An optimization of supplements and physical factors for growth of hemocyte cell culture from Penaeus vannamei in selective medium | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article An optimization of supplements and physical factors for growth of hemocyte cell culture from Penaeus vannamei in selective medium Sivakumar Selvaraj, Kalaimani N This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1488767/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Optimization of cell culture medium was carried out with various supplements and physical factors for the growth of hemocyte cell cultures from Penaeus vannamei. Hemolymph-based shrimp culture medium (HBSCM-5 medium). Various concentrations of fetal bovine serum (FBS; 1–25%), shrimp muscle extract (SME; 1–25%) and basic fibroblast growth factor (bFGF; 0.5 to 5 ng mL -1) were attempted to optimize the media for the development of primary hemocyte cell culture of P. vannamei. 15% FBS was ideal for the healthy morphology of cells with rapid replication. SME supplementation at 5–20% supported the cell growth for 24 hours but only 30% of cell viability was observed after 48 hours. bFGF (0.5 to 5 ng mL -1) enhanced cell growth in the medium with 15% FBS; Cells were healthy at all concentrations of bFGF and showed enlarged fibroblast-like morphology. HBSCM-5 medium containing 15% FBS was prepared with various levels of osmolality (540 to 1470 ± 20 mOsm kg 1). The ideal pH level was examined by preparing the HBSCM-5 medium at pH between 6.8 and 8.0. Temperatures ranging from 20°C to 35°C and natural sea water (NSW) concentrations between 1% and 20% were also tested to determine their effect on cell growth and proliferation. Osmolality of 730 ± 20, pH of 7.2 and temperature of 28°C resulted in the healthy cells with good morphology. NSW supplement supported the cell growth at low concentrations of salt; however, at salt concentrations of more than 2%, cells did not form fibroblast-like morphology and instead a crystal-like morphology was observed. shrimp cell culture Penaeus vannamei optimizing culture media temperature salinity pH bFGF and HBSCM-5 medium. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Development of shrimp cell culture systems is a major challenge for the foremost researchers all over the world. For the successful development of cell line, culture media is the prime factor for survival of cells. Till now commercially available medium has been modified with permutation and combination to grow the primary cells (Jayesh et al., 2013 ). Several investigators attempted to develop the primary cell culture system; however, permanent shrimp cell lines were unsuccessful due to the lack of specific medium and supplements (Jiang et al. 2006 ;Claydon and Owens, 2008 ; Jose et al. 2012 ; Li et al. 2014 ). Based on these difficulties, the present study aimed to improve the media formulation to enhance the growth and proliferation of cells. Among various commercially available medium, L-15 media showed potential results in promoting the cell growth (Nadala et al., 1993 ; Mulford et al., 2000 ). Basic cell culture medium provides essential nutrients like salts, amino acids and vitamins for cell growth (Mothersill and Austin 2000 ). For successful development of the cell culture system, the osmolality, pH and temperature in the culture medium must also be known and based on the host conditions it needs to be optimized because these three physical parameters are vital for the in vitro cell culture development. Similarly, shrimp cells culture grow predominantly at the pH of hemolymph (7 to 8), thus ensuring the pH of the medium is within this range is essential for successful growth of cells (Hsu et al., 1995 ). The optimum water temperature for shrimp culture is between 25°C to 32°C (George and Dhar, 2010 ) and for the better growth of cells temperature within this range should be optimized. Apart from the physical parameters, the growth medium is often supplemented with various nutrients, tissue extracts, fetal bovine serum (FBS) and growth factors to promote cell proliferation (Mitsuhashi, 2001 ). These supplements are selected based on the salt, amino acid, sugar and lipid profile of hemolymph of the specific species being studied. The basal composition of media, including proteins, lipids, carbohydrates, vitamins, amino acids, tissue extract and growth factors, are selected by trial and error by applying various combinations of supplements (Jayesh, 2012). Many reports indicated that FBS at 5–20% is essential for cell replication, but it fails to provide complex nutrients like hormones and growth factors that are needed for shrimp cells to grow. Epidermal growth factor (EGF) in the media at 20ng mL − 1 promotes cell proliferation and increases the survivability of lymphoid tissue cells of P. stylirostris (Tapay et al., 1995 ). The greatest advantages in developing a cell culture system are rapidity in forming a monolayer and maintaining a uniform cell number in the culture plate, both of which are essential for most application studies (Jose et al., 2010 ). The present study aimed to optimize the cell culture medium with various supplements, growth factor and physicochemical factors for growth of hemocyte cell culture from P.vannamei (White shrimp). Material And Methods Shrimp acclimation and tissue dissection Apparently healthy P.vannamei weighing approximately 5 to 10 g were sourced from local suppliers in and around Chennai, Tamil Nadu, India. They were acclimatized and maintained in a wet lab facility at ICAR-Central Institute of Brackishwater Aquaculture, Chennai. All animals were maintained hygienically in clean 250 L fiber-reinforced plastic (FRP) tanks with adequate aeration (Salinity 28 ± 2 ‰; temperature 30°C ± 2°C). P.vannamei were fed with commercially available pellet feed and maintained with a water exchange system. Animals were kept in the laboratory in sterile seawater for three days; every day the water was fully exchanged with sterile sea water to reduce the microbial load. Prior to sampling, the animals were surface disinfected with 70% alcohol prepared in sterile sea water. After surface sterilization, 1 mL of hemolymph was collected aseptically fromthe ventral sinus located at the base of the third abdominal segment using a 2 mL syringe containing 1 mL of modified Alsever’s solution (27 mM Na citrate, 336 mM NaCl, 115 mM Glucose and 9 mM EDTA and made upto 100 mL using sterile de-ionized water) and mixed well. The samples were increased to 10 mL with L-15 basal medium, then mixed well and stored immediately in ice for 5 to 10 minutes. The cells were pelleted by centrifugation at 200 xg for 10 minutes at 25°C and resuspended in selective medium, then seeded in 12-well plates (5×10 3 cells/well) (Nunc, Denmark) and incubated at 28°C. The hemolymph-based shrimp culture medium (HBSCM-5) is composed of L-15 medium with 15% FBS (Sigma-Aldrich, USA) and 1x antibiotic mixture (Penicillin 1,000IU/ml, Streptomycin 1,000µg/ml, Gentamicin 250µg/ml and Amphotericin B250µg/ml (Life Technologies, USA). The medium was formulated based on the hemolymph component of P.vannamei and prepared as per the method described by Sivakumar et al. (2019). The pH was adjusted to 7.2 and osmolality was adjusted to the hemolymph osmolality (730 ± 20 mOsm kg 1 ). The medium was filtered using a 0.2 µm filter on a vacuum pump, then incubated at room temperature for 24 hours to check contamination and stored at 4ºC for further use. Effect of fetal bovine serum (FBS) The hemolymph-based shrimp culture medium (HBSCM-5) medium was combined with six different concentrations of FBS (1, 5, 10, 15, 20 and 25%, Sigma-Aldrich, USA). The collected hemocyte cells were seeded in each of the different concentrations of FBS with the medium at a concentration of 5× 10 3 cells/12 well culture plate. The prepared individual medium was screened for cell growth and incubated at 28°C. Effect of osmolality (mOsm) Modified HBSCM-5 media have shown osmolality levels ranging from 400 to 550 mOsm kg 1 . To increase the osmolality to that of the hemolymph of P.vannamei, a 25% solution of Sodium chloride was added to the HBSCM-5 medium. HBSCM-5 media with different osmolalities such as 540, 730, 870, 1075, 1270 and 1470 ± 20 mOsm kg 1 were prepared and screened. Sodium chloride is the preferred compound used to adjust the osmolality to that of hemolymph of animals (Mulford and Austin 1998; Mulford etal., 2000). Effect of pH pH is an important physical parameter essential for cell growth. The pH of the hemolymph of P. vannamei was 6.68. In this study, HBSCM-5 medium at 730 ± 20 mOsm kg 1 containing 1x antibiotic and antimycotic solution with 15% FBS was adjusted to four different pH levels (6.8, 7.2, 7.5 and 8.0) to determine the effect of different pH levels on cell growth, cell viability and morphological changes. Effects were observed under an inverted microscope at 20x magnification. Effect of temperature ( 0 C ) Temperature is another important physical parameter essential for cell growth. Hemocyte cells, incubated with HBSCM-5 medium at osmolality 730 ± 20 mOsm kg 1 ,pH 7.2 with 15% FBS at five different temperatures (20, 24, 28, 32, 35°C) were screened. Effect of natural sea water (NSW ‰ ) Six different concentrations of natural sea water (NSW; 01, 02, 05, 10, 15 and 20‰, were added to HBSCM-5 medium withpH 7.2 with 15% FBS. The hemocyte cells were seeded into the 12-well culture plate at concentration of (5×10 3 cells/well) and then incubated at 28°C for 48 hours. Effect of shrimp muscle extract (SME) Healthy specimens of P.vannamei weighing approximately 10 g were sampled to obtain fresh gill and muscle tissue, which was then homogenized in 100 mL of sterile L-15 medium. The blended mixture was centrifuged at 5,000 xgfor 30 minutes at 4°C. The top layer was collected and again centrifuged at 13,000xgfor 15 minutes at 4°C. The supernatant was filtered through 0.45µm paper (Millipore, USA) and stored at -70°C until further use. Different concentrations (01, 02, 05, 10, 20 and 25%) of shrimp muscle extract were added into the HBSCM-5 medium. The hemocyte cells were seeded into the 12-well culture plate at concentration of (5×10 3 cells/well) and the cells were incubated at 28°C for 48 hours. The cell morphology was observed at 20x magnification in inverted microscopy. Effect of basic fibroblast growth factor (bFGF) Basic fibroblast growth factor (bFGF) in various concentrations (0.5, 1, 3 and 5 ngmL -1 of bFGF) were added to the HBSCM-5 medium with 15% FBS. The hemocyte cells were seeded into the 12-well plates at a concentration of (5×10 3 cells/well) and the cells were incubated at 28°C for 48 hours. The cell morphology was observed at 20x magnification in inverted microscopy. Molecular identification of cell origin The DNA was extracted from primary monolayer cells of hemocyte from P.vannamei and PCR was carried out (Sivakumar et al., 2019). The fragments of the cytochrome c oxidase subunit I (COI) genes were amplified using universal primers F 5′ TCAACCAACCACAAAGACATTGGCAC 3′ and R 5′ TAGACTTCTGGGTGGCCAAAGAATCA 3′. The PCR products of the fragments were sequenced by an ABI 3730 DNA analyzer (Applied Biosystems). The sequences of the mtDNA gene fragments were compared with the published and known sequences in the National Centre for Biotechnology database by the basic local