal adhesion (FA) dynamics, among Rho subfamily including RhoA, RhoB, RhoC three isoforms, they possess similar sequence but the C-terminus was different, post-translation modifications often occur in C-terminus [1]. The \u003cem\u003eRhoB\u003c/em\u003e gene is a member of the Rho GTPase, GTP-bound RhoB is the active form, and the GDP-bound RhoB is the inactive form; it cycles between the GTP- and GDP-bound states. Unlike RAS, there are no studies on the mutated, constitutively active form of RhoB [2]. RhoB distributes at the cell membrane, endosomes, multivesicular bodies and nucleus. RhoB regulates cytoskeleton reassembly, cell migration, FA dynamics [3]. Various stimuli can induce RhoB transient expression, such as ultraviolet ray, cytokines, growth factors, drugs. And RhoB regulates the intracellular EGFR, Ras, and PI3K/Akt signaling pathways to modulate intracellular structure and function [4, 5]. EGFR, Ras, and PI3K-AKT have been shown to downregulate RhoB, which in turn regulates EGFR and AKT in a feedback manner [6, 7].\u003c/p\u003e \u003cp\u003eRhoB is usually downregulated in cancer and is regarded as a tumor suppressor [8]. RhoB is unmutated in various types of cancer, but its altered expression and activity are critical for cancer progression. RhoA and RhoC expressions are correlated positively with metastasis in various cancer types, while RhoB is correlated negatively with metastasis in some cancer types [9]. Meanwhile, Rho GTPases play important roles in regulating the epithelial\u0026ndash;mesenchymal transition (EMT) of cancer cells [10]. EMT plays important roles in regulating cancer cell metastasis, which requires several cellular processes including epithelial cell-cell conjunctions disruption, cell polarity loss and cytoskeletal architecture changes. EMT is induced by several transcription factors, such as Snail, Zeb-1, and Slug. Cancer cells that undergo EMT detach themselves from the primary tumor, migrate through the basement membrane, and invade the vasculature [11]. RhoB knockdown can induce the elongated morphology of lung cancer cell and downregulate the E-cadherin but increase Slug expression. RhoB directly interact with PP2A to regulate the AKT1 dephosphorylation [12]. RhoA and RhoC regulate the EMT process in colon cancer, and Rac1 activation can induce EMT [13]. A study has reported that RhoB negatively regulates cell migration and invasion via its influence on Akt activity to regulate EMT [14]. It was reported that RhoB high expression was related to worse overall survival of colorectal cancer patients.\u003c/p\u003e \u003cp\u003ePreviously, it has been reported that RhoB could regulate the cell cycle, and cell-cycle changes in prostate cancer cells with RhoB knockout or overexpression have been studied, RhoB can interact with cyclin B1 and CDK1 to induce G2/M phase arrest [15]. Among the different phase of cell cycle, S phase possesses the most RhoB while RhoB declines in the S/G2-M transition phase of the cell cycle [16]. While, some studies showed that RhoB deletion cannot affect the cell cycle [17]. Moreover, RhoB is involved in autophagy regulation. RhoB phosphorylation can enhance its interaction with TSC2, and when the RhoB/TSC2 complex translocates to the lysosome, it can effectively inhibit the mTORC1 functions, and autophagy is activated [18]. RhoB can interact with Beclin 1 and HSP90 to enhance the clearance of uropathogenic \u003cem\u003eEscherichia coli\u003c/em\u003e mainly by preventing Beclin 1 degradation [19]. RhoB turnover occurs quickly in cells, and its biosynthesis is rapidly regulated by various growth and stress stimuli. RhoB is degraded via lysosomal pathway and not the ubiquitin\u0026ndash;proteasome system [20]. RhoB seems to act contextually. A study has showed that RhoB is needed for the transformed cell to undergo apoptosis after encountering DNA damage or Taxol [4].\u003c/p\u003e \u003cp\u003eIn this study, we used CRISPR/Cas9 technology to knock out the RhoB gene in PC-3 and DU145 cells. Then, effect of RhoB on cancer cell EMT, cancer cell DTXL sensitivity, cell migration and invasion, and cell cycle of prostate cancer cells was examined. RNA sequencing (RNA-Seq) was performed to determine the differentially expressed genes (DEGs) profiles when RhoB was knocked out or overexpressed in PC-3 prostate cancer cells. RhoB can activate PI3K-AKT signaling when PC-3 cells were treated with DTXL at a concentration of 50 nM for 72 hours. Finally, prostate cancer xenograft was established to evaluate the effect of RhoB gene on cancer growth.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Materials\u003c/h2\u003e \u003cp\u003ePC-3 cells and DU145 cells were purchased from the Chinese Academy of Typical Culture Collection Cell Bank (Shanghai, China). PC-3 and DU145 cells were cultured in DMEM/F12 and DMEM medium, respectively, and was supplemented with 10% fetal bovine serum (FBS), penicillin, and streptomycin. LentiCRISPR v2 was used for gene knockout, pCDH-CMV-MCS-EF1-copGFP-T2A-Puro was used for gene overexpression, and PCDH-CMV-mRFP-GFP-hLC3B-EF1A-Puro was used to analyze autophagy; all three vectors were obtained from Addgene company. The CRISPR/Cas9-mediated RhoB gene knockout was performed via sgRNA targeting at the exon of RhoB at approximately\u0026thinsp;+\u0026thinsp;100 bp downstream of the ATG initiation codon. Oligonucleotide sequences were cloned into lentiCRISPR v2. The insert sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and were synthesized by GENERAL BIOL company (Chuzhou, Anhui, China). NC sgRNA was used as negative control. T7 endonuclease 1 (T7E1) was purchased from Vazyme (Nanjing, China), and the pUCm-T vector from Beyotime (Shanghai, China). The IPTG/X-Gal plate was used to screen the reconstructed amplicon, which was a white bacterial colony. The corresponding white colony was sequenced to assess the gene editing efficiency. Puromycin was purchased from MedChemExpress.