A Non-Antioxidant Role of Vitamin E in Antagonizing cellular Inhibitor of Apoptosis Proteins Degradation and Cell Death

A Non-Antioxidant Role of Vitamin E in Antagonizing cellular Inhibitor of Apoptosis Proteins Degradation and Cell Death | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 3 March 2026 V1 Latest version Share on A Non-Antioxidant Role of Vitamin E in Antagonizing cellular Inhibitor of Apoptosis Proteins Degradation and Cell Death Authors : Jing Zhu , Xiaofang Tian , Yujie Zhao , Fan Yang , Rui Wang , Fang Wang , Zhuhong Wang , … Show All … , Tianle Zhang , Wenqing Ren , Chenxiao Tang , Jingming Ren , Jin Cai , Yuan He , Chenjie Zhu , Xiaona Feng , Yue Liu , Siriporn Jitkaew , Chunlin Zhuang , Yaxing Zhao , and Zhenyu Cai 0000-0002-6252-5879 [email protected] Show Fewer Authors Info & Affiliations https://doi.org/10.22541/au.177253975.58580887/v1 157 views 89 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Background and Purpose: Vitamin E is well characterized as a lipophilic antioxidant; however, its non-antioxidant functions remain largely undefined. This study was designed to investigate the non-antioxidant mechanisms by which vitamin E regulates programmed cell death and to identify its specific molecular target. Experimental Approach: A high-throughput screen identified vitamin E as an inhibitor of TNF-α/SMAC mimetic-induced cell death. The mechanism of vitamin E was investigated using western blotting, immunoprecipitation, ubiquitination assays, drug affinity responsive target stability (DARTS), cellular thermal shift assay (CETSA), isothermal titration calorimetry (ITC), and molecular docking. Its in vivo efficacy was evaluated in a murine model of DSS-induced ulcerative colitis (UC). Key Results: Vitamin E selectively inhibits TNF-α/SMAC mimetic-induced cell death by directly and competitively binding to the BIR3 domain of cIAP1. This interaction prevents cIAP1 degradation and the subsequent formation of the RIPK1-dependent death complex, an effect that is independent of its canonical antioxidant function. In a murine model of colitis, vitamin E treatment significantly alleviated disease severity by preserving cIAP1. Conclusion and Implications: Our findings unveil a non-canonical function of vitamin E as a direct cIAPs antagonist and regulator of cell death signaling, presenting a mechanistic basis for its potential therapeutic application in inflammatory pathologies driven by aberrant IAP degradation. A Non-Antioxidant Role of Vitamin E in Antagonizing cellular Inhibitor of Apoptosis Proteins Degradation and Cell Death Jing Zhu 1,2,# , Xiaofang Tian 3,# , Yujie Zhao 4,# , Fan Yang 3 , Rui Wang 7 , Fang Wang 5 , Zhuhong Wang 1,2 , Tianle Zhang 1,2 , Wenqing Ren 1 , Chenxiao Tang 1,2 , Jingming Ren 1,2 , Jin Cai 1,2 , Yuan He 1 , Chenjie Zhu 2 , Xiaona Feng 3 , Yue Liu 3 , Siriporn Jitkaew 6 , Chunlin Zhuang 7, *, Yaxing Zhao 1, *, Zhenyu Cai 1,2,3, 5 , * 1. Tongji University Cancer Center, Shanghai Tenth People’s Hospital, School of Medicine, Tongji University, Shanghai, 200072, China. 2. Department of Biochemistry and Molecular Biology, School of Medicine, Tongji University, 200331, China. 3. College of Pharmacy, Ningxia Medical University, Yinchuan, Ningxia Hui Autonomous Region, Yinchuan, 750004, China. 4. Department of General Medicine，Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai, 200072, China 5. State Key Laboratory of Cardiology and Medical Innovation Center, Shanghai East Hospital, School of Medicine, Tongji University, Shanghai 200120, China. 6. Center of Excellence for Cancer and Inflammation, Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok 10330, Thailand. 7. School of Pharmacy, Second Military Medical University, Shanghai, 200433, China Key words: Vitamin E, cIAPs, Necroptosis, SMAC mimetic, Ulcerative colitis Running Title: Vitamin E stabilizes cIAPs to inhibit cell death. Abbreviations: cIAPs, cellular Inhibitor of Apoptosis Proteins; TNF-α, Tumor Necrosis Factor-α; SMAC, Second mitochondria-derived activator of caspases; RIPK1, receptor-interacting protein kinase 1; RIPK3, receptor-interacting protein kinase 3; MLKL, mixed lineage kinase domain-like protein; DSS, Dextran Sulfate Sodium; α-TOC, α-tocopherol; MEFs, Mouse Embryonic Fibroblasts; EC 50 , Half maximal effective concentration; CHX, Cycloheximide; STS, Staurosporine; TRAIL, TNF-related apoptosis-inducing ligand; DARTS, Drug Affinity Responsive Target Stability; CETSA, Cellular Thermal Shift Assay; ITC, Isothermal Titration Calorimetry; α-TOA, α-tocopherol acetate; UC, Ulcerative colitis; DAI, Disease Activity Index; #, These authors contributed equally to this work. *, To whom correspondence should be addressed. Correspondence author e-mail: [email protected] , [email protected] or [email protected] Bullet point summary What is already known 1. Vitamin E is a well-established lipid-soluble antioxidant that protects cellular membranes from oxidative damage. 2. SMAC mimetics induce cell death by binding to the BIR3 domain of cIAPs, promoting their autoubiquitination and proteasomal degradation. What does this study add 1. Vitamin E directly binds to the BIR3 domain of cIAP1, competitively inhibiting SMAC mimetic binding and preventing cIAP1 degradation independently of its antioxidant function. 2. Vitamin E, but not its antioxidant analogue Trolox, ameliorates DSS-induced ulcerative colitis in mice by preserving cIAPs protein levels. What is the clinical significance 1. Stabilization of cIAPs by vitamin E represents a novel therapeutic strategy for inflammatory diseases such as ulcerative colitis, where cIAPs degradation drives pathogenesis. 2. These findings reveal a potential nutrient-drug interaction, suggesting that vitamin E supplementation may antagonize the therapeutic efficacy of SMAC mimetics in cancer treatment. Background and Purpose: Vitamin E is well characterized as a lipophilic antioxidant; however, its non-antioxidant functions remain largely undefined. This study was designed to investigate the non-antioxidant mechanisms by which vitamin E regulates programmed cell death and to identify its specific molecular target. Experimental Approach: A high-throughput screen identified vitamin E as an inhibitor of TNF-α/SMAC mimetic-induced cell death. The mechanism of vitamin E was investigated using western blotting , immunoprecipitation, ubiquitination assays, drug affinity responsive target stability (DARTS), cellular thermal shift assay (CETSA), isothermal titration calorimetry (ITC), and molecular docking. Its in vivo efficacy was evaluated in a murine model of DSS-induced ulcerative colitis (UC). Key Results: Vitamin E selectively inhibits TNF-α/SMAC mimetic-induced cell death by directly and competitively binding to the BIR3 domain of cIAP1. This interaction prevents cIAP1 degradation and the subsequent formation of the RIPK1-dependent death complex, an effect that is independent of its canonical antioxidant function. In a murine model of colitis, vitamin E treatment significantly alleviated disease severity by preserving cIAP1. Conclusion and Implications: Our findings unveil a non-canonical function of vitamin E as a direct cIAPs antagonist and regulator of cell death signaling, presenting a mechanistic basis for its potential therapeutic application in inflammatory pathologies driven by aberrant IAP degradation. 