KU60019 induced ATM blockage regulates GPR91/has-miR-576-3p to inhibit ovarian cancer progression

KU60019 induced ATM blockage regulates GPR91/has-miR-576-3p to inhibit ovarian cancer progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article KU60019 induced ATM blockage regulates GPR91/has-miR-576-3p to inhibit ovarian cancer progression Yangyang Zhou, Xiaolei Guo, Rongjing Dang, Lin Cong, Xin Zhao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3877379/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Ataxia telangiectasia mutated (ATM) protein play a key role in the DNA damage response and sustain genomic stability, targeting which has been widely studied in different types of cancer as a potential therapeutic strategy for antitumor therapies. However, the mechanism of targeting ATM in ovarian cancer has not been fully elaborated. In the current study, we explore the influence of GPR91 on ovarian cancer cells in the context of ATM blockage in vitro . We identified that GPR91 might be a potential target of miR-576-3p in ovarian cancer cells upon KU60019 treatment. KU60019 induced cell apoptosis by downregulating GPR91 level. Inhibition of miR-576-3p reversed KU60019 induced cell apoptosis by upregulating GPR91 in vitro . Our results revealed cellular and molecular pathways in KU60019 induced cell death as well as identified a novel potential target for antitumor research. Biological sciences/Cancer/Cancer genetics Biological sciences/Cancer/Cancer prevention Biological sciences/Cancer/Tumour biomarkers ataxia telangiectasia-mutated gene KU60019 G protein-coupled receptors hsa-miR-576-3p ovarian cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Till date, ovarian cancer is one of the leading causes of death in females. There are approximately over 200,000 individuals had been diagnosed with ovarian cancer every year in the world, and nearly half will die of ovarian cancer ( 1 ). In addition, it is reported that the mortality of ovarian cancer is increased yearly in China duo to elevated estimated new cases in females ( 2 ). Increasing ovarian cancer incidence and mortality data alert researchers should be in urgent need of new exploration to uncover the pathogenic mechanism in ovarian cancer progression, and seek new supporting points to treat ovarian cancer. Recently, it was reported that ataxia telangiectasia-mutated gene (ATM) inhibition synergized with aldehyde dehydrogenase restrains successfully induced DNA double stand breaks in ovarian cancer and increases cancer cell sensitivity ( 3 ). In accordance with these, a previous study reported that ATM mutations In accordance with these, a previous study reported that miR-203a-3p could facilitate ovarian cancer cell apoptosis by targeting ATM ( 4 ), indicated a crucial role of ATM in ovarian cancer progression. GPR91 is a key enzyme that belong to G protein-coupled receptors (GPCRs), which could recognize and bind to succinate, thus, GPR91 is also named as succinate receptor. GPR91 is widely expressed in a variety of cell types, once an agonist binds to GPR91, the polarization of macrophages would be accelerated upon upon Gq/11 and PLC activation ( 5 ). It was reported that GPR91 is one of the potential targets of miR-326, proliferation and invasion of human endometrial carcinoma stem cells could be significantly inhibited in miR-326 overexpression conditions, GPR91/STAT3/VEGF pathway was involved in miR-326 regulating systems ( 6 ). However, the mechanism of GPR91 in facilitating ovarian cancer growth is still underdetermined. Hsa-miR-576-3p (miR-576-3p) belongs to microRNAs charactered by small non-coding RNAs, and gene regulatory function via recognizing and binding to the 3′untranslated region of target genes ( 7 ). Reduced miR576-3p was detected in human lung adenocarcinoma, H460 cell migration and invasion could be suppressed by overexpression of miR-576–3p ( 8 ). Another study showed that miR576-3p could bind to the 3’UTR of HIF-1α, silencing circDNMT1 suppresses the progression of gastric cell migration in vitro ( 9 ). The latest research shows that high levels of miR576-3p in ovarian cancer tissues enhanced cisplatin chemosensitivity by silencing PD-L1 and cyclin D1 ( 10 ). These results suggested that miR576-3p might regulate cancer cell growth to intervene the survival of patients. However, the role of miR576-3p in ovarian cancer development is still needed to be fully understood. In the present study, we showed an increased expression of GPR91 and declined expression of miR576-3p in ovarian cancer tissues. The expression levels of GPR91 were negatively associated with the overall survival time of ovarian cancer patients. It was predicted that miR576-3p could potentially bind to the 3’UTR of GPR91, administration of ATM inhibitor KU60019 induced cell apoptosis by enhancing miR576-3p expression and suppressed GPR91 expression. MiR576 3p inhibitor reversed the KU60019 induced cell apoptosis by elevating GPR91 expression. These findings demonstrated that ATM blockage restrained ovarian cancer cell proliferation and migration through enhancing miR-576-3p expression and suppressed GPR91 expression. GPR91 may be a novel target for ovarian cancer treatment. Results Expression of hsa-miR-576-3p was declined in ovarian cancer tissues To explore the level of miR-576-3p in ovarian cancer tissue, we analyzed the data from TCGA database, the results showed a declined expression of miR-576-3p in ovarian cancer tissues, the expression of miR-576-3p in the tissues of advanced patients was lower than that of early patients(Fig. 1 a, stage2 versus stage3 = 0.00338, stage2 versus stage4 = 0.00399). In contrast, the expression of GPR91 was significantly increased ovarian cancer tissues (Fig. 1 b). In addition, the expression of GPR91 was positively correlated with the cancer stage in ovarian cancer tissues (Fig. 1 c). We also found that the expression of miR-576-3p was gradually increased with age (supplementary Fig. 1a), and TP53 mutation did not change miR-576-3p level (supplementary Fig. 1b). The findings indicated that the miR-576-3p and GPR91 might involve in the ovarian cancer progression, and the opposite expression level suggested that miR-576-3p might be negatively correlated with GPR91. High levels of GPR91 predicted a poor outcome in ovarian cancer patients To determine whether GPR91 was linked to ovarian cancer patients’ survival, we plotted Kaplan-Meier survival curve with OS, PFS, and PPS. Although a higher levels of GPR91 had no statistical significance in OS and PPS in ovarian cancer patients (Fig. 2 a and c), PFS of patients with high levels of GPR91 was significantly poorer (Fig. 2 b). As the expression of GPR91 was correlated with cancer stage in ovarian cancer (Fig. 1 c), next we investigated the correlation between GPR91 and survival of patients with different cancer stages. Since the sample size was too small to draw survival curves at stage 1, we showed that a high levels of GPR91 predicted worse PFS (Fig. 2 e) in ovarian cancer patients, but not OS (Fig. 2 d) or PPS (Fig. 2 f). PFS has the advantage of being able to reflect the improved effect of treatment on patient survival ( 11 ). Thus, we analyzed the impact of different therapeutic agents on patient survival. Unexpectedly, the results showed that patients with high GPR91 expression had significantly reduced PFS compared with those with low GPR91 expression during platin and taxol treatment (Fig. 2 g-h). In short, GPR91 might be a potential prognostic biomarker on ovarian cancer therapy. KU60019 induced ovarian cancer cell death by reversing miR-576-3p and GPR91 expression Results from the TARGETSCAN 8.0 showed that miR-576-3p could potentially target GPR91 at 3’UTR (Fig. 3 a). To unravel whether miR-576-3p and GPR91 were involved in regulating ovarian cancer progression, we detected the expression of which in normal ovarian cells (IOSE80 cells) and ovarian cancer cells (SKOV3 cells). Compared with gene expression, GPR91 was significantly increased in the SKOV3 cells (Fig. 3 b), while a declined expression of miR-576-3p was found in SKOV3 cells (Fig. 3 c). It was reported that ATM is a key protein involved in DNA repair system and tumor progression. Inhibition