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInsert oligonucleotide sequences used for CRISPR/Cas9 knockdown\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCACCG\u003c/b\u003eCACCACGGTCCATACATACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAAAC\u003c/b\u003eTGTATGTATGGACCGTGGTG\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRhoB-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCACCG\u003c/b\u003eCACATAGTTCTCGAAGACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAAAC\u003c/b\u003eCCGTCTTCGAGAACTATGTG\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRhoB-2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCACCG\u003c/b\u003eCACCGTCTTCGAGAACTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eAAAC\u003c/b\u003eCATAGTTCTCGAAGACGGTG\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Establishment of stable RhoB knockout or overexpressed cell lines\u003c/h2\u003e \u003cp\u003eThree plasmid systems were used to pack the lentivirus system, and the virus was subsequently purified. The HEK293T cells were transfected with psPAX2, pMD2.G, and lentiCRISPR v2 or pCDH-CMV-MCS-EF1-copGFP-T2A-Puro plasmid to package the lentivirus. The PC-3 and DU145 cells were transfected with the lentivirus, and the successfully transfected cells were selected using puromycin (5 \u0026micro;g/mL). sgRNA1 generates the knockout cells and this cell line was used in subsequent studies.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.3 T7E\u003c/b\u003eI \u003cb\u003eassay\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eRhoB knock-out cancer cells were seeded into six-well plates at a concentration of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well, and their genomic DNA was isolated using the Universal Genomic DNA Kit (CWBIO, CW2298) according to the manufacturer\u0026rsquo;s instructions. The targeted genomic locus was amplified using PCR with the following primers: F: ATGGCGGCCATCCGCAAG, R: TCATAGCACCTTGCAGCA, amplicon sizes of the primers was 591 bp (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The amplicon was purified, and 200 ng of purified amplicons were denatured, reannealed, and digested with T7EI (Vazyme). To determine the DNA sequence of the targeted gene, the PCR product was TA-cloned into the pUCm-T vector. Original gel files are in the Supplementary Fig.\u0026nbsp;1A, 1B.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer for RhoB full length amplication\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRhoB full length\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eATGGCGGCCATCCGCAAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eTCATAGCACCTTGCAGCA\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Western blotting\u003c/h2\u003e \u003cp\u003eThe RhoB gene knockout or overexpressed PC-3 or DU145 cells were seeded in six-well culture plates, or cells were treated with DTXL (50 nM) for 72 h. Total protein was extracted from the cells using Westen blot lysis (Beyotime, China) and protein concentration was determined using BCA kit (Beyotime, China). Cell lysates were separated on 10\u0026ndash;15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. The membrane was blocked with 5% milk and subsequently incubated with primary antibodies against β-catenin, vimentin, zonula occludens-1 (ZO-1), N-cadherin, E-cadherin, phospho-Akt (Thr308) (13038S, CST), phospho-AKT (Ser473) (80455-1-RR, Proteintech), SRC (11097-1-AP, Proteintech), phospho-Src Family (Tyr416) (6943, CST), phospho-Src (Tyr527) (2105, CST), FAK (12636-1-AP, Proteintech), phospho-FAK (Tyr397) (8556, CST), mTOR( 66888-1-Ig, Proteintech), phospho-mTOR (Ser2448) (67778-1-Ig, Proteintech), NF-κB p65 (10745-1-AP, Proteintech), phospho-p44/42 MAPK (Erk1/2) (4370, CST), p44/42 MAPK (Erk1/2) (4695, CST), PI3 kinase p110 alpha (67071-1-Ig, Proteintech), PI3 kinase p110 beta (20584-1-AP, Proteintech), PI3 kinase p85 alpha (ab191606, Abcam), PI3 kinase p85 beta (ab180967, Abcam), and GAPDH overnight at 4\u0026deg;C. Then, the membrane was incubated with the secondary antibody for 1 h. Images were captured using a Tanon 2500R imaging system. Original gel files are in the Supplementary Fig.\u0026nbsp;1C, 2, 9.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 RhoB knockout sensitizes the cancer cells to DTXL\u003c/h2\u003e \u003cp\u003eThe PC-3 cells were plated in 96-well plates, different concentrations of DTXL were added, the cells were incubated for 24 h, and the cell viability was determined using the MTT assay. The IC\u003csub\u003e50\u003c/sub\u003e of DTXL was calculated from the cell inhibition rates. A calcein/PI cell viability/cytotoxicity assay kit was used to observe the live and dead cells. The apoptosis of prostate cancer cells with RhoB different expression that treated with DTXL or not was evaluated using Annexin V apoptosis assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 The effect of RhoB on cell migration and invasion\u003c/h2\u003e \u003cp\u003eThe effect of RhoB on the migration and invasion of PC-3 or DU145 cells was investigated. Uncoated transwell chambers (8-\u0026micro;m pores, Corning, NY, USA) were used for the migration assay, and Matrigel (356234; Corning Inc.)-coated chambers were used for the invasion assay. For this procedure, 100 \u0026micro;L of diluted Matrigel (mixed with DMEM at 1:8) was added to the upper chamber and incubated for 1 h at 37\u0026deg;C. On the other hand, 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells were seeded into the upper chamber, the lower chamber had 500 \u0026micro;L medium containing 10% FBS. Cells on the upper surface of the transwell chamber were removed with cotton swabs, and those on the lower surface were fixed and stained with crystal violet.