Nano delivery of MiR-146a and its Effect Study on Genes Involved in Apoptosis and Autophagy Pathways in Lung Cancer and Tuberculosis

Nano delivery of MiR-146a and its Effect Study on Genes Involved in Apoptosis and Autophagy Pathways in Lung Cancer and Tuberculosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Nano delivery of MiR-146a and its Effect Study on Genes Involved in Apoptosis and Autophagy Pathways in Lung Cancer and Tuberculosis Mojgan Sheikhpour, Mobina Maleki, Hanie Sakhi, Abolfazl Movafagh, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6454179/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Aug, 2025 Read the published version in BMC Biotechnology → Version 1 posted 10 You are reading this latest preprint version Abstract Background Tuberculosis (TB) and lung cancer (LC) are among the leading causes of death worldwide and present serious challenges in diagnosis and treatment. Therefore, developing new strategies for their treatment is crucial. MicroRNAs (miRNAs) are biological molecules that play a critical role in regulating essential processes, such as apoptosis and autophagy, in TB and LC by targeting specific genes. Recently, the use of carbon nanotubes functionalized with Polyethyleneimine (CNT-PEI) to deliver miRNAs to target cells has been investigated to enhance therapeutic effects. Methods In this study, miR-146a was transfected into LC (A549), macrophages infected with TB (THP1), and healthy lung cells (MRC5) using CNT-PEI. Then, the expression of miR-146a and its target genes, including BCL-2 , IL-6 , tumor necrosis factor-alpha ( TNFα ), and TNF receptor-associated factor-6 ( TRAF6 ), were measured using Real-Time PCR. Finally, the effect of overexpression of miR-146a on these genes was investigated in all three cell lines. Result The results showed successful transfection of miR-146a using the CNT-PEI nano delivery system in LC and TB cells. Then, increased expression of miR-146 increased apoptosis and autophagy by targeting the TRAF6 gene and affecting other genes such as BCL-2 , IL-6 , and TNFα through the NF-kB signaling pathway. Conclusion The findings suggest an important role for miR-146a in TB and LC, which regulates inflammatory responses and treats these diseases. However, further studies are needed on the use of CNT-PEI in vivo, as well as the balance between local anti-inflammatory and non-inflammatory factors. nano delivery miR-146a apoptosis autophagy lung cancer tuberculosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1. Introduction Lung cancer (LC), basically includes non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) ( 1 ). LC is the second most common cancer in both men and women, with a total of 235,760 new cases and 131,880 deaths reported in 2021 ( 1 ). Several genetic and environmental factors, such as smoking, asbestos, and radon, may play a role in causing LC ( 1 ). Important genes that act as an oncogene in LC are EGFR , KRAS , BRAF , PIK3CA , RET , and ROS1 ( 2 ). Apoptosis is an active and energy-dependent process, and its inhibition is linked to the development of cancers such as LC ( 3 ). The BCL-2 gene can play roles in the induction and inhibition of apoptosis through the NF-κB signaling pathway ( 3 ). The balance between apoptosis and anti-apoptotic processes in cancer cells is maintained by tumor necrosis factors (TNF) receptor-associated factor-6 ( TRAF6 ) ( 4 ). TRAF6 is associated with TNFα-induced cancer cell migration and invasion and is involved in IL-1 signaling, which leads to the activation of nuclear factor kappa B ( NF-κB ) ( 4 , 5 ). Tuberculosis (TB), caused by Mycobacterium tuberculosis ( MTB ), remains a significant public health issue worldwide. In 2021, there were 10.6 million new TB cases and 1.6 million TB-related deaths ( 6 ). An active TB infection causes fibrosis, irreversible scarring, and impaired immune function in the lung parenchyma ( 7 ). In addition, TB susceptibility is influenced by genetic polymorphisms in innate immunity and inflammation genes, including Toll-like receptors and TNF, which are also linked to LC risk ( 7 ). Autophagy is a normal physiological process that supports survival mechanisms in normal respiratory cells. It is also involved in the lysosomal degradation of microorganisms (e.g., TB), damaged organelles, and dysfunctional proteins ( 8 ). Important genes in this pathway include IL-6 , TNFα , and TRAF6 , which are widely implicated in autophagy and autophagosome maturation in diseases such as TB ( 5 , 9 ). MicroRNAs (miRNAs) are small biological molecules found in plasma, serum, urine, and saliva, and have played critical roles in the diagnosis and treatment of diseases ( 10 ). MiRNAs are small non-coding RNAs that range from 18 to 25 nucleotides in length. They bind to complementary sequences in the 3' UTR of target transcribed mRNA, leading to translational repression, gene degradation, or silencing ( 11 ). MiRNAs are involved in several biological processes, including cytokines regulation, immune responses, gene expression, cell growth, migration, invasion, differentiation, autophagy, and apoptosis ( 11 – 14 ). The miR-146 family consists of miR-146a and miR-146b, which are located in the chromosomal region 5q33.3. ( 15 ). Previous studies have demonstrated that miR-146a targets several genes in LC cells, including CCND-1 , EGFR , NFKB-1 , TRAF6 , IL-6 , IL-8 , and TNFβ . This targeting helps suppress their expression by disrupting NF-kB activity ( 9 , 16 – 20 ). MiR-146a regulates molecules involved in inflammatory signaling homeostasis and innate immunity through the IRAK1 and TRAF6 genes, which are downstream mediators of the IL-1α and TNFα signaling pathways ( 21 ). Moreover, miR-146a-5p targets the 3'UTR of TRAF6 within the NF-κB pathway, leading to apoptosis by regulating the BCL-2 gene ( 3 , 20 ). So, in inflammatory states, overexpression of miR-146a increased apoptosis and autophagy ( 14 ). Carbon nanotubes (CNTs) are known as biocompatible polymers that possess a high capacity for drug and gene (plasmid DNA, small interfering RNA, and miRNA) loading ( 22 ). CNT functionalized with polyethyleneimine (CNT-PEI) has a higher carrying capacity and fewer side effects on healthy cells. Many studies have explored the various biomedical effects of CNT-PEI in several diseases and cell signaling pathways, including apoptosis and autophagy ( 23 ). Recently, these nanoparticles have been used in the treatment and diagnosis of various diseases, such as breast and pancreatic cancer ( 24 , 25 ). In this study, miR-146a was upregulated using the CNT-PEI nano delivery system. The investigation focused on how the overexpression of miR-146a affects genes such as BCL-2 , IL-6 , and TNFα via the TRAF6 gene within the NF-κB signaling pathways in LC and TB cells. 2. Methods The experimental protocols of this research were approved by the research committee of the Pasteur Institute of Iran with the ethical code of IR.PII.REC.1400.016. 2.1. Lentiviral vector preparation and cultivation High copy number transformed lentiviral vectors pBON-Lenti-III-miR-eGFP with a length of 885 bp were purchased from Bon Yakhte Company (Fig. 1 ). They were presented into the DH5α strain of E. coli bacteria, exerting resistance to the Kanamycin antibiotic and its selective marker was Promycin (stored as lyophilized at -70°C). To culture, 5 ml (50 µg/ml) of Kanamycin antibiotic and 100 ml of the bacteria were added to the liquid LB culture medium. The bacterial culture was placed in a shaker incubator with a temperature of 37°C and a speed of 100 rpm for 24 hours. Then, bacteria were cultured linearly on LB agar medium, and a colony of the grown bacteria was cultured in 20 ml of liquid LB medium and incubated for 24 hours at 37°C and 100 rpm (Supplementary S1). 2.2. DNA extraction After 24 hours of incubating bacteria, sediment was prepared from 20 ml of culture medium at 3800 rpm for 25 minutes. Then, DNA was extracted according to the Favorgen kit (No. FAPDE050) protocol and 50 µl Elution buffer, one-minute incubation at room temperature, and two minutes centrifugation at 18000g (Supplementary S2). 2.3. Transfection of cell lines A549 and MRC5 cells were prepared from the national cell bank of the Pasteur Institute of Iran, and washed with PBS and a medium containing (DMEM + FBS 2%). 100 µl PBS and 5 µg of desired plasmid DNA were poured into six 1.5 microtubes and vortexed for one minute. Then, 600 µl PBS was poured into a sterile 1.5 microtube, and 36 µl multi-walled carbon nanotubes- polyethyleneimine (CNT-PEI, 2mg/ml) was added to it; vortexed for one minute, and incubated for 10 minutes at room temperature. After that, 100 µl of the solution containing CNT-PEI and PBS was added to the solution containing DNA and vortexed three times for three seconds each time. Subsequently, they were incubated for 25 minutes at room temperature, the CNT-DNA/PEI composite was added dropwise to each well and the plate was vortexed well. The plate was placed in an incubator at 37°C and 4 hours after transfection, the medium of cells was removed and a complete medium (DMEM + Pen/Strep + FBS 10%) was added to each well. After 24 and 48 hours of incubation, the cells were observed under a fluorescent microscope (Fig. 2 ). The MOC-2, miR-146a, and control wells (only containing CNT-PEI) were removed for flow cytometry apoptosis assay, and the broth and cell pellet were transferred to -70°C. Re-transfection was duly performed according to the last protocol so that the amount of apoptosis in the cells was checked at 24 hours. 