of ATM by KU60019 could be efficiently suppressed tumor migration and induced cell apoptosis in XX model. In this regard, we first examined the effect of KU60019 on GPR91 and miR-576-3p, and found that the expression of GPR91 was suppressed in SKOV3 cells, while the expression of miR-576-3p was significantly induced upon KU60019 stimulation (Fig. 3 d-e). In addition, we found a dramatical increased apoptotic ratio in SKOV3 cells after KU60019 treatment (Fig. 3 f). These results suggested that GPR91 and miR-576-3p might involve in KU60019 induced ovarian cancer cell apoptosis in vitro . miR-576-3p inhibited GPR91 expression in ovarian cancer cells, which reversed KU60019 induced cell apoptosis Given the finding that miR-576-3p could potentially bind to GPR91, the high levels of GPR91 predicted a poor prognosis in ovarian cancer patients, which is important for disease progression, we next asked whether these two were functionally linked in ovarian cancer progression. An increased expression of GPR91 was observed in ovarian cancer tissues (Fig. 4 a), GESA analysis showed that GPR91 was significantly enriched in apoptosis (Fig. 4 b). Indeed, administration of KU60019 significantly induced cell apoptosis in SKOV3 cells, and miR-576-3p inhibitor reversed the KU60019 induced cell apoptosis (Fig. 4 c). Furthermore, cell migration ability was also been reversed by inhibiting miR-576-3p in ovarian cancer cells (Fig. 4 d). We then questioned whether miR-576-3p inhibitor unleashes more GPR91 in SKOV3 cells. Results showed that miR-576-3p inhibitor reversed KU60019 induced upregulation of miR-576-3p and downregulation of GPR91 (Fig. 4 e-f). These results suggested that GPR91 might be a therapeutic target for ovarian cancer therapy. Discussion Ataxia telangiectasia mutated (ATM) could be activated in response to DNA damage, which lead to phosphorylation of downstream proteins to regulate apoptosis and cell cycle in cancer ( 12 ). It was reported that loss of ATM prolonged the diestrus phase in mice, ATM inhibition suppressed phosphoramide mustard induced destroys primordial follicles ( 13 ). However, the exact mechanism underlying tumor growth inhibition induced by ATM blockage were still unclear. Our results are crucial in delineating the role of GPR91/miR-576-3p during antitumor therapy with KU60019. Our discovery of GPR91, one G protein-coupled receptor expressed by ovarian cancer cells, facilitating cancer progression, is based on the aberrant expression of miR-576-3p in patients. We have shown that the expression of GPR91 was increased in ovarian cancer tissues and cell lines, which negatively correlated with the survival of patients. Although there was no significant correlation between GPR91 and OS/PPS, a higher level of GPR91 predicted poor PFS in ovarian cancer patients. OS was always recognized as the primary indicator for cancer patients, especially in patients with advanced cancer ( 14 ). However, OS is characterized as a lifespan starting from the first diagnosis of the treated disease to the event of death, which might miss key information of cancer patients who have been receiving surgery or medication in the hope of improving their survival, especially these who were in the context of advanced cancer. Indeed, there are study groups have shown that an improvement in PFS has not always reflected into an improved OS in patients with lung cancer ( 15 ). Actually, a growing number of evidences indicate the PFS might be a more reasonable surrogate endpoint to represent the effect of treatment on survival ( 11 , 16 ). Indeed, we confirmed that ovarian cancer patients treated with platin or taxol suffered shorter survival when GPR91 was overexpressed in the cancer tissues. These results indicated that GPR91, a G protein-coupled receptor expressed by ovarian cancer tissues, commonly recognized as a succinate receptor, might be resistant to antitumor drugs. Another possible explanation is that platin or taxol probably activate GPR91 signal pathway, but more experiments are needed for confirmation. In addition, we observed that KU60019 enhanced miR-576-3p expression in SKOV3 cells. Previous studies suggested that overexpression of miR-576-3p suppressed PD‑L1 and cyclin D1, leading to increased cisplatin chemosensitivity in ovarian cancer ( 10 ). miR-576-3p could also inhibit the proliferation and migration of glioma cells and bladder cancer cells by targeting different genes, respectively ( 17 , 18 ). miR-576-3p belongs to small non-coding RNAs, which could recognize and bind specific sites in the 3′untranslated region (UTR) of target messenger RNA and restrain the expression of target genes in cancers ( 7 ). Our study revealed a declined expression of miR-576-3p in ovarian cancer tissues and cell lines, which could be reversed by KU60019 stimulation. The molecular mechanism by which KU60019 induced the elevation of miR-576-3p remains unclear, but we showed that miR-576-3p inhibitor could alleviate KU60019 induced cell apoptosis, meanwhile the expression of GPR91 was significantly decreased. In addition, our results also showed that miR-576-3p could potentially bind to the 3’UTR of GPR91, which indicated that KU60019 might inhibit GPR91 expression via miR-576-3p in ovarian cancer. In line with our study, elevated miR-576-3p expression suppressed cell invasion and proliferation, inducing apoptosis by silencing frizzled-related protein 1 in ovarian cancer cell ( 19 ). Recent studies have shown that miR-576-3p could be sponged by hsa_circ_0012673 in breast cancer, the high levels of miR-576-3p impaired the growth and migration of breast cancer cells ( 20 ). Consequently, studies of miR-576-3p might be facilitated for research and treatment of cancer. Taken together, our study illustrated that KU60019 alleviated ovarian cancer cell migration and enhanced cell apoptosis via upregulation of miR-576-3p. Moreover, administration of miR-576-3p inhibitor reserved KU60019 induced cell damage through increased GPR91 expression in ovarian cancer cells. Our results provided novel insights on how ATM blockage induced cell apoptosis and tumor growth limitation, establishing miR-576-3p as a potential antitumor target in ovarian cancer. Materials and Methods Bioinformatics Data Mining Gene expression p datasets (GSE216150, GSE227276) were obtained from the Gene Expression Omnibus ( https://www.ncbi.nlm.nih.gov/gds/?term= ). Expression level of miR576-3p and GPR91, and the correlation between pathological stage and the target gene was analyzed by the online tool UALCAN ( https://ualcan.path.uab.edu/index.html ) and GEPIA ( http://gepia.cancer-pku.cn/ ). Kaplan-Meier Plotter ( http://kmplot.com/analysis/index.php?p=background ) was used to assess the correlation between the expression of target genes and survival in ovarian cancer. Binding site between miR576-3p and GPR91 was predicted by TargetScan ( www.targetscan.org ). Signaling pathways of the target gene were enriched by gene set enrichment analysis (GSEA). Cell Culture SKOV3 cells were cultured in dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Skove cell line was purchased from the Shanghai Zhong Qiao Xin Zhou Biotechnology Co.,Ltd. Drug treatment and transfection ATM inhibitor KU60019 was purchased from Topscience Co. Ltd. ( https://www.tsbiochem.com/ ). KU60019 was dissolved with dimethylsulfoxide, and kept them in the − 80℃ refrigerator. miR576-3p inhibitor and the negative control was purchased from Shanghai GenePharma Co., Ltd. KU60019 was added to stimulate cells at a final concentration of 10 nM for 24 hours. In some experiments, miR576-3p inhibitor or the negative control was added to cells with HiPerFect Transfection Reagent (Qiagen) according to the manufacturer’s protocol. Cell apoptosis analysis Cells treated with KU60019 and/or miR576-3p inhibitor were collected and washed twice with cold phosphate buffer solution. Then, cells were suspended in 100 ul binding buffer and stained with Annexin V- Fluorescein isothiocyanate (FITC)/ propidium iodide (PI) Apoptosis Detection Kit (Yeasen Biotechnology (Shanghai) Co., LTD) according to the manufacturer’s protocols. Analysis of cell apoptosis was determined by the Ariall flow cytometer (BD