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Cell cycle analysis\u003c/h2\u003e \u003cp\u003eThe RhoB gene was successfully knocked out or overexpressed in PC-3 or DU145 cells. Then, the prostate cancer cells were seeded in six-well plates at a concentration of 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well. The cells were washed with cold PBS and fixed with 70% ethanol at 4\u0026deg;C overnight, treated with RNase A for 30 min, and stained with propidium iodide (PI) for 30 min at 37\u0026deg;C according to the manufacturer\u0026rsquo;s protocol. The cell cycle was measured using flow cytometry (BD FACS Caton, USA), and the data were analyzed using the FlowJo software (version 10.9).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 RNA-Seq of RhoB knockout and overexpression PC-3 cells\u003c/h2\u003e \u003cp\u003eThe RNA-Seq was performed to evaluate the differentially expressed genes (DEGs) in RhoB knockout (KO group), RhoB overexpressed (OE group), and RhoB normally expressed (CON group) PC-3 cells. The total RNA was extracted from the cells. The expression of each gene was calculated using the mean value of log\u003csub\u003e2\u003c/sub\u003e(TPM\u0026thinsp;+\u0026thinsp;1). The BGISEQ was used for sequencing, and the sequence length was PE150. The raw reads were filtered to obtain the clean reads, and the HISAT software was used to BLAST the clean reads to the reference genome GCF_000001405.39_GRCh38.p13. \u0026ldquo;Q value\u0026thinsp;\u0026le;\u0026thinsp;0.05, │log2FC│\u0026ge;1\u0026rdquo; was used as the threshold to judge the significance of gene expression differences among KO, OE, and CON. The comparison groups were KO vs. CON, OE vs. CON, and OE vs. KO. The Gene Ontology (GO)/ Kyoto Encyclopedia of Genes and Genomes (KEGG) cluster analysis of the DEGs was performed using the Dr. Tom online system provided by BGI. The heatmaps were drawn using the online system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eWildtype PC-3 cells or RhoB KO or RhoB OE PC-3 cells were treated with DTXL (50 nM) for 72 h, and then cells were incubated with phospho-FAK (Tyr397) (8556, CST) primary antibody overnight, then incubated with goat anti-rabbit IgG H\u0026amp;L (Alexa Fluor\u0026reg; 488) at dilution of 1:200 for 2 h at RT, then the cells were incubated with actin-tracker red-rhodamine (Beyotime, Shanghai) at dilution of 1:100 for 30 min at RT, the nuclei was stained using DAPI. Then the distribution of p-FAK and F-actin fiber was observed using fluorescence microscope (BX53, Olympus).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Tumor xenograft\u003c/h2\u003e \u003cp\u003e200 \u0026micro;L of wildtype PC-3 cells or RhoB KO or RhoB OE PC-3 cells were subcutaneously injected into NOD-SCID mice (male, 4 weeks old), the cell concentration was 5\u0026times;10\u003csup\u003e6\u003c/sup\u003e/mL. Five days later, the long diameter and short diameter of tumor was measured. Then, the long diameter and short diameter of tumor was measured each day until on 14 day after tumor cell injection. Tumor volume was calculated using the following formula: tumor volume (mm\u003csup\u003e3\u003c/sup\u003e)\u0026thinsp;=\u0026thinsp;0.5 \u0026times; L \u0026times; W\u003csup\u003e2\u003c/sup\u003e, where L is the longest dimension and W is the perpendicular dimension. Mice were euthanized through cervical dislocation and tumor were dissected, and HE staining were conducted to observe the histology changes. Tunnel staining was used to evaluate the cancer cell apoptosis of tumor cells, immunohistochemistry staining was used to evaluate RhoB (14326-1-AP, Proteintech), Cleaved caspase3(GB11532-100), Ki67(GB121141-100) protein expression on the tumor cells. All animal experimental procedures adhered to institutional ethical requirements and were approved by the Ethics Committee of Jining No.1 People\u0026rsquo;s Hospital (License No. JNRM-2022-DW-062).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Immunohistochemistry and Tunnel staining\u003c/h2\u003e \u003cp\u003eXenograft tumor tissue from mice were embedded in paraffin, paraffin-embedded tumor was sectioned, sections were dewaxed to water. Slides were treated with 3% hydrogen peroxide to 25 min to block endogenous peroxidase. Then 3% BSA was used to block the untargeted protein for 1 hour at room temperature. Then slides were incubated with the corresponding primary antibody at 4\u0026deg;C for overnight incubation. The primary antibodies were RhoB, cleaved caspase3, Ki-67. Washout the primary antibody, and incubated with the secondary antibody and stained with DAB detection kit according to manufacturer\u0026rsquo;s protocols. Protein expression was scored and quantified. The quantification method was based on a multiplicative index of the average staining intensity (0\u0026ndash;3) and extent of staining (0\u0026ndash;4) in the tissue, yielding a staining index ranging from 0 to 12. All the analyses were conducted or confirmed by two certified clinical pathologists.\u003c/p\u003e \u003cp\u003eAs for tunnel staining, the slides were treated with protease K working solution and TDT enzyme, dUTP and buffer in the Tunnel kit according to manufactures\u0026rsquo; instructions. DAPI solution was dripped into the slide and incubated at room temperature for 10 min in the dark and observed using fluorescent microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 9.5 software was used to perform statistical analysis. One-way analysis of variance was used for the comparison of differences among multiple groups, followed by the Student\u0026ndash;Newman\u0026ndash;Keuls method. A value of \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significantly different.