2.4. Cell infection with bacteria (MDR, XDR) Pulmonary monocyte cells (THP1) were prepared from the national cell bank of the Pasteur Institute of Iran, and were used as an infected model, so THP1 cells were differentiated into macrophages and infested with bacteria (MOI = 10). According to calculations, 70 µL of McFarland's suspension was added to each well of the cell plate and incubated for 4 hours in a 37°C incubator ( 27 ). 2.5. RNA extraction, cDNA synthesis, and Real-Time PCR RNA was extracted from the samples transfected with plasmid miR-146a, MOC P-Lenti, and treated with CNT-PEI (as a pDNA carrier) using a Trizol RNA extraction kit of Sinaclon (No. EX6101). After RNA extraction, cDNA synthesis was performed to examine gene expression using the Real-Time PCR technique. For this purpose, the Parstous cDNA synthesis protocol (No. A101161) was used. The Master Mix kit (Green qPCR MasterMix 2X) of Yekta Tajiz Azma Super SYBR (No. YT2551) and specific primers (as shown in Table 1 ) were used to perform the Real-Time PCR process. Finally, the Melting Curve Analysis and the PCR product were electrophoresed (1% agarose gel) for final confirmation. Table 1 Primer sequences used for Real-Time -PCR. Name Sequence (5′ → 3′) miRNA-146a Forward GTTTGGTGAGAACTGAATTCCA miRNA-146a Reverse GTGCAGGGTCCGAGGT miRNA-146a Stem-loop GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACCCA 2.6. Statistical analysis One-way ANOVA method was used for statistical analysis of dose-response tests in each group and cell line using Graph Pad Prism software (version 9.0(, and P < 0.05 was considered significant. 3. Result 3.1. Fluorescent microscope observation As shown in Fig. 2, single pDNA as a control was observed overnight after transfection by CNT-PEI in an acceptable number of cells transfected with miR-146a GFP. However, GFP was observed in a small number of cells transfected with MOC. 3.2. Electrophoresis and flow cytometry results In the DNA-CNT-PEI analysis with gel electrophoresis from a dilution of 1/8 to 1, no band was observed, which was considered the binding of DNA to CNT-PEI (Fig. 3). According to Figs. 4 and 5, the flow cytometry results showed that cells transfected with a plasmid containing miR-146a exhibited 23.06% apoptosis and 1.76% necrosis after 24 hours. After 48 hours, the apoptosis rate in these cells increased to 39.7%, which was 18.68% higher than the control condition (without pDNA). 3.3. MRC5 transfection results A few MOC-transfected cells were observed on the MRC5 (as control) cell lines after 24 hours. However, flow cytometry results showed 8.07% and 27.2% apoptosis and almost 10% necrosis in cells transfected with miR-146a and MOC, respectively (Fig. 6). 3.4. Results of examining BCL-2 and TRAF6 genes and miR-146a in A549 cell line Based on Fig. 7, the results regarding BCL-2 gene expression in A549 cells showed that the expression of the sample transfected with miR-146a, P-Lenti, and CNT-PEI had increased compared to the control sample (non-transfected cell). According to the analyses performed in Fig. 8 regarding the expression of the TRAF6 gene, the results show the expression of the P-Lenti sample was higher than that of the control sample, on the other hand, the expression of miR-146a and CNT-PEI samples had decreased compared to the control sample. On the other hand, the results of miR-146a expression, using the Real-Time PCR method, showed that the expression of miR-146a was higher in the sample transfected with miR-146a compared to the control sample. Additionally, the P-Lenti sample showed more expression than the control sample, but its expression was lower than miR-146a. 3.5. Results of examining BCL-2 and TRAF6 genes and miR-146a in the MRC5 cell line After evaluating the expression results of the above genes in the A549 cell line, the expression of the same genes in the MRC5 cell line was investigated, too. Figures 9 and 10 show the expression of the BCL-2 and TRAF6 gene in the MRC5 cell line, respectively. These analyses showed that the samples transfected with CNT-PEI, P-Lenti, and miR-146a had higher expression than the control sample. Furthermore, the analyses of miR-146a expression showed that the P-Lenti and miR-146a samples had lower expression than the control. 3.6. Results of examining IL-6 and TNFα genes and miR-146a in THP-1 cell line According to Figs. 11 and 12, the expression of IL-6 and TNFα genes in the THP-1 cell line had lower expression in the samples transfected with miR-146a, P-Lenti, and CNT-PEI compared to the control sample. On the other hand, the examination of the expression of miR-146a showed that the transfected samples of P-Lenti and miR-146a show lower expression than the control sample. 4. Discussion In this study, miR-146a transfection was well performed in different lung cell lines (A549, MRC5, and THP1). The results indicated that miR-146a overexpression causes apoptosis in LC and promotes autophagy in TB by targeting the TRAF6 gene, which influences genes such as BCL-2 , IL- 6, and TNFα through the NF-κB signaling pathway. In previous studies, the CNT nano delivery system has been used as a non-viral carrier in various cells, especially cancer, which has increased apoptosis, necrosis, and ultimately treatment ( 28 , 29 ). The CNT-PEI transfection system achieves DNA transfection and gene expression enhancement through the proton sponge effect ( 30 ). This system has had many clinical applications for gene delivery, monoclonal antibodies, oligonucleotide, small interfering RNA, etc. into the cell cytoplasm ( 31 – 33 ). A review of numerous studies showed that overexpression of miR-146 can activate the immune system. For example, studies on osteoarthritis (OA) showed that the expression of miR-146a-5p in the cartilage tissue of patients with OA inhibiting the expression of TRAF6 and suppressing the activation of the NF-κB signaling pathway can increase cell apoptosis ( 34 ). In addition, overexpression of miR-146a in hepatocellular carcinoma cells inhibits proliferation and invasion and increases apoptosis by targeting TRAF6 ( 35 ). Others had reported that miR-146a-5p was upregulated in pancreatic islets treated with proinflammatory cytokines and was associated with β-cell apoptosis and impaired insulin secretion ( 14 ). Overexpression of miR-146a in NK/T cell lymphoma, SNK6, and YT cell lines inhibited NF-κB and TNF6 , suppressed cell proliferation, induced apoptosis, and increased chemosensitivity ( 36 ). In a study conducted by Hu, Q. et al. ( 17 ), it was observed that the overexpression of miR-146a increases the survival of cervical cancer cells through the reduction of IRAK1 and TRAF6 . Another study exhibited that HIF-1α , miR-146a, and BCL-2 increase hypoxia-induced autophagy ( 19 ). MiR-146 by targeting genes such as IRAK1 , TRAF6 , TNFα , BCL-2 , PTEN , KRAS , IL-6 , and MAPK1 can control autophagy and apoptosis in TB and LC through NF-κB , PI3K/AKT, and MAPK pathways ( 3 , 37 ). Previous studies showed that miR-146a acts as an anti-cancer agent in LC by targeting EGFR , TGF-β , and NF-κB signaling, as well as IRAK-1 , ATG-12, TRAF6, BCL-2 , and JNK-2 genes ( 38 – 40 ). In addition, more expression of miR-146a in NSCLC suppressed cell growth, inhibited cell migration, and induced cell apoptosis ( 20 , 41 , 42 ). Chen et al. ( 38 ) demonstrated that upregulation of miR-146a significantly inhibited EGFR downstream signaling in NSCLC cell lines. The overexpression of miR-146a can prevent the expression of MIF through gene targeting; thereby inhibiting the proliferation of A549 cells and inducing apoptosis of cancer cells ( 43 ). MiRNAs are associated with inflammatory responses by regulating the replication of TB and inducing pathogenesis by targeting the TRAF-6 signaling pathway ( 44 ). Overexpression of miR-146a can modulate the inflammatory response by targeting TNF6 and IRAK1 ( 45 ). Alijani E et al. ( 46 ) found that miR-146a and miR-155 were increased in people with TB compared to healthy people, and regulated the inflammatory response to reduce tissue damage infected with MTB . Liu Z. et al. ( 47 ) showed that overexpression of miR-146a enhances the killing ability of THP1 cells against intracellular M. bovis BCG and reduces the expression of the TNFα gene. Therefore, upregulation of miR-146 using CNT-PEI may have great potential for the treatment of TB and LC. 5. Conclusion These therapies can potentially enhance the efficacy and safety of various treatments. However, further research and development is needed to optimize this approach and identify the most effective miRNA targets. In addition, further studies are needed to investigate any potential off-target effects of these therapies and to assess their long-term safety and efficacy in clinical settings. Also, it is crucial to examine the balance between stimulatory and inhibitory factors in determining cell survival or death. Ultimately, with the advancements in nanotechnology and its application in miRNA-based therapies, this approach could revolutionize the treatment of various diseases and lead to better outcomes for patients ( 48 ). Declarations Ethical approval: Not Applicable Consent for publications: Not Applicable Data availability statement All data generated or analyzed during this study are included in this published article [and its supplementary information files]. Funding information No financial support is relevant to this study. Authorship contribution statement Mojgan Sheikhpour: Conceptualization, Methodology, Validation, Resources, Data curation, Formal analysis, Writing – original draft, Writing – review & editing, Supervision, Project administration. Mobina Maleki: Conceptualization, Methodology, Validation, Data curation. Hanie Sakhi: Writing – original draft. Seyed Ali Nojoumi: Review & editing. Leila Ghazizadeh: Methodology. Declaration of competing interest No conflict of interest. References Sakhi H, Arabi M, Ghaemi A, Movafagh A, Sheikhpour M. Oncolytic viruses in lung cancer treatment: a review article. Immunotherapy. 