Biosciences). RNA extraction and Quantitative Real-time PCR Total RNA was extracted from SKOV3 cells using Total RNA Isolation Kit (Yeasen Biotechnology (Shanghai) Co., LTD). Up to 1 ug GPR91 RNA was reversely transcribed into cDNA using Hifair® AdvanceFast 1st Strand cDNA Synthesis Kit (Yeasen Biotechnology (Shanghai) Co., LTD). To detect the expression of miR576-3p, MolPure® Cell/Tissue miRNA Kit was used to obtain miRNA in SKOV3 cells, miRNA 1st Strand cDNA Synthesis Kit (Tolo Biotech Co.,Ltd) was used to obtain cDNA. qPCR was performed using Hieff® qPCR SYBR Green Master Mix(High Rox Plus, Yeasen Biotechnology (Shanghai) Co., LTD). The primer sequence of GPR91 is: F 5’ AAAAAAAAAAAAAAA 3’, R 5’ AAAAAAAAAAAAAAAAAA 3’; miR-576-3p: 5’ AAGATGTGGAAAAATT 3’; GAPDH: F 5’ CTGGGCTACACTGAGCACC 3’, R 5’ AAGTGGTCGTTGAGGGCAATG 3’; U6: F 5’ CGCTTCGGCAGCACATATAC 3’, R 5’ TTCACGAATTTGCGTGTCATC 3’. miR-576-3p inhibitor: 5’ GAUUCCAAUUUUUCCACAUCUU 3’. Inhibitor NC: 5’ CAGUACUUUUGUGUAGUACAA 3’. CCK-8 Cell Viability Assay 10 ul CCK-8 reagent was added to the cells in 96-well plates to a final volume of 100 ul. The 96-well plates were placed at 37℃ for 1 hour and the absorbance at 450 nm was recorded by a microplate reader. Wound healing assay SKOV3 cells with approximately 95% confluence treated with KU60019 and/or miR576-3p inhibitor in 6-well plates were scraped straightly using a 200 ul pipette tip, cell debris were washed with cold phosphate buffer solution. Cells were cultured in DMEM medium with 0.1% fetal bovine serum. Cell migration area was assessed by comparing images at 0 hour and 24 hours. Statistical Analysis The results are represented as mean ± SD. GraphPad 7.0 (San Diego, CA, USA) was used for statistical analyses. Two-tailed Student’s tests were used for two-group comparisons. A p value of less than 0.05 was considered statistically significant. Declarations Acknowledgement N/A. Authors' contributions Yangyang Zhou performed the experiments. Yangyang Zhou, Xiaolei Guo, Rongjing Dang and Lin Cong were involved in experiments and data collection, and figures formation. Yangyang Zhou, Xiaolei Guo, Rongjing Dang, and Lin Cong wrote the manuscript. Xin Zhao revised the manuscript. Xin Zhao conceived the idea and supervised the project. All co-authors have seen and approved the manuscript. Data Availability Statement The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request. Conflicts of interest The authors declare no potential conflicts of interest. I am employed by (hereinafter referred to as the company) on (date) of (date) in the library, and I declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the following guidelines and to report appropriately when there is a potential for actual or potential conflict. These conflicts of interest may be caused by my immediate family members, other members of my family or stakeholders. Therefore, the prohibited sexual behaviors involved in this commitment also involve my immediate family members, other members of my family or stakeholders. I promise that I will write to the president or vice president of the company about the conflicts of interest caused or possible to be caused by my immediate family members, other members of my family or stakeholders Presentation. Competing interests Xiaolei Guo is employed by the Jilin Provincial Junzheng Inspection & testing Technology Co., Ltd. (hereinafter referred to as the company) on 2023, and Xiaolei Guo declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the guidelines of Scientific Reports and to report appropriately when there is a potential for actual or potential conflict. I only participate in the current research for academic purposes. I have no agreements with any for-profit and non-profit research sponsors. The other authors declare that they have no competing interest. Funding N/A. Ethics Statement The current study has been submitted to and approved by the ethics committee of the First Hospital of Jilin University. All authors complied with the ARRIVE guidelines. All experiments were performed in accordance with relevant named guidelines and regulations. References Narod S. Can advanced-stage ovarian cancer be cured? Nature reviews Clinical oncology (2016) 13(4):255-61. Epub 2016/01/21. doi: 10.1038/nrclinonc.2015.224. PubMed PMID: 26787282. Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. CA: a cancer journal for clinicians (2016) 66(2):115-32. Epub 2016/01/26. doi: 10.3322/caac.21338. PubMed PMID: 26808342. Grimley E, Cole AJ, Luong TT, McGonigal SC, Sinno S, Yang D, et al. Aldehyde dehydrogenase inhibitors promote DNA damage in ovarian cancer and synergize with ATM/ATR inhibitors. Theranostics (2021) 11(8):3540-51. Epub 2021/03/06. doi: 10.7150/thno.51885. PubMed PMID: 33664846; PubMed Central PMCID: PMCPMC7914353. Liu HY, Zhang YY, Zhu BL, Feng FZ, Zhang HT, Yan H, et al. MiR-203a-3p regulates the biological behaviors of ovarian cancer cells through mediating the Akt/GSK-3β/Snail signaling pathway by targeting ATM. Journal of ovarian research (2019) 12(1):60. Epub 2019/07/07. doi: 10.1186/s13048-019-0532-2. PubMed PMID: 31277702; PubMed Central PMCID: PMCPMC6612229. Trauelsen M, Hiron TK, Lin D, Petersen JE, Breton B, Husted AS, et al. Extracellular succinate hyperpolarizes M2 macrophages through SUCNR1/GPR91-mediated Gq signaling. Cell reports (2021) 35(11):109246. Epub 2021/06/17. doi: 10.1016/j.celrep.2021.109246. PubMed PMID: 34133934. Gao Y, Qian H, Tang X, Du X, Wang G, Zhang H, et al. Superparamagnetic iron oxide nanoparticle-mediated expression of miR-326 inhibits human endometrial carcinoma stem cell growth. International journal of nanomedicine (2019) 14:2719-31. Epub 2019/05/23. doi: 10.2147/ijn.s200480. PubMed PMID: 31114192; PubMed Central PMCID: PMCPMC6497851. Hill M, Tran N. miRNA interplay: mechanisms and consequences in cancer. Disease models & mechanisms (2021) 14(4). Epub 2021/05/12. doi: 10.1242/dmm.047662. PubMed PMID: 33973623; PubMed Central PMCID: PMCPMC8077553. Greenawalt EJ, Edmonds MD, Jain N, Adams CM, Mitra R, Eischen CM. Targeting of SGK1 by miR-576-3p Inhibits Lung Adenocarcinoma Migration and Invasion. Molecular cancer research : MCR (2019) 17(1):289-98. Epub 2018/09/28. doi: 10.1158/1541-7786.mcr-18-0364. PubMed PMID: 30257988; PubMed Central PMCID: PMCPMC6318035. Li H, Cao B, Zhao R, Li T, Xu X, Cui H, et al. circDNMT1 Promotes Malignant Progression of Gastric Cancer Through Targeting miR-576-3p/Hypoxia Inducible Factor-1 Alpha Axis. Frontiers in oncology (2022) 12:817192. Epub 2022/06/18. doi: 10.3389/fonc.2022.817192. PubMed PMID: 35712504; PubMed Central PMCID: PMCPMC9197105. Zuo Y, Zheng W, Tang Q, Liu J, Wang S, Xin C. miR‑576‑3p overexpression enhances cisplatin sensitivity of ovarian cancer cells by dysregulating PD‑L1 and cyclin D1. Molecular medicine reports (2021) 23(1). Epub 2020/11/26. doi: 10.3892/mmr.2020.11719. PubMed PMID: 33236151. Cooper K, Tappenden P, Cantrell A, Ennis K. A systematic review of meta-analyses assessing the validity of tumour response endpoints as surrogates for progression-free or overall survival in cancer. British journal of cancer (2020) 123(11):1686-96. Epub 2020/09/12. doi: 10.1038/s41416-020-01050-w. PubMed PMID: 32913287; PubMed Central PMCID: PMCPMC7687906. Wang N, Yu M, Fu Y, Ma Z. Blocking ATM Attenuates SKOV3 Cell Proliferation and Migration by Disturbing OGT/OGA Expression via hsa-miR-542-5p. Frontiers in oncology (2022) 12:839508. Epub 2022/07/08. doi: 10.3389/fonc.2022.839508. PubMed PMID: 35795059; PubMed Central PMCID: PMCPMC9251376. Clark KL, Keating AF. Ataxia-telangiectasia mutated coordinates the ovarian DNA repair and atresia-initiating response to phosphoramide mustard. Biology of reproduction (2020) 102(1):248-60. Epub 2019/08/23. doi: 10.1093/biolre/ioz160. PubMed PMID: 31435664. Li Y, Liang X, Li H, Chen X. Comparative efficacy and safety of immune checkpoint inhibitors for unresectable advanced melanoma: A systematic review and network meta-analysis. International immunopharmacology (2023) 115:109657. Epub 2023/01/07. doi: 10.1016/j.intimp.2022.109657. PubMed PMID: 36608446. Hayashi H, Okamoto I, Morita S, Taguri M, Nakagawa K. Postprogression survival for first-line chemotherapy of patients