Essential mycobacterial gene glmM as an immunotherapeutic target against tuberculosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Essential mycobacterial gene glmM as an immunotherapeutic target against tuberculosis Vinay Nandicoori, Meetu Agarwal, Ved Prakash Dwivedi, Ashima Bhaskar, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3364986/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Aug, 2024 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Abstract The limitations of TB treatment are the long duration and immune-dampening effects of anti-tuberculosis therapy. The cell wall of mycobacteria helps in its survival, pathogenicity, and virulence and provides resistance against different antibiotics. Hence, cell wall biosynthesis pathways and the enzymes involved are crucial and, thus, are good therapeutic targets. Here, we identify Mycobacterium tuberculosis ( Mtb ) GlmM, (GlmM Mtb ) involved in the UDP-GlcNAc synthesis pathway as an essential enzyme. Using the CRISPR interference-mediated gene silencing approach, we generated a conditional knockdown strain, Rv-glmM kD . Depletion of GlmM Mtb affects the morphology and thickness of the cell wall. The Rv-glmM kD strain attenuated Mtb survival in vitro , in the host macrophages ( ex vivo ), and in a murine mice infection model ( in vivo ). Results suggest that the depletion of GlmM Mtb induces M1 macrophage polarization, prompting a pro-inflammatory cytokine response, apparent from the upregulation of activation markers, including IFNɣ and IL-17 that resists the growth of Mtb . Collectively, these observations provide a rationale for exploring GlmM Mtb as a potential therapeutic target. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Tuberculosis (TB) is a deadly disease caused by one of the most successful and terrifying human pathogens, Mycobacterium tuberculosis ( Mtb ), that silently encompasses most of the human population. Even though anti-tuberculosis therapy (ATT) can eradicate drug-sensitive strains of Mtb in 6–8 months of treatment directly observed treatment short course (DOTS), failure in the implementation of the full course becomes the reason for emerging DR (drug resistant) strains 1 . The major drawback of ATT is that it does not have an immune modulator as suggested by the WHO to control contrary effects on the host (WHO. 2007). Therefore, innovative therapeutic strategies are urgently needed involving the identification of new drug targets and the impact of their inhibition on the host immune system to achieve the END TB target by 2030 (WHO. 2021). Post-infection Mtb is phagocytosed by antigen-presenting cells (APCs), which activate T lymphocytes to upregulate protective pro-inflammatory cytokines 2 , 3 . A complex immunological response is involved in the case of TB that decides the fate of infection predominantly governed by subsets of T lymphocytes 4 . To survive inside stressful conditions offered by host pathogens have developed various mechanisms, for that mycobacterial species have a unique cell wall structure that plays a key role in its growth, virulence, survival inside the host, and escape from immune responses 5 , 6 . The impermeability of cell walls is one major concern that affects the efficacy of existing antibiotics 7 . Therefore, identifying targets that can affect the strength of the cell wall or make it more pores could be an important strategy to deal with the pathogen. Hence, the enzymes involved in cell wall synthesis offer potential targets for new anti-tuberculosis drugs. It is composed of three layers of outer mycolic acid (MA), which is connected to the lower peptidoglycan (PG) layer via middle arabinogalactan (AG). PG is a repeat disaccharide unit (N-acetylmuramic acid-N-acetyl glucosamine) attached to AG through a disaccharide linker (a-L-rhamnosyl-a-D-N-acetylglucosaminosyl-1-phosphate). UDP-N-acetylglucosamine (UDP-GlcNAc) is a direct glycosyl donor of the disaccharide linker and a precursor for PG synthesis, also involved in various reactions 5 . Hence, its biosynthesis is crucial which starts from a glycolytic intermediate D-fructose-6-phosphate 8 . First, Glucosamine-6-phosphate synthase (GlmS) converts fructose-6-phosphate into glucosamine-6-phosphate, which becomes glucosamine-1-phosphate by Phosphoglucosamine mutase (GlmM) activity during the second reaction. Subsequently, glucosamine-1-phosphate acetyltransferase/N-acetylglucosamine-1- phosphate uridyltransferase (GlmU) converts glucosamine-1-phosphate into N-acetylglucosamine-1-phosphate by acetyltransferase activity followed by its uridyltransferase activity and the final product UDP-GlcNAc forms. However, in eukaryotes, glucosamine-6-phosphate converts into N-acetylglucosamine-6-phosphate by the activity of GAT (acetyl-CoA: D-glucosamine-6-phosphate N-acetyltransferase) which further converts into N-acetylglucosamine-1-phosphate by GNA1 (glucose-6-phosphate acetyltransferase; UAP1, UDP-N-Acetylglucosamine Pyrophosphorylase) 9 . The reactions catalyzed by GlmM and the first reaction (acetyltransferase activity) of GlmU are unique to prokaryotes, making them attractive therapeutic targets. By this prediction, GlmU Mtb has been studied thoroughly, and effective inhibitors have been designed, which are under further investigation 10 – 12 . Previously, the importance of GlmM was identified in E. coli , where its inactivation resulted in disturbed morphology and cell lysis 13 . Subsequently, it was studied that ureC from Helicobacter pylori restored the lethal effects of glmM mutant in E. coli 14 . A mutation in glmM affects cell growth, morphology, biofilm formation, and sensitivity to penicillin with increased polymorphonuclear leukocyte (PMN)-dependent killing in Streptococcus gordonii (2008, FEMS, 2009 FEMS). In Bacillus anthracis , crystal structure revealed key residues that play a role in catalysis and specificity 15 . GlmM was identified as a modulator of c-di-AMP levels in Lactococcus lactis and Staphylococcus aureus , where C-di-AMP synthesis enzyme CdaA and DacA was shown to be inhibited by direct binding of GlmM 16 , 17 . GlmM from M. smegmatis, MSMEG_1556 , and Mtb , Rv 3441c have been identified, and the effects of mutation on biofilm formation and antimicrobial susceptibilities have been studied in M. smegmatis 18 , 19 . In this study, we set out to answer if glmM Mtb is essential for bacterial survival and virulence and to what extent. We have performed in vitro , ex vivo and in vivo experiments to examine the importance of this gene in the growth of bacteria outside and inside the host and found that GlmM is essential in all three conditions. Furthermore, we analyzed the host's immune response in the case of mutant and control. Interestingly, we have observed increased pro-inflammatory immune response from macrophages and enhanced Th1 and Th17 cell activation in the spleen of mice in the case of mutants compared to controls. It suggests that GlmM plays a crucial role in mycobacterial virulence, and suppressed expression of GlmM causes a better immune response. Together, the data presented here demonstrate that GlmM Mtb is a viable