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 CRISPR/Cas9-mediated knockout of RhoB in prostate cancer cells\u003c/h2\u003e \u003cp\u003eWhen the PC-3 cells were treated with sgRNA1 lentiCRISPR v2 or sgRNA2 lentiCRISPR v2 lentivirus, the target genome sequence was effectively cleaved by sgRNA1, sgRNA2, but not NTC sgRNA; the T7E1 assay reflected this phenomenon (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Then, the western blot assay was performed to determine the RhoB protein expression level, and sgRNA1 and sgRNA2 were found to mediate the complete knockout of the RhoB protein in PC-3 cells. On the contrary, NTC treatment did not alter the RhoB protein expression, and overexpression lentivirus increased the expression remarkably (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To confirm the RhoB gene mutation, the PC-3 cells treated with sgRNA1, sgRNA2, or NTC were used for PCR amplification of the target sequence, subcloned into a T vector, and sequenced. Sequence mutations, including deletions, insertions, and point mutations, were determined using Sanger sequencing (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D, E). It was observed that sgRNA1 and sgRNA2 effectively induced DSBs, and the nonhomologous recombination repair (NHEJ) occurred late. The single clone of the RhoB knockout PC-3 cell line was obtained using limited dilution assays, and it was augmented and observed under the microscope (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 EMT of prostate cancer cells after RhoB knockout\u003c/h2\u003e \u003cp\u003eWhen RhoB gene was knocked out in the PC-3 and DU145 cells, epithelial markers E-cadherin and ZO-1 decreased and the mesenchymal marker vimentin increased. This result indicated that RhoB knockout effectively induced EMT. On the contrary, when the RhoB gene was overexpressed in PC-3 and DU145 cells, the epithelial marker E-cadherin increased and the mesenchymal marker vimentin decreased. This observation signified that the reverse process named mesenchymal\u0026ndash;epithelial transition occurred. N-cadherin expression did not change remarkably when RhoB was knocked out or overexpressed. Furthermore, when RhoB was knocked out, the β-catenin expression level increased. This finding suggests that when RhoB was knocked out, the β-catenin signaling pathway was probably activated (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Influence of RhoB on cytotoxicity of DTXL towards PC-3 cell\u003c/h2\u003e \u003cp\u003eFor PC-3 cells, the IC\u003csub\u003e50\u003c/sub\u003e values of DTXL in wildtype, RhoB KO, and RhoB OE cells were 190.8, 74.06, and 374 nM, respectively. These results indicated that RhoB overexpression decreased DTXL sensitivity towards PC-3 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePC-3 cells that treated with PBS but not DTXL constituted the control group, and there were almost no dead cells. Some dead cells were present in the control\u0026thinsp;+\u0026thinsp;DTXL group, which signified that DTXL exerted a cell-killing effect toward PC-3 cells. However, when the RhoB gene was knocked out, the dead cells after DTXL treatment increased dramatically compared with the wild-type prostate cancer cells treated with the drug. On the contrary, when the RhoB gene was knockout, DTXL of the same concentration enhanced the cytotoxicity toward the cancer cells compared with the control\u0026thinsp;+\u0026thinsp;DTXL group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Subsequently, the apoptosis of PC-3 cells after treatment with different formulations was measured using the flow cytometry method. The total apoptosis rates (early apoptosis rate plus the late apoptosis rate) of the control, control\u0026thinsp;+\u0026thinsp;DTXL, RhoB OE\u0026thinsp;+\u0026thinsp;DTXL, and RhoB KO\u0026thinsp;+\u0026thinsp;DTXL groups were 0%, 34.29%, 9.90%, and 61.16%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Migration and invasion assays\u003c/h2\u003e \u003cp\u003eThe results demonstrated that the overexpression of RhoB significantly inhibited cancer cell migration when compared with the control group, and the number of migrated PC-3 or DU145 cells was less compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Knockout of RhoB enhanced prostate cancer cell migration, and the number of cells that migrated to the lower surface of the transwell membrane increased significantly when compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Overexpression of RhoB significantly decreased the number of invading PC-3 or DU145 cells across the transwell membrane compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Cell-cycle analysis\u003c/h2\u003e \u003cp\u003eKnockout or overexpression of RhoB in PC-3 cells or DU145 cells did not alter the cell distribution in the G1, S, or G2/M phase relative to the respective control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The experiment was performed in triplicate, and the proportions of cells in the G1, S, and G2/M phases were analyzed statistically. There were no significant differences among the control group, RhoB knockout group, and RhoB overexpression group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 RNA-Seq results of RhoB gene manipulation in PC-3 prostate cancer cells\u003c/h2\u003e \u003cp\u003eIn KO vs. CON, 201 genes were upregulated and 62 were downregulated. In OE vs. CON, 243 genes were upregulated and 249 were downregulated. Finally, in OE vs. KO, 151 genes were upregulated and 346 were downregulated (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGO enrichment analysis was performed to identify the significant enrichment terms in the DEGs. The results revealed that focal adhesion, adherens junction, cell\u0026ndash;cell junction, and collagen-containing extracellular matrix were enriched in the DEGs of KO vs. CON; focal adhesion, adherens junction, lamellipodium, extracellular exosome, and cell junction were enriched in the DEGs of OE vs. CON; and focal adhesion, adherens junction, cell junction, extracellular exosome, and endoplasmic reticulum were enriched in the DEGs of OE vs. KO. These results indicated focal adhesion of PC-3 cells was changed after RhoB gene knockout or overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eIn KEGG enrichment analysis, the signaling pathway of PI3K-AKT, ECM\u0026ndash;receptor interaction, focal adhesion, proteoglycans in cancer, cell adhesion molecules, and oxidative phosphorylation was enriched in the DEGs of KO vs. CON; proteoglycans in cancer, focal adhesion, pathways in cancer, oxidative