with advanced non-small-cell lung cancer. Annals of oncology : official journal of the European Society for Medical Oncology (2012) 23(6):1537-41. Epub 2011/11/01. doi: 10.1093/annonc/mdr487. PubMed PMID: 22039091. Belin L, Tan A, De Rycke Y, Dechartres A. Progression-free survival as a surrogate for overall survival in oncology trials: a methodological systematic review. British journal of cancer (2020) 122(11):1707-14. Epub 2020/03/28. doi: 10.1038/s41416-020-0805-y. PubMed PMID: 32214230; PubMed Central PMCID: PMCPMC7250908. Liang Z, Li S, Xu X, Xu X, Wang X, Wu J, et al. MicroRNA-576-3p inhibits proliferation in bladder cancer cells by targeting cyclin D1. Molecules and cells (2015) 38(2):130-7. Epub 2015/01/06. doi: 10.14348/molcells.2015.2146. PubMed PMID: 25556372; PubMed Central PMCID: PMCPMC4332027. Hu Q, Liu F, Yan T, Wu M, Ye M, Shi G, et al. MicroRNA‑576‑3p inhibits the migration and proangiogenic abilities of hypoxia‑treated glioma cells through hypoxia‑inducible factor‑1α. International journal of molecular medicine (2019) 43(6):2387-97. Epub 2019/04/25. doi: 10.3892/ijmm.2019.4157. PubMed PMID: 31017266; PubMed Central PMCID: PMCPMC6488173. Wu Y, Zhou J, Li Y, Shi X, Shen F, Chen M, et al. Hsa_circ_0001445 works as a cancer suppressor via miR-576-5p/SFRP1 axis regulation in ovarian cancer. Cancer medicine (2023) 12(5):5736-50. Epub 2022/10/20. doi: 10.1002/cam4.5317. PubMed PMID: 36259450; PubMed Central PMCID: PMCPMC10028118. Qiu X, Zhang Q, Deng Q, Li Q. Circular RNA hsa_circ_0012673 Promotes Breast Cancer Progression via miR-576-3p/SOX4 Axis. Molecular biotechnology (2023) 65(1):61-71. Epub 2022/07/07. doi: 10.1007/s12033-022-00524-x. PubMed PMID: 35794450. Additional Declarations Competing interest reported. Xiaolei Guo is employed by the Jilin Provincial Junzheng Inspection & testing Technology Co., Ltd. (hereinafter referred to as the company) on 2023, and Xiaolei Guo declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the guidelines of Scientific Reports and to report appropriately when there is a potential for actual or potential conflict. I only participate in the current research for academic purposes. I have no agreements with any for-profit and non-profit research sponsors. The other authors declare that they have no competing interest. Supplementary Files supplementaryfigures.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3877379","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":268523955,"identity":"b90eb21d-e10c-4f9e-b9c7-ab0a72316e12","order_by":0,"name":"Yangyang Zhou","email":"","orcid":"","institution":"The First Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Yangyang","middleName":"","lastName":"Zhou","suffix":""},{"id":268523956,"identity":"43d696be-4b13-4701-81a3-d4cd63c662d9","order_by":1,"name":"Xiaolei Guo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaolei","middleName":"","lastName":"Guo","suffix":""},{"id":268523957,"identity":"ce53437f-b399-4918-8fc0-0d67ad8e3999","order_by":2,"name":"Rongjing Dang","email":"","orcid":"","institution":"The First Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Rongjing","middleName":"","lastName":"Dang","suffix":""},{"id":268523958,"identity":"5b9d011c-c3ee-4a9e-8d56-62493d2d630d","order_by":3,"name":"Lin Cong","email":"","orcid":"","institution":"The First Hospital of Jilin University","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Cong","suffix":""},{"id":268523959,"identity":"14833dd8-828d-43ad-8b49-326f3c17d982","order_by":4,"name":"Xin Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYLCCDxUS9W38zQcYEojVwTjjjA1jv8SxBOK1MPO2pDHObMgxIE65/Iz0Z9K8DYeZDQ6c+fzh4Q47Bv72bvyWMfYcSDacu+Mwm8Hh3m0SiWeSGSTOnN2A31HsDQcfvD1zmMfgwNltDIltzAwGErn4tbAxMzYc4G07LGFwIOfxh8S2esJaeNibGR/ytqUZSDbkMEgkth0mrEWC5xizITCQE/gljpkBtRznIegXUIhJAKMygY2/+fHHn23Vcvztvfi1YLqUNOWjYBSMglEwCrACALX1SyVhg/maAAAAAElFTkSuQmCC","orcid":"","institution":"The First Hospital of Jilin University, Jilin University","correspondingAuthor":true,"prefix":"","firstName":"Xin","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2024-01-19 02:44:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3877379/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3877379/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50101069,"identity":"f6930bec-28b5-41d6-80aa-94bd805ba084","added_by":"auto","created_at":"2024-01-24 14:45:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":241544,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of GPR91 and miR-576-3p in ovarian cancer\u003c/p\u003e\n\u003cp\u003eExpression of GPR91 (a) and miR-576-3p (b) in ovarian cancer tissues and adjacent normal tissues was obtained from the TCGA database. (c) Correlation analysis of GPR91 and cancer stage.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/5f6a6c482e168e58a410fa4c.png"},{"id":50101072,"identity":"089d52fe-bb01-42c9-bf63-7c7e73e1b3e2","added_by":"auto","created_at":"2024-01-24 14:45:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":693327,"visible":true,"origin":"","legend":"\u003cp\u003eGPR91 overexpression correlates to patients’ low overall survival carrying ovarian cancer\u003c/p\u003e\n\u003cp\u003eData from 879 patients diagnosed with ovarian cancer were obtained from TCGA database for kaplan-meier survival analysis of patients’ OS (a), PFS (b), and PPS (c) in relation with GPR91 expression. Ovarian cancer patients in stages 2, 3, and 4 was analyzed for OS (d), PFS (e), and PPS (f). Patients treated with platin (g) or taxol (h) were analyzed for PFS.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/94ae78913a698b8628b43dcc.png"},{"id":50101070,"identity":"00d9bc92-ce17-49f6-a2d0-2d5d4c03feef","added_by":"auto","created_at":"2024-01-24 14:45:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":224393,"visible":true,"origin":"","legend":"\u003cp\u003eKU60019 induced cell apoptosis via miR-576-3p upregulation and GPR91 suppression\u003c/p\u003e\n\u003cp\u003e(a) Predicted binding sites of miR-576-3p and GPR91. qRT-PCR analysis of GPR91 (b) and miR-576-3p (c) in IOSE80 cells and SKOV3 cells. SKOV3 cells were treated with 20 uM KU60019 for 24 hours, and the expression of GPR91 (d) and miR-576-3p (e) was detected. (f) Apoptosis ratio in KU60019 treated cells was analyzed by flow cytometry. Data are presented as mean ± SD. ** P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/00d9d3e2e88c27830af00e6e.png"},{"id":50101666,"identity":"2ae0f176-332d-41a0-8d8b-a9afb8da99ea","added_by":"auto","created_at":"2024-01-24 14:53:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1808000,"visible":true,"origin":"","legend":"\u003cp\u003emiR-576-3p reversed KU60019 induced cell apoptosis in ovarian cancer cells\u003c/p\u003e\n\u003cp\u003eOvarian cancer data was collected from TCGA database, expression (a) and GSEA (b) of GPR91 were analyzed. SKOVE cells treated with\u003c/p\u003e\n\u003cp\u003e(a) Expression of GPR91 in ovarian cancer, data was collected from TCGA database. SKOV3 cells were treated with 20 uM KU60019 for 24 hours, cell migration (c), GPR91 (e), and miR-576-3p expression were analyzed. Data are presented as mean ± SD. ** P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/a3bfa444b2c9caba235634a4.png"},{"id":50302342,"identity":"353ac36a-ac4b-485c-878c-c8a463ef6a46","added_by":"auto","created_at":"2024-01-29 12:19:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1229502,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/bb629b55-6fcd-4cbe-bf35-3e228baf905b.pdf"},{"id":50101074,"identity":"4bdda9dd-e194-428c-a888-06b9223e9f80","added_by":"auto","created_at":"2024-01-24 14:45:06","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":106713,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3877379/v1/cd482cd5c3b643f0d61f7dee.pdf"}],"financialInterests":"Competing interest reported. Xiaolei Guo is employed by the Jilin Provincial Junzheng Inspection \u0026 testing Technology Co., Ltd. (hereinafter referred to as the company) on 2023, and Xiaolei Guo declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the guidelines of Scientific Reports and to report appropriately when there is a potential for actual or potential conflict. I only participate in the current research for academic purposes. I