alignment search tool (BLAST). Results Due to increase in viral diseases, prophylaxis, and lack of treatment due to non-availability of specific treatment for the respective disease, studies on the improvement in the shrimp cell culture system became significant. The potential for optimizing the medium used for hemocyte cell culture growth of P.vannamei by adding different supplements, including fetal bovine serum, shrimp muscle extract, natural sea water, and basic fibroblast growth factor was explored . Cell culture growth in the optimized medium at different levels of osmolality, pH and temperature was also observed.When the optimized medium was used, in vitro proliferation of hemocyte of P.vannamei was significant and found to adhere within six hours and confluent monolayer formation was achieved within 24-48 hours of plating. This monolayer culture was maintained, and healthy cells have shown prominent morphological characteristics. Fibroblast-like and round cells of hemocytes with higher growth and multiplicity were observed in the HBSCM-5 medium. Effect of pH Growth patterns were recorded under different pH levels. At pH 7.2 a large number of healthy cells with good morphology were observed after 24 hours of incubation. Formation of cell debris and granulation were observed at pH 7.5 and 8.0, which consequently resulted in cell lysis after 48 hours (Fig.1. A1-A5). Decreased cell viability and poor attachment were recorded below pH 6.8. Effect of temperature Hemocyte cell observations have shown that the cells incubated at 28°C were healthy, forming a confluent monolayer and fibroblast-like and round morphology (Fig.1. B1-B5). Incubation at 20°C and 24°C resulted in less cell adherence, no prominent formation of a confluent monolayer and cells were not healthy. At 32°C and 35°C the cells were partially attached in the culture plate, lost their original morphology and were lysed within 48 hours. Effect of Osmolality (mOsm) Osmolality of 730 ± 20 mOsm kg 1 , previously found to be the optimal range for hemocyte cell culture, resulted in confluent monolayer formation and observation of intact fibroblast-like and round morphology. When the osmolality was increased from 730 ± 20 mOsm kg 1 to 1470 ± 20 mOsm kg 1 , the morphology of the cells changed to crystal-like formation, which resulted in decreased viability. The medium color also changed from pink to brown and cell clumping occurred. Similarly, when the osmolality of the medium was decreased 540 mOsm kg 1 , the cells were not healthy and a confluent monolayer formed and also did not form a fibroblast-like morphology in HBSCM-5 medium with 540± 20 mOsm kg 1 (Fig.2. A1-A6). Effect of basic fibroblast growth factor (bFGF) Cells were attached uniformly at all concentrations in the range between 0.5 and 5 ng/mL -1 , forming a confluent monolayer and fibroblast-like morphology. Healthy elongated cells were observed after 48 hours (Fig.2. B1-B6). Effect of fetal bovine serum (FBS) Poor adherence was observed while using 1% and 5% FBS, and the cells were not healthy. Rapid cell proliferation was recorded at 10% to 20% FBS. Optimal growth was observed at 15% to 20%, which resulted in 90% adherence of seeded cells with noticeable formation of a complete monolayer and good cell viability. At 25% FBS, cell growth was inhibited (Fig.3. A1-A6). Effect of concentration of natural sea water (NSW ‰ ) Supplementing the HBSCM-5 medium with NSW concentrations greater than 5‰, resulted in rapid attachment of cells, but cell clumping was also observed (Fig.3. B1-B6). Initially there was a change in the color of the medium within 24 hours and cell morphology became crystal-like. At 2‰, NSW, a group of crystals-like cells with reduced viability formed. Most of the cells were floating after 48 hours and did not form fibroblast-like morphology in HBSCM-5 medium with a 5 to 20‰of NSW. Effect of shrimp muscle extracts (SME) Cells were not attached at 0% or 1% SME. At 5%, 10% and 20% SME the cells adhered very rapidly, and fibroblast-like cell morphology and healthy cells were observed (Fig.4. A1-A6). At 25% SME, the cell growth was inhibited, and cell lysis was observed after 24 hours. Even though 5%, 10% and 20% SME initially promoted cell growth, the cells were completely lysed within 2 to 3 days (Fig.4. B1-B6). Molecular identification of the cell line Molecular identification of cell origin was performed by amplification of the COI mitochondrial DNA. Comparative analysis of the sequences revealed a match of 99% for COI to known P.vannamei hemocyte cell mitochondrial DNA sequences. These sequences thus confirmed that primary hemocyte cells were derived from P.vannamei . These sequences have been submitted to the GenBank with accession number KY564433 (Sivakumar et al.2019). Discussion Generally, crustacean primary cell culture would not survive for more than five days in the basal medium and the addition of appropriate nutrient supplements is essential for cell proliferation (Hsu et al., 1995 ). In order to enhance the growth of the cells from P.vannamei previous studies screened various supplements with one or more combinations (Table 2). This study optimized HBSCM-5 medium with various supplementary nutrients, including fetal bovine serum, shrimp muscle extract, natural sea water and basic fibroblast growth factor to explore their ability to promote cell growth. The optimum medium was also prepared at different osmolalities, pH levels and temperatures to explore their effect on cell growth. Proper maintenance of pH in culture media is very essential for the growth of cells. Shrimp are highly sensitive to changes in pH and mortality occurs when the pH is lowered below 6.8 (Han et al., 2013 ). This was in line with our present study where at 6.5 pH there was a seizure in cell growth. Since the pH of hemolymph was found to be 6.68, the media prepared with pH ranging from 6.8 to 7.2 resulted in clear media without any precipitation and supported better growth of cells. This is similar to many previous studies that suggested an optimum pH range of 6.8 to 7.6 (Toullec et al. 1996 ; Maeda et al. 2003 ; Zeng et al. 2010 ; Han et al. 2013 ; Jayesh et al. 2013 ; Li et al. 2014 ). Temperature plays a vital role in the survival and morphology changes and healthy cells of hemocyte. In our study the optimum temperature was 28°C, which resulted in the formation of a confluent monolayer of cells and intact fibroblast-like and round morphology, both of which concur with the results observed by Goswami et al., ( 2010 ). Osmotic pressure is another important physical parameter to be considered for the growth of cells, which not only affects cell proliferation but also the metabolites produced. In this study, promising growth and intact cell morphology were observed at 730 ± 20 mOsm kg 1 osmolality. A previous study had shown better growth at osmolalities between 470 mOsm kg 1 and 770 mOsm kg 1 (Li et al., 2014 ). In our study, the osmolality range where maximum growth was achieved is in concurrence with the osmolality of hemocyte cells that was previously measured in the hemolymph sample. In our study, the addition of NSW in the medium as a supplement did not assist in the growth and proliferation of cells. Earlier studies have also shown L-15 medium supplemented with NSW had poor buffering capacity (Sashikumar and Desai, 2008 ). FBS is the most common and widely used supplement added to enhance cell growth. FBS contains high levels of embryonic growth promoting factors and components that have been shown to satisfy the metabolic requirements of cells during culture (Jayesh et al., 2012 ). Additionally, hydrocortisone present in FBS was found to promote cell attachment and the growth hormone somatomedin has been observed to have a mitogenic effect (Freshney, 2005). In the present study, FBS used at concentrations between 10% and 20% showed better growth and proliferation of cells, but when increased to 25%, FBS inhibited the cell growth. This is in agreement with earlier reports that also explored the effect of FBS (Kasornchandra et al., 1999 ; Goswami et al., 2010 ). Some studies reported that 20% FBS highly promoted the cell growth (Kasornchandra et al., 1999 ; Jiang et al., 2006 ; Jose et al., 2011 ). Usage of 10% FBS has also shown improved cell growth (Maeda et al. 2003 ; George and Dhar, 2010 ). Hemocyte cell attachment and proliferation was observed with SME supplementation in HBSCM-5 medium. Even though the cells were healthy morphology observed. Hemocyte cells had good morphology in the medium containing only SME (no FBS), after which the cells got lysed within 48 hours. When 20% SME was incorporated in the medium, cell growth was inhibited. This may be due to the presence of an inhibitory substance in SME. This is also in agreement with the study by (Fraser and Hall, 1999 ; Luedeman and Lightner, 1992 ). In contrast, SME prepared from juvenile shrimp had a beneficial effect on the growth and proliferation of hemocytes and ovaries (George and Dhar, 2010 ). Growth factors are vital elements essential to maintain normal cellular activities. In the present study, all concentrations of bFGF in the medium enhanced the cell growth. Enlarged morphology of the cells was observed when compared with normal cells. bFGF binds to the heparin-like molecule situated in the extracellular matrix of the endothelial cells, thus stimulating cell proliferation and differentiation (Ma et al., 2017 ). Similarly, a high concentration of bFGF will down-regulate the bFGF receptor and induce cell transformation. According to a previous report addition of bFGF stimulated cell growth and able to withstand passage for 90 times in the lymphoid culture (Hsu et al., 1995 ). Conclusion The hemocyte cell culture was optimized for use as an in vitro cell culture system by testing cell growth on HBSCM-5 medium with various supplements, growth factors and physical parameters. Hemocyte culture was optimized for supplements including fetal bovine serum, shrimp muscle extract, and basic fibroblast growth factor, as well as physico-chemical factors including pH, temperature, osmolality and natural sea water concentration. Based on the cell morphology, growth and tendency for cell proliferation and also cell viability were observed. An optimized media with known concentrations of supplements, growth factors and also physico-chemical factors will be significant for a researcher. The in vitro hemocyte cell culture system grown in our study would be useful for further research and for developing an immortal cell line and specific culture medium. Declarations Acknowledgments The authors thank the Director of ICAR-CIBA for financial support. The authors acknowledge the financial support from the ICAR, ICAR-Central Institute of Brackish water Aquaculture for providing the necessary facilities. Funding Info This research work received no external funding. author- ship, and/or publication of this article Conflict-of-interest statement The authors declare no conflict of interest to research. We certify that the submission is original work and is not under review at any other publication. Ethics statement Not applicable for shrimp cell culture Consent to participate Not applicable Author Contributions Conceived and designed the experiments: Dr.N.Kalaimani, and performed the experiments and wrote the Manuscript: Dr.S. Sivakumar. References