phosphorylation, and adherens junction were enriched in the DEGs of OE vs. CON; and PI3K-AKT signaling pathway, adherens junction, focal adhesion, proteoglycans in cancer, and pathways in cancer were enriched in the DEGs of OE vs. KO. These results indicated that PI3K-AKT signaling pathway was changed after RhoB gene knockout or overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eThe focal adhesion signaling pathway was enriched in the DEGs of OE vs. CON, and the genes ITGA2, EGFR, VEGFC, PPP1CB, LAMC2, TNC, VEGFA, LAMA3, THBS1, and LAMB3 were differentially expressed in OE and CON (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The PI3K-AKT signaling pathway was enriched in the DEGs of OE vs. CON, and the genes THBS1, AREG, ITGA2, EGFR, VEGFC, JAK1, ITGA5, LAMB2, COL6A3, TGFA, ERBB3, IL4R, CDKN1A, and IL6 were differentially expressed (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). ECM\u0026ndash;receptor interaction signaling pathway was enriched in the DEGs of KO vs. CON, and the genes included NPNT, COL6A3, ITGAV, COL4A1, ITGA5, COL4A2, COL1A1, and DAG1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Pathways in cancer signaling were enriched in the DEGs of KO vs. CON, and the genes included TGFB2, IL6, MSH2, COL4A2, NOTCH2, MSH6, IL4R, NCOA3, EGLN1, RUNX1, STAT2, NOTCH3, and AKT3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.7 RhoB activate PI3K-AKT signaling upon low concentration of DTXL\u003c/h2\u003e \u003cp\u003eIn order to study the underlying mechanism of RhoB on DTXL sensitivity, we selected the DTXL concentration of 50 nM, which is below the IC50 values of DTXL towards PC-3 cells with RhoB KO or RhoB OE. PC-3 cells were treated with DTXL (50 nM) for 72 days. It was found that overexpressed RhoB can enhance the phosphorylation of AKT at T308, p-T308-AKT was increased in PC-3 cells treated with DTXL (50nM, 72 h), while p-S473-AKT did not increase. p-Y527-Src did not change in DTXL treated cells, and RhoB cannot regulate it. p-Y416-Src decreased in the RhoB overexpressed cancer cells, this indicated that RhoB can downregulate it no matter whether the cancer cells were treated with DTXL. p-FAK level increased after PC-3 cells treated with DTXL. p110α, p110β, p85α and p85β did not change remarkably no matter RhoB gene expression and DTXL treatment. And it was shown that RhoB activated PI3K-AKT signaling pathway upon DTXL treatment, but RhoB did not affect Src activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eImmunofluorescent results indicated that p-FAK in the cytoplasm increased when the three types of cells treated with DTXL (50 nM) for 72 days. And F-actin of cancer cells decreased upon DTXL treatment in wild type and RhoB KO group, but did not decrease in RhoB OE group. This indicated that DTXL did not affect F-actin dramatically in RhoB OE group, when compared with wild type and RhoB KO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.8 RhoB knockout decreases tumor growth in prostate cancer xenografts\u003c/h2\u003e \u003cp\u003eProstate cancer xenografts were established to study RhoB in vivo effects. The tumor growth curve showed that RhoB OE can decrease the in vivo tumor growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eA, B), cancer cell morphology did not show changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eE). Tunnel staining of cancer tissues indicated that much more apoptosis occurred in RhoB OE cells than control cells or knockout cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eF), and IHC results also showed that cleaved caspase 3 expressed much more in RhoB OE cells while Ki67 index was much lower in this group (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eG-J). These results indicated that RhoB overexpression can decrease the proliferation of cancer cells and induce apoptosis. TCGA database showed that RhoB expression decreased in prostate adenocarcinoma (PRAD) tissues compared with normal prostate tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eC). And prostate cancer patients with RhoB overexpression correlates with a much better prognosis compared with RhoB low/medium expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e9\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eEMT is one important reason of prostate cancer metastasis, and this was regulated by various molecular mechanism [21]. The incidence of prostate cancer is increasing every year in China, especially in developed regions, which could be due to the PSA screening and improved biopsy techniques [22]. Furthermore, RhoB is involved in Taxol-induced apoptosis of transformed cells. RhoB probably activates apoptosis when prostate cancer cells are treated with Taxol [23]. Some studies have shown that EMT is closely related to cancer cell migration and invasion, and plays important role in cancer metastasis [24, 25]. In this study, the CRISPR/Cas9 gene editing method was used to knock out the RhoB gene in PC-3 and DU145 cells. RhoB was successfully knocked out, which was verified at the gene level and protein level. The sgRNA was designed to target the exon of the RhoB gene at approximately\u0026thinsp;+\u0026thinsp;100 bp downstream of the ATG initiation codon, which effectively induced INDEL in the RhoB gene, as confirmed via Sanger sequencing. We did not observe the off-target effects, off-target effects are cell type-specific and depend on the DSB repair pathway of the specific cell type [26].