1 | INTRODUCTION Vitamin E is a lipid-soluble vitamin that serves as a primary antioxidant defense in cellular membranes(Herrera & Barbas, 2001). As an essential micronutrient obtained primarily from dietary sources such as nuts, seeds, vegetable oils, and leafy greens, vitamin E plays a crucial role in promoting daily nutritional balance and supporting overall human health (Zaaboul & Liu, 2022). Its canonical function involves the donation of a hydrogen atom from its phenolic group to lipid peroxyl radicals, thereby interrupting chain-propagation reactions of lipid peroxidation(Brigelius-Flohé & Traber, 1999). This activity is essential for the protection of polyunsaturated fatty acids and the preservation of membrane integrity, particularly in tissues subjected to high oxidative stress(Mishima & Conrad, 2022). Although its antioxidant properties are well-documented, the non-antioxidant functions of vitamin E, including its specific molecular targets and underlying mechanisms, remain inadequately characterized. Emerging evidence suggests that vitamin E may modulate cell signaling pathways and gene expression programs independently of its radical-scavenging activity(Azzi & Stocker, 2000; Ungurianu, Zanfirescu, Nițulescu, & Margină, 2021a), however, the identities of its binding partners and detailed mechanistic insights are still largely elusive. The Inhibitor of Apoptosis (IAP) family proteins, including cIAP1, cIAP2 and XIAP, are key regulators of cell death and survival signaling(Salvesen & Duckett, 2002). Through BIR domain-mediated interactions and E3 ubiquitin ligase activity, they suppress apoptosis and modulate NF-κB signaling(Varfolomeev et al., 2007). The endogenous IAP antagonist, SMAC/DIABLO, promotes apoptosis by promoting degradation of IAPs upon mitochondrial release(Chai et al., 2000; Li et al., 2004). Pharmacological SMAC mimetics are small molecules designed to mimic the SMAC peptide, binding with high affinity to IAP proteins and inducing their autoubiquitination and proteasomal degradation(Bai, Smith, & Wang, 2014). This degradation attenuates NF-κB signaling and can promote apoptosis or, in apoptosis-resistant contexts, necroptosis. IAP proteins are frequently overexpressed in malignancies, contributing to therapy resistance and poor clinical outcomes(Kumar, Fairmichael, Longley, & Turkington, 2020). Consequently, SMAC mimetics are currently under clinical investigation for cancer treatment(Fulda & Vucic, 2012). Moreover, dysregulated IAP activity has been linked to inflammatory and autoimmune disorders, underscoring their broad pathophysiological relevance(Gyrd-Hansen & Meier, 2010; Silke & Meier, 2013). In this study, we uncover a novel, non-antioxidant role for vitamin E as a direct and selective antagonist of cIAP1. We demonstrate that vitamin E binds cIAP1, competitively inhibiting SMAC mimetic-induced ubiquitination and proteasomal degradation, thereby preserving cIAPs protein levels and protecting against TNF-α-induced cell death. Importantly, vitamin E ameliorates DSS-induced UC in vivo by preventing cIAPs loss. These findings establish vitamin E as a previously unrecognized stabilizer of cIAPs and a modulator of programmed cell death, highlighting its therapeutic potential in inflammatory diseases driven by dysregulated cell death pathways. 2 | METHODS 2.1 | Materials α-Tocopherol (Cat# T1648), β-Tocopherol (Cat# TN1441), γ-Tocopherol (Cat# T8293), δ-Tocopherol (Cat# T6000), D-α-Tocopherol acetate (Cat# T1016), Trolox (Cat# T1710), Z-VAD-fmk (Cat# T6013), SM-164 (Cat# T12932L), Cycloheximide (Cat# T1225), MG-132 (Cat# T2154), Cisplatin (Cat# T1564), Staurosporine (Cat# T6680) and Pronase (Cat# T13827) were purchased from TargetMol (USA). Recombinant Human TNF-α (Cat# DC008), Recombinant Mouse TNF-α (Cat# CF09), Human TRAIL(Cat# C022) were purchased from Novoprotein (Suzhou, China). CellTiter-Lumi™ Luminescent Cell Viability Assay Kit (Cat# C0065L) and Lipo293™ Transfection Reagent (C0521) was purchased from Beyotime (Shanghai, China). Dextran Sulfate Sodium Salt (Cat# 9011-18-1) was purchased from MP Biomedicals (USA). 2.2 | Antibodies The following antibodies were from commercial sources: anti-RIPK1 (BD, Cat# 610458, RRID:AB_397831); anti-phospho-hRIPK1 (CST, Cat# 65746, RRID:AB_2799693); anti-hRIPK3 (CST, Cat# 13526, RRID:AB_2687467); anti-phospho-hRIPK3 (Abcam, Cat# ab209384, RRID:AB_2714035); anti-hMLKL (Abcam, Cat# ab184718, RRID:AB_2755030); anti-phospho-hMLKL (Abcam, Cat# ab196436, RRID:AB_2687465); anti-phospho-mRIPK1 (CST, Cat# 53286, RRID:AB_2925183); anti-mRIPK3 (CST, Cat# 95702, RRID:AB_2721823); anti-phospho-mRIPK3 (CST, Cat# 91702, RRID:AB_2937060); anti-mMLKL (CST, Cat# 37705, RRID:AB_2799118); anti-phospho-mMLKL (CST, Cat# 37333, RRID:AB_2799112); anti-Cleaved Caspase-3 (CST, Cat# 9661, RRID:AB_2341188). anti-Caspase-3 (CST, Cat# 9662, RRID:AB_331439); anti-Caspase-8 (CST, Cat# 4790, RRID:AB_10545768); anti-hcIAP1 (CST, Cat# 7065, RRID:AB_10890862); anti-hcIAP1 (ABclonal, Cat# A19688,); anti-hcIAP2 (CST, Cat# 3130, RRID:AB_10693298); anti-pan-cIAP (R&D, Cat# MAB3400, RRID:AB_2063803); anti-Ub (CST, Cat# 3936, RRID:AB_331292); anti-c-Myc (Santa cruz, Cat# sc-40, RRID:AB_627268); anti-Flag (Bioss, Cat# bsm-33346M, RRID:AB_3083063) and GAPDH (HUABIO, Cat# ET1601-4, RRID:AB_3069615). 2.3 | Cell culture and transfection HT-29 (NCI‐DTP Cat# HT‐29, RRID: CVCL_0320), MDA-MB-231 (NCI-DTP Cat# MDA-MB-231, RRID: CVCL_0062) and HEK293T (ICLC Cat# HTL04001, RRID: CVCL_0063) cell lines were obtained from the American Type Culture Collection (ATCC, Manassasa, VA). Mouse embryonic fibroblasts (MEFs) were isolated from E13.5 C57/BL6 mouse embryos and immortalized with SV40 large T antigen (SV40LT), as previously described(Y. He et al., 2024). All cell lines were cultured in DMEM, containing 10% FBS and P/S (100 IU/mL penicillin and 100 μg/mL streptomycin sulfate). Cell cultures were incubated at 37 °C in a 5% CO 2 atmosphere. The plasmids were transfected with Lipo293™ Transfection Reagent according to the manufacturer’s protocol. After 24 h, the cell lysates were analyzed by immunoblotting. 2.4 | High-Throughput Screen (HTS) A set of 350 compounds was selected for HTS based on chemical diversity, known annotations, compound availability, and general representation in historical HTS screens. A total of 1 ×10 4 HT-29 cells were seeded in 96-well culture plate and incubated at 37 °C for 24 h. On the next day, cells were pre-treated with test compounds (20 μM), SM-164 (10 nM) and Z-VAD-fmk (20 μM) for 30 min and then treated with hTNF-α (20 ng/mL) for 12 h to induced Necroptosis. Cell viability was examined by using the CellTiter-Lumi™ Assay kit (Beyotime, China). Luminescence was recorded with a Tecan Spark microplate reader (Tecan Instruments, Switzerland). Compounds exhibiting an EC 50 value below 20 μM in the primary screen were advanced to secondary and tertiary validation assays. Among these, α-tocopherol (α-TOC) was identified as the most potent compound. 2.5 | Cell treatment and cell viability assays To induce necroptosis, cells were pretreated with or without α-TOC for 30 min and then treated with Z-VAD-fmk (20 μM) and SM-164 (10 nM) or CHX (5 μg/mL) for 30 min, followed by stimulation with TNF-α (20 ng/mL) (TSZ/TCZ) for indicated time. To induce apoptosis, cells were pretreated with or without α-TOC for 30 min and then treated with SM-164 (10 nM) or CHX (5 μg/mL) for 30 min, followed by stimulation with TNF-α (20 ng/mL) (TS/TC) for indicated time. For other apoptosis induction, cells were pretreated with or without α-TOC for 30 min, followed by stimulation with Cisplatin (50 μM) or STS (1 μM), respectively. If there are any differences, a detailed description will be given in the figure legend. Cell viability was examined by using the CellTiter-Lumi™ Assay kit (Beyotime, China). Luminescence was recorded with a Tecan Spark microplate reader (Tecan Instruments, Switzerland). 2.6 | Immunoblotting and immunoprecipitation assays Cell lysates were extracted using RIPA buffer supplemented with protease and phosphatase inhibitors, along with PMSF (MCE, Shanghai, China). The lysates were separated by SDS‐PAGE and subsequently transferred to membranes for immunoblotting analysis. Protein bands were visualized using an enhanced chemiluminescence detection system (Tanon, China) according to the manufacturer’s instructions. For immunoprecipitation assays, cells were pretreated with α-TOC for 30 min and subsequently exposed to TSZ for the indicated time. Following treatment, cells were harvested and lysed in cell lysis buffer (Beyotime, Cat#P0013) for 30 min at 4 °C. After centrifugation, the supernatants were incubated with the specified antibody (1 μg) and protein A/G magnetic beads (15 μL, MCE, Cat#HY-K0202) overnight at 4 °C with rotation. The beads were then washed extensively with PBS, and bound proteins were eluted by boiling in 1× SDS sample buffer (50 μL). The immunoprecipitated proteins were analyzed by immunoblotting with the indicated antibodies. 