2024;16(2):75–97. Abolfathi H, Sheikhpour M, Mohammad Soltani B, Fahimi H. The comparison and evaluation of the miR-16, miR-155 and miR-146a expression pattern in the blood of TB and NSCLC patients: A Research paper. Gene Rep. 2021;22:100967. Abolfathi H, Arabi M, Sheikhpour M. A literature review of microRNA and gene signaling pathways involved in the apoptosis pathway of lung cancer. Respir Res. 2023;24(1):55. Zhang XL, Dang YW, Li P, Rong MH, Hou XX, Luo DZ, et al. Expression of tumor necrosis factor receptor-associated factor 6 in lung cancer tissues. Asian Pac J cancer prevention: APJCP. 2014;15(24):10591–6. Starczynowski DT, Lockwood WW, Deléhouzée S, Chari R, Wegrzyn J, Fuller M, et al. TRAF6 is an amplified oncogene bridging the RAS and NF-κB pathways in human lung cancer. J Clin Investig. 2011;121(10):4095–105. Yang L, Zhuang L, Ye Z, Li L, Guan J, Gong W. Immunotherapy and biomarkers in patients with lung cancer with tuberculosis: Recent advances and future Directions. iScience. 2023;26(10):107881. Bhowmik S, Mohanto NC, Sarker D, Sorove AA. Incidence and Risk of Lung Cancer in Tuberculosis Patients, and Vice Versa: A Literature Review of the Last Decade. Biomed Res Int. 2022;2022:1702819. Racanelli AC, Kikkers SA, Choi AMK, Cloonan SM. Autophagy and inflammation in chronic respiratory disease. Autophagy. 2018;14(2):221–32. Shao J, Ding Z, Peng J, Zhou R, Li L, Qian Q, et al. MiR-146a-5p promotes IL-1β-induced chondrocyte apoptosis through the TRAF6-mediated NF-kB pathway. Inflamm Res. 2020;69(6):619–30. Ying H, FengYing S, YanHong W, YouMing H, FaYou Z, HongXiang Z, et al. MicroRNA-155 from sputum as noninvasive biomarker for diagnosis of active pulmonary tuberculosis. Iran J basic Med Sci. 2020;23(11):1419–25. Ruan K, Fang X, Ouyang G, MicroRNAs. Novel regulators in the hallmarks of human cancer. Cancer Lett. 2009;285(2):116–26. M K, S S, S M. Expression levels of candidate circulating microRNAs in pediatric tuberculosis. Pathogens global health. 2020;114(5):262–70. Bonafé GA, Boschiero MN, Sodré AR, Ziegler JV, Rocha T, Ortega MM. Natural Plant Compounds: Does Caffeine, Dipotassium Glycyrrhizinate, Curcumin, and Euphol Play Roles as Antitumoral Compounds in Glioblastoma Cell Lines? Front Neurol. 2021;12:784330. Krishnan P, Branco RCS, Weaver SA, Chang G, Lee CC, Syed F et al. miR-146a-5p mediates inflammation-induced β cell mitochondrial dysfunction and apoptosis. bioRxiv: the preprint server for biology. 2024. Mao S, Wu J, Yan J, Zhang W, Zhu F. Dysregulation of miR-146a: a causative factor in epilepsy pathogenesis, diagnosis, and prognosis. Front Neurol. 2023;14:1094709. Li YL, Wang J, Zhang CY, Shen YQ, Wang HM, Ding L, et al. MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016;7(37):59287–98. Hu Q, Song J, Ding B, Cui Y, Liang J, Han S. miR-146a promotes cervical cancer cell viability via targeting IRAK1 and TRAF6. Oncol Rep. 2018;39(6):3015–24. https:// mpd.bioinf.uni-sb.de/mirnas.html Zhang F, Wang J, Chu J, Yang C, Xiao H, Zhao C, et al. MicroRNA-146a Induced by Hypoxia Promotes Chondrocyte Autophagy through Bcl-2. Cell Physiol Biochem. 2015;37(4):1442–53. Liu X, Liu B, Li R, Wang F, Wang N, Zhang M, et al. miR-146a-5p Plays an Oncogenic Role in NSCLC via Suppression of TRAF6. Front cell Dev biology. 2020;8:847. Wani JA, Majid S, Khan A, Arafah A, Ahmad A, Jan BL et al. Clinico-Pathological Importance of miR-146a in Lung Cancer. Diagnostics (Basel). 2021;11(2). Sheikhpour M, Golbabaie A, Kasaeian A. Carbon nanotubes: A review of novel strategies for cancer diagnosis and treatment. Mater Sci Engineering: C. 2017;76:1289–304. Kamazani FM, Sotoodehnejad nematalahi F, Siadat SD, Pornour M, Sheikhpour M. A success targeted nano delivery to lung cancer cells with multi-walled carbon nanotubes conjugated to bromocriptine. Sci Rep. 2021;11(1):24419. Zomorodbakhsh S, Abbasian Y, Naghinejad M, Sheikhpour M. The Effects Study of Isoniazid Conjugated Multi-Wall Carbon Nanotubes Nanofluid on Mycobacterium tuberculosis. Int J Nanomed. 2020;15:5901–9. Taghavi S, HashemNia A, Mosaffa F, Askarian S, Abnous K, Ramezani M. Preparation and evaluation of polyethylenimine-functionalized carbon nanotubes tagged with 5TR1 aptamer for targeted delivery of Bcl-xL shRNA into breast cancer cells. Colloids Surf B. 2016;140:28–39. https:// bonbiotech.ir/بانک/بانک-وکتور/وکتورهای-لنتی-ویروسی/ pbon-lenti-iii-mir-egfp/ Sheikhpour M, Shokrgozar MA, Biglari A, Pornour M, Abdolrahimi F, Poorazar Dizaji S, et al. Gene Expression and In Vitro Pharmacogenetic Studies of Dopamine and Serotonin Gene Receptors in Tuberculosis. Tanaffos. 2021;20(2):126–33. Fahira AI, Amalia R, Barliana MI, Gatera VA, Abdulah R. Polyethyleneimine (PEI) as a Polymer-Based Co-Delivery System for Breast Cancer Therapy. Breast cancer (Dove Med Press). 2022;14:71–83. Moradian H, Fasehee H, Keshvari H, Faghihi S. Poly(ethyleneimine) functionalized carbon nanotubes as efficient nano-vector for transfecting mesenchymal stem cells. Colloids Surf B. 2014;122:115–25. Nunes A, Amsharov N, Guo C, Van den Bossche J, Santhosh P, Karachalios TK, et al. Hybrid polymer-grafted multi-walled carbon nanotubes for in vitro gene delivery. Small. 2010;6(20):2281–91. Wu H, Shi H, Zhang H, Wang X, Yang Y, Yu C, et al. Prostate stem cell antigen antibody-conjugated multiwalled carbon nanotubes for targeted ultrasound imaging and drug delivery. Biomaterials. 2014;35(20):5369–80. Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci USA. 1995;92(16):7297–301. Zhang QY, Ho PY, Tu MJ, Jilek JL, Chen QX, Zeng S, et al. Lipidation of polyethylenimine-based polyplex increases serum stability of bioengineered RNAi agents and offers more consistent tumoral gene knockdown in vivo. Int J Pharm. 2018;547(1–2):537–44. Zhong J-H, Li J, Liu C-F, Liu N, Bian R-X, Zhao S-M et al. Effects of microRNA-146a on the proliferation and apoptosis of human osteoarthritis chondrocytes by targeting TRAF6 through the NF-κB signalling pathway. Biosci Rep. 2017;37(2). Zu Y, Yang Y, Zhu J, Bo X, Hou S, Zhang B, et al. MiR-146a suppresses hepatocellular carcinoma by downregulating TRAF6. Am J cancer Res. 2016;6(11):2502–13. Paik JH, Jang JY, Jeon YK, Kim WY, Kim TM, Heo DS, et al. MicroRNA-146a downregulates NFκB activity via targeting TRAF6 and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clin cancer research: official J Am Association Cancer Res. 2011;17(14):4761–71. Sheikhpour M, Abolfathi H, Karimipoor M, Movafagh A, Shahsavani M. The Common miRNAs between Tuberculosis and Non-Small Cell Lung Cancer: A Critical Review. Tanaffos. 2021;20(3):197–208. Yuan F, Zhang S, Xie W, Yang S, Lin T, Chen X. Effect and mechanism of miR-146a on malignant biological behaviors of lung adenocarcinoma cell line. Oncol Lett. 2020;19(6):3643–52. Pang L, Lu J, Huang J, Xu C, Li H, Yuan G, et al. Upregulation of miR-146a increases cisplatin sensitivity of the non-small cell lung cancer A549 cell line by targeting JNK-2. Oncol Lett. 2017;14(6):7745–52. Wu Z, Lu H, Sheng J, Li L. Inductive microRNA-21 impairs anti-mycobacterial responses by targeting IL-12 and Bcl-2. FEBS Lett. 2012;586(16):2459–67. Iacona JR, Lutz CS. miR-146a-5p: Expression, regulation, and functions in cancer. Wiley Interdiscip Rev RNA. 2019;10(4):e1533. Chen G, Umelo IA, Lv S, Teugels E, Fostier K, Kronenberger P, et al. miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS ONE. 2013;8(3):e60317. Wang W-M, Liu J-C. Effect and molecular mechanism of mir-146a on proliferation of lung cancer cells by targeting and regulating MIF gene. Asian Pac J Trop Med. 2016;9(8):806–11. Chauhan D, Davuluri KS. microRNAs associated with the pathogenesis and their role in regulating various signaling pathways during Mycobacterium tuberculosis infection. 2022;12. Li S, Yue Y, Xu W, Xiong S. MicroRNA-146a represses mycobacteria-induced inflammatory response and facilitates bacterial replication via targeting IRAK-1 and TRAF-6. PLoS ONE. 2013;8(12):e81438. Alijani E, Rad FR, Katebi A, Ajdary S. Differential Expression of miR-146 and miR-155 in Active and Latent Tuberculosis Infection. Iran J public health. 2023;52(8):1749–57. Liu Z, Zhou G, Deng X, Yu Q, Hu Y, Sun H, et al. Analysis of miRNA expression profiling in human macrophages responding to Mycobacterium infection: Induction of the immune regulator miR-146a. J Infect. 2014;68(6):553–61. Jain D, Prajapati SK, Jain A, Singhal R. Nano-formulated siRNA-based therapeutic approaches for cancer therapy. Nano Trends. 