\u003c/p\u003e \u003cp\u003eIn this study, RhoB knockout was demonstrated to decrease E-cadherin expression and increase vimentin expression. In addition, RhoB knockout increased the expression of β-catenin and decreased the ZO-1 protein expression. Therefore, RhoB knockout was speculated to induce EMT in prostate cancer cells, which agreed with the findings from a previous study [27]. However, the N-cadherin expression did not change remarkably in our study. On the contrary, RhoB overexpression inhibited EMT-related proteins in prostate cancer cells. The migration and invasion properties of prostate cancer cells were enhanced when the RhoB gene was knocked out. In a previous study on lung cancer cells, when RhoB was knocked out, the migration and invasion of lung cancer cells increased. RhoB change the morphology of bronchial, RhoB knockout induced the elongation of bronchial cells, and RhoB overexpression induced the round-shaped cells [27\u0026ndash;29]. Therefore, RhoB knockout can induce the mesenchymal phenotype of cancer cells and enhance motility. The RNA-Seq results signified these genes pertaining to focal adhesion, adherens junction, and cell\u0026ndash;cell junction were enriched in the DEGs of KO vs. CON. This observation indicated the involvement of RhoB in the regulation of cell focal adhesion and adherens junction. One study showed that RhoB acted as an oncogenic gene in breast cancer and phosphorylated the AKT protein and upregulated the expression of hypoxia-inducible factor-1α (HIF1α) under hypoxic conditions. The difference between this study and ours lies in the hypoxic conditions [30]. Some studies have shown that the tumor microenvironment plays a pertinent role in determining whether RhoB functions as an oncogene or as a tumor suppressor [4].\u003c/p\u003e \u003cp\u003eDTXL is the most commonly used chemotherapeutic agent in prostate cancer treatment. However, drug resistance occurs upon prolonged therapy [31]. Our in vitro cell viability assay results implied that the knockout of RhoB can enhance the cytotoxicity of DTXL toward PC-3 cells. The IC50 of DTXL decreased in RhoB knockout cancer cells when compared with the wild-type cells. Calcein AM/PI assay exhibited that dead cells were high in the RhoB knockout groups. Hence, RhoB knockout appears to sensitize the prostate cancer cells to DTXL, thereby resulting in apoptosis. In contrast, RhoB overexpression increased DTXL resistance in PC-3 cells. And the underlying mechanism was PI3K-AKT signaling pathway activation, we find that RhoB can activate p-T308-AKT at low dose DTXL (50 nM) and incubate for 72 h, RhoB cannot activate p-S473-AKT in RhoB overexpressed PC-3 cells. RhoB overexpression can downregulate p-Y416-Src but did not change p-Y527-Src. Low dose DTXL can increase the p-FAK level, and RhoB knockout can downregulate the p85α level. The immunofluorescent results also indicated that RhoB overexpression can activate the p-FAK and increase the F-actin when cells treated with DTXL (50 nM, 72h). When cancer cells were not treated with DTXL, RhoB loss seems to increase the F-actin, and this was consistent with Transwell and EMT results. RhoB exert obviously different effects on AKT when cancer cells treated with DTXL or not. This is very interesting, may be DTXL reversed the RhoB effect on AKT. And one previous study showed that RhoB overexpression endow lung cancer cell resistance to erlotinib through activation of AKT, the RhoB/AKT axis was very important in inducing erlotinib resistance of lung cancer cell [32]. Another study showed that RhoB overexpression was related to worse survival of colorectal cancer patients who received chemotherapy [33]. It seems that RhoB overexpression could induce drug resistance of chemotherapeutic agents. And our results also indicated that RhoB overexpression can induce DTXL resistance in PC-3 cells. One study showed that RhoB degradation increased focal adhesion (FA) formation and thereby increase cell invasion, when RhoB interact with ARF6, this was consistent with our results showing RhoB KO enhance F-actin activity.\u003c/p\u003e \u003cp\u003eIn conclusion, RhoB was involved in the regulation of prostate cancer cell EMT, DTXL sensitivity towards PC-3 cells, migration and invasion of prostate cancer cells. When RhoB was knocked out using the CRISPR/Cas9 technique, the cancer cells lost their intercellular junctions and basal\u0026ndash;apical polarity. Moreover, the actin cytoskeleton was rearranged to facilitate cell elongation and motility. These results were verified using RNA-Seq, which also indicated that RhoB was involved in the cell focal adhesion and adherens junction. However, the gene did not affect the cell cycle. Furthermore, when PC-3 cells were treated with low dose DTXL (50 nM, 72h), we find that RhoB overexpression can activate p-T308-AKT and inhibit p-Y416-Src, this is interesting, and the concrete mechanism needs to be elucidated in future study. In prostate cancer xenograft, RhoB OE seems to inhibit caner growth and more cancer cell undergo apoptosis. Our study shed some light on prostate cancer patients chemotherapeutic, combination use of AKT inhibitor and DTXL in RhoB overexpressing prostate cancer will be much more effective than single use of DTXL.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was financially supported through grants from the Natural Science Foundation of Shandong Province (Nos. ZR2023MH260 and ZR2017QH005), the National Natural Science Foundation of China (Grant No. 81803097), Doctoral Fund of Jining No.1 People\u0026rsquo;s Hospital (2022-BS-002) and Key Research and Development Plan of Jining (2022YXNS113).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments including animal experiments were approved by the Ethics Committee of Jining No.1 People\u0026rsquo;s Hospital approved this study (License No. JNRM-2022-DW-062). No human experiments were conducted in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRegistry and the Registration No. of the study/trial.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal Studies.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have consented to publication of this manuscript. All authors have read and approved the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFASTQ files will be uploaded to Genome Sequence Archive (GSA) in BIG Data Center (http://bigd.big.ac.cn/gsa), Being Institute of Genomics (BIG), Chinese Academy of Science, with an accession number HRA005103. And the BioProject number is PRJCA018403.