Claydon K, Owens L (2008) Attempts at immortalization of crustacean primary cell cultures using human cancer genes. In Vitro Cell Dev Biol 44:451–457 Fraser CA, Hall MR (1999) Studies on primary cell cultures derived from ovarian tissue of Penaeus monodon . Methods Cell Sci 21:213–218 Freshney RI (2015) Culture of animal cells: a manual of basic technique and specialized applications. John Wiley & Sons. George SK, Dhar AK (2010) An improved method of cell culture system from eye stalk, hepatopancreas, muscle, ovary, and hemocytes of Penaeus vannamei . In Vitro Cell Dev Biol Anim 46:801–810 George SK, Kaizer KN, Betz YM, Dhar AK (2011) Multiplication of Taura syndrome virus in primary hemocyte culture of shrimp ( Penaeus vannamei ). J Virol Methods 172(1–2):54–59 Goswami M, Lakra WS, Rajaswaminathan T, Rathore G (2010) Development of cell culture system from the giant freshwater prawn Macrobrachium rosenbergii (de Man). Mol Biol Rep 37:2043–2048 Han Q, Li P, Lu X, Guo Z, Guo H (2013) Improved primary cell culture and subculture of lymphoid organs of the greasyback shrimp Metapenaeus ensis . Aquaculture 410:101–113 Hsu YL, Yang YH, Chen YC, Tung MC, Wu JL, Engelking MH, Leong JC (1995) Development of an in vitro subculture system for the oka organ (Lymphoid tissue) of Penaeus monodon . Aquaculture 136:43–55 Jayesh P, Jose S, Philip R, Bright Singh IS (2013) A novel medium for the development of in vitro cell culture system from Penaeus monodon . Cytotechnology 65:307–322 Jayesh P, Seena J, Singh ISB (2012) Establishment of Shrimp Cell Lines: Perception and Orientation. Indian J Virol 23:244–251 Jiang YS, Zhan WB, Wang SB, Xing J (2006) Development of primary shrimp hemocyte cultures of Penaeus chinensis to study white spot syndrome virus (WSSV) infection. Aquaculture 253:114–119 Jose S, Mohandas A, Philip R, Bright Singh IS (2010) Primary hemocyte culture of Penaeus monodon as an in vitro model for white spot syndrome virus titration, viral and immune related gene expression and cytotoxicity assays. J Invertebr Pathol 105:312–321 Jose S, Jayesh P, Mohandas A, Philip R, Bright Singh IS (2011) Application of primary haemocyte culture of Penaeus monodon in the assessment of cytotoxicity and genotoxicity of heavy metals and pesticides. Mar Environ Res 71:169–177 Jose S, Jayesh P, Sudheer NS, Poulose G, Mohandas A, Philip R, Bright Singh IS (2012) Lymphoid organ cell culture system from Penaeus monodon (Fabricius) as a platform for white spot syndrome virus and shrimp immune-related gene expression. J Fish Dis 35:321–334 Kasornchandra J, Khongpradit R, Ekpanithanpong U, Boonyaratpalin S (1999) Progress in the development of shrimp cell cultures in Thailand. Methods Cell Sci 21:231–235 Li W, Nguyen VT, Corteel M, Dantas-Lima JJ, Van Thuong K, Van Tuan V, Bossier P, Sorgeloos P, Nauwynck H (2014) Characterization of a primary cell culture from lymphoid organ of Litopenaeus vannamei and use for studies on WSSV replication. Aquaculture 433:157–163 Li W, Van Tuan V, Van Thuong K, Bossier P, Nauwynck H (2015) Eye extract improves cell migration out of lymphoid organ explants of L. vannamei and viability of the primary cell cultures. In Vitro Cell Dev Biol -Anim 51:651–654 Luedeman R, Lightner DV (1992) Development of an in vitro primary cell culture system from the penaeid shrimp, Penaeus stylirostris and Penaeus vannamei . Aquaculture 101:205–211 Ma J, Zeng L, Lu Y (2017) Penaeid shrimp cell culture and its applications. Rev Aquac 9:88–98 Maeda M, Mizuki E, Itami T, Ohba M (2003) Ovarian primary tissue culture of the kuruma shrimp Marsupenaeus japonicus . Vitro Cell Dev Biol - Anim 39:208–212 Mitsuhashi J (2001) Development of highly nutritive culture media. In-Vitro Cell Dev Biol - Anim 37:330–337 Mothersill C, Austin B (2000) Aquatic Invertebrate Cell Culture. Springer,book Mulford AL, Austin B (1998) Development of primary cell cultures from Nephrops norvegicus . Methods Cell Sci 19:269–275 Mulford AL, Lyng F, Mothersill C, Austin B (2000) Development and characterization of primary cell cultures from the hematopoietic tissues of the Dublin Bay prawn, Nephrops norvegicus . Methods Cell Sci 22:265–275 Nadala EC, Loh PC, Lu PC (1993) Primary culture of lymphoid, nerve, and ovary cells from Penaeus stylirostris and Penaeus vannamei . In Vitro Cell Dev Biol Anim 29A:620–622 Sashikumar A, Desai PV (2008) Development of primary cell culture from Scylla serrata . Cytotechnology 56:161–169 Sivakumar S, Swaminathan TR, Anandan R, Kalaimani N (2019) Medium optimization and characterization of cell culture system from Penaeus vannamei for adaptation of white spot syndrome virus (WSSV). J Virol Methods 270:38–45 Tapay LM, Lu Y, Brock JA, Nadala EC, Loh PC (1995) Transformation of primary cultures of shrimp ( Penaeus stylirostris ) lymphoid (Oka) organ with Simian virus-40 (T) antigen. Proc. Soc. Exp. Biol. Med. 209, 73–78 Toullec JY, Crozat Y, Patrois J, Porcheron P (1996) Development of Primary Cell Cultures from the Penaeid Shrimps Penaeus vannamei and P. indicus . J Crustac Biol 16:643–649 Vieira-Girao PRN, Falcao CB, Rocha IRCB, Lucena HMR, Costa FHF, Rádis-Baptista G (2017) Antiviral activity of Ctn [15–34], A cathelicidin-derived eicosapeptide, against infectious myonecrosis virus in Litopenaeus vannamei primary hemocyte cultures. Food Environ Virol 9:277–286 Zeng H, Ye H, Li S, Wang G, Huang J (2010) Hepatopancreas cell cultures from mud crab, Scylla paramamosain . In-Vitro Cell Dev Biol - Anim 46:431–437 Tables Table 1. Supplement and physical factor combinations tested on HBSCM-5 medium and associated observations. No Supplement and/or Physical factor Observations 1 1% FBS Very few cells attached 2 5% FBS Partial cell attachment but no replication 3 HBSCM-5 medium with 10% FBS Cell proliferation 4 HBSCM-5 medium with 15% FBS Rapid proliferation and healthy cells 5 HBSCM-5 medium with 20% FBS Proliferation and healthy cells 6 HBSCM-5 medium with 25% FBS Cell attachment but no replication 7 HBSCM-5 medium with 15% FBS and 0.5 ng mL -1 bFGF Rapidly attachment and enlarged the cell morphology was observed 8 HBSCM-5 medium with 15% FBS and 1 ng mL -1 of bFGF Rapidly attachment and enlarged the cell morphology was seen 9 HBSCM-5 medium with 15% FBS and 3 ng mL -1 of FGF Rapidly attachment and enlarged the cell morphology was observed 10 HBSCM-5 medium with 15% FBS and 5 ng mL -1 of FGF Rapidly attached and enlarged the cell morphology was seen 11 HBSCM-5 medium with 15% FBS and 540 ± 20 mOsm kg 1 Cells attached but most of the cells showed round morphology 12 HBSCM-5 medium with 15% FBS and 730 ± 20 mOsm kg 1 Rapid cell attachment, fibroblast-like morphology and cell proliferation was observed 13 HBSCM-5 medium with 15% FBS and 870 ± 20 mOsm kg 1 Cells attachment, medium color changed and cells formed clump was observed 14 HBSCM-5 medium with 15% FBS and 1075 ± 20 mOsm kg 1 Cells attachment, medium color changed and cells formed mass clump was observed 15 HBSCM-5 medium with 15% FBS and 1270 ± 20 mOsm kg 1 Medium color changed and most of the cells formed like-cluster were seen 16 HBSCM-5 medium with 15% FBS and 1470 ± 20 mOsm kg 1 Medium color also changed and most of the cells formed -mass cluster. 17 HBSCM-5 medium with 15% FBS and pH 6.8 Cells attached but most of the cells got lysis within 24 hours 18 HBSCM-5 medium with 15% FBS and pH 7.2 Rapid cell attachment, healthy cells and good morphology and proliferation was observed 19 HBSCM-5 medium with 15% FBS and pH 7.5 Less cells attachment and cells got lysis within 2 days 20 HBSCM-5 medium with 15% FBS and pH 8.0 Few cells attached, proliferation not seen and cells got lysis within 2 days 22 HBSCM-5 medium with 15% FBS and 20ºC temperature few cells attached and cell proliferation was not seen 23 HBSCM-5 medium with 15% FBS and 24ºC TM Very less cells attached and cell proliferation was not observed 24 HBSCM-5 medium with 15% FBS and 28ºC TM Rapid cells attachment 25 HBSCM-5 medium with 15% FBS and 32ºC TM Cells partially attachment and cells got lysis 26 HBSCM-5 medium with 15% FBS and 35ºC TM Few cells attached and no further progress 27 HBSCM-5 medium with 01% SME Only few cells attached 28 HBSCM-5 medium with 05% SME Some cells attached and no further cell proliferation 29 HBSCM-5 medium with 10% SME Moderately attachment the cells and cell proliferation was observed 30 HBSCM-5 medium with 15% SME Rapid attachment, healthy cell morphology and proliferation was observed, after 48 hrs the cells got lysis completely 31 HBSCM-5 medium with 20% SME Healthy and proliferation of cells was observed, after 48 hrs cells got lysis completely 32 HBSCM-5 medium with 25% SME Less cells attached and inhibited the cell growth and cells got lysis within 48 hrs 33 HBSCM-5 medium with 15% FBS and 1‰ NSW Cell proliferation was observed 34 HBSCM-5 medium with 15% FBS and 2‰ NSW Proliferation of cells seen 35 HBSCM-5 medium with 15% FBS and 5‰ NSW Most of the cells showed round type morphology 36 HBSCM-5 medium with 15% FBS and 10‰ NSW The medium color changed and clump of cells was seen 37 HBSCM-5 medium with 15% FBS and 15‰ NSW The medium color changed and mass clump of cells was seen 38 HBSCM-5 medium with 15% FBS and 20‰ NSW The medium color changed and mass clump of cells was seen Table 2: Various studies carried out in P.vannamei. to develop the primary cell culture S.NO Authors Different Tissues Media Supplements Osmolality TEM PH Cell culture/ growth 1 Luedeman and Lightner, 1992 Ovary Grace’s sect medium 10% FBS 700-750 25°C 28°C 6.8-7.2 80% confluence formed within a 2-day period 2 Nadala et al., 1993 Oka cells 2x L-15 medium 20% FBS & 8%SME and 20ng/ml EGF 750-770 25°C proper pH is essential Found to markedly enhance cell growth. Cells which used to take 2 weeks to form a monolayer. 3 Toullec et al., 1996 Grace’s insect medium 10% FBS 750-760 29°C 7.0 Developed primary cell culture maintained up to 2 weeks 4 George and Dhar, 2010 Hemocytes and various tissues Grace's insect medium 10% FBS and 10% SME 730± 10 26°C and 28°C - Improved methods of cell culture from eye stalk, hepatopancreas, muscle, ovary, and hemocytes of shrimp Penaeus vannamei 5 George et al., 2011 Hemocytes 2× Grace’s Insect Medium 10% FBS and 10% SME 730± 10 27°C - Hemocytes primary cell culture developed from Penaeus vannamei 6 Li et al., 2014 Lymphoid organ 2× L-15 medium 20% FBS 900 ± 20 27°C 7.5 Promoted the migration of cells from the explants and cell survival. 600 μg/ml cholesterol and 1000 μg/ml L-glutathione (GSH) both enhanced cell survival and performance in vitro. 7 Li et al., 2015 Lymphoid organ 2× L-15 medium 20% FBS & 10% of eye extract 900 ± 20 27°C 7.5 10% of eye extract or 3% of ovary extract to cells for the maximal health of primary cell cultures from the lymphoid organ of P. vannamei. 8 Vieira-Gira’ et al.,2017 Hemocytes 2x L-15medium 20% FBS and 2% glucose 720 29°C - These hemocytes remained viable for at least 8 days with a slight increase in viability on that period. Supplementary Files Highlights.