and promising target for therapeutic intervention against tuberculosis. Results GlmM Mtb is essential for bacterial growth. High-throughput transposon-based mutagenesis studies suggested glmM Mtb to be an essential gene for the in vitro growth of the bacteria 20 , 21 . Thus to understand the requirement of GlmM, we generated knockdown strains of Mtb H37Rv by using the CRISPRi-based approach described earlier 22 . The strain Rv-glmM kD thus generated shows depletion of GlmM in an anhydrotetracycline (ATc)–dependent manner, wherein the addition of ATc results in a knockdown. To confirm, we grew the Rv and Rv-glmM kD in the liquid cultures in the presence and absence of ATc, which showed the inability of the Rv-glmM kD strain to sustain growth in the presence of ATc (Fig. 1 a). To validate that observed growth defects are due to the down-regulation of GlmM Mtb , we compared RNA and protein expression levels in the presence and absence of ATc. Data revealed ~ 50 and ~ 85% suppression at the RNA level in the presence of 25 and 50 (ng/ml) of ATc, respectively, while the level of glmM Mtb in the absence of ATc was comparable to Rv (Fig. 1 b). Western blot analysis showed that in the presence of ATc, the protein levels were significantly lower by the 4th day, which became undetectable 7th day (Fig. 1 c), confirming the generation of glmM Mtb knockdown strain. In all subsequent experiments, we used 50 ng/ml ATc. Next, we analyzed the growth profile of the Rv-glmM kD strain in the presence and absence of ATc by absorbance (A 600 ) and colony-forming unit (CFU) over seven days. As presented in Fig. 1 a, control cultures achieved A 600 of ~ 4.3, while depleted Rv-glmM kD cultures failed to grow beyond A 600 of ~ 0.27 (Fig. 1 d). CFU enumeration indicated > 2 log 10 folds (100 fold) compromised growth in the mutant strain on the 4th day and > 4 log 10 fold differences 6 days post-ATc addition (Fig. 1 e). An ideal target of therapeutic intervention should be essential at different stages of growth, and early intervention should result in pathogen clearance. To evaluate the impact of GlmM depletion at different growth stages, we added ATc on either the day 0, 2nd, 4 th, or 6th-day post-inoculation. We observed a substantial reduction in growth even when ATc was added 4 days post-inoculation (Fig. 1 f). Collectively, results suggest the importance of GlmM at early and late stages of bacterial growth in the extracellular conditions. GlmM is essential for growth in hypoxic conditions. Survival in hypoxic conditions is crucial for being a successful pathogen. It was previously observed that GlmM plays an important role in biofilm formation in M. smegmatis , whose core is hypoxic 18 , 19 . Hence, we examined the survival of the Rv-glmM kD strain in the modified Wayne’s model 23 . Hypoxia was first established (for 20 days), followed by depletion of GlmM by the addition of ATc for 10 and 20 days (Fig. 2 a). The addition of ATc resulted in significantly reduced growth at both time points (Fig. 2 b), indicating the importance of GlmM in hypoxic conditions. Previous studies showed that orthologs of GlmM are involved in cell wall synthesis, and its depletion distorts the morphology of the cell 24 – 26 . To determine the impact of GlmM Mtb depletion on cellular morphology, we performed TEM (transmission electron microscopy) and SEM (scanning electron microscopy) imaging analysis of Rv and Rv-glmM kD cells grown for 96 h in the absence and presence of ATc. The addition of ATc did not impact the cell morphology in the case of Rv . On the other hand, in the absence of GlmM Mtb (+ ATc condition), cells were crumbled and fused (Fig. 2 c). TEM analysis indicated that in the case of Rv and Rv-glmM kD -ATc, the cell wall thickness is comparable. However, there we observed a significant decrease in the cell wall thickness in Rv-glmM kD +ATc samples (Fig. 2 d-e). Together data suggests that the absence of GlmM results in decreased cell wall thickness, eventually crumbling and death. GlmM depletion induces protective immunity inside macrophages. Macrophages are the key cellular source of cytokines that impact the commencement of both innate and adaptive immune arms. It is established from the previous studies that for survival and pathogenesis, Mtb escapes this immune attack by modulating the macrophage defense in its own favor 27 . Macrophages can polarize in two ways M1 and M2; while M1 secretes pro-inflammatory cytokines like IL-1β, IL-6, IL-12, and TNF-α that promotes resistance against Mtb , M2 induces an anti-inflammatory response like IL-10 that favours Mtb growth 28 . Mtb is known to favor M2 polarization and suppress the M1 response 29 . To evaluate the impact of GlmM depletion on bacterial survival in macrophages, we infected peritoneal macrophages (PФ) isolated from C57BL6 mice with Rv and Rv-glmM kd . GlmM was depleted from one set of Rv-glmM kd infected cells by adding ATc in the culture media at 4 h post-infection (p.i) (Fig. 3 a). The infected cells were analyzed at different time point’s p.i for different purposes such as CFU analysis, cytokine profiling and FACS, western blot, and qRT-PCR experiments (Fig. 3 a). We observed compromised survival of knockdown strain in the presence of ATc compared to controls ( Rv and Rv-glmM kD -ATc ). Whereas Rv and Rv-glmM kD -ATc showed 4 and 4.2 log 10 CFU values at 96 h p.i the log 10 CFU value of 2 was observed in Rv-glmM kD +ATc infected cells (Fig. 3 b). We subsequently examined macrophage activation markers in Rv and Rv-glmM kD strain using qRT-PCR and FACS analysis and found significant upregulation of CD86 and MHCII (major histocompatibility complex II) in Rv-glmM kD +ATc infected cells compared with Rv and Rv-glmM kD -ATc infected cells (Fig. 3 C-F). Moreover, Rv-glmM kD strain in the presence of ATc showed increased levels of M1- specific pro-inflammatory cytokines viz. IL-1β, IL-12, TNF-α, IL-6, IL-22 with simultaneous down-regulation of IL-10 (Fig. 3 g). To delineate the molecular mechanism behind this M1-macrophage response, we have investigated MAPK and ERK signaling pathways known to be involved in the production of pro-inflammatory cytokines and the modulation of macrophage polarization 30 , 31 . MAPK phosphorylation in macrophages is associated with Th1 cell activation and differentiation, which is crucial for protecting against Mtb infection 32 . We find that activation of P38 and ERK1/2 pathways as demonstrated by higher levels of phosphorylated proteins in Rv-glmM kD +ATc infected cells compared with either Rv or Rv-glmM kD -ATc infected cells (Fig. 3 h). However, decreased phosphorylation of AKT was observed upon GlmM depletion. Since mTORC and AKT signaling are tightly connected and AKT activation through phosphorylation activates mTORC1 responsible for reduced autophagy supports Mtb survival 33 . Therefore, less phosphorylation of AKT further strengthened the hypothesis that depletion of GlmM improved the anti-mycobacterial response. Collectively, this data suggested that reduction in GlmM expression causes Compromised bacterial survival in macrophages, and it also stimulates