2.7 | Plasmids and lentiviral particles To generate cIAP1 knockout cell lines using the CRISPR-Cas9 approach, gRNA oligonucleotides were cloned into the pLenti-CRISPRv2 vector. The targeting sequences of the designed gRNAs are as follows: sgcIAP1 #1 sense: 5′- CACCGCAAGCTACTATGTTCCAAGG -3′ sgcIAP1 #1 antisense: 5′- AAACCCTTGGAACATAGTAGCTTGC -3′ sgcIAP1 #2 sense: 5′- CACCGATGCTATGTCAGAACACCGG -3′ sgcIAP1 #2 antisense: 5′- AAACCCGGTGTTCTGACATAGCATC -3′ Lentivirus was produced by co-transfecting HEK293T cells with the packaging plasmids psPAX2 and pMD2.G, along with either an empty vector or a sgRNA-containing plasmid. The viral supernatant was harvested 48 h post-transfection and subsequently filtered with a 0.45-μm filter. Lentiviruses expressing sgRNA were used to infect MEF cells with the addition of polybrene, following selection using puromycin. 2.8 | In vitro Ubiquitination assay In vitro ubiquitination assays were performed in a 20 μL reaction system containing ubiquitination buffer (50 mM Tris, pH 7.5, 10 mM MgCl2, 2 mM ATP, 0.6 mM DTT), human recombinant E1 (100 ng, Sino Biological), human recombinant E2 UbcH5c (200 ng, R&D Systems), ubiquitin (5 μg, R&D Systems), and recombinant c-IAP1 (100 ng, R&D Systems), with or without α-TOC or SM-164. After incubation at 37 °C for 2 h, reactions were terminated by adding 5× SDS loading buffer and boiling at 95 °C for 5 min, followed by immunoblotting with indicated antibodies. 2.9 | Purification of recombinant protein cIAP1 BIR3 The human cIAP1 domain BIR3 (aa259–352) was cloned into pGEX 4p-1 vectors. All constructs were expressed in E. coli BL21(DE3) using 0.1 mM IPTG induction at 37 °C for 4 h. Cell lysate was sequentially purified by Ni-NTA affinity chromatography with imidazole elution (2–250 mM) and GST affinity chromatography using Glutathione Beads eluted with 20 mM GSH. The GST tag was removed by 3C protease cleavage, followed by a second Ni-NTA step to separate the His-tagged target protein from the cleaved tag. The purified protein was dialyzed and concentrated into the final buffer (25 mM Tris, 500 mM NaCl, pH 7.4), the protein was obtained with a final purity of ~80% as assessed by SDS-PAGE. 2.10 | Drug affinity responsive target stability (DARTS) HEK293T cells were plated in 6 cm dishes and transfected with Flag-tagged cIAP1 using Lipo293™ transfection reagent. After 24 h, cells were harvested by scraping and lysed in IP buffer. Following protein quantification, the lysates were treated with α-TOC at the indicated concentrations and subsequently digested with 0.1% Pronase for 20 minutes at 37 °C. The reaction was terminated by adding SDS loading buffer, and the samples were analyzed by SDS-PAGE. Protein Thermal Stability was analyzed by immunoblotting. 2.11 | Cellular Thermal Shift Assay (CETSA) The purified recombinant Flag-tagged cIAP1BIR3 protein was incubated with either α-TOC (50 μM) or DMSO for 2 hours. Following incubation, the protein samples were aliquoted and incubated in 0, 43, 46, 49, 52 °C for 3 min. The samples were then immediately cooled on ice and denatured by adding 5× loading buffer followed by boiling at 95 °C for 5 min. The stability of the cIAP1BIR3 protein at each temperature was subsequently assessed by immunoblotting with an anti-Flag antibody. 2.12| Molecular docking The 3D structures of α-TOC (Compound CID: 14985) and SM-164 (Compound CID:17756618) were obtained from Pubchem (https://pubchem.ncbi.nlm.nih.gov/). Human cIAP1 BIR3 domain (PDB ID:3D9U) was used as the template for molecular docking studies, which were conducted using Schrödinger Maestro 11.4 (USA). Protein preparation was performed with the Schrödinger Protein Preparation Wizard under default settings, following a standard workflow: (1) addition of missing hydrogen atoms to the X-ray structure, (2) removal of crystallographic water molecules, (3) assignment of ionization states using PropKa, and (4) energy minimization with the OPLS-AA 2005 force field to optimize hydrogen-bonding networks. All docking procedures were performed as described previously(Yan et al., 2023). Docking was performed using Glide in Standard Precision (SP) mode, without constraints. To validate the protocol, the ligand was re-docked into its original binding site to validate the protocol. Ligand flexibility was permitted during docking, which employed a grid-based approach and an empirical scoring function to predict binding poses. Simulation stability was assessed by monitoring the root-mean-square deviation (RMSD) relative to the energy-minimized starting structure. Final docking results were visualized and rendered using PyMol (http://pymol.sourceforge.net/). 2.13 | Isothermal Titration Calorimetry (ITC) assay ITC binding experiments were performed using a MicroCal PEAQ-ITC system (Malvern Panalytical) at 25 °C. The receptor (0.02 mM) was prepared in a buffer containing 25 mM Tris (pH 7.4) and 500 mM NaCl and loaded into the sample cell (350 μL). The ligand solution (approximately 0.4 mM) was injected into the cell in 19 steps of 2.0 μL per injection, with a spacing of 150 s between injections and the solution stirred at 750 rpm. The data were analyzed using the MicroCal PEAQ analysis software to determine the binding affinity. 2.14 | Animal experiment All animal procedures were conducted in accordance with the National Institutes of Health guidelines and were approved by the Animal Care and Use Committee of Tongji University (Permission #:TJAA01425102). This study also adhered to the ARRIVE guidelines for reporting animal experiments. Mice were bred and maintained under specific pathogen-free (SPF) conditions in individually ventilated cages, with a 12-hour light/dark cycle and a constant ambient temperature of 25 °C. All experimental mice were 8–10 weeks of age. Unless otherwise stated, male C57BL/6 mice were purchased from Gem Pharmatech Co., Ltd. 2.15 | Induction of Ulcerative colitis (UC) Briefly, eight- to ten-week-old male mice were grouped as follows: Vehicle (n=5), DSS (n=5), DSS plus α-TOC (n=5), and DSS plus Trolox (n=5). With the exception of the Vehicle group, all mice received 3% DSS in their drinking water ad libitum for 7 days. From day 3 to day 10, α-TOC and Trolox (both administered at 500 mg/kg) were dissolved in corn oil and delivered once daily via oral gavage. Mice in the Vehicle and DSS groups received an equivalent volume of corn oil via gavage. Body weight, stool consistency, and the presence of gross blood in the feces or around the anus were assessed daily. The disease activity index (DAI) was calculated according to previously established criteria(Zhao et al., 2021). On day 10, all mice were euthanized by CO₂ inhalation, and the entire colons were collected for subsequent analysis. 2.16 | Hematoxylin and eosin (H&E) staining H&E staining was performed according to standard protocols. Briefly, colon tissues were fixed in formalin overnight, embedded in paraffin, and sectioned. The sections were then stained with hematoxylin and eosin to visualize nuclear and cytoplasmic structures, respectively. Images of the colon pathology were acquired using an upright microscope. Histological scoring was conducted based on established criteria as previously described(Zhao et al., 2023). 2.17 | Quantitative RT-PCR Total RNA was extracted with TRIzol reagent (Thermo Fisher Scientific, USA). cDNA was synthesized from total RNA using the Strand cDNA Synthesis Kit (TransGen, China; Cat# AH321-01). The mRNA expression level of cIAP1 was quantified by real-time PCR with PerfectStart® Green qPCR SuperMix (TransGen, China; Cat# AQ602-01) on a QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific, USA). GAPDH was used as the internal reference gene for normalization. The primer sequences used were as follows: cIAP1 sense: 5′ -CAAGCTACTATGTTCCAAGG-3′, cIAP1 antisense: 5′ -CCTTGGAACATAGTAGCTTG-3′; GAPDH sense: 5′ -ATGCTATGTCAGAACACCGG-3′, GAPDH antisense: 5′ -CCGGTGTTCTGACATAGCAT-3′. 2.18 | Clinical database analysis The gene expression data for cIAP1 (official gene symbol: BIRC2) were retrieved from the Gene Expression Omnibus (GEO) repository. Specifically, two datasets containing paired samples from healthy people and ulcerative colitis (UC) patients were utilized for this analysis: GSE111889 (n=50 pairs) and GSE243625 (n=15 pairs). The normalized expression values for the cIAP1 transcript were directly extracted from each dataset’s provided matrix. Comparative analysis of cIAP1 expression between healthy people and UC groups was then performed within and across the respective cohorts. 