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major Revisions Needed 08 Jun, 2022 Reviewers agreed at journal 20 May, 2022 Reviews received at journal 14 Apr, 2022 Reviewers invited by journal 14 Apr, 2022 Editor assigned by journal 08 Apr, 2022 First submitted to journal 25 Mar, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1488767","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":98636481,"identity":"c53fb7e6-4ccd-4fa6-bc80-7c3ab331a6d7","order_by":0,"name":"Sivakumar Selvaraj","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYDACZgYGxgYGBh4gk/EBkODhI0ULswFICxsxFoG0gACbBJgkpFy+ncfw44w/22T4Zx8+Vvk1x06GjYH54aMbeLQYHOYxltzYdptH4lxa2m3ZbclAh7EZG+fg08LMliD5sOE2jwEPj9ltyW3MQC08bNL4tMg3syX/fPAHoqVYcls9YS0Mh5mPSW5gg2hh/LjtMGEtBkAtljNBfjnDlizNuO04DxszAb/I9x9svtnz57Y9fw/zwY8/t1Xb87M3P3yM12HIgJkHTBKrHAQYf5CiehSMglEwCkYMAABgqkCASzOSMQAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0533-5830","institution":"ICAR - CIBA: ICAR - Central Institute of Brackishwater Aquaculture","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Sivakumar","middleName":"","lastName":"Selvaraj","suffix":""},{"id":98636482,"identity":"e3f73ba7-7bbe-4762-b834-900bb0639844","order_by":1,"name":"Kalaimani N","email":"","orcid":"","institution":"ICAR - Central Institute of Brackishwater Aquaculture","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kalaimani","middleName":"","lastName":"N","suffix":""}],"badges":[],"createdAt":"2022-03-25 10:42:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1488767/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1488767/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":20504116,"identity":"6a0dcc3f-0211-411d-93dd-c926ea1b9b1d","added_by":"auto","created_at":"2022-04-19 14:27:07","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1291576,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003e Hemocyte cells grown in HBSCM-5 medium supplemented with 15% FBS and prepared at different pH levels. Cells grown at pH levels of 6.8, 7.2, 7.5 and 8.0 are depicted in A1-A5, respectively. B) Hemocyte cells grown in HBSCM-5 medium supplemented with 15% FBS and incubated at different temperatures. Cells grown at temperatures of 20ºC, 24ºC, 28ºC, 32ºC and 35ºC are depicted in B1-B5, respectively.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/25e4767625fe169cba41c915.png"},{"id":20504115,"identity":"9b17b72e-bb8e-4d07-b2bf-b25894d10c9b","added_by":"auto","created_at":"2022-04-19 14:27:07","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2126795,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003e Hemocyte cells grown in HBSCM-5 medium supplemented with 15% FBS and prepared at different osmolalities. Cells grown with 540, 730, 870, 1075, 1270 and 1470 ± 20 mOsm kg\u003csup\u003e1\u003c/sup\u003e are depicted in A1-A6, respectively. B) Hemocyte cells grown in HBSCM-5 medium supplemented with 15% FBS and different concentrations of bFGF.\u0026nbsp;Cells grown at bFGF concentrations of 0, 0.5, 1, 3 and 5 ng /mL\u003csup\u003e-1\u003c/sup\u003e are shown in C1-C5, respectively. All cells were observed after 48 hours of incubation using inverted phase contrast microscopy at 20X magnification.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/30cc5fccb43e44b15b9cb9d2.png"},{"id":20504113,"identity":"c4202121-04de-4cd9-b9b9-c21502b1926f","added_by":"auto","created_at":"2022-04-19 14:27:07","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2030390,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA)\u003c/strong\u003e Hemocyte cells grown in HBSCM-5 medium with supplemented various concentrations of FBS. Cells grown with FBS concentrations of 2%, 5%, 10%, 15%, 20% and 25% are depicted in A1-A6, respectively. Hemocyte cells grown in HBSCM-5 medium supplemented with 15% FBS and prepared with different concentrations of NSW. Cells grown with NSW concentrations of 1‰, 2‰, 5‰, 10‰, 15‰ and 20‰ are shown in B1-B6, respectively.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/3f09778633bd5db5818f12a1.png"},{"id":20504948,"identity":"f471df02-b16f-4e27-bce7-faa3ddafb2d0","added_by":"auto","created_at":"2022-04-19 14:32:07","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1999383,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eB).\u003c/strong\u003e Hemocyte cells cultured in HBSCM-5 medium supplemented with various concentrations of shrimp muscle extract (SME). Cells grown in SME concentrations of 1%, 2%, 5%, 10%, 20% and 25% are depicted after 24 hours of incubation in B1-B6, respectively, and after 48 hours of incubation in C1-C6.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/4259f469f93f5183b56c2def.png"},{"id":20504119,"identity":"ba6d66fe-2154-4a3d-aba1-1cbf940f4591","added_by":"auto","created_at":"2022-04-19 14:27:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":68668,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of pH, Temperature and Osmolality showed cells viability/ml\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/a5e6a39893f6fc7d68047d6a.png"},{"id":20505578,"identity":"e3b62398-bc85-4fb4-a45d-e0cfd0a96c4c","added_by":"auto","created_at":"2022-04-19 14:37:07","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":99517,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of SME, FBS, bFGF and NSW showed cells viability/ml\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/873ab999599378161c3523c3.png"},{"id":20505583,"identity":"bed533a5-40e8-439c-a1e8-4eff4736ec78","added_by":"auto","created_at":"2022-04-19 14:37:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":579649,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/372e96c9-ee62-4a51-866e-232268a91c95.pdf"},{"id":20504114,"identity":"b4245830-09f9-4aec-8c65-1c41f8c94b9d","added_by":"auto","created_at":"2022-04-19 14:27:07","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15503,"visible":true,"origin":"","legend":"","description":"","filename":"Highlights.docx","url":"https://assets-eu.researchsquare.com/files/rs-1488767/v1/b7c3d69e89c5c32a94b0b1f5.docx"}],"financialInterests":"","formattedTitle":"An optimization of supplements and physical factors for growth of hemocyte cell culture from Penaeus vannamei in selective medium","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDevelopment of shrimp cell culture systems is a major challenge for the foremost researchers all over the world. For the successful development of cell line, culture media is the prime factor for survival of cells. Till now commercially available medium has been modified with permutation and combination to grow the primary cells (Jayesh et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Several investigators attempted to develop the primary cell culture system; however, permanent shrimp cell lines were unsuccessful due to the lack of specific medium and supplements (Jiang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2006\u003c/span\u003e;Claydon and Owens, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Jose et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Based on these difficulties, the present study aimed to improve the media formulation to enhance the growth and proliferation of cells. Among various commercially available medium, L-15 media showed potential results in promoting the cell growth (Nadala et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Mulford et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Basic cell culture medium provides essential nutrients like salts, amino acids and vitamins for cell growth (Mothersill and Austin \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). For successful development of the cell culture system, the osmolality, pH and temperature in the culture medium must also be known and based on the host conditions it needs to be optimized because these three physical parameters are vital for the in vitro cell culture development. Similarly, shrimp cells culture grow predominantly at the pH of hemolymph (7 to 8), thus ensuring the pH of the medium is within this range is essential for successful growth of cells (Hsu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). The optimum water temperature for shrimp culture is between 25\u0026deg;C to 32\u0026deg;C (George and Dhar, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and for the better growth of cells temperature within this range should be optimized.\u003c/p\u003e \u003cp\u003eApart from the physical parameters, the growth medium is often supplemented with various nutrients, tissue extracts, fetal bovine serum (FBS) and growth factors to promote cell proliferation (Mitsuhashi, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). These supplements are selected based on the salt, amino acid, sugar and lipid profile of hemolymph of the specific species being studied. The basal composition of media, including proteins, lipids, carbohydrates, vitamins, amino acids, tissue extract and growth factors, are selected by trial and error by applying various combinations of supplements (Jayesh, 2012). Many reports indicated that FBS at 5\u0026ndash;20% is essential for cell replication, but it fails to provide complex nutrients like hormones and growth factors that are needed for shrimp cells to grow. Epidermal growth factor (EGF) in the media at 20ng mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e promotes cell proliferation and increases the survivability of lymphoid tissue cells of \u003cem\u003eP. stylirostris\u003c/em\u003e (Tapay et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1995\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe greatest advantages in developing a cell culture system are rapidity in forming a monolayer and maintaining a uniform cell number in the culture plate, both of which are essential for most application studies (Jose et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The present study aimed to optimize the cell culture medium with various supplements, growth factor and physicochemical factors for growth of hemocyte cell culture from \u003cem\u003eP.vannamei\u003c/em\u003e (White shrimp).\u003c/p\u003e"},{"header":"Material And Methods","content":"\u003cp\u003e\u003cstrong\u003eShrimp acclimation and tissue dissection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eApparently healthy \u003cem\u003eP.vannamei\u003c/em\u003e weighing approximately 5 to 10 g were sourced from local suppliers in and around Chennai, Tamil Nadu, India. They were acclimatized and maintained in a wet lab facility at ICAR-Central Institute of Brackishwater Aquaculture, Chennai. All animals were maintained hygienically in clean 250 L fiber-reinforced plastic (FRP) tanks with adequate aeration (Salinity 28 \u0026plusmn; 2 \u0026permil;; temperature 30\u0026deg;C \u0026plusmn; 2\u0026deg;C). \u003cem\u003eP.vannamei\u003c/em\u003e were fed with commercially available pellet feed and maintained with a water exchange system. Animals were kept in the laboratory in sterile seawater for three days; every day the water was fully exchanged with sterile sea water to reduce the microbial load.