pro-inflammatory responses, probably via MAPK signaling. GlmM Mtb is indispensable for Mtb survival and pathogenesis in vivo. GlmM is an important enzyme involved in the synthesis of UDP-GlcNAc, a critical component of cell wall synthesis. Few pathogens are known to use GlcNAc from the host for the synthesis of UDP-GlcNAc, and others are dependent on cell wall recycling for the same in the absence of the UDP-GlcNAc biosynthesis pathway 34 , 35 . However, this information is not available in the case of Mtb . The essentiality of GlmU has been established in previous studies of the lab 12 . If Mtb can utilize the GlcNAc from the host, the activities of GlmS and GlmM may not be essential (Figure. S1). Hence, to investigate the possible presence of alternate pathways, we examined the in vivo survival and pathogenicity of Rv-glmM kD in a murine infection model. Mice were challenged with Rv and Rv-glmM kD strains through the aerosol route (Fig. 4 a). CFU enumeration 24 h pi suggested efficient and equivalent deposition of both the strains Rv and Rv-glmM kD in the lungs of mice (Fig. 4 b). Depletion of GlmM was initiated 1 day p.i by providing doxycycline (Dox) through drinking water, and CFUs were enumerated four weeks p.i. The bacillary load was significantly lower in the lungs and spleen of Rv-glmM kD infected mice treated with Dox compared with the absence of Dox treatment (Fig. 4 b). Rv -infected mice treated with Dox were used as the reference control mice for CFU enumeration (Fig. 4 b). Subsequently, we sought to investigate the impact of GlmM depletion from an established infection. Mice were infected with Rv and Rv-glmM kD , and the infection was allowed to be established for two weeks (Fig. 4 c). Subsequently, Rv-glmM kD mice were divided into two group’s one group was given Dox for 4 or 8 weeks to deplete GlmM Mtb . CFUs were comparable for Rv and Rv-glmM kD at 1-day and 2 weeks p.i. CFUs enumerated 4- and 8-weeks post Dox treatment in Rv-glmM kD showed ~ 2.5 and 4 log 10 fold decrease, respectively, compared with mice untreated with Dox (Fig. 4 c). A similar trend was observed in the spleen as well. Gross pathology and histopathology data strengthened the observation wherein no significant granuloma formation was observed in the Rv-glmM kD +Dox samples (Figure S2). Together, this data suggest that GlmM is critical for the survival of Mtb within the host at acute and chronic stage of infections. Depletion of GlmM induces host protective immune response against Mtb . Strength of host immune system and pathogen determine the eventual outcome of an infection. It is apparent from the data presented in Fig. 4 that the depletion of glmM significantly decreased bacillary load suggesting that the strength of pathogen is lower, vis v vis host immune system. Thus, we set out to examine the host immune response in the mice infected with Rv or Rv-glmM kD in the absence and presence of Dox. Towards this, we infected C57BL6 mice with a low dose of Rv or Rv-glmM kD and glmM was depleted in one set for a period of 60 days (Fig. 5 a). As anticipated in Rv + Dox or Rv-glmM kD -Dox infected samples the bacillary load was comparable, while the Rv-glmM kD +Dox infected mice did not show any CFUs (Fig. 5 b). Antigen-presenting cells and Th1 cells are the key players contributing to the immunological control of Mtb infection 27 . Hence, we profiled various immune cells in the spleen of infected mice. The gating strategy used in this study is depicted in Figure S3. Increased percentage of CD11b + cells with enhanced expression of co-stimulatory molecules CD86 + and MHCII + was observed in the spleen of RvΔglmM + Dox infected mice compared to Rv + Dox or Rv-glmM kD -Dox (Figure S4). We also observed a significant increase in CD4 + and CD8 + T cells in the spleen of mutant-infected mice (Figure S4). Presence of increased CD69 surface expression (Fig. 5 c), suggests activation of both CD4 + and CD8 + T cells (Fig. 5 c). Differentiation of CD4 + and CD8 + cells into protective Th1 and Th17 subsets was evident by the significant increase in gamma interferon (INFɣ) and Interleukin 17 (IL-17) levels in the splenic T cells of Rv-glmM kD +Dox infected mice compared to Rv + Dox or Rv-glmM kD -Dox (Fig. 5 d-g). RT PCR analysis of spleenocytes demonstrated increased expression of macrophage activation markers CD86, MHCII, and pro-inflammatory cytokines IL-1β, IL-12, TNF-α, IL-6, while no significant change in IL-10 in Rv-glmM kD +Dox infected samples compared with Rv + Dox or Rv-glmM kD -Dox (Fig. 5 h-i). Th17 cell responses play an important role in establishing protective immune responses against TB 3 and do not majorly contribute to primary immune response 36 . We think that activation of Th17 response by targeting GlmM Mtb can also help the host in recall responses. Together these results suggests a shift in the immune response in favor of host upon GlmM depletion. Discussion The mycobacterium cell wall is composed of a complex structure comprising highly impermeable mycolyl-arabinogalactan-peptidoglycan (mAGP) complex, that play an important role in survival and maintaining a cell shape. Due to the presence of such protective wall Mtb is able to replicate in the hostile environment of macrophages and resist the action of several therapeutic agents 37 . PG of this complex seems unexceptional but it contains various molecular subtleties that help Mtb to enter into the non-replicative dormant stage 5 . Most of the β-lactam antibiotics are ineffective in case of Mtb due to impermeability and highly active β-lactamase (BlaC) that efficiently hydrolyses many β-lactam drugs to render them ineffective 38 . Fosfomycin, a MurA inhibitor does not work in the case of Mtb due to alteration in single amino acid in mycobacterial MurA 39 . D-Cycloserine prevents L-alanine racemase (alr) and dipeptidyl synthetase (ddl) resulting into hindered formation of pent peptide side chains of PG but due to toxic effects on the central nervous system, its use is severely limited to MDR-TB 40 . A large proportion of the cell wall PG is cross-linked by non-classical l,d-transpeptidases, which are intrinsically impervious to these antibiotics 41 . Hence, the enzymes that catalyze the PG biosynthesis pathway are essential to bacterial cells and their restriction to the prokaryotes collectively makes them an attractive target for the development of new antibiotics. Biosynthesis of UDP-GlcNAc, a central metabolite for both PG and AG synthesis are involves three enzymes, GlmS, GlmM, and GlmU. In this study, we generated a knockdown of glmM in Mtb and examined its impact on growth and survival in in vitro, ex vivo, and in vivo. In compliance with the earlier studies reported for M. smegmatis , the closest nonpathogenic homolog of Mtb 19 GlmM Mtb was also found essential for the in vitro growth of bacteria (Fig. 1 ). GlmM is part of cell wall synthesis machinery and its role in morphology has been demonstrated in orthologs 24 , 26 . Here, SEM and TEM analysis revealed the crumpling of Mtb cells and diluted cell wall, respectively in the case of mutant (Fig. 2 ). Mycobacterial cell wall