2023;1:100006. Additional Declarations No competing interests reported. Supplementary Files supplementary.docx Cite Share Download PDF Status: Published Journal Publication published 11 Aug, 2025 Read the published version in BMC Biotechnology → Version 1 posted Editorial decision: Revision requested 13 May, 2025 Reviews received at journal 06 May, 2025 Reviews received at journal 06 May, 2025 Reviewers agreed at journal 03 May, 2025 Reviewers agreed at journal 03 May, 2025 Reviewers agreed at journal 01 May, 2025 Reviewers invited by journal 30 Apr, 2025 Editor assigned by journal 28 Apr, 2025 Submission checks completed at journal 26 Apr, 2025 First submitted to journal 26 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6454179","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":451507694,"identity":"1fdf9b9f-31af-4d23-8d19-02c86d32712e","order_by":0,"name":"Mojgan Sheikhpour","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYFACHgaGhAMHQCzGByAuHylamA1AXDaitDBAtLBJgElCGnT7zx788ODMnTx+9t5nlV9z7GTYGJgfPrqBR4vZjbxkiYQbz4ole46b3Zbdlgx0GJuxcQ5eLTwGEgkfDiduuJHGdltyGzNQCw+bNF4t588Y/4BpKZbcVk+ElgM5ZkCHQbQwftx2mAgtN3LMLBLOHAb65RizNOO24zxszIT8AnTYzR/HDgNDrI3x489t1fb87M0PH+PTAgMJIIKZB0wSoRyuhfEHkapHwSgYBaNgZAEAbQtOHI2DsosAAAAASUVORK5CYII=","orcid":"","institution":"Pasteur Institute of Iran","correspondingAuthor":true,"prefix":"","firstName":"Mojgan","middleName":"","lastName":"Sheikhpour","suffix":""},{"id":451507695,"identity":"684b7bd3-a85c-4f6b-94b3-eadceab6c327","order_by":1,"name":"Mobina Maleki","email":"","orcid":"","institution":"University of Milano","correspondingAuthor":false,"prefix":"","firstName":"Mobina","middleName":"","lastName":"Maleki","suffix":""},{"id":451507696,"identity":"23382b03-49bd-4785-abcc-05a5a8708918","order_by":2,"name":"Hanie Sakhi","email":"","orcid":"","institution":"Pasteur Institute of Iran","correspondingAuthor":false,"prefix":"","firstName":"Hanie","middleName":"","lastName":"Sakhi","suffix":""},{"id":451507697,"identity":"14ca7435-7540-4a30-bd80-1ae39cd4a76e","order_by":3,"name":"Abolfazl Movafagh","email":"","orcid":"","institution":"Shahid Beheshti University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Abolfazl","middleName":"","lastName":"Movafagh","suffix":""},{"id":451507698,"identity":"7f4505ea-4721-4d7c-bf96-f17f3892ec94","order_by":4,"name":"Seyed Ali Nojoumi","email":"","orcid":"","institution":"Pasteur Institute of Iran","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Ali","lastName":"Nojoumi","suffix":""},{"id":451507699,"identity":"21f0580f-243e-4b29-9534-6bd9cff7451e","order_by":5,"name":"Leila ghazizadeh","email":"","orcid":"","institution":"Pasteur Institute of Iran","correspondingAuthor":false,"prefix":"","firstName":"Leila","middleName":"","lastName":"ghazizadeh","suffix":""}],"badges":[],"createdAt":"2025-04-15 11:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6454179/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6454179/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12896-025-01019-8","type":"published","date":"2025-08-11T15:56:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82042009,"identity":"4e363c6c-d333-4347-8931-6b9c063205f6","added_by":"auto","created_at":"2025-05-06 09:14:10","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":58795,"visible":true,"origin":"","legend":"\u003cp\u003eThe structure of pBON-Lenti-III-miR-eGFP vector (26).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/db478ce592578085c099e7b2.jpg"},{"id":82042616,"identity":"2c511868-bfda-470d-9344-c5a548c791fe","added_by":"auto","created_at":"2025-05-06 09:22:11","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":36493,"visible":true,"origin":"","legend":"\u003cp\u003eTransfection of cells with CNT-PEI: A and B) miR-146a and C) MOC-Plenti. Acceptable results were observed in cells transfected with miR-146a, while only a small number of cells transfected with MOC showed GFP expression, after 24 hours.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/c91461b44237292218a3c79c.jpg"},{"id":82042010,"identity":"b25304ec-59b4-4fe7-bb01-7a9f7726f9a9","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":21284,"visible":true,"origin":"","legend":"\u003cp\u003eThe electrophoresis gel result of: A) miR-146a and MOC pDNA, B) CNT-PEI-pDNA and single pDNA (as a control). No bands were observed in the DNA-CNT-PEI analysis through gel electrophoresis for dilutions ranging from 1/8 to 1.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/fc9283905b7c1a9709270873.jpg"},{"id":82044415,"identity":"0fd13ac1-2783-4dd6-a0b4-13a7cd87a224","added_by":"auto","created_at":"2025-05-06 09:30:11","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":60070,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of flow cytometry showed 23.06% apoptosis and 1.76% necrosis in cells transfected with a plasmid containing miR-146a after 24 hours.\u003c/p\u003e\n\u003cp\u003e(Q1: Necrosis, Q2: Late Apoptosis, Q3: Early Apoptosis, Q4: Live Cells)\u003c/p\u003e","description":"","filename":"Figure4.jpg.png.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/75edc41af20b55c5197d0e29.jpg"},{"id":82042012,"identity":"6e705403-d3cb-418e-b31a-3c8d3fd8afe9","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":107490,"visible":true,"origin":"","legend":"\u003cp\u003eThe results of apoptosis by flow cytometry showed 39.7% apoptosis and 9.3% necrosis in cells transfected with miR-146a, while 21.02% apoptosis and 2.76% necrosis were observed in the control state after 48 hours.\u003c/p\u003e\n\u003cp\u003e(Q1: Necrosis, Q2: Late Apoptosis, Q3: Early Apoptosis, Q4: Live Cells)\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/13d40149a1709054734b456c.jpg"},{"id":82042015,"identity":"55d81ebc-1456-4b23-bfc8-5f6329ea4c12","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":800784,"visible":true,"origin":"","legend":"\u003cp\u003eThe flow cytometry results showed 8.07% apoptosis and 10.9% necrosis in cells transfected with miR-146a, compared to 27.2% apoptosis and 10.3% necrosis in cells transfected with MOC in MRC5 cell lines after 48 hours.\u003c/p\u003e\n\u003cp\u003e(Q1: Necrosis, Q2: Late Apoptosis, Q3: Early Apoptosis, Q4: Live Cells)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/c449edd852cd05ae4221a6cf.png"},{"id":82045668,"identity":"4a6536fc-af03-4e4f-8821-358574d1db5f","added_by":"auto","created_at":"2025-05-06 09:38:11","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":51490,"visible":true,"origin":"","legend":"\u003cp\u003eThe results show that \u003cem\u003eBCL-2\u003c/em\u003e gene expression in A549 cells was higher in the miR-146a, P-Lenti, and CNT-PEI transfected sample compared to the control (non-transfected cell).\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/7c38164bc2962ba15d05fdb4.jpg"},{"id":82042027,"identity":"b92e310a-e50d-49ac-9521-7d43e4beb8e0","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":50227,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTRAF6\u003c/em\u003e gene expression in P-Lenti samples was higher than in the control sample, while miR-146a and CNT-PEI samples expression was decreased compared to the control sample in A549 cell lines.\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/6aeba20c2b5eef2973669f8b.jpg"},{"id":82042618,"identity":"70bf5925-fd8a-4ba4-b394-4a5e393a05d5","added_by":"auto","created_at":"2025-05-06 09:22:11","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":50736,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of\u003cem\u003e the BCL-2\u003c/em\u003e gene in MRC5 cells showed more expression in cells transfected with CNT-PEI, P-Lenti, and miR-146a compared to the control section; miR-146a was lower than P-Lenti and CNT-PEI.\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/cb41d2544c93de69dd74d3d8.jpg"},{"id":82042018,"identity":"e89a9efb-223c-4ab8-8f98-5f1eb5670e7b","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":42851,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of the \u003cem\u003eTRAF6\u003c/em\u003e gene in MRC5 cells showed more expression in cells transfected with CNT-PEI, P-Lenti, and miR-146a compared to the control section.\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/f7d1301f62532bb0036f2c16.jpg"},{"id":82042620,"identity":"70509a28-544c-4de0-98fe-e0ae51ba6540","added_by":"auto","created_at":"2025-05-06 09:22:11","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":39306,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of the\u003cem\u003e IL-6\u003c/em\u003e gene in the THP1 cell line was decreased in cells transfected with miR-146, P-Lenti, and CNT-PEI, but it was increased in non-transfected cells.\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/a365798dc2644cfcd472086c.jpg"},{"id":82048362,"identity":"8e23d85f-a332-4a8e-b4d0-4458b33a986d","added_by":"auto","created_at":"2025-05-06 09:46:11","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":39774,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of the \u003cem\u003eTNFα\u003c/em\u003e gene in the THP1 cell line was decreased in cells transfected with miR-146, P-Lenti, and CNT-PEI.On the contrary, its expression was higher in non-transfected cells.\u003c/p\u003e\n\u003cp\u003eFrom left to right: control sample (non-transfected cells), sample transfected with miR-146a, P-Lenti, and CNT-PEI.\u003c/p\u003e","description":"","filename":"Figure12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/9dddaa53770d1e32fddfd77f.jpg"},{"id":89310458,"identity":"747d6bdc-fd31-4bde-83c2-f87edabbbf6e","added_by":"auto","created_at":"2025-08-18 15:59:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2347206,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/2c3c8994-e18b-4c81-8cbb-4105b7eaa990.pdf"},{"id":82042023,"identity":"8f74cc6e-2c68-4ffb-bb8c-c6fb71ec591b","added_by":"auto","created_at":"2025-05-06 09:14:11","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1547749,"visible":true,"origin":"","legend":"","description":"","filename":"supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-6454179/v1/9f348dcde4361da68a6691fc.