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePrior to sampling, the animals were surface disinfected with 70% alcohol prepared in sterile sea water. After surface sterilization, 1 mL of hemolymph was collected aseptically fromthe ventral sinus located at the base of the third abdominal segment using a 2 mL\u0026nbsp;syringe containing 1 mL of modified Alsever\u0026rsquo;s solution (27 mM Na citrate, 336 mM NaCl, 115 mM Glucose and 9 mM EDTA\u0026nbsp;and made upto 100 mL using sterile de-ionized water) and mixed well. The samples were increased to 10 mL with L-15 basal medium, then mixed well and stored immediately in ice for 5 to 10 minutes. The cells were pelleted by centrifugation at 200 xg for 10 minutes at 25\u0026deg;C and resuspended in selective medium, then seeded in 12-well plates (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) (Nunc, Denmark) and incubated at 28\u0026deg;C. The hemolymph-based shrimp culture medium (HBSCM-5) is composed of L-15 medium with 15% FBS (Sigma-Aldrich, USA) and 1x antibiotic mixture (Penicillin 1,000IU/ml, Streptomycin 1,000\u0026micro;g/ml, Gentamicin 250\u0026micro;g/ml and Amphotericin B250\u0026micro;g/ml (Life Technologies, USA). The medium was formulated based on the hemolymph component of \u003cem\u003eP.vannamei\u003c/em\u003e and prepared as per the method described by Sivakumar et al. (2019). The pH was adjusted to 7.2 and osmolality was adjusted to the hemolymph osmolality (730 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e).\u0026nbsp;The medium was filtered using a 0.2\u0026nbsp;\u0026micro;m filter\u0026nbsp;on a vacuum pump, then incubated at room temperature for 24 hours to check contamination and stored at 4\u0026ordm;C for further use.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of fetal bovine serum (FBS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; The hemolymph-based shrimp culture medium (HBSCM-5) medium was combined with six different concentrations of FBS (1, 5, 10, 15, 20 and 25%, Sigma-Aldrich, USA). The collected hemocyte cells were seeded in each of the different concentrations of FBS with the medium at a concentration of 5\u0026times; 10\u003csup\u003e3\u0026nbsp;\u003c/sup\u003ecells/12 well culture plate. The prepared individual medium was screened for cell growth and incubated at\u0026nbsp;28\u0026deg;C.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eosmolality (mOsm) \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eModified HBSCM-5 media have shown osmolality levels ranging from 400 to 550 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e. To increase the osmolality to that of the hemolymph of \u003cem\u003eP.vannamei,\u003c/em\u003e a 25% solution of Sodium chloride was added to the HBSCM-5 medium. HBSCM-5 media with different osmolalities such as 540, 730, 870, 1075, 1270 and 1470 \u0026plusmn; 20 mOsm kg\u003csup\u003e\u0026shy;1\u0026nbsp;\u003c/sup\u003ewere prepared and screened. \u0026nbsp;Sodium chloride is the preferred compound used to adjust the osmolality to that of hemolymph of animals (Mulford and Austin 1998; Mulford etal., 2000).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003epH\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003epH is an important physical parameter essential for cell growth. The pH of the hemolymph of \u003cem\u003eP. vannamei\u003c/em\u003e was 6.68. In this study, HBSCM-5 medium at 730 \u0026plusmn; 20 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e containing 1x antibiotic and antimycotic solution with 15% FBS was adjusted to four different pH levels (6.8, 7.2, 7.5 and 8.0) to determine the effect of different pH levels on cell growth, cell viability and morphological changes. Effects were observed under an inverted microscope at 20x magnification.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003etemperature (\u003c/strong\u003e\u003csup\u003e0\u003c/sup\u003eC\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTemperature is another important physical parameter essential for cell growth. \u0026nbsp;Hemocyte cells, incubated with HBSCM-5 medium at osmolality 730 \u0026plusmn; 20 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e,pH 7.2 with 15% FBS at five different temperatures (20, 24, 28, 32, 35\u0026deg;C) were screened.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003enatural sea water (NSW\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u0026permil;\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSix different concentrations of natural sea water (NSW; 01, 02, 05, 10, 15 and 20\u0026permil;, were added to HBSCM-5 medium withpH 7.2 with 15% FBS. The hemocyte cells were seeded into the 12-well culture plate at concentration of (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) and then incubated at 28\u0026deg;C for 48 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of shrimp muscle extract (SME)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHealthy specimens of \u003cem\u003eP.vannamei\u003c/em\u003e weighing approximately 10 g were sampled to obtain fresh gill and muscle tissue, which was then homogenized in 100 mL of sterile L-15 medium. The blended mixture was centrifuged at 5,000 xgfor 30 minutes at 4\u0026deg;C. The top layer was collected and again centrifuged at 13,000xgfor 15 minutes at 4\u0026deg;C. The supernatant was filtered through 0.45\u0026micro;m paper (Millipore, USA) and stored at -70\u0026deg;C until further use. Different concentrations (01, 02, 05, 10, 20 and 25%) of shrimp muscle extract were added into the HBSCM-5 medium. The hemocyte cells were seeded into the 12-well culture plate at concentration of (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) and the cells were incubated at 28\u0026deg;C for 48 hours. The cell morphology was observed at 20x magnification in inverted microscopy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ebasic fibroblast growth factor (bFGF)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBasic fibroblast growth factor (bFGF) in various concentrations (0.5, 1, 3 and 5 ngmL\u003csup\u003e-1\u003c/sup\u003e of bFGF) were added to the HBSCM-5 medium with 15% FBS. The hemocyte cells were seeded into the 12-well plates at a concentration of (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) and the cells were incubated at 28\u0026deg;C for 48 hours. The cell morphology was observed at 20x magnification in inverted microscopy.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular identification of cell origin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe DNA was extracted from primary monolayer cells of hemocyte from \u003cem\u003eP.vannamei\u003c/em\u003e and PCR was carried out (Sivakumar et al., 2019). The fragments of the cytochrome c oxidase subunit I (COI) genes were amplified using universal primers F 5\u0026prime; TCAACCAACCACAAAGACATTGGCAC 3\u0026prime; and R 5\u0026prime; TAGACTTCTGGGTGGCCAAAGAATCA 3\u0026prime;. The PCR products of the fragments were sequenced by an ABI 3730 DNA analyzer (Applied Biosystems). The sequences of the mtDNA gene fragments were compared with the published and known sequences in the National Centre for Biotechnology database by the basic local alignment search tool (BLAST).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eDue to increase in viral diseases, prophylaxis, and lack of treatment due to non-availability of specific treatment for the respective disease, studies on the improvement in the shrimp cell culture system became significant. The potential for optimizing the medium used for hemocyte cell culture growth of \u003cem\u003eP.vannamei\u003c/em\u003e by adding different supplements, including fetal bovine serum, shrimp muscle extract, natural sea water, and \u003cem\u003ebasic fibroblast growth factor was explored\u003c/em\u003e. Cell culture growth in the optimized medium at different levels of osmolality, pH and temperature was also observed.When the optimized medium was used, in vitro proliferation of hemocyte of\u003cem\u003eP.vannamei\u003c/em\u003e was significant and found to adhere within six hours and confluent monolayer formation was achieved within 24-48 hours of plating. This monolayer culture was maintained, and healthy cells have shown prominent morphological characteristics. Fibroblast-like and round cells of hemocytes with higher growth and multiplicity were observed in the HBSCM-5 medium.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of pH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGrowth patterns were recorded under different pH levels. At pH 7.2 a large number of healthy cells with good morphology were observed after 24 hours of incubation. Formation of cell debris and granulation were observed at pH 7.5 and 8.0, which consequently resulted in cell lysis after 48 hours (Fig.1. A1-A5). Decreased cell viability and poor attachment were recorded below pH 6.8.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of temperature\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHemocyte cell observations have shown that the cells incubated at 28°C were healthy, forming a confluent monolayer and fibroblast-like and round morphology (Fig.1. B1-B5). Incubation at 20°C and 24°C resulted in less cell adherence, no prominent formation of a confluent monolayer and cells were not healthy. At 32°C and 35°C the cells were partially attached in the culture plate, lost their original morphology and were lysed within 48 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of Osmolality (mOsm)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOsmolality of 730 ± 20 mOsm kg\u003csup\u003e1\u003c/sup\u003e, previously found to be the optimal range for hemocyte cell culture, resulted in confluent monolayer formation and observation of intact fibroblast-like and round morphology. When the osmolality was increased from 730 ± 20 mOsm kg\u003csup\u003e1\u003c/sup\u003e to 1470 ± 20 mOsm kg\u003csup\u003e1\u003c/sup\u003e, the morphology of the cells changed to crystal-like formation, which resulted in decreased viability. The medium color also changed from pink to brown and cell clumping occurred. Similarly, when the osmolality of the medium was decreased 540 mOsm kg\u003csup\u003e1\u003c/sup\u003e, the cells were not healthy and a confluent monolayer formed and also did not form a fibroblast-like morphology in HBSCM-5 medium with 540± 20 mOsm kg\u003csup\u003e1\u003c/sup\u003e (Fig.2. A1-A6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of \u003cem\u003ebasic fibroblast growth factor (bFGF)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were attached uniformly at all concentrations in the range between 0.5 and 5 ng/mL\u003csup\u003e-1\u003c/sup\u003e, forming a confluent monolayer and fibroblast-like morphology. Healthy elongated cells were observed after 48 hours (Fig.2. B1-B6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of fetal bovine serum (FBS)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePoor adherence was observed while using 1% and 5% FBS, and the cells were not healthy. Rapid cell proliferation was recorded at 10% to 20% FBS. Optimal growth was observed at 15% to 20%, which resulted in 90% adherence of seeded cells with noticeable formation of a complete monolayer and good cell viability. At 25% FBS, cell growth was inhibited (Fig.3. A1-A6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of concentration of natural sea water (NSW\u003c/strong\u003e‰\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSupplementing the HBSCM-5 medium with NSW concentrations greater than 5‰, resulted in rapid attachment of cells, but cell clumping was also observed (Fig.3. B1-B6). Initially there was a change in the color of the medium within 24 hours and cell morphology became crystal-like. At 2‰, NSW, a group of crystals-like cells with reduced viability formed. Most of the cells were floating after 48 hours and did not form fibroblast-like morphology in HBSCM-5 medium with a 5 to 20‰of NSW.