undergoes cell wall remodeling during hypoxia to adapt to the environment. Hence, we speculate that GlmM may play some role in hypoxic conditions since its role in biofilm formation has been shown earlier with orthologs 18 . In line with this hypothesis, bacterial survival was significantly reduced in hypoxic condition upon GlmM depletion (Fig. 2 ). In addition to the de novo pathway wherein fructose-6-phosphate an intermediate of glycolysis changed into UDP-GlcNAc, salvage pathway is known to occur in some other bacteria and parasites 42 . In the salvage pathway, GlcNAc is taken from the host or available through cell wall recycling to the cytosol 43 . GlcNAc gets phosphorylated and converted into GlcNAc-6-phosphate and then GlcNAc-1-phosphate or directly to GlcNAc-1-phosphate which can enter in different parts of the synthesis. Therefore, the lack of information on such pathways in Mtb makes us interested to investigate the essentiality of GlmM for Mtb survival inside the host. Here we speculate, if a salvage pathway exists in Mtb for the synthesis of UDP-GlcNAc, in the absence of isomerase enzyme GlmM, bacteria should survive in the mutant. However, it was not reflected in ex vivo experiments performed using peritoneal macrophages, and Mtb survival was compromised in the absence of GlmM (Fig. 3 ). To further authenticate our ex vivo results we used the murine infection model for in vivo experiments and found reduced GlmM expression result in less bacterial survival and pathogenicity (Fig. 4 ). Moreover, GlmM Mtb was crucial for bacterial survival in all the stages of infection including before and after the establishment of infection (Fig. 4 ). Hence, it is conceivable that GlmM Mtb is essential for bacterial survival in in vitro, ex vivo and in vivo conditions. During Mtb infection, the immune system plays a critical role to control the replication and survival of the mycobacteria inside the host, in the presence of a strong immune response Mtb enters into dormant a non-replicative stage. It is established that Mtb infection is more prevalent in the absence of an appropriate Th1 immune response 44 . The extent of Mtb infection correlates with the dynamics of pro- and anti-inflammatory responses which stimulate T helper cell differentiation. Interestingly, we found that down-regulation of GlmM not only inhibits Mtb growth it simultaneously encourages the host immune system to fight better against infection. For that it stimulates macrophage towards the M1 response that secretes pro-inflammatory cytokines like IL-1β, IL-12, IL-6, IL-22, and TNFα (Fig. 3 ). However, the expression of anti-inflammatory cytokine IL-10 which promotes Mtb growth was less. To deepen more in the mechanism via which this pro-inflammatory response is occurring we observed the activation of p38 and ERK by phosphorylation (Fig. 3 ). P38 and ERK are MAPK which are known to stimulate the expression of proinflammatory cytokines and multiple effector molecules that will aid in protective host immunity during Mtb infection. Furthermore, activation of IFNɣ and IL-17 was observed in the isolated spleen of glmM mutant infected mice (Fig. 5 ). The development of novel inhibitors for essential and conserved Mtb pathways is one potential strategy to shorten the duration of TB chemotherapy and eradicate drug-resistant TB. With the advancement of genome sequencing and molecular biology of mycobacteria it is possible to identify essential bacterial pathways for drug development. Enzymes of UDP-GlcNAc pathway, especially GlmM due to its uniqueness to bacteria indeed offer an attractive target for new TB drug development. Here, in this study by giving a host immune angel we have suggested a distinct cause for importance of GlmM Mtb . The present study has given deep insight knowledge about the potential of GlmM enzyme for designing inhibitors, which will be further used together with current TB drugs for more effective TB treatment. Material and Methods Materials and growth conditions. Oligonucleotides (Table 1 ) were procured from Sigma. Doxycycline hydrochloride was purchased from Bio-chem Pharmaceutical. Antibodies used in this study; Anti-Mouse: CD3-Pacific Blue, CD4-QR, CD8-APCCy7, CD69-PE, IFNγ-BV510, IL17-BV650, CD11b-APCCy7, CD86-PerCPCy5.5, MHCII-PE from Biolegend, USA. Anti-human/anti-mouse: ERK, p-ERK, AKT, p-AKT, p38, P-p38, β-Actin were purchased from Cell Signaling Technologies. 7H9 medium supplemented with 10% ADC (NaCl, dextrose, bovine serum albumin, and catalase), 0.2% glycerol, and 0.1% Tween 80 was used for the liquid growth of Mtb strains. 7H11 agar with 10% OADC (ADC and oleic acid) and 0.2% glycerol were used for Mtb strain growth on plates. Mtb recombinants were selected on kanamycin (25 mg/mL). Medium components were from BD Difco, Sigma-Aldrich, and Hi-Media. Molecular grade reagents were procured from Merck, Ameresco, or Sigma; restriction-modification enzymes were from NEB; and SEM chemicals were from Electron Microscopy Sciences. Table 1 List of the Primers used in the study: Primer Sequence (5’-3’) IL10 Forward Primer CATGGGTCTTGGGAAGAGAA IL10 Reverse Primer AACTGGCCACAGTTTTCAGG IL6 Forward Primer CCGGAGAGGAGACTTCACAG IL6 Reverse Primer TCCACGATTTCCCAGAGAAC TNFα Forward Primer TAGCCAGGAGGGAGAACAGA TNFα Reverse Primer TTTTCTGGAGGGAGATGTGG GAPDH Forward Primer AACTTTGGCATTGTGGAAGG GAPDH Reverse Primer GGATGCAGGGATGATGTTCT IL1β Forward Primer CCCAAGCAATACCCAAAGAA IL1β Reverse Primer GCTTGTGCTCTGCTTGTGAG IL22 Forward Primer CCGAGGAGTCAGTGCTAAGG IL22 Reverse Primer CATGTAGGGCTGGAACCTGT IL12p40 Forward Primer AAGGAACAGTGGGTGTCCAG IL12p40 Reverse Primer GGAGACACCAGCAAAACGAT CD86 Forward Primer TGTTTCCGTGGAGACGCAAG CD86 Reverse Primer TTGAGCCTTTGTAAATGGGCA MHCII(H2-AB) Forward Primer AGCCCCATCACTGTGGAGT MHCII(H2-AB) Reverse Primer GATGCCGCTCAACATCTTGC glmM Forward RT primer GGATCGACTCACCTTGACC glmM Reverse RT primer TCACCGGCCTCTTTCATTG sigA Forward RT primer CCATCCCGAAAAGGAAGACC sigA Reverse RT primer TCGAGGTCTGGTTCAGCGTC Construction of knockdown strains using CRISPRi To achieve the repression of Rv3441c ( glmM ) gene, a pair of complementary oligonucleotides specific to the target ORFs near the 5’-end were synthesized, annealed, and cloned in pDCas9 + at AflII–AcII sites. This plasmid contains Dcas9, as described previously 22 . Recombinants were electroporated in Mtb H37 Rv to generate Kan R knockdown strains. Since the plasmid contained a tetracycline-inducible promoter suppression was achieved by treatment of bacterial cultures with ATc. Growth rate kinetics. Exponential-phase cultures of Rv , Rv-glmM kD -ATc, and Rv-glmM kD +ATc strains grown in Middlebrook 7H9-ADC medium were seeded at an optical density at 600 nm (OD600) of;0.05 in 7H9 medium. OD600 was monitored every 24 h, and the CFU were enumerated by serially diluting the cultures and plating them on 7H11 agar. Western blot analysis Rv , Rv-glmM kD strains grown in the absence of ATc were seeded at OD ~ 0.05 in the absence or presence of 50 ng/ml ATc. 1 Whole-cell lysates (WCLs) were prepared as described previously 45 at different times points according to the Fig. 1 . RIPA buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1.0% NP-40, 0.5% Sodium deoxycholate, 0.1% SDS) freshly supplemented with complete protease inhibitor and PhosSTOP purchased from Roche was used to prepare WCLs of peritoneal macrophages. Concentrations of WCLs were estimated using the Bradford protein estimation method, Samples were electrophoresed on SDS-PAGE and electro-blotted onto nitrocellulose membranes (Bio-Rad). After blocking with 5% BSA prepared in PBST (PBS and 0.05% Tween-20), blots were probed for different proteins using corresponding antibodies acquired from CST (Anti-human/anti-mouse: ERK, p-ERK, AKT, p-AKT, p38, P-p38, β-Actin ) except α-GlmM, α-GroEL1 which were in-house generated. Blots were developed on autoradiograms using chemiluminescent HRP substrate (ECL, Millipore). RNA isolation and qPCR analysis. For bacteria, total RNA was isolated from exponentially growing bacteria cells as described in 46 . Briefly, to isolate total RNA, cells were inoculated at 0.05 OD in the presence or absence of ATc and allowed to grow for three days. Cells were re-suspended in trizol reagent (Invitrogen), and total RNA was isolated from following mycobacterial cells followed by cDNA synthesis using iScript cDNA synthesis kit (Bio-Rad). qRT-PCRs was performed using the respective primers (Table 1 ). For peritoneal macrophages and splenocytes, total RNA was isolated using standard RNA isolation protocol followed by cDNA synthesis. Real-time PCR was performed using SYBR Green Master Mix (Bio-Rad). Bio-Rad Real-Time thermal cycler (BioRad, USA) was used for Real-time quantitative RT-PCR analysis. The list of Primers used in the study is provided in the Table 1 . Hypoxia experiment. In vitro , hypoxia stress was assessed through a modified Wayne’s hypoxia model as described earlier 12 . Briefly, bacterial strains were inoculated in 7H9-ADC at an OD 600 of; 0.1; 1.5 mg/mL of methylene blue was added to a visual redox indicator. The experiment was carried out in tightly sealed glass tubes with 15% headspace at 37°C without agitation. ATc (50 ng/ml) were injected into the cultures on 20th day and the number of CFUs was determined at different time points. For that Bacterial cells were serially diluted and plated on 7H11-OADC agar, and after 15 days colonies appeared and counted. Peritoneal macrophage infections. BALB/c and C57BL6 mice of 4–6 weeks were maintained in the Animal facility at ICGEB, New Delhi, India. Mice were accessed and obtained for experimental procedures from the facility. C57BL/6 mice were injected intra-peritoneally with 2 ml of 4% thioglycollate (Sigma). Five days later, ice-cold PBS was injected into the peritoneal cavity to extract macrophages. Cells were counted and seeded in RPMI-1640 medium supplemented with 10% fetal bovine serum, (FBS) (Thermo fisher scientific Inc or Hyclone). Cells were washed with PBS to remove non-adherent cells after overnight incubation at 37˚C and 5% CO2. For infection, single cell suspensions were prepared from Log phase cultures of Rv and Rv-glmM kD strains by passing through a 26 gauge needle 5 times. Cells were infected at MOI of 1:10 (cell: bacteria). 4 h post-infection (p.i) media was removed, cells were washed twice to remove extracellular bacteria. The cells were replenished with RPMI media containing 10% FBS with or without 50 ng/ml ATc. 24, 48, 72, or 96 h pi; cells were lysed in 100 µl of 0.02% SDS and CFUs were enumerated in different dilutions on OADC-containing 7H11 agar plates Murine infection experiment. Rv and Rv-glmM kD cultures were revived and grown up to exponential phase OD 600 ~ 0.8, cultures were washed and re-suspended in the 1X sterile PBS, and single-cell suspensions were prepared by passing the culture five times through a 26 gauge needle. Bacterial cell suspension (1.5 * 10 6 cells per ml) total volume of 15 ml was placed in the nebulizer of the Madison aerosol chamber. Mice were grouped and labeled according to the experiment. First, bacterial deposition was checked in the lungs at 24 hpi. Doxycycline hydrochloride, (1 mg/ kg with 5% dextrose in drinking water) was provided as specified in the figures/ legends, either from the time of the infection (day 1) or after establishment of infection (21 days pi). 5–6 mice from each group were sacrificed at different time points and organs (lungs and spleen) were harvested, homogenized in 0.2 µm filtered PBS, plated in different dilutions onto 7H11 Middlebrooks (Difco™) plates comprising 10% oleic acid, albumin, dextrose, and catalase (OADC) and incubated at 37°C for 21–28 days. Mtb colonies were counted on different dilutions and CFUs were estimated as per dilution. Half the lung and spleen tissues were used for immune cell profiling. For histology1/4th portion of lung tissues were fixed in 10% neutral buffered formalin solution and coated with wax for sectioning followed by hematoxylin and eosin (H and E) staining and examine under a microscope. Granulomas for each animal in every group were screened in 5 different fields. Images in figures are illustrative of visualized section images. Scanning electron microscopy and transmission electron microscopy. Rv and Rv-glmM kD strains were grown in the absence and presence of ATc at an OD 600 of; 0.6, harvested from 10-mL cultures. Scanning and Transmission electron microscopy (SEM & TEM) analysis of these samples were performed as described earlier 12 . Briefly, for TEM, cells were fixed, gradually dehydrated, and polymerized using Epson 812 resin; 63-nm sections were cut using an ultramicrotome (Leica) and subsequently stained using uranyl acetate and lead citrate for visualization under a Tecnai G2 20 twin (FEI) transmission electron microscope (). Cell length, width, and thickness were quantified with the help of Smart TIFF software and Carl Zeiss Tiff Annotation Editor. Histology Lung tissues were fixed in formalin solution and coated with wax for sectioning. Sections were stained with Hematoxylin and Eosin (H and E) dyes and slides were scored for granulomas by analyzing under a light microscope Flow cytometry: surface and intracellular staining For ex vivo experiments, infected macrophages were taken out 48h pi and stained for different surface markers and intracellular cytokines as described in 47 . Briefly, macrophages were surface stained with CD11b (APC/Cy7), CD86 (PerCPCy5.5), and MHC-II (PE). For in vivo infections spleen and lungs from mice of different group were isolated and macerated in ice-cold RPMI 1640 (Hyclone) media supplemented with 10% FBS using frosted glass slides to make single cell suspension. RBC lyse was done using RBC lysis buffer, and cells were washed with 10% RPMI 1640. Cells were counted and 1×10 6 cells per well were seeded in 12 well plates for staining. Cells were activated using 10 µg/ml cell surface antigen (CSA) stimulation. Subsequently, 0.5 µg/ml Brefeldin and Monensin solutions (Bio Legend) were added during the last 4 hrs of culture. After treatment cells were washed with FACS buffer (PBS + 3% FBS) twice followed by antibody staining against surface markers and then 30 min fixation with 100 µl fixation