2.19 | Clinical sample Ulcerative colitis (UC) and normal colonic tissue samples were collected during the initial surgical resection at Shanghai Tenth People’s Hospital. All participants provided written informed consent and voluntarily took part in the study. The collection and use of all samples were approved by Ethics Committee and the institutional review board of Shanghai Tenth People’s Hospital (Ethics #: 23KT89). 2.20 | Immunohistochemical staining Colon tissues were fixed in formalin for at least 24 hours and subsequently embedded in paraffin. Paraffin-embedded sections were subjected to immunohistochemical staining with an anti-cIAP1 antibody at a dilution of 1:50. The expression of cIAP1 was evaluated using a semi-quantitative scoring system that incorporated both the proportion of stained cells and the staining intensity. Two independent pathologists, blinded to the clinical data, performed the assessment. The proportion score (PS) reflected the percentage of positive intestinal epithelial cells: 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%), and 4 (76–100%). The intensity score (IS) was defined as follows: 0 (negative), 1 (weak), 2 (moderate), and 3 (strong)(Xu et al., 2022). A final immunoreactivity score (ranging from 0 to 12) for each sample was derived from the product of the PS and IS. 2.21 | Statistical analysis The student’s t-test and one-way analysis of variance (ANOVA) were used for comparison among all different groups represented with the mean values ± standard errors. Log-rank (Mantel-Cox) test was performed for survival curve analysis using GraphPad Prism 8 (GraphPad Software, USA). All experiments were repeated at least five times with similar results. p < 0.05 was considered statistically significant. 3 | RESULTS 3.1 | Vitamin E selectively antagonizes TNF-α/SMAC mimetic-induced apoptosis and necroptosis To identify natural necroptosis inhibitors, we conducted a high-throughput screen of a 350-compound natural product library in HT-29 cells. Necroptosis was induced using TNF-α, SMAC mimetic SM-164, and caspase inhibitor Z-VAD-fmk (TSZ), and cell viability was assessed with CellTiter-Lumi assay (Figure 1A). Interestingly, among the tested compounds, α-tocopherol (α-TOC), a natural vitamin E isomer, potently inhibited TSZ-induced necroptosis (Figure 1B). Dose-response analysis confirmed concentration-dependent protection by α-TOC (Figure 1C). Additionally, α-TOC attenuated TNF-α plus SMAC mimetic (TS)-induced apoptosis in HT-29 cells (Figure 1D). Similar protective effects were observed in mouse embryonic fibroblasts (MEFs) against TSZ-induced necroptosis and TS-induced apoptosis (Figure 1E and F). Furthermore, we found α-TOC also protected human breast cancer cell line MDA-MB-231 from SAMC mimetic-induced cell death (Figure 1G). Vitamin E comprises eight naturally occurring isomers: four tocopherols (α-, β-, γ-, δ-) and four tocotrienols (α-, β-, γ-, δ-), which differ in side-chain saturation and chromanol methylation. α- and γ-TOC are the most abundant dietary forms (Zaaboul & Liu, 2022). We then evaluated the half-maximal effective concentration (EC 50 ) of four tocopherol isomers in HT-29 and MEF cells. As shown in Figure 1H and I, all these isomers dose-dependently suppressed TSZ-induced necroptosis, indicating that vitamin E broadly protects against TNF-α/SMAC mimetic-induced cell death. Since α-TOC possesses the highest bioavailability and biological activity, making it the primary form for assessing vitamin E requirements(Jiang, 2014), we then used it to represent vitamin E in all following experiments. TNF-α-induced apoptosis can be triggered by combining with SMAC mimetics (e.g., SM-164)(Lu et al., 2008), which inhibit IAP proteins, or by cycloheximide (CHX), which blocks NF-κB activation via protein synthesis inhibition(Wang, Du, & Wang, 2008). Adding caspase inhibitor Z-VAD-fmk switches cell death to necroptosis(S. He et al., 2009). We then investigated whether α-TOC also inhibited TNF plus CHX-induced cell death. Surprisingly, we found pretreatment with α-TOC did not affect TNF-α/CHX (TC)-induced apoptosis or TNF-α/CHX/Z-VAD-fmk (TCZ)-induced necroptosis (Figure 2A-D). Additionally, α-TOC did not protect against cell death induced by other member of TNF superfamily TRAIL, DNA-damage agent cisplatin, or kinase inhibitor staurosporine (Figure 2E-G). Thus, these results indicate that vitamin E selectively antagonizes SMAC mimetic-induced apoptosis and necroptosis. 3.2 | Vitamin E inhibits cell death signaling induced by TNF-α/SMAC mimetic To elucidate the mechanism by which vitamin E inhibits TNF and SMAC mimetic-induced cell death, we analyzed key signaling components in TNF-mediated cell death, including RIPK1, RIPK3 and MLKL(van Loo & Bertrand, 2023). α-TOC suppressed RIPK1 phosphorylation and caspase-3 (casp-3) cleavage upon TS treatment (Figure 3A and B), and inhibited phosphorylation of RIPK1, RIPK3, and MLKL in TSZ-induced necroptosis (Figure 3C and D). Additionally, we found no significant differences in RIPK1/RIPK3/MLKL phosphorylation or casp-3 cleavage between α-TOC-treated and untreated MEF cells under TC or TCZ conditions (Figure 3E and F), suggesting α-TOC has no effects on TNF-α plus CHX-induced cell death. We further assessed whether α-TOC affects the assembly of the RIPK1-RIPK3 necrosome and complex II (containing RIPK1, FADD, and caspase-8)(Y. He et al., 2024). α-TOC blocked TSZ-induced necrosome formation in both HT-29 and MEF cells (Figure 3G and H). Immunoprecipitation of caspase-8 (casp-8) revealed that α-TOC disrupted the recruitment of RIPK1 and FADD to casp-8 in TSZ-stimulated cells (Figure 3I and J). Together, these results demonstrate that vitamin E specifically inhibits TNF/SMAC mimetic-induced cell death by impairing RIPK1-dependent signaling complex formation. 3.3 | Vitamin E stabilizes cellular Inhibitor of Apoptosis Proteins to antagonize SMAC mimetic-induced cell death. It is known that vitamin E is a lipophilic antioxidant that protects cells from free radical damage(Brigelius-Flohé & Traber, 1999). To determine whether its antioxidant activity mediates SMAC mimetic-induced cell death, we employed its water-soluble analog Trolox. Trolox retains the essential phenolic hydroxyl group but lacks the hydrophobic side chain, conferring enhanced solubility while preserving radical-scavenging capacity(Mickle & Weisel, 1993). We observed that Trolox failed to inhibit TNF/SMAC mimetic-induced cell death, indicating the antioxidant function of vitamin E is not involved in this type of cell death (Figure 4A). The SMAC mimetic induces autoubiquitination and proteasomal degradation of cIAPs, resulting in the release of RIPK1 from the TNF receptor complex and subsequent formation of cytosolic complex II. This complex facilitates casp-8 activation, which is essential for TNF-mediated apoptosis(Wang et al., 2008). Given that vitamin E selectively inhibited TNF-α/SMAC mimetic-induced cell death, we investigated whether it influences cIAPs stability. Notably, we found that α-TOC completely prevented cIAPs degradation triggered by TS or TSZ in both HT-29 and MEF cells (Figure 4B-E). Furthermore, α-TOC, but not the water-soluble analogue Trolox, suppressed SMAC mimetic-induced cIAPs degradation in these cell lines (Figure 4F-H). These results indicate that vitamin E blocks SMAC mimetic-induced cIAPs degradation through a mechanism independent of its antioxidant activity. To determine whether cIAPs are required for the protective effect of α-TOC, we generated cIAP1-knockout MEF cells (Figure 4I) and assessed the response to TSZ-induced necroptosis. In the absence of cIAP1, α-TOC failed to confer protection against cell death (Figure 4J). Consistent with these findings, immunoblot analysis showed that α-TOC did not inhibit TSZ-induced phosphorylation of RIPK1, RIPK3, or MLKL in cIAP1-knockout cells (Figure 4K). Taken together, these results demonstrate that vitamin E blocks SMAC mimetic-induced cIAP1 degradation, thereby preventing SMAC mimetic-induced necroptosis. 