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffect of shrimp muscle extracts (SME)\u003c/strong\u003e \u003c/p\u003e\n\u003cp\u003eCells were not attached at 0% or 1% SME. At 5%, 10% and 20% SME the cells adhered very rapidly, and fibroblast-like cell morphology and healthy cells were observed (Fig.4. A1-A6). At 25% SME, the cell growth was inhibited, and cell lysis was observed after 24 hours. Even though 5%, 10% and 20% SME initially promoted cell growth, the cells were completely lysed within 2 to 3 days (Fig.4. B1-B6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular identification of the cell line\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMolecular identification of cell origin was performed by amplification of the COI mitochondrial DNA. Comparative analysis of the sequences revealed a match of 99% for COI to known \u003cem\u003eP.vannamei\u003c/em\u003e hemocyte cell mitochondrial DNA sequences. These sequences thus confirmed that primary hemocyte cells were derived from \u003cem\u003eP.vannamei\u003c/em\u003e. These sequences have been submitted to the GenBank with accession number KY564433 (Sivakumar et al.2019).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eGenerally, crustacean primary cell culture would not survive for more than five days in the basal medium and the addition of appropriate nutrient supplements is essential for cell proliferation (Hsu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). In order to enhance the growth of the cells from \u003cem\u003eP.vannamei\u003c/em\u003e previous studies screened various supplements with one or more combinations (Table\u0026nbsp;2). This study optimized HBSCM-5 medium with various supplementary nutrients, including fetal bovine serum, shrimp muscle extract, natural sea water and basic fibroblast growth factor to explore their ability to promote cell growth. The optimum medium was also prepared at different osmolalities, pH levels and temperatures to explore their effect on cell growth. Proper maintenance of pH in culture media is very essential for the growth of cells. Shrimp are highly sensitive to changes in pH and mortality occurs when the pH is lowered below 6.8 (Han et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This was in line with our present study where at 6.5 pH there was a seizure in cell growth. Since the pH of hemolymph was found to be 6.68, the media prepared with pH ranging from 6.8 to 7.2 resulted in clear media without any precipitation and supported better growth of cells. This is similar to many previous studies that suggested an optimum pH range of 6.8 to 7.6 (Toullec et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Maeda et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Zeng et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Jayesh et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTemperature plays a vital role in the survival and morphology changes and healthy cells of hemocyte. In our study the optimum temperature was 28\u0026deg;C, which resulted in the formation of a confluent monolayer of cells and intact fibroblast-like and round morphology, both of which concur with the results observed by Goswami et al., (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOsmotic pressure is another important physical parameter to be considered for the growth of cells, which not only affects cell proliferation but also the metabolites produced. In this study, promising growth and intact cell morphology were observed at 730\u0026thinsp;\u0026plusmn;\u0026thinsp;20 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e osmolality. A previous study had shown better growth at osmolalities between 470 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e and 770 mOsm kg\u003csup\u003e\u0026shy;1\u003c/sup\u003e (Li et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In our study, the osmolality range where maximum growth was achieved is in concurrence with the osmolality of hemocyte cells that was previously measured in the hemolymph sample. In our study, the addition of NSW in the medium as a supplement did not assist in the growth and proliferation of cells. Earlier studies have also shown L-15 medium supplemented with NSW had poor buffering capacity (Sashikumar and Desai, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). FBS is the most common and widely used supplement added to enhance cell growth. FBS contains high levels of embryonic growth promoting factors and components that have been shown to satisfy the metabolic requirements of cells during culture (Jayesh et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Additionally, hydrocortisone present in FBS was found to promote cell attachment and the growth hormone somatomedin has been observed to have a mitogenic effect (Freshney, 2005). In the present study, FBS used at concentrations between 10% and 20% showed better growth and proliferation of cells, but when increased to 25%, FBS inhibited the cell growth. This is in agreement with earlier reports that also explored the effect of FBS (Kasornchandra et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Goswami et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Some studies reported that 20% FBS highly promoted the cell growth (Kasornchandra et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Jose et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Usage of 10% FBS has also shown improved cell growth (Maeda et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; George and Dhar, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eHemocyte cell attachment and proliferation was observed with SME supplementation in HBSCM-5 medium. Even though the cells were healthy morphology observed. Hemocyte cells had good morphology in the medium containing only SME (no FBS), after which the cells got lysed within 48 hours. When 20% SME was incorporated in the medium, cell growth was inhibited. This may be due to the presence of an inhibitory substance in SME. This is also in agreement with the study by (Fraser and Hall, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Luedeman and Lightner, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). In contrast, SME prepared from juvenile shrimp had a beneficial effect on the growth and proliferation of hemocytes and ovaries (George and Dhar, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGrowth factors are vital elements essential to maintain normal cellular activities. In the present study, all concentrations of bFGF in the medium enhanced the cell growth. Enlarged morphology of the cells was observed when compared with normal cells. bFGF binds to the heparin-like molecule situated in the extracellular matrix of the endothelial cells, thus stimulating cell proliferation and differentiation (Ma et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Similarly, a high concentration of bFGF will down-regulate the bFGF receptor and induce cell transformation. According to a previous report addition of bFGF stimulated cell growth and able to withstand passage for 90 times in the lymphoid culture (Hsu et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e1995\u003c/span\u003e).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe hemocyte cell culture was optimized for use as an \u003cem\u003ein vitro\u003c/em\u003e cell culture system by testing cell growth on HBSCM-5 medium with various supplements, growth factors and physical parameters. Hemocyte culture was optimized for supplements including fetal bovine serum, shrimp muscle extract, and basic fibroblast growth factor, as well as physico-chemical factors including pH, temperature, osmolality and natural sea water concentration. Based on the cell morphology, growth and tendency for cell proliferation and also cell viability were observed. An optimized media with known concentrations of supplements, growth factors and also physico-chemical factors will be significant for a researcher. The \u003cem\u003ein vitro\u003c/em\u003e hemocyte cell culture system grown in our study would be useful for further research and for developing an immortal cell line and specific culture medium.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the Director of ICAR-CIBA for financial support. The authors acknowledge the financial support from the ICAR, ICAR-Central Institute of Brackish water Aquaculture for providing the necessary facilities.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Info\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research work received no external funding. author- ship, and/or publication of this article\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict-of-interest statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest to research. We certify that the submission is original work and is not under review at any other publication.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable for shrimp cell culture\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceived and designed the experiments: Dr.N.Kalaimani, and \u0026nbsp;performed the experiments and wrote the Manuscript: Dr.S. Sivakumar.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eClaydon K, Owens L (2008) Attempts at immortalization of crustacean primary cell cultures using human cancer genes. In Vitro Cell Dev Biol 44:451\u0026ndash;457\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraser CA, Hall MR (1999) Studies on primary cell cultures derived from ovarian tissue of \u003cem\u003ePenaeus monodon\u003c/em\u003e. Methods Cell Sci 21:213\u0026ndash;218\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFreshney RI (2015) Culture of animal cells: a manual of basic technique and specialized applications. John Wiley \u0026amp; Sons.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorge SK, Dhar AK (2010) An improved method of cell culture system from eye stalk, hepatopancreas, muscle, ovary, and hemocytes of \u003cem\u003ePenaeus vannamei\u003c/em\u003e. In Vitro Cell Dev Biol Anim 46:801\u0026ndash;810\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorge SK, Kaizer KN, Betz YM, Dhar AK (2011) Multiplication of Taura syndrome virus in primary hemocyte culture of shrimp (\u003cem\u003ePenaeus vannamei\u003c/em\u003e). J Virol Methods 172(1\u0026ndash;2):54\u0026ndash;59\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoswami M, Lakra WS, Rajaswaminathan T, Rathore G (2010) Development of cell culture system from the giant freshwater prawn \u003cem\u003eMacrobrachium rosenbergii\u003c/em\u003e (de Man). Mol Biol Rep 37:2043\u0026ndash;2048\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Q, Li P, Lu X, Guo Z, Guo H (2013) Improved primary cell culture and subculture of lymphoid organs of the greasyback shrimp \u003cem\u003eMetapenaeus ensis\u003c/em\u003e. Aquaculture 410:101\u0026ndash;113\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsu YL, Yang YH, Chen YC, Tung MC, Wu JL, Engelking MH, Leong JC (1995) Development of an \u003cem\u003ein vitro\u003c/em\u003e subculture system for the oka organ (Lymphoid tissue) of \u003cem\u003ePenaeus monodon\u003c/em\u003e. Aquaculture 136:43\u0026ndash;55\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayesh P, Jose S, Philip R, Bright Singh IS (2013) A novel medium for the development of in vitro cell culture system from \u003cem\u003ePenaeus monodon\u003c/em\u003e. Cytotechnology 65:307\u0026ndash;322\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJayesh P, Seena J, Singh