buffer (Bio Legend). In the case of intracellular staining cells were first permeabilized using permeabilizing buffer (Bio Legend) then staining was done with fluorescently labeled anti-cytokine antibodies. Anti-Mouse: CD3-Pacific Blue, CD4-QR, CD8-APCCy7, CD69-PE, IFNγ-BV510, IL17-BV650, from Biolegend, USA. The intensity of fluorochromes was assessed by flow cytometry (BD LSRFortessa Cell Analyzer—Flow Cytometers, BD Biosciences) followed by data analysis via FlowJo (Tree Star, USA). Declarations Acknowledgments We acknowledge the support of the DBT-supported Tuberculosis Aerosol Challenge Facility at the International Centre for Genetic Engineering and Biotechnology (ICGEB), New Delhi, India, and their staff in accomplishing this work. This work was supported by the funding provided by the Department of Biotechnology, Government of India (BT/PR13522/COE/34/27/2015) to VKN. M.A. acknowledges the DST-INSPIRE Faculty Fellowship, DST, and the Government of India (DST/INSPIRE/04/2019/002743). A.B. receives a DST-INSPIRE Faculty Fellowship from the Department of Science and Technology (DST), Government of India, and an HGK-IYBA Fellowship from the Department of Biotechnology, Government of India. Author Contribution Data curation: Meetu Agarwal, Biplab Singha, Archna Singh, Shivam Chaturvedi, Ashima Bhaskar, Nisheeth Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori Formal analysis: Meetu Agarwal, Ashima Bhaskar, Biplab singha, Archna Singh, Ved Prakash Dwivedi, Vinay Kumar Nandicoori Funding acquisition: Meetu Agarwal, Vinay Kumar Nandicoori. Investigation: Meetu Agarwal, Biplab Singha, Ashima Bhaskar, Ved Prakash Dwivedi, Methodology: Meetu Agarwal, Biplab singha, Shivam Chaturvedi, Archna Singh, Ashima Bhaskar, Ved Prakash Dwivedi, Supervision: Meetu Agarwal, Vinay Kumar Nandicoori. Validation: Meetu Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori. Visualization: Meetu Agarwal, Vinay Kumar Nandicoori. Writing – original draft: Meetu Agarwal Writing – review & editing: Meetu Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori. Competing interest The authors declare no conflict of interest. Ethics statement . Animal experimentation: Animal experiments were carried out in accordance with the guidelines approved by the Animal Ethics Committee of National Institute of Immunology (NII, Approval ID: IAEC#462/18), New Delhi, India, International Centre for Genetic Engineering and Biotechnology (ICGEB, approval ICGEB/IAEC/18092021/IMB-19), New Delhi, India and the Department of Biotechnology (DBT) Government of India. Mice were ethically sacrificed according to institutional and DBT regulations. References Laurenzi, M., Ginsberg, A. & Spigelman, M. Challenges associated with current and future TB treatment. Infect. Disord. Drug Targets 7 , 105–119 (2007). Choi, H.-G. et al. Antigen-Specific IFN-γ/IL-17-Co-Producing CD4+ T-Cells Are the Determinants for Protective Efficacy of Tuberculosis Subunit Vaccine. Vaccines 8 , 300 (2020). Khader, S. A. et al. IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat. Immunol. 8 , 369–377 (2007). Cadena, A. M., Flynn, J. L. & Fortune, S. M. The Importance of First Impressions: Early Events in Mycobacterium tuberculosis Infection Influence Outcome. mBio 7 , e00342-00316 (2016). Alderwick, L. J., Harrison, J., Lloyd, G. S. & Birch, H. L. The Mycobacterial Cell Wall--Peptidoglycan and Arabinogalactan. Cold Spring Harb. Perspect. Med. 5 , a021113 (2015). Brennan, P. J. & Nikaido, H. The envelope of mycobacteria. Annu. Rev. Biochem. 64 , 29–63 (1995). Jacobo-Delgado, Y. M., Rodríguez-Carlos, A., Serrano, C. J. & Rivas-Santiago, B. Mycobacterium tuberculosis cell-wall and antimicrobial peptides: a mission impossible? Front. Immunol. 14 , 1194923 (2023). Soni, V., Rosenn, E. H. & Venkataraman, R. Insights into the central role of N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU) in peptidoglycan metabolism and its potential as a therapeutic target. Biochem. J. 480 , 1147–1164 (2023). Milewski, S., Gabriel, I. & Olchowy, J. Enzymes of UDP-GlcNAc biosynthesis in yeast. Yeast Chichester Engl. 23 , 1–14 (2006). Han, X. et al. Action of Dicumarol on Glucosamine-1-Phosphate Acetyltransferase of GlmU and Mycobacterium tuberculosis. Front. Microbiol. 10 , 1799 (2019). Singh, M., Kempanna, P. & Bharatham, K. Identification of Mtb GlmU Uridyltransferase Domain Inhibitors by Ligand-Based and Structure-Based Drug Design Approaches. Mol. Basel Switz. 27 , 2805 (2022). Soni, V. et al. Depletion of M. tuberculosis GlmU from Infected Murine Lungs Effects the Clearance of the Pathogen. PLoS Pathog. 11 , e1005235 (2015). Mengin-Lecreulx, D. & van Heijenoort, J. Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli. J. Biol. Chem. 271 , 32–39 (1996). De Reuse, H., Labigne, A. & Mengin-Lecreulx, D. The Helicobacter pylori ureC gene codes for a phosphoglucosamine mutase. J. Bacteriol. 179 , 3488–3493 (1997). Mehra-Chaudhary, R., Mick, J. & Beamer, L. J. Crystal Structure of Bacillus anthracis Phosphoglucosamine Mutase, an Enzyme in the Peptidoglycan Biosynthetic Pathway ▿. J. Bacteriol. 193 , 4081–4087 (2011). Tosi, T. et al. Inhibition of the Staphylococcus aureus c-di-AMP cyclase DacA by direct interaction with the phosphoglucosamine mutase GlmM. PLoS Pathog. 15 , e1007537 (2019). Zhu, Y. et al. Cyclic-di-AMP synthesis by the diadenylate cyclase CdaA is modulated by the peptidoglycan biosynthesis enzyme GlmM in Lactococcus lactis. Mol. Microbiol. 99 , 1015–1027 (2016). Kang, J. et al. Effect of phosphoglucosamine mutase on biofilm formation and antimicrobial susceptibilities in M. smegmatis glmM gene knockdown strain. PloS One 8 , e61589 (2013). Li, S. et al. Identification of M. tuberculosis Rv3441c and M. smegmatis MSMEG_1556 and essentiality of M. smegmatis MSMEG_1556. PloS One 7 , e42769 (2012). Griffin, J. E. et al. High-Resolution Phenotypic Profiling Defines Genes Essential for Mycobacterial Growth and Cholesterol Catabolism. PLOS Pathog. 7 , e1002251 (2011). Levendosky, K., Janisch, N. & Quadri, L. E. N. Comprehensive essentiality analysis of the Mycobacterium kansasii genome by saturation transposon mutagenesis and deep sequencing. mBio e0057323 (2023) doi:10.1128/mbio.00573-23. Choudhary, E., Thakur, P., Pareek, M. & Agarwal, N. Gene silencing by CRISPR interference in mycobacteria. Nat. Commun. 6 , 6267 (2015). Wayne, L. G. & Hayes, L. G. An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. Infect. Immun. 64 , 2062–2069 (1996). Shimazu, K. et al. Identification of the Streptococcus gordonii glmM gene encoding phosphoglucosamine mutase and its role in bacterial cell morphology, biofilm formation, and sensitivity to antibiotics. FEMS Immunol. Med. Microbiol. 53 , 166–177 (2008). Urano-Tashiro, Y., Saiki, K., Yamanaka, Y., Ishikawa, Y. & Takahashi, Y. Streptococcus gordonii DL1 evades polymorphonuclear leukocyte-mediated killing via resistance to lysozyme. PLoS ONE 16 , e0261568 (2021). Yajima, A. et al. Contribution of phosphoglucosamine mutase to the resistance of Streptococcus gordonii DL1 to polymorphonuclear leukocyte killing. FEMS Microbiol. Lett. 297 , 196–202 (2009). Flynn, J. L., Chan, J. & Lin, P. L. Macrophages and control of granulomatous inflammation in tuberculosis. Mucosal Immunol. 