3.4 | Vitamin E directly binds cIAP1 to antagonize SMAC mimetic-induced autoubiquitination and degradation To investigate the mechanism by which vitamin E prevents SMAC mimetic-induced degradation of cIAPs, we first examined the ubiquitination of cIAP1 in cells treated with a SMAC mimetic. Cell lysates from SM-164-treated or untreated cells were immunoprecipitated with an anti-cIAP1 antibody, and the immunoprecipitates were analyzed by western blotting using an anti-ubiquitin antibody to detect ubiquitinated cIAP1. High-molecular-weight smears, indicative of poly-ubiquitinated cIAP1, were observed in the cells co-treated with SM-164 and the proteasome inhibitor MG132. In contrast, α-TOC markedly suppressed SM-164-induced poly-ubiquitination of cIAP1 (Figure 5A). Similarly, α-TOC inhibited poly-ubiquitination of exogenously expressed cIAP1 in HEK293T cells following SM-164 treatment (Figure 5B). Furthermore, in an in vitro ubiquitination assay, SM-164 enhanced poly-ubiquitination of recombinant cIAP1, while α-TOC treatment dose-dependently reduced this effect (Figure 5C), suggesting vitamin E may directly inhibit SMAC mimetic-induced ubiquitination of cIAP1. We next assessed the potential physical interaction between α-TOC and cIAP1 by using the Drug Affinity Responsive Target Stability (DARTS) assay. The results showed that α-TOC treatment protected cIAP1 from proteolytic digestion in a dose-dependent manner (Figure 5D). To further characterize this interaction, we performed molecular docking between α-TOC and cIAP1. cIAP1 consists of three N-terminal BIR domains, a CARD domain, and a C-terminal RING domain(Kocab & Duckett, 2016). Among these, the glide energy and glide score of the BIR3 domain indicate that it is the potential binding site for α-TOC (Figure 5E), indicating it as the binding site. Consistent with this finding, the BIR3 domain exhibited enhanced resistance to proteolysis in the presence of α-TOC in DARTS assays (Figure 5F). Moreover, cellular thermal shift assay (CETSA) results showed that α-TOC stabilizes the BIR3 domain under thermal stress (Figure 5G). Finally, isothermal titration calorimetry (ITC) confirmed direct binding, yielding a dissociation constant (Kd) of 18.4 μM (Figure 5H). Molecular docking simulations demonstrated that α-TOC binds specifically to the BIR3 domain of cIAP1, engaging multiple residues including Cys303, Asp304, Gly306, Leu307, Arg308, Cys309, Trp310, Glu319, Trp323, and Phe324 (Figure 5I). Notably, the extended hydrophobic side chain of α-TOC is deeply inserted into a hydrophobic pocket formed by the side chains of Cys309, Trp310, Glu319, Trp323, and Phe324, resulting in extensive van der Waals contacts and hydrophobic interactions that serve as the principal stabilizing forces of the complex. Additionally, the phenolic hydroxyl group of the chromanol ring forms a key hydrogen bond with the side chain of Cys303. To further validate the binding mode of α-TOC to cIAP1 at critical residues, we first assessed whether α-TOA, a derivative in which the phenolic hydroxyl group of α-TOC is esterified, could inhibit SMAC mimetic-induced cIAP1 degradation. As shown in Figure 5J, α-TOA failed to prevent cIAP1 degradation triggered by SMAC mimetics, indicating that the phenolic hydroxyl group is essential for the functional interaction with cIAP1. We next generated two point mutations within the binding pocket of cIAP1, substituting Cys309 and Glu319 with alanine and glutamine (C309A and E319Q), respectively. In cells expressing the C309A mutant, α-TOC exhibited a markedly attenuated protective effect against SMAC mimetic-induced cIAP1 degradation, underscoring the critical role of Cys309 in mediating the interaction (Figure 5K). Taken together, these results demonstrate that vitamin E inhibits SMAC mimetic-induced autoubiquitination and degradation of cIAP1 through direct binding to its BIR3 domain. 3.5 | Vitamin E competitively inhibits SMAC mimetic-induced cIAP degradation and cell death It is well established that SMAC-mimetic compounds target the BIR3 domain of cIAPs(Fulda & Vucic, 2012). Comparative molecular docking analysis revealed that α-TOC occupies a binding mode similar to that of the SMAC-mimetic compound SM-164 (Figure 6A). These structural insights suggest that α-TOC may act as a competitive inhibitor by preventing SM-164 binding, thereby blocking cIAP1 degradation. To experimentally validate whether α-TOC competitively inhibits SM-164-induced cIAP1 degradation and subsequent cell death, we treated HT-29 cells with escalating doses of SM-164 in the presence of a fixed concentration of α-TOC (25 μM). The results showed that SM-164 induced cIAP1 degradation and cell death in a dose-dependent manner (Figure 6B and C), supporting the notion that α-TOC competes with the SMAC-mimetic compound for binding to cIAPs, thus suppressing downstream signaling events. Furthermore, α-TOC dose-dependently inhibited SAMC protein-induced cIAP1 degradation in HEK293 cells (Figure 6D and E). Collectively, these data demonstrate that vitamin E impedes SMAC protein and SMAC mimetic compound-induced cIAP1 degradation through competitive interaction with a shared region in cIAP1. 3.6 | Stabilization of cIAPs by vitamin E protects against DSS-induced UC in mice Studies in murine models of colitis demonstrate that vitamin E supplementation ameliorates colonic inflammation and preserves intestinal barrier integrity. However, these protective effects are independent of its antioxidant ability(Carrier, Aghdassi, Cullen, & Allard, 2002; Liu, Nakatsu, Jones-Hall, Kozik, & Jiang, 2021). We found that cIAP1 protein expression was significantly downregulated in human clinical UC specimens (Figure 7A, Supplementary Figure 1 and Supplementary Table I), despite unaltered cIAP1 mRNA levels in colon tissues from UC patients (Figure 7B). This suggests that the degradation of cIAPs and subsequent cell death may contribute to UC pathogenesis. Given our in vitro evidence that vitamin E inhibits SMAC-induced cIAPs loss and cell death, we hypothesized that vitamin E might ameliorate UC through cIAPs stabilization. To test this, we evaluated whether therapeutic administration of vitamin E could alleviate DSS-induced UC in mice. Mice were first subjected to DSS treatment for 3 days, followed by α-TOC administration for 7 days. α-TOC treatment significantly mitigated UC severity, as evidenced by reduced weight loss (Figure 7C), lower disease activity index (DAI) scores (Figure 7D), attenuated colon shortening (Figure 7E), and improved histopathological outcomes (Figure 7F). In contrast, Trolox, a water-soluble vitamin E analog with antioxidant property, provided only modest protection (Figure 7C-F). To investigate the underlying mechanism, we evaluated cIAPs protein expression using a pan-cIAP antibody. While cIAP1 mRNA levels showed no significant differences among all groups (Figure 7G), cIAPs protein expression was markedly reduced in colon tissues of mice treated with DSS alone or DSS combined with Trolox (Figure 7H). In contrast, α-TOC treatment restored cIAPs expression in DSS-challenged mice (Figure 7H). Furthermore, levels of cleaved casp-3 were significantly lower in the α-TOC group compared to the DSS-alone or DSS plus Trolox groups (Figure 7H), indicating that vitamin E treatment attenuates DSS-induced apoptosis. Collectively, these results suggest that vitamin E alleviates DSS-induced UC in mice not through its conventional antioxidant activity, but rather via stabilization of cIAPs proteins. 