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTiantian Sheng and Hang Su did most of the experiment, and Lu Yao collected the data, Zhen Qu analyzed the data, Xiaoran Chen, Hui Liu and Yuetian Li prepared the Figures, Xiangyu Zhang and Wenjuan Shao wrote the main manuscript text. All authors have read and approved the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e Jansen S, Gosens R, Wieland T, Schmidt M. Paving the Rho in cancer metastasis: Rho GTPases and beyond. Pharmacol Ther. 2018, 183:1\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Hodge RG, Schaefer A, Howard SV, Der CJ. RAS and RHO family GTPase mutations in cancer: twin sons of different mothers? Crit Rev Biochem Mol Biol. 2020, 55(4):386\u0026ndash;407.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zaoui K, Smith HW, Park M, Duhamel S. ARF6 controls RHOB targeting to endosomes regulating cancer cell invasion. Mol Cell Oncol. 2020, 7(5): 1766932.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Prendergast GC. Actin' up: RhoB in cancer and apoptosis. Nat Rev Cancer. 2001, 1(2): 162-8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Gutierrez E, Cahatol I, Bailey CAR, Lafargue A, Zhang N, Song Y, Tian H, Zhang Y, Chan R, Gu K, Zhang ACC, Tang J, Liu C, Connis N, Dennis P, Zhang C. Regulation of RhoB Gene Expression during Tumorigenesis and Aging Process and Its Potential Applications in These Processes. Cancers (Basel). 2019, 11(6): 818.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Jiang K, Delarue FL, Sebti SM. EGFR, ErbB2 and Ras but not Src suppress RhoB expression while ectopic expression of RhoB antagonizes oncogene-mediated transformation. Oncogene. 2004, 23(5): 1136-45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Gu J, Huang W, Wang X, Zhang J, Tao T, Zheng Y, Liu S, Yang J, Chen ZS, Cai CY, Li J, Wang H, Fan Y. Hsa-miR-3178/RhoB/PI3K/Akt, a novel signaling pathway regulates ABC transporters to reverse gemcitabine resistance in pancreatic cancer. Mol Cancer. 2022; 21(1):112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Ju JA, Gilkes DM. RhoB: Team Oncogene or Team Tumor Suppressor? Genes (Basel). 2018, 9(2):67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Ridley AJ. RhoA, RhoB and RhoC have different roles in cancer cell migration. J Microsc. 2013, 251(3): 242-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Crosas-Molist E, Samain R, Kohlhammer L, Orgaz JL, George SL, Maiques O, Barcelo J, Sanz-Moreno V. Rho GTPase signaling in cancer progression and dissemination. Physiol Rev. 2022, 102(1): 455\u0026ndash;510.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Brabletz T, Kalluri R, Nieto MA, Weinberg RA. EMT in cancer. Nat Rev Cancer. 2018,18(2): 128\u0026ndash;134.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Bousquet E, Calvayrac O, Mazi\u0026egrave;res J, Lajoie-Mazenc I, Boubekeur N, Favre G, Pradines A. RhoB loss induces Rac1-dependent mesenchymal cell invasion in lung cells through PP2A inhibition. Oncogene. 2016, 35(14): 1760-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zacharopoulou N, Tsapara A, Kallergi G, Schmid E, Alkahtani S, Alarifi S, Tsichlis PN, Kampranis SC, Stournaras C. The Epigenetic Factor KOM2B Regulates EMT and Small GTPases in Colon Tumor Cells. Cell Physiol Biochem. 2018;47(1):368\u0026ndash;377.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Calvayrac O, Pradines A, Favre G. RHOB expression controls the activity of serine/threonine protein phosphatase PP2A to modulate mesenchymal phenotype and invasion in non-small cell lung cancers. Small GTPases. 2018, 9(4): 339\u0026ndash;344.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Chen W, Niu S, Ma X, Zhang P, Gao Y, Fan Y, Pang H, Gong H, Shen D, Gu L, Zhang Y, Zhang X. RhoB Acts as a Tumor Suppressor That Inhibits Malignancy of Clear Cell Renal Cell Carcinoma. PLoS One. 2016, 11(7): e0157599.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zalcman G, Closson V, Linar\u0026egrave;s-Cruz G, Lerebours F, Honor\u0026eacute; N, Tavitian A, Olofsson B. Regulation of Ras-related RhoB protein expression during the cell cycle. Oncogene. 1995, 10(10): 1935-45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu AX, Cerniglia GJ, Bernhard EJ, Prendergast GC. RhoB is required to mediate apoptosis in neoplastically transformed cells after DNA damage. Proc Natl Acad Sci U S A. 2001, 98(11): 6192-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu M, Zeng T, Zhang X, Liu C, Wu Z, Yao L, Xie C, Xia H, Lin Q, Xie L, Zhou D, Deng X, Chan HL, Zhao TJ, Wang HR. ATR/Chk1 signaling induces autophagy through sumoylated RhoB-mediated lysosomal translocation of TSC2 after DNA damage. Nat Commun. 2018, 9(1): 4139.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Miao C, Yu M, Pei G, Ma Z, Zhang L, Yang J, Lv J, Zhang ZS, Keller ET, Yao Z, Wang Q. An infection-induced RhoB-Beclin 1-Hsp90 complex enhances clearance of uropathogenic Escherichia coli. Nat Commun. 2021, 12(1): 2587.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e P\u0026eacute;rez-Sala D, Boya P, Ramos I, Herrera M, Stamatakis K. The C-terminal sequence of RhoB directs protein degradation through an endo-lysosomal pathway. PLoS One. 2009, 4(12): e8117.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Siegel RL, Miller KO, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023, 73(1): 17\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Ju W, Zheng R, Zhang S, Zeng H, Sun K, Wang S, Chen R, Li L, Wei W, He J. Cancer statistics in Chinese older people, 2022: current burden, time trends, and comparisons with the US, Japan, and the Republic of Korea. Sci China Life Sci. 2023, 66(5): 1079\u0026ndash;1091.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Liu Ax, Cerniglia GJ, Bernhard EJ, Prendergast GC. RhoB is required to mediate apoptosis in neoplastically transformed cells after DNA damage. Proc Natl Acad Sci U S A. 2001, 98(11): 6192-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zhang B, Li Y, Wu Q, Xie L, Barwick B, Fu C, Li X, Wu D, Xia S, Chen J, Qian WP, Yang L, Osunkoya AO, Boise L, Vertino PM, Zhao Y, Li M, Chen HR, Kowalski J, Kucuk O, Zhou W, Dong JT. Acetylation of KLF5 maintains EMT and tumorigenicity to cause chemoresistant bone metastasis in prostate cancer. Nat Commun. 