4 , 271–278 (2011). Saqib, U. et al. Phytochemicals as modulators of M1-M2 macrophages in inflammation. Oncotarget 9 , 17937–17950 (2018). Thiriot, J. D., Martinez-Martinez, Y. B., Endsley, J. J. & Torres, A. G. Hacking the host: exploitation of macrophage polarization by intracellular bacterial pathogens. Pathog. Dis. 78 , ftaa009 (2020). Cho, J.-E., Park, S., Cho, S.-N., Lee, H. & Kim, Y. S. c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (p38 MAPK) are involved in Mycobacterium tuberculosis-induced expression of Leukotactin-1. BMB Rep. 45 , 583–588 (2012). Pasquinelli, V. et al. Phosphorylation of mitogen-activated protein kinases contributes to interferon γ production in response to Mycobacterium tuberculosis. J. Infect. Dis. 207 , 340–350 (2013). Ashwell, J. D. The many paths to p38 mitogen-activated protein kinase activation in the immune system. Nat. Rev. Immunol. 6 , 532–540 (2006). Covarrubias, A. J., Aksoylar, H. I. & Horng, T. Control of macrophage metabolism and activation by mTOR and Akt signaling. Semin. Immunol. 27 , 286–296 (2015). Gisin, J., Schneider, A., Nägele, B., Borisova, M. & Mayer, C. A cell wall recycling shortcut that bypasses peptidoglycan de novo biosynthesis. Nat. Chem. Biol. 9 , 491–493 (2013). Sonnenburg, J. L. et al. Glycan foraging in vivo by an intestine-adapted bacterial symbiont. Science 307 , 1955–1959 (2005). Khader, S. A. & Cooper, A. M. IL-23 and IL-17 in tuberculosis. Cytokine 41 , 79–83 (2008). Batt, S. M., Burke, C. E., Moorey, A. R. & Besra, G. S. Antibiotics and resistance: the two-sided coin of the mycobacterial cell wall. Cell Surf. Amst. Neth. 6 , 100044 (2020). Bush, K. & Bradford, P. A. β-Lactams and β-Lactamase Inhibitors: An Overview. Cold Spring Harb. Perspect. Med. 6 , a025247 (2016). Silver, L. L. Fosfomycin: Mechanism and Resistance. Cold Spring Harb. Perspect. Med. 7 , a025262 (2017). de Chiara, C. et al. D-Cycloserine destruction by alanine racemase and the limit of irreversible inhibition. Nat. Chem. Biol. 16 , 686–694 (2020). Maitra, A. et al. Cell wall peptidoglycan in Mycobacterium tuberculosis: An Achilles’ heel for the TB-causing pathogen. FEMS Microbiol. Rev. 43 , 548–575 (2019). Biwi, J., Biot, C., Guerardel, Y., Vercoutter-Edouart, A.-S. & Lefebvre, T. The Many Ways by Which O-GlcNAcylation May Orchestrate the Diversity of Complex Glycosylations. Mol. Basel Switz. 23 , 2858 (2018). Jankute, M., Cox, J. A. G., Harrison, J. & Besra, G. S. Assembly of the Mycobacterial Cell Wall. Annu. Rev. Microbiol. 69 , 405–423 (2015). Chandra, P., Grigsby, S. J. & Philips, J. A. Immune evasion and provocation by Mycobacterium tuberculosis. Nat. Rev. Microbiol. 20 , 750–766 (2022). Agarwal, M., Soni, V., Kumar, S., Singha, B. & Nandicoori, V. K. Unique C-terminal extension and interactome of Mycobacterium tuberculosis GlmU impacts it’s in vivo function and the survival of pathogen. Biochem. J. 478 , 2081–2099 (2021). Singha, B. et al. The unique N-terminal region of Mycobacterium tuberculosis sigma factor A plays a dominant role in the essential function of this protein. J. Biol. Chem. 299 , 102933 (2023). Pahuja, I. et al. Berberine governs NOTCH3/AKT signaling to enrich lung-resident memory T cells during tuberculosis. PLOS Pathog. 19 , e1011165 (2023). Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Published Journal Publication published 06 Aug, 2024 Read the published version in Communications Biology → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3364986","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":236844723,"identity":"6acaf59f-4bc4-43fb-a89b-66ea5a79aff7","order_by":0,"name":"Vinay Nandicoori","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAw0lEQVRIiWNgGAWjYDACZhBxgEGOgZmxAcTkIVqLMQlaGCBaEhuIdpfBcd6Dn3nO3Enfzs7cwPCjhkHGnKCWw3zJ0jw3nuXubGZsYOw5xsBjScg+yWYeA2meD4dzNxwG+oW3gYHH4ABhLca/gVrSDYBaGP8So4WfmccM6LDDCSAtzETZAtJiOefMYUOQww7LHJMgrIWN/4zxjTfHDssbnD/+8OGbGht7glpAgAkWfUDFEkSoBwLGH8SpGwWjYBSMgpEKAA4RPEu6r5bHAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-5682-4178","institution":"National Institute of Immunology","correspondingAuthor":true,"prefix":"","firstName":"Vinay","middleName":"","lastName":"Nandicoori","suffix":""},{"id":236844724,"identity":"f428833f-b2e8-47bb-8ae1-1558e40a12e2","order_by":1,"name":"Meetu Agarwal","email":"","orcid":"","institution":"Jamia hamdard University","correspondingAuthor":false,"prefix":"","firstName":"Meetu","middleName":"","lastName":"Agarwal","suffix":""},{"id":236844725,"identity":"574d0d51-5ca1-4ba3-b351-07cd0c92af65","order_by":2,"name":"Ved Prakash Dwivedi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ved","middleName":"Prakash","lastName":"Dwivedi","suffix":""},{"id":236844726,"identity":"bdf83bf1-8fd5-4649-bf5c-03235be1547d","order_by":3,"name":"Ashima Bhaskar","email":"","orcid":"","institution":"ICGEB","correspondingAuthor":false,"prefix":"","firstName":"Ashima","middleName":"","lastName":"Bhaskar","suffix":""},{"id":236844727,"identity":"71a1e5c3-e83b-4869-9b96-55b91589593b","order_by":4,"name":"Biplab Singha","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Biplab","middleName":"","lastName":"Singha","suffix":""},{"id":236844728,"identity":"e44cac1d-ac7c-4c16-a9f1-07897c07db9e","order_by":5,"name":"Archana Singh","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Archana","middleName":"","lastName":"Singh","suffix":""},{"id":236844729,"identity":"f398e081-8d9b-45de-bf6f-4404f3a58898","order_by":6,"name":"Nisheeth Agarwal","email":"","orcid":"https://orcid.org/0000-0001-9203-3026","institution":"Translational Health Science and Technology Institute (THSTI)","correspondingAuthor":false,"prefix":"","firstName":"Nisheeth","middleName":"","lastName":"Agarwal","suffix":""},{"id":236844730,"identity":"592b6f50-b51c-4939-a820-dbd2e1eaaae1","order_by":7,"name":"Shivam Chaturvedi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Shivam","middleName":"","lastName":"Chaturvedi","suffix":""}],"badges":[],"createdAt":"2023-09-18 07:30:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3364986/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3364986/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s42003-024-06620-9","type":"published","date":"2024-08-06T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":44146825,"identity":"83e98fb6-f0de-4a12-9fd6-a27d7e04422e","added_by":"auto","created_at":"2023-10-05 15:37:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":112837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGlmM\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e is essential for bacterial growth. \u003c/strong\u003e\u003c/em\u003e\u003cem\u003eIn vitro\u003c/em\u003e growth analysis of different strains of \u003cem\u003eMtb\u003c/em\u003e H37\u003cem\u003eRv\u003c/em\u003e \u003cstrong\u003ea. \u003c/strong\u003e\u003cem\u003eRv\u003c/em\u003e and\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were grown to log phase to seed fresh cultures at an initial A\u003csub\u003e600\u003c/sub\u003e of 0.1 in the presence and