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Nano delivery of MiR-146a and its Effect Study on Genes Involved in Apoptosis and Autophagy Pathways in Lung Cancer and Tuberculosis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eLung cancer (LC), basically includes non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). LC is the second most common cancer in both men and women, with a total of 235,760 new cases and 131,880 deaths reported in 2021 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Several genetic and environmental factors, such as smoking, asbestos, and radon, may play a role in causing LC (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Important genes that act as an oncogene in LC are \u003cem\u003eEGFR\u003c/em\u003e, \u003cem\u003eKRAS\u003c/em\u003e, \u003cem\u003eBRAF\u003c/em\u003e, \u003cem\u003ePIK3CA\u003c/em\u003e, \u003cem\u003eRET\u003c/em\u003e, and \u003cem\u003eROS1\u003c/em\u003e (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eApoptosis is an active and energy-dependent process, and its inhibition is linked to the development of cancers such as LC (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The \u003cem\u003eBCL-2\u003c/em\u003e gene can play roles in the induction and inhibition of apoptosis through the \u003cem\u003eNF-κB\u003c/em\u003e signaling pathway (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The balance between apoptosis and anti-apoptotic processes in cancer cells is maintained by tumor necrosis factors (TNF) receptor-associated factor-6 (\u003cem\u003eTRAF6\u003c/em\u003e) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). \u003cem\u003eTRAF6\u003c/em\u003e is associated with TNFα-induced cancer cell migration and invasion and is involved in IL-1 signaling, which leads to the activation of nuclear factor kappa B (\u003cem\u003eNF-κB\u003c/em\u003e) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTuberculosis (TB), caused by \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMTB\u003c/em\u003e), remains a significant public health issue worldwide. In 2021, there were 10.6\u0026nbsp;million new TB cases and 1.6\u0026nbsp;million TB-related deaths (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). An active TB infection causes fibrosis, irreversible scarring, and impaired immune function in the lung parenchyma (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In addition, TB susceptibility is influenced by genetic polymorphisms in innate immunity and inflammation genes, including Toll-like receptors and TNF, which are also linked to LC risk (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAutophagy is a normal physiological process that supports survival mechanisms in normal respiratory cells. It is also involved in the lysosomal degradation of microorganisms (e.g., TB), damaged organelles, and dysfunctional proteins (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Important genes in this pathway include \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eTNFα\u003c/em\u003e, and \u003cem\u003eTRAF6\u003c/em\u003e, which are widely implicated in autophagy and autophagosome maturation in diseases such as TB (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMicroRNAs (miRNAs) are small biological molecules found in plasma, serum, urine, and saliva, and have played critical roles in the diagnosis and treatment of diseases (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). MiRNAs are small non-coding RNAs that range from 18 to 25 nucleotides in length. They bind to complementary sequences in the 3' UTR of target transcribed mRNA, leading to translational repression, gene degradation, or silencing (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). MiRNAs are involved in several biological processes, including cytokines regulation, immune responses, gene expression, cell growth, migration, invasion, differentiation, autophagy, and apoptosis (\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe miR-146 family consists of miR-146a and miR-146b, which are located in the chromosomal region 5q33.3. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Previous studies have demonstrated that miR-146a targets several genes in LC cells, including \u003cem\u003eCCND-1\u003c/em\u003e, \u003cem\u003eEGFR\u003c/em\u003e, \u003cem\u003eNFKB-1\u003c/em\u003e, \u003cem\u003eTRAF6\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eIL-8\u003c/em\u003e, and \u003cem\u003eTNFβ\u003c/em\u003e. This targeting helps suppress their expression by disrupting \u003cem\u003eNF-kB\u003c/em\u003e activity (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18 CR19\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). MiR-146a regulates molecules involved in inflammatory signaling homeostasis and innate immunity through the \u003cem\u003eIRAK1\u003c/em\u003e and \u003cem\u003eTRAF6\u003c/em\u003e genes, which are downstream mediators of the \u003cem\u003eIL-1α\u003c/em\u003e and \u003cem\u003eTNFα\u003c/em\u003e signaling pathways (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Moreover, miR-146a-5p targets the 3'UTR of \u003cem\u003eTRAF6\u003c/em\u003e within the \u003cem\u003eNF-κB\u003c/em\u003e pathway, leading to apoptosis by regulating the \u003cem\u003eBCL-2\u003c/em\u003e gene (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). So, in inflammatory states, overexpression of miR-146a increased apoptosis and autophagy (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCarbon nanotubes (CNTs) are known as biocompatible polymers that possess a high capacity for drug and gene (plasmid DNA, small interfering RNA, and miRNA) loading (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). CNT functionalized with polyethyleneimine (CNT-PEI) has a higher carrying capacity and fewer side effects on healthy cells. Many studies have explored the various biomedical effects of CNT-PEI in several diseases and cell signaling pathways, including apoptosis and autophagy (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Recently, these nanoparticles have been used in the treatment and diagnosis of various diseases, such as breast and pancreatic cancer (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study, miR-146a was upregulated using the CNT-PEI nano delivery system. The investigation focused on how the overexpression of miR-146a affects genes such as \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, and \u003cem\u003eTNFα\u003c/em\u003e via the \u003cem\u003eTRAF6\u003c/em\u003e gene within the \u003cem\u003eNF-κB\u003c/em\u003e signaling pathways in LC and TB cells.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003eThe experimental protocols of this research were approved by the research committee of the Pasteur Institute of Iran with the ethical code of IR.PII.REC.1400.016.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Lentiviral vector preparation and cultivation\u003c/h2\u003e \u003cp\u003eHigh copy number transformed lentiviral vectors pBON-Lenti-III-miR-eGFP with a length of 885 bp were purchased from Bon Yakhte Company (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). They were presented into the DH5α strain of \u003cem\u003eE. coli\u003c/em\u003e bacteria, exerting resistance to the Kanamycin antibiotic and its selective marker was Promycin (stored as lyophilized at -70\u0026deg;C).\u003c/p\u003e \u003cp\u003eTo culture, 5 ml (50 \u0026micro;g/ml) of Kanamycin antibiotic and 100 ml of the bacteria were added to the liquid LB culture medium. The bacterial culture was placed in a shaker incubator with a temperature of 37\u0026deg;C and a speed of 100 rpm for 24 hours. Then, bacteria were cultured linearly on LB agar medium, and a colony of the grown bacteria was cultured in 20 ml of liquid LB medium and incubated for 24 hours at 37\u0026deg;C and 100 rpm (Supplementary S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. DNA extraction\u003c/h2\u003e \u003cp\u003eAfter 24 hours of incubating bacteria, sediment was prepared from 20 ml of culture medium at 3800 rpm for 25 minutes. Then, DNA was extracted according to the Favorgen kit (No. FAPDE050) protocol and 50 \u0026micro;l Elution buffer, one-minute incubation at room temperature, and two minutes centrifugation at 18000g (Supplementary S2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Transfection of cell lines\u003c/h2\u003e \u003cp\u003eA549 and MRC5 cells were prepared from the national cell bank of the Pasteur Institute of Iran, and washed with PBS and a medium containing (DMEM\u0026thinsp;+\u0026thinsp;FBS 2%). 100 \u0026micro;l PBS and 5 \u0026micro;g of desired plasmid DNA were poured into six 1.5 microtubes and vortexed for one minute. Then, 600 \u0026micro;l PBS was poured into a sterile 1.5 microtube, and 36 \u0026micro;l multi-walled carbon nanotubes- polyethyleneimine (CNT-PEI, 2mg/ml) was added to it; vortexed for one minute, and incubated for 10 minutes at room temperature. After that, 100 \u0026micro;l of the solution containing CNT-PEI and PBS was added to the solution containing DNA and vortexed three times for three seconds each time. Subsequently, they were incubated for 25 minutes at room temperature, the CNT-DNA/PEI composite was added dropwise to each well and the plate was vortexed well. The plate was placed in an incubator at 37\u0026deg;C and 4 hours after transfection, the medium of cells was removed and a complete medium (DMEM\u0026thinsp;+\u0026thinsp;Pen/Strep\u0026thinsp;+\u0026thinsp;FBS 10%) was added to each well. After 24 and 48 hours of incubation, the cells were observed under a fluorescent microscope (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The MOC-2, miR-146a, and control wells (only containing CNT-PEI) were removed for flow cytometry apoptosis assay, and the broth and cell pellet were transferred to -70\u0026deg;C. Re-transfection was duly performed according to the last protocol so that the amount of apoptosis in the cells was checked at 24 hours.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Cell infection with bacteria (MDR, XDR)\u003c/h2\u003e \u003cp\u003ePulmonary monocyte cells (THP1) were prepared from the national cell bank of the Pasteur Institute of Iran, and were used as an infected model, so THP1 cells were differentiated into macrophages and infested with bacteria (MOI\u0026thinsp;=\u0026thinsp;10). According to calculations, 70 \u0026micro;L of McFarland's suspension was added to each well of the cell plate and incubated for 4 hours in a 37\u0026deg;C incubator (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. RNA extraction, cDNA synthesis, and Real-Time PCR\u003c/h2\u003e \u003cp\u003eRNA was extracted from the samples transfected with plasmid miR-146a, MOC P-Lenti, and treated with CNT-PEI (as a pDNA carrier) using a Trizol RNA extraction kit of Sinaclon (No. EX6101).