2021, 12(1): 1714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Zheng Y, Li P, Huang H, Ye X, Chen W, Xu G, Zhang F. Androgen receptor regulates eIF5A2 expression and promotes prostate cancer metastasis via EMT. Cell Death Discov. 2021, 7(1): 373.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Duan J, Lu G, Xie Z, Lou M, Luo J, Guo L, Zhang Y. Genome-wide identification of CRISPR/Cas9 off-targets in human genome. Cell Res. 2014, 24(8): 1009-12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Bousquet E, Mazi\u0026egrave;res J, Privat M, Rizzati V, Casanova A, Ledoux A, Mery E, Couderc B, Favre G, Pradines A. Loss of RhoB expression promotes migration and invasion of human bronchial cells via activation of AKT1. Cancer Res. 2009, 69(15): 6092-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Bousquet E, Calvayrac O, Mazi\u0026egrave;res J, Lajoie-Mazenc I, Boubekeur N, Favre G, Pradines A. RhoB loss induces Rac1-dependent mesenchymal cell invasion in lung cells through PP2A inhibition. Oncogene. 2016, 35(14): 1760-9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Sun M, Nie FQ, Zang C, Wang Y, Hou J, Wei C, Li W, He X, Lu KH. The Pseudogene DUXAP8 Promotes Non-small-cell Lung Cancer Cell Proliferation and Invasion by Epigenetically Silencing EGR1 and RHOB. Mol Ther. 2017, 25(3): 739\u0026ndash;751.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Ju JA, Godet I, DiGiacomo JW, GilkesDM. RhoB is regulated by hypoxia and modulates metastasis inbreast cancer.Cancer Reports. 2020;3:e1164.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Hashemi M, Zandieh MA, Talebi Y, Rahmanian P, Shafiee SS, Nejad MM, Babaei R, Sadi FH, Rajabi R, Abkenar ZO, Rezaei S, Ren J, Nabavi N, Khorrami R, Rashidi M, Hushmandi K, Entezari M, Taheriazam A. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies. Biomed Pharmacother. 2023, 160: 114392.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Calvayrac O, Mazi\u0026egrave;res J, Figarol S, Marty-Detraves C, Raymond-Letron I, Bousquet E, Farella M, Clermont-Taranchon E, Milia J, Rouquette I, Guibert N, Lusque A, Cadranel J, Mathiot N, Savina A, Pradines A, Favre G. The RAS-related GTPase RHOB confers resistance to EGFR-tyrosine kinase inhibitors in non-small-cell lung cancer via an AKT-dependent mechanism. EMBO Mol Med. 2017, 9(2): 238\u0026ndash;250.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e Kopsida M, Liu N, Kotti A, Wang J, Jensen L, Jothimani G, Hildesjo C, Haapaniemi S, Zhong W, Pathak S, Sun XF. RhoB expression associated with chemotherapy response and prognosis in colorectal cancer. Cancer Cell Int. 2024, 24(1):75.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Prostate cancer, RhoB, CRISPR/Cas9, RNA-Seq, Docetaxel","lastPublishedDoi":"10.21203/rs.3.rs-5198679/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5198679/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDocetaxel is the first line treatment method for castration-resistant prostate cancer (CRPC). RhoB plays important role in prostate cancer metastasis and PI3K-AKT signaling pathway. RhoB involves in regulation of cytoskeleton reassembly, cell migration, focal adhesion (FA) dynamics. CRISPR/Cas9 gene editing technique was utilized to knock out the \u003cem\u003eRhoB\u003c/em\u003e gene in prostate cancer cells, and was confirmed by using T7 endonuclease I (T7EI) and Sanger sequencing. Epithelial\u0026ndash;mesenchymal transition (EMT) process was enhanced by \u003cem\u003eRhoB\u003c/em\u003e knockout (KO), IC50 value of docetaxel towards PC-3 cells with RhoB KO decreased. Migration and invasion of prostate cancer cells were enhanced when the \u003cem\u003eRhoB\u003c/em\u003e gene was knocked out, and these were inhibited when the gene was overexpressed. But, cell cycle of prostate cancer cells was not affected by the RhoB gene status. RNA seq was conducted on PC-3 cells which were overexpressed or knock out RhoB gene. The RNA seq results indicated that \u003cem\u003eRhoB\u003c/em\u003e may regulate focal adhesion, ECM receptor interaction, and PI3K-AKT signaling pathway and further influence the EMT process, migration, and invasion of prostate cancer cells. We also found that RhoB overexpression activate PI3K-AKT signaling when PC-3 cells were treated with low concentration of DTXL (50 nM, 72 h), suggesting RhoB overexpression decreased DTXL cytotoxicity towards prostate cancer cells via PI3K-AKT signaling activation.\u003c/p\u003e","manuscriptTitle":"RhoB regulates prostate cancer cell proliferation and docetaxel sensitivity via PI3K-AKT signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-11-08 11:39:51","doi":"10.21203/rs.3.rs-5198679/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-10-07T08:54:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-04T05:20:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-04T05:19:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Cancer","date":"2024-10-03T13:32:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"db4b1a9d-e539-4d6a-ae0b-71f81476af40","owner":[],"postedDate":"November 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-03T16:05:27+00:00","versionOfRecord":{"articleIdentity":"rs-5198679","link":"https://doi.org/10.1186/s12885-025-13762-4","journal":{"identity":"bmc-cancer","isVorOnly":false,"title":"BMC Cancer"},"publishedOn":"2025-02-26 15:57:52","publishedOnDateReadable":"February 26th, 2025"},"versionCreatedAt":"2024-11-08 11:39:51","video":"","vorDoi":"10.1186/s12885-025-13762-4","vorDoiUrl":"https://doi.org/10.1186/s12885-025-13762-4","workflowStages":[]},"version":"v1","identity":"rs-5198679","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5198679","identity":"rs-5198679","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}