4 | DISCUSSION Vitamin E has long been recognized as an essential lipid-soluble antioxidant, playing a crucial role in protecting cellular membranes from oxidative damage. However, a growing body of evidence suggests that its biological functions extend far beyond radical scavenging. Recent studies have begun to illuminate its non-antioxidant roles, particularly in modulating signaling pathways relevant to disease(Azzi & Stocker, 2000; Ungurianu, Zanfirescu, Nițulescu, & Margină, 2021b). For instance, a study by Wang et al. demonstrated that vitamin E enhances anti-tumor immunity by reinvigorating dendritic cells through direct targeting of the checkpoint protein SHP1(Yuan et al., 2022). This finding significantly advanced our understanding of vitamin E as a modulator of immune signaling. Our study builds upon this emerging paradigm by identifying cIAPs as a novel direct molecular target of vitamin E. This discovery not only unveils a previously uncharacterized non-antioxidant mechanism of vitamin E but also carries profound implications for therapeutic strategies. Given that SMAC mimetics, designed to degrade cIAPs and induce cancer cell death, are actively being evaluated in clinical trials for cancer therapy, our findings suggest a potential drug-nutrient interaction. The concomitant use or high-dose supplementation of vitamin E in patients undergoing SMAC mimetic-based treatments might inadvertently antagonize the therapeutic efficacy of these agents by preventing cIAPs degradation. Therefore, our work highlights the necessity of carefully considering vitamin E intake in clinical contexts where cIAPs degradation is therapeutically desired, potentially advising against its supplementation during such treatments to achieve optimal anti-cancer outcomes. Beyond its newly identified role in countering SMAC mimetic-induced cell death, vitamin E is a well-established inhibitor of oxidative cell death pathways, most notably ferroptosis. Ferroptosis is an iron-dependent form of regulated necrosis driven by lipid peroxidation(Stockwell, 2022). It can be effectively suppressed by vitamin E through its canonical antioxidant activity(Scarpellini et al., 2023). Our findings significantly broaden the anti-cell death repertoire of vitamin E by demonstrating its potent capacity to inhibit two additional, distinct forms of programmed cell death, apoptosis and necroptosis, induced by the TNF-α/SMAC mimetic combination. This protective effect is mechanistically divorced from its radical-scavenging function, as evidenced by the inactivity of the antioxidant analog Trolox. This positions vitamin E as a unique pleiotropic inhibitor capable of mitigating multiple, disparate cell death pathways via both antioxidant and non-antioxidant mechanisms. In pathologies where excessive or dysregulated cell death is a hallmark, such as ischemic injuries, neurodegenerative disorders, and inflammatory diseases, the ability to simultaneously dampen ferroptosis, apoptosis, and necroptosis could offer a superior therapeutic advantage compared to agents targeting a single pathway(Conrad, Angeli, Vandenabeele, & Stockwell, 2016). Thus, our research not only deepens the mechanistic understanding of vitamin E’s cytoprotective functions but also nominates it as a promising broad-spectrum agent for treating complex diseases characterized by concomitant activation of multiple cell death modalities. The essential role of vitamin E in human health has been predominantly attributed to its antioxidant properties, which are thought to underpin its benefits in combating oxidative stress associated with aging, cardiovascular disease, and cognitive decline. However, the reliance on this single mechanism may represent an oversimplification of its physiological functions. Our discovery that vitamin E directly stabilizes cIAPs and modulates cell death signaling independent of antioxidant activity necessitates a paradigm shift in interpreting its in vivo effects. The beneficial outcomes observed in our murine model of DSS-induced UC, where vitamin E, but not Trolox, ameliorated disease severity by preventing inflammation-associated cIAPs loss, provide a compelling in vivo validation of this non-canonical pathway. This suggests that at least some of the documented health benefits of vitamin E, particularly in inflammatory conditions, may be mediated through the stabilization of IAP proteins and the subsequent suppression of deleterious cell death signaling. Future investigations into the physiological functions of vitamin E as a vitamin must, therefore, incorporate this novel axis. Thus, reevaluating existing epidemiological and clinical data through the lens of cIAPs stabilization could yield new insights and potentially explain some of the inconsistencies observed in intervention trials focused solely on antioxidant effects of vitamin E. In conclusion, our study delineates a novel non-antioxidant pathway through which vitamin E stabilizes cIAPs and inhibits specific forms of programmed cell death. While we have employed molecular docking and biophysical assays like ITC to characterize the binding interaction, a high-resolution co-crystal structure of vitamin E bound to the BIR3 domain of cIAP1 remains a critical future objective. Such structural elucidation would unambiguously reveal precise atomic interactions and provide an invaluable blueprint for the rational design of novel small molecules that mimic this stabilizing interaction. In conclusion, our findings expand the functional repertoire of vitamin E beyond antioxidant roles and provide mechanistic insight into its potential as a therapeutic agent for inflammatory diseases characterized by dysregulated IAP signaling. This work opens new avenues for targeting cIAPs stability in conditions where excessive cell death contributes to pathogenesis. AUTHOR CONTRIBUTIONS Z.C., C.Z. and J.Z. conceived and designed experiments. X.T., Y.Z., F.Y., F.W., Z.W., T.Z., W.R., C. T., J.R., J.C., Y.H., C.Z. and X.F. performed experiments. C.Z., Y.Z. and J.Z interpreted the data and wrote the original manuscript. Y.Z. provided resources. Y.L. and S.J. provided helpful discussions and refined the paper. ACKNOWLEDGEMENTS This work was supported by grants from National Key Research and Development Program of China (No. 2021YFA1302200); National Natural Science Foundation of China (No. 32200453, No.32170748 and No.82204481); the Key Research and Development Program of Ningxia (No.2022BFH02012); Shanghai Committee of Science and Technology (No. 22ZR1448000 and No. 21490714300) and Fundamental Research Funds for the Central Universities. CONFLICT OF INTEREST STATEMENT The authors declare no conflict of interest. DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry, and Animal Experimentation and as recommended by funding agencies, publishers and other organizations engaged with supporting research. DATA AVAILABILITY STATEMENT The data that support the findings of this study are available from the corresponding author upon reasonable request. Some data may not be made available because of privacy or ethical restrictions. REFERENCES Azzi, A., & Stocker, A. (2000). Vitamin E: non-antioxidant roles. Prog Lipid Res, 39 (3), 231-255. doi:10.1016/s0163-7827(00)00006-0Bai, L., Smith, D. C., & Wang, S. (2014). Small-molecule SMAC mimetics as new cancer therapeutics. Pharmacol Ther, 144 (1), 82-95. doi:10.1016/j.pharmthera.2014.05.007Brigelius-Flohé, R., & Traber, M. G. (1999). Vitamin E: function and metabolism. FASEB J, 13 (10), 1145-1155. Carrier, J., Aghdassi, E., Cullen, J., & Allard, J. P. (2002). Iron supplementation increases disease activity and vitamin E ameliorates the effect in rats with dextran sulfate sodium-induced colitis. J Nutr, 132 (10), 3146-3150. doi:10.1093/jn/131.10.3146Chai, J., Du, C., Wu, J. W., Kyin, S., Wang, X., & Shi, Y. (2000). Structural and biochemical basis of apoptotic activation by Smac/DIABLO. Nature, 406 (6798), 855-862. doi:10.1038/35022514Conrad, M., Angeli, J. P., Vandenabeele, P., & Stockwell, B. R. (2016). Regulated necrosis: disease relevance and therapeutic opportunities. Nat Rev Drug Discov, 15 (5), 348-366. doi:10.1038/nrd.2015.6Fulda, S., & Vucic, D. (2012). Targeting IAP proteins for therapeutic intervention in cancer. Nat Rev Drug Discov, 11 (2), 109-124. doi:10.1038/nrd3627Gyrd-Hansen, M., & Meier, P. (2010). IAPs: from caspase inhibitors to modulators of NF-kappaB, inflammation and cancer. Nat Rev Cancer, 10 (8), 561-574. doi:10.1038/nrc2889He, S., Wang, L., Miao, L., Wang, T., Du, F., Zhao, L., & Wang, X. (2009). Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell, 137 (6), 1100-1111. doi:10.1016/j.cell.2009.05.021He, Y., Yang, T., Li, J., Li, K., Zhuang, C., Zhang, M., … Cai, Z. (2024). Identification of a marine-derived sesquiterpenoid, Compound-8, that inhibits tumour necrosis factor-induced cell death by blocking complex II assembly. Br J Pharmacol, 181 (15), 2443-2458. doi:10.1111/bph.16364Herrera, E., & Barbas, C. (2001). Vitamin E: action, metabolism and perspectives. J Physiol Biochem, 57 (2), 43-56. Jiang, Q. (2014). Natural forms of vitamin E: metabolism, antioxidant, and anti-inflammatory activities and their role in disease prevention and therapy. Free Radic Biol Med, 72 , 76-90. doi:10.1016/j.freeradbiomed.2014.03.035Kocab, A. J., & Duckett, C. S. (2016). Inhibitor of apoptosis proteins as intracellular signaling intermediates. Febs j, 283 (2), 221-231. doi:10.1111/febs.13554Kumar, S., Fairmichael, C., Longley, D. B., & Turkington, R. C. (2020). The Multiple Roles of the IAP Super-family in cancer. Pharmacol Ther, 214 , 107610. doi:10.1016/j.pharmthera.2020.107610Li, L., Thomas, R. M., Suzuki, H., De Brabander, J. K., Wang, X., & Harran, P. G. (2004). A small molecule Smac mimic potentiates TRAIL- and TNFalpha-mediated cell death. Science, 305 (5689), 1471-1474. doi:10.1126/science.1098231Liu, K. Y., Nakatsu, C. H., Jones-Hall, Y., Kozik, A., & Jiang, Q. (2021). Vitamin E alpha- and gamma-tocopherol mitigate colitis, protect intestinal barrier function and modulate the gut microbiota in mice. Free Radic Biol Med, 163 , 180-189. doi:10.1016/j.freeradbiomed.2020.12.017Lu, J., Bai, L., Sun, H., Nikolovska-Coleska, Z., McEachern, D., Qiu, S., … Wang, S. (2008). SM-164: a novel, bivalent Smac mimetic that induces apoptosis and tumor regression by concurrent removal of the blockade of cIAP-1/2 and XIAP. Cancer Res, 68 (22), 9384-9393. doi:10.1158/0008-5472.Can-08-2655Mickle, D. A., & Weisel, R. D. (1993). Future directions of vitamin E and its analogues in minimizing myocardial ischemia-reperfusion injury. Can J Cardiol, 9 (1), 89-93. Mishima, E., & Conrad, M. (2022). Nutritional and Metabolic Control of Ferroptosis. Annu Rev Nutr, 42 , 275-309. doi:10.1146/annurev-nutr-062320-114541Salvesen, G. S., & Duckett, C. S. (2002). IAP proteins: blocking the road to death’s door. Nat Rev Mol Cell Biol, 3 (6), 401-410. doi:10.1038/nrm830Scarpellini, C., Klejborowska, G., Lanthier, C., Hassannia, B., Vanden Berghe, T., & Augustyns, K. (2023). Beyond ferrostatin-1: a comprehensive review of ferroptosis inhibitors. Trends Pharmacol Sci, 44 (12), 902-916. doi:10.1016/j.tips.2023.08.012Silke, J., & Meier, P. (2013). Inhibitor of apoptosis (IAP) proteins-modulators of cell death and inflammation. Cold Spring Harb Perspect Biol, 5 (2), a008730. doi:10.1101/cshperspect.a008730Stockwell, B. R. (2022). Ferroptosis turns 10: Emerging mechanisms, physiological functions, and therapeutic applications. Cell, 185 (14), 2401-2421. doi:10.1016/j.cell.2022.06.003Ungurianu, A., Zanfirescu, A., Nițulescu, G., & Margină, D. (2021a). Vitamin E beyond Its Antioxidant Label. Antioxidants (Basel), 10 (5), 634. doi:10.3390/antiox10050634Ungurianu, A., Zanfirescu, A., Nițulescu, G., & Margină, D. (2021b). Vitamin E beyond Its Antioxidant Label. Antioxidants (Basel), 10 (5)doi:10.3390/antiox10050634van Loo, G., & Bertrand, M. J. M. (2023). Death by TNF: a road to inflammation. Nat Rev Immunol, 23 (5), 289-303. doi:10.1038/s41577-022-00792-3Varfolomeev, E., Blankenship, J. W., Wayson, S. M., Fedorova, A. V., Kayagaki, N., Garg, P., … Vucic, D. (2007). IAP antagonists induce autoubiquitination of c-IAPs, NF-kappaB activation, and TNFalpha-dependent apoptosis. Cell, 131 (4), 669-681. doi:10.1016/j.cell.2007.10.030Wang, L., Du, F., & Wang, X. (2008). TNF-alpha induces two distinct caspase-8 activation pathways. Cell, 133 (4), 693-703. doi:10.1016/j.cell.2008.03.036Xu, D., Ma, R., Ju, Y., Song, X., Niu, B., Hong, W., … Li, X. (2022). Cholesterol sulfate alleviates ulcerative colitis by promoting cholesterol biosynthesis in colonic epithelial cells. Nat Commun, 13 (1), 4428. doi:10.1038/s41467-022-32158-7Yan, J., Li, Y., Ding, L., Hou, R., Xing, C., Jiang, C., … Zhuang, C. (2023). Fragment-Based Discovery of Azocyclic Alkyl Naphthalenesulfonamides as Keap1-Nrf2 Inhibitors for Acute Lung Injury Treatment. J Med Chem, 66 (12), 8267-8280. doi:10.1021/acs.jmedchem.3c00686Yuan, X., Duan, Y., Xiao, Y., Sun, K., Qi, Y., Zhang, Y., … Yu, D. (2022). Vitamin E Enhances Cancer Immunotherapy by Reinvigorating Dendritic Cells via Targeting Checkpoint SHP1. Cancer Discov, 12 (7), 1742-1759. doi:10.1158/2159-8290.CD-21-0900Zaaboul, F., & Liu, Y. (2022). Vitamin E in foodstuff: Nutritional, analytical, and food technology aspects. Compr Rev Food Sci Food Saf, 21 (2), 964-998. doi:10.1111/1541-4337.12924Zhao, Y., Liu, P., Luan, H., Jiang, H., Xu, Y., Zhang, Y., … Li, R. (2023). Demethyleneberberine alleviated the inflammatory response by targeting MD-2 to inhibit the TLR4 signaling. Front Immunol, 14 , 1130404. doi:10.3389/fimmu.2023.1130404Zhao, Y., Luan, H., Jiang, H., Xu, Y., Wu, X., Zhang, Y., & Li, R. (2021). Gegen Qinlian decoction relieved DSS-induced ulcerative colitis in mice by modulating Th17/Treg cell homeostasis via suppressing IL-6/JAK2/STAT3 signaling. Phytomedicine, 84 , 153519. doi:10.1016/j.phymed.2021.153519 Figure 1. Vitamin E antagonizes TNF-α/SMAC mimetic-induced apoptosis and necroptosis. (A) Schematic overview of the high-throughput screening (HTS) workflow for identifying necroptosis inhibitors from a 350-compound library using a TSZ-induced necroptosis platform. (B) HT-29 cells were pre-treated with each compound (20 μM) for 30 min and then stimulated with TSZ (TNF-α: 20 ng/mL; SM-164: 10 nM; Z-VAD-fmk: 20 μM) for 12 h to induce necroptosis. Among the tested compounds, α-tocopherol (α-TOC) inhibited TSZ-induced necroptosis. (C) HT-29 cells were pre-treated with DMSO or α-TOC at the indicated concentrations followed by stimulation with TSZ or (D) TS (TNF-α: 20 ng/mL; SM-164: 10 nM). Cell death was evaluated by flow cytometry after staining with PI. (E) MEF cells were pre-treated with DMSO or α-TOC at the indicated concentrations followed by stimulation with TSZ or (F) TS (TNF-α: 20 ng/mL; SM-164: 10 nM). Cell death was evaluated by flow cytometry after staining with PI. (G) MDA-MB-231 cells were pre-treated with DMSO or α-TOC (50 μM) followed by stimulation with SM-164 for 12 h. (H) HT-29 or (I) MEF cells were pre-treated with four tocopherol isomers at indicated concentrations for 30 min and then treated with TSZ. Cell viability was determined by CellTiter-Lumi assay. Bar graphs represent the mean ± SD from five independent experiments. The levels of significance were indicated as: *, p < 0.05; **, p < 0.01 ; ***, p < 0.001. Figure 2. Vitamin E fails to inhibit cell death in the absence of SMAC mimetics (A) HT-29 cells were pre-treated with either DMSO or α-TOC for 30 min at the indicated concentrations followed by stimulation with TC (TNF-α: 20 ng/mL; cycloheximide: 5 μg/mL) or (B) TCZ (Z-VAD-fmk: 20 μM) for 12 h. (C) MEF cells were pre-treated with either DMSO or α-TOC for 30 min at the indicated concentrations followed by stimulation with TC or (D) TCZ for 12 h. (E) MDA-MB-231 cells were pre-treated with either DMSO or α-TOC for 30 min at the indicated concentrations followed by stimulation with TRAIL (20 ng/mL) for 16 h. (F) MEF cells were pre-treated with either DMSO or α-TOC for 30 min at the indicated concentrations followed by stimulation with Cisplatin (50 μM) or (G) Staurosporine (STS, 1 μM) for 12 h. Cell viability was determined by CellTiter-Lumi assay. Bar graphs represent the mean ± SD from five independent experiments. Figure 3. Vitamin E inhibits cell death signaling induced by TNF-α/SMAC mimetic. (A) HT-29 or (B) MEF cells were pre-treated with DMSO or α-TOC (25 and 50 μM, respectively) for 30 min followed by treatment with TS at the indicated time. Cells were lysed and immunoblotted with indicated antibodies. (C) HT-29 or (D) MEF cells were pre-treated with DMSO or α-TOC for 30 min followed by treatment with TSZ at the indicated time. Cells were lysed and immunoblotted with indicated antibodies. (E) MEF cells were pre-treated with DMSO or α-TOC for 30 min followed by treatment with TC or (F) TCZ for indicated time. Cells were lysed and immunoblotted with indicated antibodies. (G) HT-29 or (H) MEF cells were pre-treated with either DMSO or α-TOC for 30 min followed by stimulation with TSZ for 2 h. Cell lysates were immunoprecipitated with RIPK3 and RIPK1 antibody, respectively (IP: RIPK3 or RIPK1) and analyzed by immunoblotting with indicated antibodies. (I) HT-29 or (J) MEF cells were pre-treated with either DMSO or α-TOC for 30 min followed by stimulation with TSZ for indicated time. Cell lysates were immunoprecipitated with Casp8 antibody (IP: Casp8) and analyzed by immunoblotting with indicated antibodies. All western data are representative of five independent experiments. Figure 4. Vitamin E stabilizes cellular inhibitor of apoptosis proteins to antagonize SMAC mimetic-induced cell death. (A) Left, the chemical structures of α-TOC and Trolox. Right, HT-29 cells were pre-treated with DMSO or Trolox at the indicated concentrations followed by stimulation with TS for 12 h. Cell