\u003c/p\u003e \u003cp\u003eAfter RNA extraction, cDNA synthesis was performed to examine gene expression using the Real-Time PCR technique. For this purpose, the Parstous cDNA synthesis protocol (No. A101161) was used. The Master Mix kit (Green qPCR MasterMix 2X) of Yekta Tajiz Azma Super SYBR (No. YT2551) and specific primers (as shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were used to perform the Real-Time PCR process. Finally, the Melting Curve Analysis and the PCR product were electrophoresed (1% agarose gel) for final confirmation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used for Real-Time -PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiRNA-146a Forward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTTGGTGAGAACTGAATTCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiRNA-146a Reverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGCAGGGTCCGAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiRNA-146a Stem-loop\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAACCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e \u003cp\u003eOne-way ANOVA method was used for statistical analysis of dose-response tests in each group and cell line using Graph Pad Prism software (version 9.0(, and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003e3.1. Fluorescent microscope observation\u003c/h2\u003e\n \u003cp\u003eAs shown in Fig.\u0026nbsp;2, single pDNA as a control was observed overnight after transfection by CNT-PEI in an acceptable number of cells transfected with miR-146a GFP. However, GFP was observed in a small number of cells transfected with MOC.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\"\u003e\n \u003ch2\u003e3.2. Electrophoresis and flow cytometry results\u003c/h2\u003e\n \u003cp\u003eIn the DNA-CNT-PEI analysis with gel electrophoresis from a dilution of 1/8 to 1, no band was observed, which was considered the binding of DNA to CNT-PEI (Fig.\u0026nbsp;3).\u003c/p\u003e\n \u003cp\u003eAccording to Figs.\u0026nbsp;4 and 5, the flow cytometry results showed that cells transfected with a plasmid containing miR-146a exhibited 23.06% apoptosis and 1.76% necrosis after 24 hours. After 48 hours, the apoptosis rate in these cells increased to 39.7%, which was 18.68% higher than the control condition (without pDNA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\"\u003e\n \u003ch2\u003e3.3. MRC5 transfection results\u003c/h2\u003e\n \u003cp\u003eA few MOC-transfected cells were observed on the MRC5 (as control) cell lines after 24 hours. However, flow cytometry results showed 8.07% and 27.2% apoptosis and almost 10% necrosis in cells transfected with miR-146a and MOC, respectively (Fig.\u0026nbsp;6).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\"\u003e\n \u003ch2\u003e3.4. Results of examining \u003cem\u003eBCL-2\u003c/em\u003e and \u003cem\u003eTRAF6\u003c/em\u003e genes and miR-146a in A549 cell line\u003c/h2\u003e\n \u003cp\u003eBased on Fig.\u0026nbsp;7, the results regarding \u003cem\u003eBCL-2\u003c/em\u003e gene expression in A549 cells showed that the expression of the sample transfected with miR-146a, P-Lenti, and CNT-PEI had increased compared to the control sample (non-transfected cell).\u003c/p\u003e\n \u003cp\u003eAccording to the analyses performed in Fig.\u0026nbsp;8 regarding the expression of the \u003cem\u003eTRAF6\u003c/em\u003e gene, the results show the expression of the P-Lenti sample was higher than that of the control sample, on the other hand, the expression of miR-146a and CNT-PEI samples had decreased compared to the control sample.\u003c/p\u003e\n \u003cp\u003eOn the other hand, the results of miR-146a expression, using the Real-Time PCR method, showed that the expression of miR-146a was higher in the sample transfected with miR-146a compared to the control sample. Additionally, the P-Lenti sample showed more expression than the control sample, but its expression was lower than miR-146a.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\"\u003e\n \u003ch2\u003e3.5. Results of examining \u003cem\u003eBCL-2\u003c/em\u003e and \u003cem\u003eTRAF6\u003c/em\u003e genes and miR-146a in the MRC5 cell line\u003c/h2\u003e\n \u003cp\u003eAfter evaluating the expression results of the above genes in the A549 cell line, the expression of the same genes in the MRC5 cell line was investigated, too. Figures\u0026nbsp;9 and 10 show the expression of the \u003cem\u003eBCL-2\u003c/em\u003e and \u003cem\u003eTRAF6\u003c/em\u003e gene in the MRC5 cell line, respectively. These analyses showed that the samples transfected with CNT-PEI, P-Lenti, and miR-146a had higher expression than the control sample.\u003c/p\u003e\n \u003cp\u003eFurthermore, the analyses of miR-146a expression showed that the P-Lenti and miR-146a samples had lower expression than the control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\"\u003e\n \u003ch2\u003e3.6. Results of examining \u003cem\u003eIL-6\u003c/em\u003e and \u003cem\u003eTNFα\u003c/em\u003e genes and miR-146a in THP-1 cell line\u003c/h2\u003e\n \u003cp\u003eAccording to Figs.\u0026nbsp;11 and 12, the expression of \u003cem\u003eIL-6\u003c/em\u003e and \u003cem\u003eTNFα\u003c/em\u003e genes in the THP-1 cell line had lower expression in the samples transfected with miR-146a, P-Lenti, and CNT-PEI compared to the control sample.\u003c/p\u003e\n \u003cp\u003eOn the other hand, the examination of the expression of miR-146a showed that the transfected samples of P-Lenti and miR-146a show lower expression than the control sample.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn this study, miR-146a transfection was well performed in different lung cell lines (A549, MRC5, and THP1). The results indicated that miR-146a overexpression causes apoptosis in LC and promotes autophagy in TB by targeting the \u003cem\u003eTRAF6\u003c/em\u003e gene, which influences genes such as \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eIL-\u003c/em\u003e6, and \u003cem\u003eTNFα\u003c/em\u003e through the \u003cem\u003eNF-κB\u003c/em\u003e signaling pathway.\u003c/p\u003e \u003cp\u003eIn previous studies, the CNT nano delivery system has been used as a non-viral carrier in various cells, especially cancer, which has increased apoptosis, necrosis, and ultimately treatment (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). The CNT-PEI transfection system achieves DNA transfection and gene expression enhancement through the proton sponge effect (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). This system has had many clinical applications for gene delivery, monoclonal antibodies, oligonucleotide, small interfering RNA, etc. into the cell cytoplasm (\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA review of numerous studies showed that overexpression of miR-146 can activate the immune system. For example, studies on osteoarthritis (OA) showed that the expression of miR-146a-5p in the cartilage tissue of patients with OA inhibiting the expression of \u003cem\u003eTRAF6\u003c/em\u003e and suppressing the activation of the \u003cem\u003eNF-κB\u003c/em\u003e signaling pathway can increase cell apoptosis (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). In addition, overexpression of miR-146a in hepatocellular carcinoma cells inhibits proliferation and invasion and increases apoptosis by targeting \u003cem\u003eTRAF6\u003c/em\u003e (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Others had reported that miR-146a-5p was upregulated in pancreatic islets treated with proinflammatory cytokines and was associated with β-cell apoptosis and impaired insulin secretion (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Overexpression of miR-146a in NK/T cell lymphoma, SNK6, and YT cell lines inhibited \u003cem\u003eNF-κB\u003c/em\u003e and \u003cem\u003eTNF6\u003c/em\u003e, suppressed cell proliferation, induced apoptosis, and increased chemosensitivity (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). In a study conducted by Hu, Q. et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), it was observed that the overexpression of miR-146a increases the survival of cervical cancer cells through the reduction of \u003cem\u003eIRAK1\u003c/em\u003e and \u003cem\u003eTRAF6\u003c/em\u003e. Another study exhibited that \u003cem\u003eHIF-1α\u003c/em\u003e, miR-146a, and \u003cem\u003eBCL-2\u003c/em\u003e increase hypoxia-induced autophagy (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMiR-146 by targeting genes such as \u003cem\u003eIRAK1\u003c/em\u003e, \u003cem\u003eTRAF6\u003c/em\u003e, \u003cem\u003eTNFα\u003c/em\u003e, \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003ePTEN\u003c/em\u003e, \u003cem\u003eKRAS\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, and \u003cem\u003eMAPK1\u003c/em\u003e can control autophagy and apoptosis in TB and LC through \u003cem\u003eNF-κB\u003c/em\u003e, PI3K/AKT, and MAPK pathways (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Previous studies showed that miR-146a acts as an anti-cancer agent in LC by targeting \u003cem\u003eEGFR\u003c/em\u003e, \u003cem\u003eTGF-β\u003c/em\u003e, and \u003cem\u003eNF-κB\u003c/em\u003e signaling, as well as \u003cem\u003eIRAK-1\u003c/em\u003e, \u003cem\u003eATG-12, TRAF6, BCL-2\u003c/em\u003e, and \u003cem\u003eJNK-2\u003c/em\u003e genes (\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). In