have no agreements with any for-profit and non-profit research sponsors. \nThe other authors declare that they have no competing interest.","formattedTitle":"KU60019 induced ATM blockage regulates GPR91/has-miR-576-3p to inhibit ovarian cancer progression","fulltext":[{"header":"Background","content":"\u003cp\u003eTill date, ovarian cancer is one of the leading causes of death in females. There are approximately over 200,000 individuals had been diagnosed with ovarian cancer every year in the world, and nearly half will die of ovarian cancer (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). In addition, it is reported that the mortality of ovarian cancer is increased yearly in China duo to elevated estimated new cases in females (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Increasing ovarian cancer incidence and mortality data alert researchers should be in urgent need of new exploration to uncover the pathogenic mechanism in ovarian cancer progression, and seek new supporting points to treat ovarian cancer. Recently, it was reported that ataxia telangiectasia-mutated gene (ATM) inhibition synergized with aldehyde dehydrogenase restrains successfully induced DNA double stand breaks in ovarian cancer and increases cancer cell sensitivity (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). In accordance with these, a previous study reported that ATM mutations\u003c/p\u003e \u003cp\u003eIn accordance with these, a previous study reported that miR-203a-3p could facilitate ovarian cancer cell apoptosis by targeting ATM (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), indicated a crucial role of ATM in ovarian cancer progression.\u003c/p\u003e \u003cp\u003eGPR91 is a key enzyme that belong to G protein-coupled receptors (GPCRs), which could recognize and bind to succinate, thus, GPR91 is also named as succinate receptor. GPR91 is widely expressed in a variety of cell types, once an agonist binds to GPR91, the polarization of macrophages would be accelerated upon upon Gq/11 and PLC activation (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). It was reported that GPR91 is one of the potential targets of miR-326, proliferation and invasion of human endometrial carcinoma stem cells could be significantly inhibited in miR-326 overexpression conditions, GPR91/STAT3/VEGF pathway was involved in miR-326 regulating systems (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). However, the mechanism of GPR91 in facilitating ovarian cancer growth is still underdetermined.\u003c/p\u003e \u003cp\u003eHsa-miR-576-3p (miR-576-3p) belongs to microRNAs charactered by small non-coding RNAs, and gene regulatory function via recognizing and binding to the 3\u0026prime;untranslated region of target genes (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Reduced miR576-3p was detected in human lung adenocarcinoma, H460 cell migration and invasion could be suppressed by overexpression of miR-576\u0026ndash;3p (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Another study showed that miR576-3p could bind to the 3\u0026rsquo;UTR of HIF-1α, silencing circDNMT1 suppresses the progression of gastric cell migration \u003cem\u003ein vitro\u003c/em\u003e (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). The latest research shows that high levels of miR576-3p in ovarian cancer tissues enhanced cisplatin chemosensitivity by silencing PD-L1 and cyclin D1 (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). These results suggested that miR576-3p might regulate cancer cell growth to intervene the survival of patients. However, the role of miR576-3p in ovarian cancer development is still needed to be fully understood.\u003c/p\u003e \u003cp\u003eIn the present study, we showed an increased expression of GPR91 and declined expression of miR576-3p in ovarian cancer tissues. The expression levels of GPR91 were negatively associated with the overall survival time of ovarian cancer patients. It was predicted that miR576-3p could potentially bind to the 3\u0026rsquo;UTR of GPR91, administration of ATM inhibitor KU60019 induced cell apoptosis by enhancing miR576-3p expression and suppressed GPR91 expression. MiR576 3p inhibitor reversed the KU60019 induced cell apoptosis by elevating GPR91 expression. These findings demonstrated that ATM blockage restrained ovarian cancer cell proliferation and migration through enhancing miR-576-3p expression and suppressed GPR91 expression. GPR91 may be a novel target for ovarian cancer treatment.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eExpression of hsa-miR-576-3p was declined in ovarian cancer tissues\u003c/h2\u003e\n\u003cp\u003eTo explore the level of miR-576-3p in ovarian cancer tissue, we analyzed the data from TCGA database, the results showed a declined expression of miR-576-3p in ovarian cancer tissues, the expression of miR-576-3p in the tissues of advanced patients was lower than that of early patients(Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, stage2 versus stage3\u0026thinsp;=\u0026thinsp;0.00338, stage2 versus stage4\u0026thinsp;=\u0026thinsp;0.00399). In contrast, the expression of GPR91 was significantly increased ovarian cancer tissues (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). In addition, the expression of GPR91 was positively correlated with the cancer stage in ovarian cancer tissues (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec). We also found that the expression of miR-576-3p was gradually increased with age (supplementary Fig.\u0026nbsp;1a), and TP53 mutation did not change miR-576-3p level (supplementary Fig.\u0026nbsp;1b). The findings indicated that the miR-576-3p and GPR91 might involve in the ovarian cancer progression, and the opposite expression level suggested that miR-576-3p might be negatively correlated with GPR91.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eHigh levels of GPR91 predicted a poor outcome in ovarian cancer patients\u003c/h2\u003e\n\u003cp\u003eTo determine whether GPR91 was linked to ovarian cancer patients\u0026rsquo; survival, we plotted Kaplan-Meier survival curve with OS, PFS, and PPS. Although a higher levels of GPR91 had no statistical significance in OS and PPS in ovarian cancer patients (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea and c), PFS of patients with high levels of GPR91 was significantly poorer (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb). As the expression of GPR91 was correlated with cancer stage in ovarian cancer (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec), next we investigated the correlation between GPR91 and survival of patients with different cancer stages. Since the sample size was too small to draw survival curves at stage 1, we showed that a high levels of GPR91 predicted worse PFS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ee) in ovarian cancer patients, but not OS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ed) or PPS (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ef).\u003c/p\u003e\n\u003cp\u003ePFS has the advantage of being able to reflect the improved effect of treatment on patient survival (\u003cspan class=\"CitationRef\"\u003e11\u003c/span\u003e). Thus, we analyzed the impact of different therapeutic agents on patient survival. Unexpectedly, the results showed that patients with high GPR91 expression had significantly reduced PFS compared with those with low GPR91 expression during platin and taxol treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eg-h). In short, GPR91 might be a potential prognostic biomarker on ovarian cancer therapy.