ISB (2012) Establishment of Shrimp Cell Lines: Perception and Orientation. Indian J Virol 23:244\u0026ndash;251\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang YS, Zhan WB, Wang SB, Xing J (2006) Development of primary shrimp hemocyte cultures of \u003cem\u003ePenaeus chinensis\u003c/em\u003e to study white spot syndrome virus (WSSV) infection. Aquaculture 253:114\u0026ndash;119\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJose S, Mohandas A, Philip R, Bright Singh IS (2010) Primary hemocyte culture of \u003cem\u003ePenaeus monodon\u003c/em\u003e as an \u003cem\u003ein vitro\u003c/em\u003e model for white spot syndrome virus titration, viral and immune related gene expression and cytotoxicity assays. J Invertebr Pathol 105:312\u0026ndash;321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJose S, Jayesh P, Mohandas A, Philip R, Bright Singh IS (2011) Application of primary haemocyte culture of \u003cem\u003ePenaeus monodon\u003c/em\u003e in the assessment of cytotoxicity and genotoxicity of heavy metals and pesticides. Mar Environ Res 71:169\u0026ndash;177\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJose S, Jayesh P, Sudheer NS, Poulose G, Mohandas A, Philip R, Bright Singh IS (2012) Lymphoid organ cell culture system from \u003cem\u003ePenaeus monodon\u003c/em\u003e (Fabricius) as a platform for white spot syndrome virus and shrimp immune-related gene expression. J Fish Dis 35:321\u0026ndash;334\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKasornchandra J, Khongpradit R, Ekpanithanpong U, Boonyaratpalin S (1999) Progress in the development of shrimp cell cultures in Thailand. Methods Cell Sci 21:231\u0026ndash;235\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Nguyen VT, Corteel M, Dantas-Lima JJ, Van Thuong K, Van Tuan V, Bossier P, Sorgeloos P, Nauwynck H (2014) Characterization of a primary cell culture from lymphoid organ of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e and use for studies on WSSV replication. Aquaculture 433:157\u0026ndash;163\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Van Tuan V, Van Thuong K, Bossier P, Nauwynck H (2015) Eye extract improves cell migration out of lymphoid organ explants of \u003cem\u003eL. vannamei\u003c/em\u003e and viability of the primary cell cultures. In Vitro Cell Dev Biol -Anim 51:651\u0026ndash;654\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuedeman R, Lightner DV (1992) Development of an in vitro primary cell culture system from the penaeid shrimp, \u003cem\u003ePenaeus stylirostris\u003c/em\u003e and \u003cem\u003ePenaeus vannamei\u003c/em\u003e. Aquaculture 101:205\u0026ndash;211\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa J, Zeng L, Lu Y (2017) Penaeid shrimp cell culture and its applications. Rev Aquac 9:88\u0026ndash;98\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaeda M, Mizuki E, Itami T, Ohba M (2003) Ovarian primary tissue culture of the kuruma shrimp \u003cem\u003eMarsupenaeus japonicus\u003c/em\u003e. Vitro Cell Dev Biol - Anim 39:208\u0026ndash;212\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMitsuhashi J (2001) Development of highly nutritive culture media. In-Vitro Cell Dev Biol - Anim 37:330\u0026ndash;337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMothersill C, Austin B (2000) Aquatic Invertebrate Cell Culture. Springer,book\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulford AL, Austin B (1998) Development of primary cell cultures from \u003cem\u003eNephrops norvegicus\u003c/em\u003e. Methods Cell Sci 19:269\u0026ndash;275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMulford AL, Lyng F, Mothersill C, Austin B (2000) Development and characterization of primary cell cultures from the hematopoietic tissues of the Dublin Bay prawn, \u003cem\u003eNephrops norvegicus\u003c/em\u003e. Methods Cell Sci 22:265\u0026ndash;275\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNadala EC, Loh PC, Lu PC (1993) Primary culture of lymphoid, nerve, and ovary cells from \u003cem\u003ePenaeus stylirostris\u003c/em\u003e and \u003cem\u003ePenaeus vannamei\u003c/em\u003e. In Vitro Cell Dev Biol Anim 29A:620\u0026ndash;622\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSashikumar A, Desai PV (2008) Development of primary cell culture from \u003cem\u003eScylla serrata\u003c/em\u003e. Cytotechnology 56:161\u0026ndash;169\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSivakumar S, Swaminathan TR, Anandan R, Kalaimani N (2019) Medium optimization and characterization of cell culture system from \u003cem\u003ePenaeus vannamei\u003c/em\u003e for adaptation of white spot syndrome virus (WSSV). J Virol Methods 270:38\u0026ndash;45\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTapay LM, Lu Y, Brock JA, Nadala EC, Loh PC (1995) Transformation of primary cultures of shrimp (\u003cem\u003ePenaeus stylirostris\u003c/em\u003e) lymphoid (Oka) organ with Simian virus-40 (T) antigen. Proc. Soc. Exp. Biol. Med. 209, 73\u0026ndash;78\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToullec JY, Crozat Y, Patrois J, Porcheron P (1996) Development of Primary Cell Cultures from the Penaeid Shrimps \u003cem\u003ePenaeus vannamei\u003c/em\u003e and \u003cem\u003eP. indicus\u003c/em\u003e. J Crustac Biol 16:643\u0026ndash;649\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVieira-Girao PRN, Falcao CB, Rocha IRCB, Lucena HMR, Costa FHF, R\u0026aacute;dis-Baptista G (2017) Antiviral activity of Ctn [15\u0026ndash;34], A cathelicidin-derived eicosapeptide, against infectious myonecrosis virus in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e primary hemocyte cultures. Food Environ Virol 9:277\u0026ndash;286\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng H, Ye H, Li S, Wang G, Huang J (2010) Hepatopancreas cell cultures from mud crab, \u003cem\u003eScylla paramamosain\u003c/em\u003e. In-Vitro Cell Dev Biol - Anim 46:431\u0026ndash;437\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1. Supplement and physical factor combinations tested on HBSCM-5 medium and associated observations.\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e\u003cstrong\u003eNo\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"39.49843260188088%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSupplement and/or Physical factor\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"54.70219435736677%\"\u003e\n \u003cp\u003e\u003cstrong\u003eObservations\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003e1% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eVery few cells attached\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003e5% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003ePartial cell attachment but no replication\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 10% FBS\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCell proliferation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapid proliferation and healthy cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 20% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eProliferation and healthy cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 25% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCell attachment but no replication\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and 0.5 ng mL\u003csup\u003e-1\u003c/sup\u003e bFGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapidly attachment and enlarged the cell morphology was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 1 ng mL\u003csup\u003e-1\u003c/sup\u003e of bFGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapidly attachment and enlarged the cell morphology was seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 3 ng mL\u003csup\u003e-1\u003c/sup\u003e of FGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapidly attachment and enlarged the cell morphology was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 5 ng mL\u003csup\u003e-1\u003c/sup\u003e of FGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapidly attached and enlarged the cell morphology was seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and 540 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCells attached but most of the cells showed round morphology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 730 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapid cell attachment, fibroblast-like morphology and cell proliferation was \u0026nbsp;observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 870 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCells attachment, medium color changed and cells formed clump was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 1075 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCells attachment, medium color changed and cells formed mass clump was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and 1270 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eMedium color changed and most of the cells formed like-cluster were seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 1470 \u0026plusmn; 20 mOsm kg\u0026shy;\u003csup\u003e\u0026shy;1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eMedium color also changed and most of the cells formed -mass cluster.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and pH 6.8\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCells attached but most of the cells got lysis within 24 hours\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand pH 7.2\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapid cell attachment, healthy cells and good morphology and proliferation was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and pH 7.5\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eLess cells attachment and cells got lysis within 2 days\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and pH 8.0 \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eFew cells attached, proliferation not seen and cells got lysis within 2 days\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 20\u0026ordm;C temperature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003efew cells attached and cell proliferation was not seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 24\u0026ordm;C TM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eVery less cells attached and cell proliferation was not observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and 28\u0026ordm;C TM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapid cells attachment\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 32\u0026ordm;C TM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCells partially attachment and \u0026nbsp;cells got lysis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand 35\u0026ordm;C TM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eFew cells attached and no further progress\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 01% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eOnly few cells attached\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 05% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eSome cells attached \u0026nbsp;and no further cell proliferation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 10% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eModerately attachment the cells and cell proliferation was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eRapid attachment, healthy