addition, more expression of miR-146a in NSCLC suppressed cell growth, inhibited cell migration, and induced cell apoptosis (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Chen et al. (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e) demonstrated that upregulation of miR-146a significantly inhibited EGFR downstream signaling in NSCLC cell lines. The overexpression of miR-146a can prevent the expression of \u003cem\u003eMIF\u003c/em\u003e through gene targeting; thereby inhibiting the proliferation of A549 cells and inducing apoptosis of cancer cells (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMiRNAs are associated with inflammatory responses by regulating the replication of TB and inducing pathogenesis by targeting the \u003cem\u003eTRAF-6\u003c/em\u003e signaling pathway (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). Overexpression of miR-146a can modulate the inflammatory response by targeting \u003cem\u003eTNF6\u003c/em\u003e and \u003cem\u003eIRAK1\u003c/em\u003e (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). Alijani E et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e) found that miR-146a and miR-155 were increased in people with TB compared to healthy people, and regulated the inflammatory response to reduce tissue damage infected with \u003cem\u003eMTB\u003c/em\u003e. Liu Z. et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e) showed that overexpression of miR-146a enhances the killing ability of THP1 cells against intracellular \u003cem\u003eM. bovis\u003c/em\u003e BCG and reduces the expression of the \u003cem\u003eTNFα\u003c/em\u003e gene. Therefore, upregulation of miR-146 using CNT-PEI may have great potential for the treatment of TB and LC.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThese therapies can potentially enhance the efficacy and safety of various treatments. However, further research and development is needed to optimize this approach and identify the most effective miRNA targets. In addition, further studies are needed to investigate any potential off-target effects of these therapies and to assess their long-term safety and efficacy in clinical settings. Also, it is crucial to examine the balance between stimulatory and inhibitory factors in determining cell survival or death. Ultimately, with the advancements in nanotechnology and its application in miRNA-based therapies, this approach could revolutionize the treatment of various diseases and lead to better outcomes for patients (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publications:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article [and its supplementary information files].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo financial support is relevant to this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMojgan Sheikhpour:\u003c/strong\u003e Conceptualization, Methodology, Validation, Resources, Data curation, Formal analysis, Writing – original draft, Writing – review \u0026amp; editing, Supervision, Project administration. \u003cstrong\u003eMobina Maleki:\u003c/strong\u003e Conceptualization, Methodology, Validation, Data curation. \u003cstrong\u003eHanie Sakhi:\u003c/strong\u003e\u0026nbsp; Writing – original draft. \u003cstrong\u003eSeyed Ali Nojoumi:\u003c/strong\u003e Review \u0026amp; editing. \u003cstrong\u003eLeila Ghazizadeh:\u003c/strong\u003e Methodology.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSakhi H, Arabi M, Ghaemi A, Movafagh A, Sheikhpour M. Oncolytic viruses in lung cancer treatment: a review article. Immunotherapy. 2024;16(2):75\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbolfathi H, Sheikhpour M, Mohammad Soltani B, Fahimi H. The comparison and evaluation of the miR-16, miR-155 and miR-146a expression pattern in the blood of TB and NSCLC patients: A Research paper. Gene Rep. 2021;22:100967.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbolfathi H, Arabi M, Sheikhpour M. A literature review of microRNA and gene signaling pathways involved in the apoptosis pathway of lung cancer. Respir Res. 2023;24(1):55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang XL, Dang YW, Li P, Rong MH, Hou XX, Luo DZ, et al. Expression of tumor necrosis factor receptor-associated factor 6 in lung cancer tissues. Asian Pac J cancer prevention: APJCP. 2014;15(24):10591\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStarczynowski DT, Lockwood WW, Del\u0026eacute;houz\u0026eacute;e S, Chari R, Wegrzyn J, Fuller M, et al. TRAF6 is an amplified oncogene bridging the RAS and NF-κB pathways in human lung cancer. J Clin Investig. 2011;121(10):4095\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L, Zhuang L, Ye Z, Li L, Guan J, Gong W. Immunotherapy and biomarkers in patients with lung cancer with tuberculosis: Recent advances and future Directions. iScience. 2023;26(10):107881.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBhowmik S, Mohanto NC, Sarker D, Sorove AA. Incidence and Risk of Lung Cancer in Tuberculosis Patients, and Vice Versa: A Literature Review of the Last Decade. Biomed Res Int. 2022;2022:1702819.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRacanelli AC, Kikkers SA, Choi AMK, Cloonan SM. Autophagy and inflammation in chronic respiratory disease. Autophagy. 2018;14(2):221\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao J, Ding Z, Peng J, Zhou R, Li L, Qian Q, et al. MiR-146a-5p promotes IL-1β-induced chondrocyte apoptosis through the TRAF6-mediated NF-kB pathway. Inflamm Res. 2020;69(6):619\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYing H, FengYing S, YanHong W, YouMing H, FaYou Z, HongXiang Z, et al. MicroRNA-155 from sputum as noninvasive biomarker for diagnosis of active pulmonary tuberculosis. Iran J basic Med Sci. 2020;23(11):1419\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuan K, Fang X, Ouyang G, MicroRNAs. Novel regulators in the hallmarks of human cancer. Cancer Lett. 2009;285(2):116\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM K, S S, S M. Expression levels of candidate circulating microRNAs in pediatric tuberculosis. Pathogens global health. 2020;114(5):262\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonaf\u0026eacute; GA, Boschiero MN, Sodr\u0026eacute; AR, Ziegler JV, Rocha T, Ortega MM. Natural Plant Compounds: Does Caffeine, Dipotassium Glycyrrhizinate, Curcumin, and Euphol Play Roles as Antitumoral Compounds in Glioblastoma Cell Lines? Front Neurol. 2021;12:784330.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnan P, Branco RCS, Weaver SA, Chang G, Lee CC, Syed F et al. miR-146a-5p mediates inflammation-induced β cell mitochondrial dysfunction and apoptosis. bioRxiv: the preprint server for biology. 2024.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao S, Wu J, Yan J, Zhang W, Zhu F. Dysregulation of miR-146a: a causative factor in epilepsy pathogenesis, diagnosis, and prognosis. Front Neurol. 2023;14:1094709.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi YL, Wang J, Zhang CY, Shen YQ, Wang HM, Ding L, et al. MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016;7(37):59287\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Q, Song J, Ding B, Cui Y, Liang J, Han S. miR-146a promotes cervical cancer cell viability via targeting IRAK1 and TRAF6. Oncol Rep. 2018;39(6):3015\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ehttps://\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003empd.bioinf.uni-sb.de/mirnas.html\u003c/span\u003e\u003cspan address=\"http://mpd.bioinf.uni-sb.de/mirnas.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang F, Wang J, Chu J, Yang C, Xiao H, Zhao C, et al. MicroRNA-146a Induced by Hypoxia Promotes Chondrocyte Autophagy through Bcl-2. Cell Physiol Biochem. 2015;37(4):1442\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Liu B, Li R, Wang F, Wang N, Zhang M, et al. miR-146a-5p Plays an Oncogenic Role in NSCLC via Suppression of TRAF6. Front cell Dev biology. 2020;8:847.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWani JA, Majid S, Khan A, Arafah A, Ahmad A, Jan BL et al. Clinico-Pathological Importance of miR-146a in Lung Cancer. Diagnostics (Basel). 2021;11(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikhpour M, Golbabaie A, Kasaeian A. Carbon nanotubes: A review of novel strategies for cancer diagnosis and treatment. Mater Sci Engineering: C. 2017;76:1289\u0026ndash;304.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamazani FM, Sotoodehnejad nematalahi F, Siadat SD, Pornour M, Sheikhpour M. A success targeted nano delivery to lung cancer cells with multi-walled carbon nanotubes conjugated to bromocriptine. Sci Rep. 2021;11(1):24419.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZomorodbakhsh S, Abbasian Y, Naghinejad M, Sheikhpour M. The Effects Study of Isoniazid Conjugated Multi-Wall Carbon Nanotubes Nanofluid on Mycobacterium tuberculosis. Int J Nanomed. 2020;15:5901\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaghavi S, HashemNia A, Mosaffa F, Askarian S, Abnous K, Ramezani M. Preparation and evaluation of polyethylenimine-functionalized carbon nanotubes tagged with 5TR1 aptamer for targeted delivery of Bcl-xL shRNA into breast cancer cells. Colloids Surf B. 2016;140:28\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ehttps://\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ebonbiotech.ir/بانک/بانک-وکتور/وکتورهای-لنتی-ویروسی/ pbon-lenti-iii-mir-egfp/\u003c/span\u003e\u003cspan address=\"http://bonbiotech.ir/بانک/بانک-وکتور/وکتورهای-لنتی-ویروسی/ pbon-lenti-iii-mir-egfp/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikhpour M, Shokrgozar MA, Biglari A, Pornour M, Abdolrahimi F, Poorazar Dizaji S, et al. Gene Expression and In Vitro Pharmacogenetic Studies of Dopamine and Serotonin Gene Receptors in Tuberculosis. Tanaffos. 