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003eKU60019 induced ovarian cancer cell death by reversing miR-576-3p and GPR91 expression\u003c/h2\u003e\n\u003cp\u003eResults from the TARGETSCAN 8.0 showed that miR-576-3p could potentially target GPR91 at 3\u0026rsquo;UTR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea). To unravel whether miR-576-3p and GPR91 were involved in regulating ovarian cancer progression, we detected the expression of which in normal ovarian cells (IOSE80 cells) and ovarian cancer cells (SKOV3 cells). Compared with gene expression, GPR91 was significantly increased in the SKOV3 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb), while a declined expression of miR-576-3p was found in SKOV3 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec). It was reported that ATM is a key protein involved in DNA repair system and tumor progression. Inhibition of ATM by KU60019 could be efficiently suppressed tumor migration and induced cell apoptosis in XX model. In this regard, we first examined the effect of KU60019 on GPR91 and miR-576-3p, and found that the expression of GPR91 was suppressed in SKOV3 cells, while the expression of miR-576-3p was significantly induced upon KU60019 stimulation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed-e). In addition, we found a dramatical increased apoptotic ratio in SKOV3 cells after KU60019 treatment (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ef). These results suggested that GPR91 and miR-576-3p might involve in KU60019 induced ovarian cancer cell apoptosis \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003emiR-576-3p inhibited GPR91 expression in ovarian cancer cells, which reversed KU60019 induced cell apoptosis\u003c/h2\u003e\n\u003cp\u003eGiven the finding that miR-576-3p could potentially bind to GPR91, the high levels of GPR91 predicted a poor prognosis in ovarian cancer patients, which is important\u0026nbsp;for disease progression, we next asked whether these two were functionally\u0026nbsp;linked in ovarian cancer progression. An increased expression of GPR91 was observed in ovarian cancer tissues (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea), GESA analysis showed that GPR91 was significantly enriched in apoptosis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb). Indeed, administration of KU60019 significantly induced cell apoptosis in SKOV3 cells, and miR-576-3p inhibitor reversed the KU60019 induced cell apoptosis (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ec). Furthermore, cell migration ability was also been reversed by inhibiting miR-576-3p in ovarian cancer cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ed). We then questioned whether miR-576-3p inhibitor unleashes more GPR91 in SKOV3 cells. Results showed that miR-576-3p inhibitor reversed KU60019 induced upregulation of miR-576-3p and downregulation of GPR91 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ee-f). These results suggested that GPR91 might be a therapeutic target for ovarian cancer therapy.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAtaxia telangiectasia mutated (ATM) could be activated in response to DNA damage, which lead to phosphorylation of downstream proteins to regulate apoptosis and cell cycle in cancer (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). It was reported that loss of ATM prolonged the diestrus phase in mice, ATM inhibition suppressed phosphoramide mustard induced destroys primordial follicles (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). However, the exact mechanism underlying tumor growth inhibition induced by ATM blockage were still unclear. Our results are crucial in delineating the role of GPR91/miR-576-3p during antitumor therapy with KU60019.\u003c/p\u003e \u003cp\u003eOur discovery of GPR91, one G protein-coupled receptor expressed by ovarian cancer cells, facilitating cancer progression, is based on the aberrant expression of miR-576-3p in patients. We have shown that the expression of GPR91 was increased in ovarian cancer tissues and cell lines, which negatively correlated with the survival of patients. Although there was no significant correlation between GPR91 and OS/PPS, a higher level of GPR91 predicted poor PFS in ovarian cancer patients. OS was always recognized as the primary indicator for cancer patients, especially in patients with advanced cancer (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). However, OS is characterized as a lifespan starting from the first diagnosis of the treated disease to the event of death, which might miss key information of cancer patients who have been receiving surgery or medication in the hope of improving their survival, especially these who were in the context of advanced cancer. Indeed, there are study groups have shown that an improvement in PFS has not always reflected into an improved OS in patients with lung cancer (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Actually, a growing number of evidences indicate the PFS might be a more reasonable surrogate endpoint to represent the effect of treatment on survival (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Indeed, we confirmed that ovarian cancer patients treated with platin or taxol suffered shorter survival when GPR91 was overexpressed in the cancer tissues. These results indicated that GPR91, a G protein-coupled receptor expressed by ovarian cancer tissues, commonly recognized as a succinate receptor, might be resistant to antitumor drugs. Another possible explanation is that platin or taxol probably activate GPR91 signal pathway, but more experiments are needed for confirmation.\u003c/p\u003e \u003cp\u003eIn addition, we observed that KU60019 enhanced miR-576-3p expression in SKOV3 cells. Previous studies suggested that overexpression of miR-576-3p suppressed PD‑L1 and cyclin D1, leading to increased cisplatin chemosensitivity in ovarian cancer (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). miR-576-3p could also inhibit the proliferation and migration of glioma cells and bladder cancer cells by targeting different genes, respectively (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). miR-576-3p belongs to small non-coding RNAs, which could recognize and bind specific sites in the 3\u0026prime;untranslated region (UTR) of target messenger RNA and restrain the expression of target genes in cancers (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Our study revealed a declined expression of miR-576-3p in ovarian cancer tissues and cell lines, which could be reversed by KU60019 stimulation. The molecular mechanism by which KU60019 induced the elevation of miR-576-3p remains unclear, but we showed that miR-576-3p inhibitor could alleviate KU60019 induced cell apoptosis, meanwhile the expression of GPR91 was significantly decreased. In addition, our results also showed that miR-576-3p could potentially bind to the 3\u0026rsquo;UTR of GPR91, which indicated that KU60019 might inhibit GPR91 expression via miR-576-3p in ovarian cancer. In line with our study, elevated miR-576-3p expression suppressed cell invasion and proliferation, inducing apoptosis by silencing frizzled-related protein 1 in ovarian cancer cell (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Recent studies have shown that miR-576-3p could be sponged by hsa_circ_0012673 in breast cancer, the high levels of miR-576-3p impaired the growth and migration of breast cancer cells (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Consequently, studies of miR-576-3p might be facilitated for research and treatment of cancer.\u003c/p\u003e \u003cp\u003eTaken together, our study illustrated that KU60019 alleviated ovarian cancer cell migration and enhanced cell apoptosis via upregulation of miR-576-3p. Moreover, administration of miR-576-3p inhibitor reserved KU60019 induced cell damage through increased GPR91 expression in ovarian cancer cells. Our results provided novel insights on how ATM blockage induced cell apoptosis and tumor growth limitation, establishing miR-576-3p as a potential antitumor target in ovarian cancer.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eBioinformatics Data Mining\u003c/p\u003e\n\u003cp\u003eGene expression p datasets (GSE216150, GSE227276) were obtained from the Gene Expression Omnibus (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/gds/?term=\u003c/span\u003e\u003c/span\u003e). Expression level of miR576-3p and GPR91, and the correlation between pathological stage and the target gene was analyzed by the online tool UALCAN\u0026nbsp;(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ualcan.path.uab.edu/index.html\u003c/span\u003e\u003c/span\u003e) and GEPIA (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gepia.cancer-pku.cn/\u003c/span\u003e\u003c/span\u003e). Kaplan-Meier Plotter (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://kmplot.com/analysis/index.php?p=background\u003c/span\u003e\u003c/span\u003e) was used to assess the correlation between the expression of target genes and survival in ovarian cancer. Binding site between miR576-3p and GPR91 was predicted by TargetScan (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e\u003ca href=\"https://www.ncbi.nlm.nih.gov/gds/?term=\" target=\"_blank\"\u003ewww.targetscan.org\u003c/a\u003e\u003c/span\u003e\u003c/span\u003e). Signaling pathways of the target gene were enriched by gene set enrichment analysis (GSEA).