cell morphology and proliferation was observed, after 48 hrs the cells got lysis completely\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 20% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eHealthy and proliferation of cells was observed, after 48 hrs cells got lysis completely\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 25% SME\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eLess cells attached and inhibited the cell growth and cells got lysis within 48 hrs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and \u0026nbsp;1\u0026permil; NSW \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eCell proliferation was observed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand \u0026nbsp;2\u0026permil; NSW\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eProliferation of cells seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eand \u0026nbsp;5\u0026permil; NSW\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eMost of the cells showed round type morphology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and \u0026nbsp; \u0026nbsp; 10\u0026permil; NSW\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eThe medium color changed and clump of cells was seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and \u0026nbsp; \u0026nbsp; 15\u0026permil; NSW\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eThe medium color changed and mass clump of cells was seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.799373040752351%\"\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"38.71473354231975%\"\u003e\n \u003cp\u003eHBSCM-5 medium with 15% FBS\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;and \u0026nbsp; \u0026nbsp; 20\u0026permil; NSW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"top\" width=\"55.4858934169279%\"\u003e\n \u003cp\u003eThe medium color changed and mass clump of cells was seen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2: Various studies carried out in \u003cem\u003eP.vannamei.\u0026nbsp;\u003c/em\u003eto develop the primary cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e\u003cstrong\u003eS.NO\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e\u003cstrong\u003eDifferent\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTissues\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e\u003cstrong\u003eMedia\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSupplements\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e\u003cstrong\u003eOsmolality\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTEM\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCell culture/ growth\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eLuedeman and\u003c/p\u003e\n \u003cp\u003eLightner, 1992\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eOvary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eGrace\u0026rsquo;s sect\u003c/p\u003e\n \u003cp\u003emedium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e10% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e700-750\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e25\u0026deg;C 28\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e6.8-7.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003e80% confluence formed within a 2-day period\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eNadala et al., 1993\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eOka cells\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e2x L-15 medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e20% FBS \u0026amp; 8%SME and 20ng/ml EGF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e750-770\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e25\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003eproper pH is essential\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003eFound to markedly enhance cell growth. Cells which used to take 2 weeks to form a monolayer.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eToullec et al., 1996\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eGrace\u0026rsquo;s insect\u003c/p\u003e\n \u003cp\u003emedium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e10% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e750-760\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e29\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e7.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003eDeveloped primary cell culture maintained up to 2 weeks\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eGeorge and \u0026nbsp; \u0026nbsp; \u0026nbsp; Dhar, 2010\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eHemocytes and various tissues\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eGrace\u0026apos;s insect medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e10% FBS and 10% SME\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e730\u0026plusmn; 10\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e26\u0026deg;C and 28\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003eImproved methods of cell culture from eye stalk, hepatopancreas, muscle, ovary, and hemocytes of shrimp \u003cem\u003ePenaeus vannamei\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eGeorge\u0026nbsp;et al., 2011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eHemocytes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e2\u0026times;\u0026nbsp;Grace\u0026rsquo;s Insect Medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e10% FBS and 10% SME\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e730\u0026plusmn; 10\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e27\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003eHemocytes primary cell culture developed from \u003cem\u003ePenaeus vannamei\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eLi et al., 2014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eLymphoid organ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e2\u0026times; L-15 medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e20% FBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e900 \u0026plusmn; 20\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e27\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e\u0026nbsp;7.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003ePromoted the migration of cells from the explants and cell survival. 600 \u0026mu;g/ml cholesterol and 1000 \u0026mu;g/ml L-glutathione (GSH) both enhanced cell survival and performance in vitro.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eLi et al., 2015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eLymphoid organ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e2\u0026times; L-15 medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e20% \u0026nbsp;FBS \u0026amp; 10% of eye extract\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e900 \u0026plusmn; 20\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e27\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e7.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003e10% of eye extract or 3% of ovary extract to cells for the maximal health of primary cell cultures from the lymphoid organ of \u003cem\u003eP. vannamei.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"5.194805194805195%\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.788211788211788%\"\u003e\n \u003cp\u003eVieira-Gira\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eet al.,2017\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003eHemocytes\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.38961038961039%\"\u003e\n \u003cp\u003e2x L-15medium\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.589410589410589%\"\u003e\n \u003cp\u003e20% FBS and 2% glucose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.390609390609391%\"\u003e\n \u003cp\u003e720\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.392607392607393%\"\u003e\n \u003cp\u003e29\u0026deg;C\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.6923076923076925%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.172827172827173%\"\u003e\n \u003cp\u003eThese hemocytes remained viable for at least 8 days with a slight increase in viability on that period.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"shrimp cell culture, Penaeus vannamei, optimizing culture media, temperature, salinity, pH, bFGF and HBSCM-5 medium.","lastPublishedDoi":"10.21203/rs.3.rs-1488767/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1488767/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOptimization of cell culture medium was carried out with various supplements and physical factors for the growth of hemocyte cell cultures from Penaeus vannamei. Hemolymph-based shrimp culture medium (HBSCM-5 medium). Various concentrations of fetal bovine serum (FBS; 1\u0026ndash;25%), shrimp muscle extract (SME; 1\u0026ndash;25%) and basic fibroblast growth factor (bFGF; 0.5 to 5 ng mL -1) were attempted to optimize the media for the development of primary hemocyte cell culture of P. vannamei. 15% FBS was ideal for the healthy morphology of cells with rapid replication. SME supplementation at 5\u0026ndash;20% supported the cell growth for 24 hours but only 30% of cell viability was observed after 48 hours. bFGF (0.5 to 5 ng mL -1) enhanced cell growth in the medium with 15% FBS; Cells were healthy at all concentrations of bFGF and showed enlarged fibroblast-like morphology. HBSCM-5 medium containing 15% FBS was prepared with various levels of osmolality (540 to 1470\u0026thinsp;\u0026plusmn;\u0026thinsp;20 mOsm kg \u0026shy;1). The ideal pH level was examined by preparing the HBSCM-5 medium at pH between 6.8 and 8.0. Temperatures ranging from 20\u0026deg;C to 35\u0026deg;C and natural sea water (NSW) concentrations between 1% and 20% were also tested to determine their effect on cell growth and proliferation. Osmolality of 730\u0026thinsp;\u0026plusmn;\u0026thinsp;20, pH of 7.2 and temperature of 28\u0026deg;C resulted in the healthy cells with good morphology. NSW supplement supported the cell growth at low concentrations of salt; however, at salt concentrations of more than 2%, cells did not form fibroblast-like morphology and instead a crystal-like morphology was observed.\u003c/p\u003e","manuscriptTitle":"An optimization of supplements and physical factors for growth of hemocyte cell culture from Penaeus vannamei in selective medium","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-04-19 14:27:03","doi":"10.21203/rs.3.rs-1488767/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major Revisions Needed","date":"2022-06-08T04:03:55+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2022-05-20T07:43:32+00:00","index":0,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-04-15T02:52:00+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-04-14T09:40:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-04-08T15:15:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2022-03-25T06:42:02+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"122a5dec-d79d-4036-baf4-b3afa6203ab6","owner":[],"postedDate":"April 19th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-07-29T14:43:04+00:00","versionOfRecord":[],"versionCreatedAt":"2022-04-19 14:27:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1488767","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1488767","identity":"rs-1488767","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.