2021;20(2):126\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFahira AI, Amalia R, Barliana MI, Gatera VA, Abdulah R. Polyethyleneimine (PEI) as a Polymer-Based Co-Delivery System for Breast Cancer Therapy. Breast cancer (Dove Med Press). 2022;14:71\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoradian H, Fasehee H, Keshvari H, Faghihi S. Poly(ethyleneimine) functionalized carbon nanotubes as efficient nano-vector for transfecting mesenchymal stem cells. Colloids Surf B. 2014;122:115\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNunes A, Amsharov N, Guo C, Van den Bossche J, Santhosh P, Karachalios TK, et al. Hybrid polymer-grafted multi-walled carbon nanotubes for in vitro gene delivery. Small. 2010;6(20):2281\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu H, Shi H, Zhang H, Wang X, Yang Y, Yu C, et al. Prostate stem cell antigen antibody-conjugated multiwalled carbon nanotubes for targeted ultrasound imaging and drug delivery. Biomaterials. 2014;35(20):5369\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci USA. 1995;92(16):7297\u0026ndash;301.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang QY, Ho PY, Tu MJ, Jilek JL, Chen QX, Zeng S, et al. Lipidation of polyethylenimine-based polyplex increases serum stability of bioengineered RNAi agents and offers more consistent tumoral gene knockdown in vivo. Int J Pharm. 2018;547(1\u0026ndash;2):537\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong J-H, Li J, Liu C-F, Liu N, Bian R-X, Zhao S-M et al. Effects of microRNA-146a on the proliferation and apoptosis of human osteoarthritis chondrocytes by targeting TRAF6 through the NF-κB signalling pathway. Biosci Rep. 2017;37(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZu Y, Yang Y, Zhu J, Bo X, Hou S, Zhang B, et al. MiR-146a suppresses hepatocellular carcinoma by downregulating TRAF6. Am J cancer Res. 2016;6(11):2502\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaik JH, Jang JY, Jeon YK, Kim WY, Kim TM, Heo DS, et al. MicroRNA-146a downregulates NFκB activity via targeting TRAF6 and functions as a tumor suppressor having strong prognostic implications in NK/T cell lymphoma. Clin cancer research: official J Am Association Cancer Res. 2011;17(14):4761\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikhpour M, Abolfathi H, Karimipoor M, Movafagh A, Shahsavani M. The Common miRNAs between Tuberculosis and Non-Small Cell Lung Cancer: A Critical Review. Tanaffos. 2021;20(3):197\u0026ndash;208.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan F, Zhang S, Xie W, Yang S, Lin T, Chen X. Effect and mechanism of miR-146a on malignant biological behaviors of lung adenocarcinoma cell line. Oncol Lett. 2020;19(6):3643\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePang L, Lu J, Huang J, Xu C, Li H, Yuan G, et al. Upregulation of miR-146a increases cisplatin sensitivity of the non-small cell lung cancer A549 cell line by targeting JNK-2. Oncol Lett. 2017;14(6):7745\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Lu H, Sheng J, Li L. Inductive microRNA-21 impairs anti-mycobacterial responses by targeting IL-12 and Bcl-2. FEBS Lett. 2012;586(16):2459\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIacona JR, Lutz CS. miR-146a-5p: Expression, regulation, and functions in cancer. Wiley Interdiscip Rev RNA. 2019;10(4):e1533.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen G, Umelo IA, Lv S, Teugels E, Fostier K, Kronenberger P, et al. miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells. PLoS ONE. 2013;8(3):e60317.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W-M, Liu J-C. Effect and molecular mechanism of mir-146a on proliferation of lung cancer cells by targeting and regulating MIF gene. Asian Pac J Trop Med. 2016;9(8):806\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChauhan D, Davuluri KS. microRNAs associated with the pathogenesis and their role in regulating various signaling pathways during Mycobacterium tuberculosis infection. 2022;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Yue Y, Xu W, Xiong S. MicroRNA-146a represses mycobacteria-induced inflammatory response and facilitates bacterial replication via targeting IRAK-1 and TRAF-6. PLoS ONE. 2013;8(12):e81438.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlijani E, Rad FR, Katebi A, Ajdary S. Differential Expression of miR-146 and miR-155 in Active and Latent Tuberculosis Infection. Iran J public health. 2023;52(8):1749\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z, Zhou G, Deng X, Yu Q, Hu Y, Sun H, et al. Analysis of miRNA expression profiling in human macrophages responding to Mycobacterium infection: Induction of the immune regulator miR-146a. J Infect. 2014;68(6):553\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain D, Prajapati SK, Jain A, Singhal R. Nano-formulated siRNA-based therapeutic approaches for cancer therapy. Nano Trends. 2023;1:100006.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bbit","sideBox":"Learn more about [BMC Biotechnology](http://bmcbiotechnol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bbit/default.aspx","title":"BMC Biotechnology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"nano delivery, miR-146a, apoptosis, autophagy, lung cancer, tuberculosis","lastPublishedDoi":"10.21203/rs.3.rs-6454179/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6454179/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eTuberculosis (TB) and lung cancer (LC) are among the leading causes of death worldwide and present serious challenges in diagnosis and treatment. Therefore, developing new strategies for their treatment is crucial. MicroRNAs (miRNAs) are biological molecules that play a critical role in regulating essential processes, such as apoptosis and autophagy, in TB and LC by targeting specific genes. Recently, the use of carbon nanotubes functionalized with Polyethyleneimine (CNT-PEI) to deliver miRNAs to target cells has been investigated to enhance therapeutic effects.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eIn this study, miR-146a was transfected into LC (A549), macrophages infected with TB (THP1), and healthy lung cells (MRC5) using CNT-PEI. Then, the expression of miR-146a and its target genes, including \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, tumor necrosis factor-alpha (\u003cem\u003eTNFα\u003c/em\u003e), and TNF receptor-associated factor-6 (\u003cem\u003eTRAF6\u003c/em\u003e), were measured using Real-Time PCR. Finally, the effect of overexpression of miR-146a on these genes was investigated in all three cell lines.\u003c/p\u003e\u003ch2\u003eResult\u003c/h2\u003e \u003cp\u003eThe results showed successful transfection of miR-146a using the CNT-PEI nano delivery system in LC and TB cells. Then, increased expression of miR-146 increased apoptosis and autophagy by targeting the \u003cem\u003eTRAF6\u003c/em\u003e gene and affecting other genes such as \u003cem\u003eBCL-2\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, and \u003cem\u003eTNFα\u003c/em\u003e through the \u003cem\u003eNF-kB\u003c/em\u003e signaling pathway.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe findings suggest an important role for miR-146a in TB and LC, which regulates inflammatory responses and treats these diseases. However, further studies are needed on the use of CNT-PEI in vivo, as well as the balance between local anti-inflammatory and non-inflammatory factors.\u003c/p\u003e","manuscriptTitle":"Nano delivery of MiR-146a and its Effect Study on Genes Involved in Apoptosis and Autophagy Pathways in Lung Cancer and Tuberculosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-06 09:14:06","doi":"10.21203/rs.3.rs-6454179/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-13T05:46:27+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-06T18:10:56+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-06T09:36:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"188380386685085810750822085921684713622","date":"2025-05-03T17:20:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"117341589478660293764387239036806599908","date":"2025-05-03T06:45:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"65498852290696050757165935874459440218","date":"2025-05-01T22:03:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-30T23:53:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-28T06:42:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-26T09:18:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Biotechnology","date":"2025-04-26T09:17:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-biotechnology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bbit","sideBox":"Learn more about [BMC Biotechnology](http://bmcbiotechnol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bbit/default.aspx","title":"BMC Biotechnology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f89cae87-d67f-4947-b80d-87b8bb9b631d","owner":[],"postedDate":"May 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T15:58:18+00:00","versionOfRecord":{"articleIdentity":"rs-6454179","link":"https://doi.org/10.1186/s12896-025-01019-8","journal":{"identity":"bmc-biotechnology","isVorOnly":false,"title":"BMC Biotechnology"},"publishedOn":"2025-08-11 15:56:50","publishedOnDateReadable":"August 11th, 2025"},"versionCreatedAt":"2025-05-06 09:14:06","video":"","vorDoi":"10.1186/s12896-025-01019-8","vorDoiUrl":"https://doi.org/10.1186/s12896-025-01019-8","workflowStages":[]},"version":"v1","identity":"rs-6454179","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6454179","identity":"rs-6454179","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}