\u003c/p\u003e\n\u003cp\u003eCell Culture\u003c/p\u003e\n\u003cp\u003eSKOV3 cells were cultured in dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Skove cell line was purchased from the Shanghai Zhong Qiao Xin Zhou Biotechnology Co.,Ltd.\u003c/p\u003e\n\u003cp\u003eDrug treatment and transfection\u003c/p\u003e\n\u003cp\u003eATM inhibitor KU60019 was purchased from Topscience Co. Ltd. (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.tsbiochem.com/\u003c/span\u003e\u003c/span\u003e). KU60019 was dissolved with dimethylsulfoxide, and kept them in the \u0026minus;\u0026thinsp;80℃ refrigerator. miR576-3p inhibitor and the negative control was purchased from Shanghai GenePharma Co., Ltd. KU60019 was added to stimulate cells at a final concentration of 10 nM for 24 hours. In some experiments, miR576-3p inhibitor or the negative control was added to cells with HiPerFect Transfection Reagent (Qiagen) according to the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\n\u003cp\u003eCell apoptosis analysis\u003c/p\u003e\n\u003cp\u003eCells treated with KU60019 and/or miR576-3p inhibitor were collected and washed twice with cold phosphate buffer solution. Then, cells were suspended in 100 ul binding buffer and stained with Annexin V- Fluorescein isothiocyanate (FITC)/ propidium iodide (PI) Apoptosis Detection Kit (Yeasen Biotechnology (Shanghai) Co., LTD) according to the manufacturer\u0026rsquo;s protocols. Analysis of cell apoptosis was determined by the Ariall flow cytometer (BD Biosciences).\u003c/p\u003e\n\u003cp\u003eRNA extraction and Quantitative Real-time PCR\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from SKOV3 cells using Total RNA Isolation Kit (Yeasen Biotechnology (Shanghai) Co., LTD). Up to 1 ug GPR91 RNA was reversely transcribed into cDNA using Hifair\u0026reg; AdvanceFast 1st Strand cDNA Synthesis Kit (Yeasen Biotechnology (Shanghai) Co., LTD). To detect the expression of miR576-3p, MolPure\u0026reg; Cell/Tissue miRNA Kit was used to obtain miRNA in SKOV3 cells, miRNA 1st Strand cDNA Synthesis Kit (Tolo Biotech Co.,Ltd) was used to obtain cDNA. qPCR was performed using Hieff\u0026reg; qPCR SYBR Green Master Mix(High Rox Plus, Yeasen Biotechnology (Shanghai) Co., LTD). The primer sequence of GPR91 is: F 5\u0026rsquo; AAAAAAAAAAAAAAA 3\u0026rsquo;, R 5\u0026rsquo; AAAAAAAAAAAAAAAAAA 3\u0026rsquo;; miR-576-3p: 5\u0026rsquo; AAGATGTGGAAAAATT 3\u0026rsquo;; GAPDH: F 5\u0026rsquo; CTGGGCTACACTGAGCACC 3\u0026rsquo;, R 5\u0026rsquo; AAGTGGTCGTTGAGGGCAATG 3\u0026rsquo;; U6: F 5\u0026rsquo; CGCTTCGGCAGCACATATAC 3\u0026rsquo;, R 5\u0026rsquo; TTCACGAATTTGCGTGTCATC 3\u0026rsquo;. miR-576-3p inhibitor: 5\u0026rsquo; GAUUCCAAUUUUUCCACAUCUU 3\u0026rsquo;. Inhibitor NC: 5\u0026rsquo; CAGUACUUUUGUGUAGUACAA 3\u0026rsquo;.\u003c/p\u003e\n\u003cp\u003eCCK-8 Cell Viability Assay\u003c/p\u003e\n\u003cp\u003e10 ul CCK-8 reagent was added to the cells in 96-well plates to a final volume of 100 ul. The 96-well plates were placed at 37℃ for 1 hour and the absorbance at 450 nm was recorded by a microplate reader.\u003c/p\u003e\n\u003cp\u003eWound healing assay\u003c/p\u003e\n\u003cp\u003eSKOV3 cells with approximately 95% confluence treated with KU60019 and/or miR576-3p inhibitor in 6-well plates were scraped straightly using a 200 ul pipette tip, cell debris were washed with cold phosphate buffer solution. Cells were cultured in DMEM medium with 0.1% fetal bovine serum. Cell migration area was assessed by comparing images at 0 hour and 24 hours.\u003c/p\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003cp\u003eStatistical Analysis\u003c/p\u003e\n\u003cp\u003eThe results are represented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. GraphPad 7.0 (San Diego, CA, USA) was used for statistical analyses. Two-tailed Student\u0026rsquo;s tests were used for two-group comparisons. A \u003cem\u003ep\u003c/em\u003e value of less than 0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgement\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eYangyang Zhou performed the experiments. Yangyang Zhou, Xiaolei Guo, Rongjing Dang and Lin Cong were involved in experiments and data collection, and figures formation. Yangyang Zhou, Xiaolei Guo, Rongjing Dang, and Lin Cong wrote the manuscript. Xin Zhao revised the manuscript. Xin Zhao conceived the idea and supervised the project. All co-authors have seen and approved the manuscript.\u003c/p\u003e\n\u003cp\u003eData Availability Statement\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003eConflicts of interest\u003c/p\u003e\n\u003cp\u003eThe authors declare no potential conflicts of interest.\u003c/p\u003e\n\u003cp\u003eI am employed by (hereinafter referred to as the company) on (date) of (date) in the library, and I declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the following guidelines and to report appropriately when there is a potential for actual or potential conflict. These conflicts of interest may be caused by my immediate family members, other members of my family or stakeholders.\u003c/p\u003e\n\u003cp\u003eTherefore, the prohibited sexual behaviors involved in this commitment also involve my immediate family members, other members of my family or stakeholders. I promise that I will write to the president or vice president of the company about the conflicts of interest caused or possible to be caused by my immediate family members, other members of my family or stakeholders Presentation.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eXiaolei Guo is employed by the Jilin Provincial Junzheng Inspection \u0026amp; testing Technology Co., Ltd. (hereinafter referred to as the company) on 2023, and Xiaolei Guo declare the following on the conflict of interest: I promise to avoid conflicts of interest (even superficial conflicts) with the company, its shareholders and its customers. A kind of I undertake to ensure that my personal conduct is in accordance with the guidelines of Scientific Reports and to report appropriately when there is a potential for actual or potential conflict. I only participate in the current research for academic purposes. I have no agreements with any for-profit and non-profit research sponsors. The other authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eN/A.\u003c/p\u003e\n\u003cp\u003eEthics Statement\u003c/p\u003e\n\u003cp\u003eThe current study has been submitted to and approved by the ethics committee of the First Hospital of Jilin University. All authors complied with the ARRIVE guidelines. All experiments were performed in accordance with relevant named guidelines and regulations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNarod S. Can advanced-stage ovarian cancer be cured? \u003cem\u003eNature reviews Clinical oncology\u003c/em\u003e (2016) 13(4):255-61. Epub 2016/01/21. doi: 10.1038/nrclinonc.2015.224. PubMed PMID: 26787282.\u003c/li\u003e\n\u003cli\u003eChen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China, 2015. \u003cem\u003eCA: a cancer journal for clinicians\u003c/em\u003e (2016) 66(2):115-32. Epub 2016/01/26. doi: 10.3322/caac.21338. PubMed PMID: 26808342.\u003c/li\u003e\n\u003cli\u003eGrimley E, Cole AJ, Luong TT, McGonigal SC, Sinno S, Yang D, et al. Aldehyde dehydrogenase inhibitors promote DNA damage in ovarian cancer and synergize with ATM/ATR inhibitors. \u003cem\u003eTheranostics\u003c/em\u003e (2021) 11(8):3540-51. Epub 2021/03/06. doi: 10.7150/thno.51885. PubMed PMID: 33664846; PubMed Central PMCID: PMCPMC7914353.