viability was determined by CellTiter-Lumi assay. (B) HT-29 cells were pre-treated with DMSO or α-TOC for 30 min followed by treatment with TS or (C) TSZ at the indicated time. Cells were lysed and immunoblotted with indicated antibodies. (D) MEF cells were pre-treated with DMSO or α-TOC for 30 min followed by treatment with TS or (E) TSZ at the indicated time. Cells were lysed and immunoblotted with indicated antibodies. (F) HT-29 or (G) MEF were pre-treated with DMSO or α-TOC for 30 min followed by treatment with SM-164 (10 nM) at the indicated time. Cells were lysed and immunoblotted with indicated antibodies. (H) HT-29 cells were pre-treated with α-TOC (25 μM) or Trolox (25 μM) for 30 min followed by treatment with SM-164 (10 nM) for 30 min. Cells were lysed and immunoblotted with indicated antibodies. (I) cIAP1 was knocked out by two sgRNA lentiviruses in MEF cells. The expression of cIAPs was examined by western blotting with pan-cIAP antibody. (J) sgRNA-Control, sgRNA-cIAP1#1 and -cIAP1#2 MEF cells were pre-treated with α-TOC for 30 min followed by treatment with TSZ for 4 h. Cell death was evaluated by flow cytometry after staining with PI. (K) Cells in (J) were pre-treated with α-TOC for 30 min followed by treatment with TSZ for 2 h. Cells were lysed and immunoblotted with indicated antibodies. All western data are representative of five independent experiments. Bar graphs represent the mean ± SD from five independent experiments. The levels of significance were indicated as: *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figure 5. Vitamin E binds cIAP1 to antagonize SMAC mimetic-induced autoubiquitination and degradation. (A) HT-29 or (B) HEK293T cells expressing Flag-cIAP1 were pre-treated with either MG132 (20 μM) or α-TOC for 30 min followed by stimulation with SM-164 for 30 min. Cell lysates were immunoprecipitated with cIAP1 or Flag antibody, respectively (IP: cIAP1 or Flag) and then immunoblotted with the indicated antibodies. (C) In vitro ubiquitination assays were performed using recombinant human cIAP1 in the presence of the indicated concentrations of α-TOC, with or without SM-164. Subsequently, the reaction mixtures were immunoblotted with the indicated antibodies. (D) HEK293T cells expressing Flag-cIAP1 were treated with or without α-TOC for 2 h and then digested with 0.1% pronase for 30 min. Protein stability was immunoblotted with the indicated antibodies. (E) Molecular docking analysis shows the binding parameters for each domain of cIAP1. N/A, Not Applicable. (F) Recombinant Flag -BIR3 protein was treated with α-TOC for 2 h and then digested with 0.1% pronase for 30 min. Protein stability was immunoblotted with anti-Flag antibody. (G) CETSA analysis of in vitro binding between α-TOC and cIAP1 BIR3 . Protein levels were investigated at different temperatures under the treatment of α-TOC (50 μM). Protein stability was analyzed by immunoblotting with anti-Flag antibody. (H) ITC analysis of interactions between α-TOC and cIAP1 BIR3 . (I) Left, The binding of cIAP1 BIR3 with α-TOC (shown in Green) was investigated by molecular docking. Right, Key residues that contact α-TOC are labeled. (J) Upper, the chemical structures of α-TOC and α-TOA. Lower, HT-29 cells were pre-treated with α-TOC (25 μM) or α-TOA (25 μM) for 30 min followed by treatment with SM-164 for 30 min. Cells were lysed and immunoblotted with the indicated antibodies. (K) HEK293T cells expressing Flag-cIAP1(Wild type, C309A or E319Q mutant) were pre-treated with α-TOC for 30 min followed by treatment with SM-164 for 30 min. Cells were lysed and immunoblotted with the indicated antibodies. All western data are representative of five independent experiments. Figure 6. Vitamin E competitively inhibits SMAC mimetic-induced cIAP degradation and cell death. (A) Structural overlay of cIAP1 BIR3 bound to α-TOC (green) and SM-164 (pink). Key residues that contact α-TOC or SM-164 are labeled. (B) HT-29 cells were pre-treated with α-TOC or DMSO at the indicated concentrations followed by stimulation with increased concentration of SM-164 and TNF-α (20 ng/ml) for 12 h. Cell viability was determined by CellTiter-Lumi assay. (C) HT-29 cells were pre-treated with α-TOC or DMSO followed by stimulation with increased concentration of SM-164 for 30min. cIAP1 degradation was analyzed by immunoblotting with indicated antibodies. (D) HEK293T cells expressing FLAG-cIAP1 and SMAC-c-Myc were pre-treated with α-TOC or DMSO at the indicated concentrations for 1 h. Cells were lysed and immunoblotted with indicated antibodies. (E) The relative band intensity of Flag-cIAP1 was quantified by Image J (n = 5 biological replicates). All western data are representative of five independent experiments. Bar graphs represent the mean ± SD from five independent experiments. The levels of significance were indicated as: n.s., non-significant (P> 0.05); *, p < 0.05; **, p < 0.01; ***, p < 0.001. Figure 7. Stabilization of cIAPs by vitamin E protects against DSS-induced ulcerative colitis in mice. (A) Representative images of immunohistochemical staining of cIAP1 and positive cells in colon tissues from healthy individuals and UC patients. Scale bar, 50 µm. (B) Analysis of the relative expression of cIAP1 in healthy people and ulcerative colitis (UC) patients, using datasets from databases GSE111889 and GSE243625. (C) Bodyweight of mice in the experimental model of UC (n = 5 for each group). (D) Disease Activity Index (DAI) of mice in (C). (E) Representative images of dissected colons and colon length from mice in (C). (F) Representative images of Hematoxylin-Eosin staining (H&E) and histological score of colon tissue from (C). Scale bar, 50 µm. (G) The relative mRNA level of cIAP1 in freshly isolated colon from the mice in (C). Bar graphs represent the mean ± SD (n = 5). (H) Western blot analysis of pan-cIAP and cleaved-caspase-3 in freshly isolated colon from the mice in (C). All western data are representative of five independent experiments. Statistical analysis was performed using a two-sided student’s t-test and ANOVA with Tukey’s multiple comparisons test. The P -value was labeled for each group. Supplementary Material File (figure1-7.pptx) Download 91.40 MB File (supplementary table ⅰ.docx) Download 19.61 KB Information & Authors Information Version history V1 Version 1 03 March 2026 Copyright This work is licensed under a Non Exclusive No Reuse License. Authors Affiliations Jing Zhu Tongji University View all articles by this author Xiaofang Tian Ningxia Medical University View all articles by this author Yujie Zhao Tongji University View all articles by this author Fan Yang Ningxia Medical University View all articles by this author Rui Wang Naval Medical University View all articles by this author Fang Wang Tongji University View all articles by this author Zhuhong Wang Tongji University View all articles by this author Tianle Zhang Tongji University View all articles by this author Wenqing Ren Tongji University View all articles by this author Chenxiao Tang Tongji University View all articles by this author Jingming Ren Tongji University View all articles by this author Jin Cai Tongji University View all articles by this author Yuan He Tongji University View all articles by this author Chenjie Zhu Tongji University View all articles by this author Xiaona Feng Ningxia Medical University View all articles by this author Yue Liu Ningxia Medical University View all articles by this author Siriporn Jitkaew Chulalongkorn University View all articles by this author Chunlin Zhuang Naval Medical University View all articles by this author Yaxing Zhao Tongji University View all articles by this author Zhenyu Cai 0000-0002-6252-5879 [email protected] Tongji University View all articles by this author Metrics & Citations Metrics Article Usage 157 views 89 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Jing Zhu, Xiaofang Tian, Yujie Zhao, et al. A Non-Antioxidant Role of Vitamin E in Antagonizing cellular Inhibitor of Apoptosis Proteins Degradation and Cell Death. Authorea . 03 March 2026. DOI: https://doi.org/10.22541/au.177253975.58580887/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.177253975.58580887/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe3514aea454193',t:'MTc3OTE5NTk3Mg=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();