\u003c/li\u003e\n\u003cli\u003eLiu HY, Zhang YY, Zhu BL, Feng FZ, Zhang HT, Yan H, et al. MiR-203a-3p regulates the biological behaviors of ovarian cancer cells through mediating the Akt/GSK-3\u0026beta;/Snail signaling pathway by targeting ATM. \u003cem\u003eJournal of ovarian research\u003c/em\u003e (2019) 12(1):60. Epub 2019/07/07. doi: 10.1186/s13048-019-0532-2. PubMed PMID: 31277702; PubMed Central PMCID: PMCPMC6612229.\u003c/li\u003e\n\u003cli\u003eTrauelsen M, Hiron TK, Lin D, Petersen JE, Breton B, Husted AS, et al. Extracellular succinate hyperpolarizes M2 macrophages through SUCNR1/GPR91-mediated Gq signaling. \u003cem\u003eCell reports\u003c/em\u003e (2021) 35(11):109246. Epub 2021/06/17. doi: 10.1016/j.celrep.2021.109246. PubMed PMID: 34133934.\u003c/li\u003e\n\u003cli\u003eGao Y, Qian H, Tang X, Du X, Wang G, Zhang H, et al. Superparamagnetic iron oxide nanoparticle-mediated expression of miR-326 inhibits human endometrial carcinoma stem cell growth. \u003cem\u003eInternational journal of nanomedicine\u003c/em\u003e (2019) 14:2719-31. Epub 2019/05/23. doi: 10.2147/ijn.s200480. PubMed PMID: 31114192; PubMed Central PMCID: PMCPMC6497851.\u003c/li\u003e\n\u003cli\u003eHill M, Tran N. miRNA interplay: mechanisms and consequences in cancer. \u003cem\u003eDisease models \u0026amp; mechanisms\u003c/em\u003e (2021) 14(4). Epub 2021/05/12. doi: 10.1242/dmm.047662. PubMed PMID: 33973623; PubMed Central PMCID: PMCPMC8077553.\u003c/li\u003e\n\u003cli\u003eGreenawalt EJ, Edmonds MD, Jain N, Adams CM, Mitra R, Eischen CM. Targeting of SGK1 by miR-576-3p Inhibits Lung Adenocarcinoma Migration and Invasion. \u003cem\u003eMolecular cancer research : MCR\u003c/em\u003e (2019) 17(1):289-98. Epub 2018/09/28. doi: 10.1158/1541-7786.mcr-18-0364. PubMed PMID: 30257988; PubMed Central PMCID: PMCPMC6318035.\u003c/li\u003e\n\u003cli\u003eLi H, Cao B, Zhao R, Li T, Xu X, Cui H, et al. circDNMT1 Promotes Malignant Progression of Gastric Cancer Through Targeting miR-576-3p/Hypoxia Inducible Factor-1 Alpha Axis. \u003cem\u003eFrontiers in oncology\u003c/em\u003e (2022) 12:817192. Epub 2022/06/18. doi: 10.3389/fonc.2022.817192. PubMed PMID: 35712504; PubMed Central PMCID: PMCPMC9197105.\u003c/li\u003e\n\u003cli\u003eZuo Y, Zheng W, Tang Q, Liu J, Wang S, Xin C. miR‑576‑3p overexpression enhances cisplatin sensitivity of ovarian cancer cells by dysregulating PD‑L1 and cyclin D1. \u003cem\u003eMolecular medicine reports\u003c/em\u003e (2021) 23(1). Epub 2020/11/26. doi: 10.3892/mmr.2020.11719. PubMed PMID: 33236151.\u003c/li\u003e\n\u003cli\u003eCooper K, Tappenden P, Cantrell A, Ennis K. A systematic review of meta-analyses assessing the validity of tumour response endpoints as surrogates for progression-free or overall survival in cancer. \u003cem\u003eBritish journal of cancer\u003c/em\u003e (2020) 123(11):1686-96. Epub 2020/09/12. doi: 10.1038/s41416-020-01050-w. PubMed PMID: 32913287; PubMed Central PMCID: PMCPMC7687906.\u003c/li\u003e\n\u003cli\u003eWang N, Yu M, Fu Y, Ma Z. Blocking ATM Attenuates SKOV3 Cell Proliferation and Migration by Disturbing OGT/OGA Expression via hsa-miR-542-5p. \u003cem\u003eFrontiers in oncology\u003c/em\u003e (2022) 12:839508. Epub 2022/07/08. doi: 10.3389/fonc.2022.839508. PubMed PMID: 35795059; PubMed Central PMCID: PMCPMC9251376.\u003c/li\u003e\n\u003cli\u003eClark KL, Keating AF. Ataxia-telangiectasia mutated coordinates the ovarian DNA repair and atresia-initiating response to phosphoramide mustard. \u003cem\u003eBiology of reproduction\u003c/em\u003e (2020) 102(1):248-60. Epub 2019/08/23. doi: 10.1093/biolre/ioz160. PubMed PMID: 31435664.\u003c/li\u003e\n\u003cli\u003eLi Y, Liang X, Li H, Chen X. Comparative efficacy and safety of immune checkpoint inhibitors for unresectable advanced melanoma: A systematic review and network meta-analysis. \u003cem\u003eInternational immunopharmacology\u003c/em\u003e (2023) 115:109657. Epub 2023/01/07. doi: 10.1016/j.intimp.2022.109657. PubMed PMID: 36608446.\u003c/li\u003e\n\u003cli\u003eHayashi H, Okamoto I, Morita S, Taguri M, Nakagawa K. Postprogression survival for first-line chemotherapy of patients with advanced non-small-cell lung cancer. \u003cem\u003eAnnals of oncology : official journal of the European Society for Medical Oncology\u003c/em\u003e (2012) 23(6):1537-41. Epub 2011/11/01. doi: 10.1093/annonc/mdr487. PubMed PMID: 22039091.\u003c/li\u003e\n\u003cli\u003eBelin L, Tan A, De Rycke Y, Dechartres A. Progression-free survival as a surrogate for overall survival in oncology trials: a methodological systematic review. \u003cem\u003eBritish journal of cancer\u003c/em\u003e (2020) 122(11):1707-14. Epub 2020/03/28. doi: 10.1038/s41416-020-0805-y. PubMed PMID: 32214230; PubMed Central PMCID: PMCPMC7250908.\u003c/li\u003e\n\u003cli\u003eLiang Z, Li S, Xu X, Xu X, Wang X, Wu J, et al. MicroRNA-576-3p inhibits proliferation in bladder cancer cells by targeting cyclin D1. \u003cem\u003eMolecules and cells\u003c/em\u003e (2015) 38(2):130-7. Epub 2015/01/06. doi: 10.14348/molcells.2015.2146. PubMed PMID: 25556372; PubMed Central PMCID: PMCPMC4332027.\u003c/li\u003e\n\u003cli\u003eHu Q, Liu F, Yan T, Wu M, Ye M, Shi G, et al. MicroRNA‑576‑3p inhibits the migration and proangiogenic abilities of hypoxia‑treated glioma cells through hypoxia‑inducible factor‑1\u0026alpha;. \u003cem\u003eInternational journal of molecular medicine\u003c/em\u003e (2019) 43(6):2387-97. Epub 2019/04/25. doi: 10.3892/ijmm.2019.4157. PubMed PMID: 31017266; PubMed Central PMCID: PMCPMC6488173.\u003c/li\u003e\n\u003cli\u003eWu Y, Zhou J, Li Y, Shi X, Shen F, Chen M, et al. Hsa_circ_0001445 works as a cancer suppressor via miR-576-5p/SFRP1 axis regulation in ovarian cancer. \u003cem\u003eCancer medicine\u003c/em\u003e (2023) 12(5):5736-50. Epub 2022/10/20. doi: 10.1002/cam4.5317. PubMed PMID: 36259450; PubMed Central PMCID: PMCPMC10028118.\u003c/li\u003e\n\u003cli\u003eQiu X, Zhang Q, Deng Q, Li Q. Circular RNA hsa_circ_0012673 Promotes Breast Cancer Progression via miR-576-3p/SOX4 Axis. \u003cem\u003eMolecular biotechnology\u003c/em\u003e (2023) 65(1):61-71. Epub 2022/07/07. doi: 10.1007/s12033-022-00524-x. PubMed PMID: 35794450.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"ataxia telangiectasia-mutated gene, KU60019, G protein-coupled receptors, hsa-miR-576-3p, ovarian cancer","lastPublishedDoi":"10.21203/rs.3.rs-3877379/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3877379/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAtaxia telangiectasia mutated (ATM) protein play a key role in the DNA damage response and sustain genomic stability, targeting which has been widely studied in different types of cancer as a potential therapeutic strategy for antitumor therapies. However, the mechanism of targeting ATM in ovarian cancer has not been fully elaborated. In the current study, we explore the influence of GPR91 on ovarian cancer cells in the context of ATM blockage \u003cem\u003ein vitro\u003c/em\u003e. We identified that GPR91 might be a potential target of miR-576-3p in ovarian cancer cells upon KU60019 treatment. KU60019 induced cell apoptosis by downregulating GPR91 level. Inhibition of miR-576-3p reversed KU60019 induced cell apoptosis by upregulating GPR91 \u003cem\u003ein vitro\u003c/em\u003e. Our results revealed cellular and molecular pathways in KU60019 induced cell death as well as identified a novel potential target for antitumor research.\u003c/p\u003e","manuscriptTitle":"KU60019 induced ATM blockage regulates GPR91/has-miR-576-3p to inhibit ovarian cancer progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-24 14:45:01","doi":"10.21203/rs.3.rs-3877379/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"42724a49-2766-4cdf-81d4-a4dc6a4692c6","owner":[],"postedDate":"January 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":28282455,"name":"Biological sciences/Cancer/Cancer genetics"},{"id":28282456,"name":"Biological sciences/Cancer/Cancer prevention"},{"id":28282457,"name":"Biological sciences/Cancer/Tumour biomarkers"}],"tags":[],"updatedAt":"2024-01-29T12:11:45+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-24 14:45:01","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3877379","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3877379","identity":"rs-3877379","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}