absence of ATc, growth of the culture in the tubes were accessed on 6th day. \u003cstrong\u003eb. \u003c/strong\u003evalidation of CRISPRi-mediated silencing of genes by quantitative RT-PCR. Quantitative RT-PCR analysis showing levels of \u003cem\u003eglmM\u003c/em\u003e transcripts in the knockdown strains of \u003cem\u003eMtb\u003c/em\u003e H37\u003cem\u003eRv\u003c/em\u003e. \u003cstrong\u003e\u0026nbsp;c. \u003c/strong\u003e\u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures grown in the absence of ATc were seeded at A\u003csub\u003e600\u003c/sub\u003e of 0.1 and the cultures were grown in the absence or presence of ATc. Whole cell lysates (WCL) were prepared second day onwards post ATc addition. The WCLs were resolved and probed with α-GlmM and α-GroEL antibodies \u003cstrong\u003ed. \u003c/strong\u003eGrowth of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains was monitored in the presence of ATc (50 ng/ml) relative to controls by measuring A\u003csub\u003e600\u003c/sub\u003e of bacterial cultures, days-wise growth was monitored by observing A\u003csub\u003e600 \u003c/sub\u003etill the 7\u003csup\u003eth\u003c/sup\u003e day. \u003cstrong\u003ee.\u003c/strong\u003e \u003cu\u003e\u003cem\u003eRv\u003c/em\u003e\u003c/u\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were seeded at A\u003csub\u003e600\u003c/sub\u003e of 0.1 in 7H9-ADC and the \u003cem\u003ein vitro \u003c/em\u003egrowth was monitored by enumerating CFU on 0, 4 and 6\u003csup\u003eth\u003c/sup\u003e day. The data represent the mean CFU log10/ml ± standard deviation (SD) of three independent replicates. ***, p \u0026lt; 0.0001. \u003cstrong\u003ef.\u003c/strong\u003e\u003cem\u003e Rv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were inoculated at an initial A\u003csub\u003e600\u003c/sub\u003e of 0.1 and the growth was monitored every day for eight days. ATc was added to the \u003cem\u003eRv\u003c/em\u003e culture on day 0 and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were either grown in the absence of ATc or were supplemented with ATc in the growth media on 0, 2nd, 4th, or 6th day.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/66fcb95dbee1a66d67f7b371.png"},{"id":44145938,"identity":"dd99b2b9-a9b7-4ae9-8868-409323c87707","added_by":"auto","created_at":"2023-10-05 15:29:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":297345,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGlmM is essential for growth in hypoxic conditions.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u003cstrong\u003ea.\u003c/strong\u003e Schematic outline of the hypoxia experiment. \u003cstrong\u003eb.\u003c/strong\u003e \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were seeded at an initial A\u003csub\u003e600\u003c/sub\u003e of 0.1 in 1.5 ml HPLC tubes containing penetrable caps. The establishment of hypoxia was monitored with the help of methylene blue color change (blue to colorless). CFUs were enumerated on day 0, day 20 and day 40. \u003cstrong\u003ec. \u003c/strong\u003eScanning electron microscopy of \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e grown for 96 h with or without ATc as indicated. The experiment was repeated thrice. \u003cstrong\u003ed.\u003c/strong\u003e Transmission electron micrographs in result at 50,000X of \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures grown with or without ATc. Scale bar: 20 nm. \u003cstrong\u003ee.\u003c/strong\u003e Cell wall thickness was measured in nm for ~ 18 cells for each sample. ***p\u0026lt;0 .0001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/e672894d315bac191d12fbda.png"},{"id":44145940,"identity":"ec791ea1-9902-46bd-a3a4-62f7dc821638","added_by":"auto","created_at":"2023-10-05 15:29:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":96117,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGlmM depletion induces protective immunity inside macrophages.\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e a.\u003c/strong\u003e Schematic to show experiment layout of \u003cem\u003eex vivo\u003c/em\u003e experiment. \u003cstrong\u003eb.\u003c/strong\u003e Peritoneal macrophages were infected with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains at 1:10 MOI. 4 hpi cells were washed and RPMI with ATc were added in one set of cells. The intracellular bacillary load was checked by CFU enumeration at 24 and 96 hpi. The data represent the mean CFU log10/ml ± SD of three independent replicates. Statistical significance was drawn in comparison with \u003cem\u003eH37Rv\u003c/em\u003e using one-way ANOVA (Tukey test; GraphPad prism 9). ***, p \u0026lt; 0.0001. \u003cstrong\u003ec.\u003c/strong\u003e RNA was isolated from infected macrophages and used in RT PCR analysis to check the expression of macrophage activation markers MHCII and CD86. \u003cstrong\u003ed-f.\u003c/strong\u003e At 48h pi Infected murine peritoneal macrophages were surface stained with antibodies against CD11b (APC/Cy7), MHCII (PE) and CD86 (FITC) followed by flow cytometry. (d) Expression of CD11b on the surface of infected macrophages. (e) Expression of co-stimulatory markers MHCII and (f) CD86 on CD11b\u003csup\u003e+\u003c/sup\u003e infected macrophages \u003cstrong\u003eg.\u003c/strong\u003e RT PCR to check the levels of Pro (IL-1β, IL-12, IL-22, IL-6 and TNFα) and anti-(IL-10) inflammatory cytokines in infected macrophages at 48 hpi. \u003cstrong\u003eh.\u003c/strong\u003e Whole-cell lysates were prepared for the western blot experiment. Immuno-blot analysis depicting the phosphorylation status of P38, ERK, and AKT in the infected macrophages. The data are representative of two independent experiments \u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/5095fb87c932f38751679d02.png"},{"id":44145942,"identity":"f707ff25-c0a2-4edf-bf3d-756f7c3aa0d5","added_by":"auto","created_at":"2023-10-05 15:29:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":62902,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eGlmM\u003c/strong\u003e\u003c/em\u003e\u003csub\u003e\u003cem\u003e\u003cstrong\u003eMtb\u003c/strong\u003e\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e\u003cstrong\u003e is indispensable for Mtb survival and pathogenesis in vivo. \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ea.\u003c/strong\u003e GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e is essential for \u003cem\u003eMtb\u003c/em\u003e survival \u003cem\u003ein vivo\u003c/em\u003e. \u003cstrong\u003ea.\u003c/strong\u003e Schematic depicting the outline of \u003cem\u003ein vivo\u003c/em\u003e murine infection experiment. Doxycycline (Dox) was introduced in the water on 1-day p.i. \u003cstrong\u003eb. \u003c/strong\u003eBALB/c mice were aerosolically challenged with 2*10\u003csup\u003e8\u003c/sup\u003e cfu of \u003cem\u003eRv\u003c/em\u003e or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e and bacillary load was enumerated in the lung and spleen homogenates at day 1 and 28 days p.i. Each data point indicates CFU log\u003csub\u003e10\u003c/sub\u003e /ml from the lung or spleen obtained from one mice and the error bar represents as mean CFU log\u003csub\u003e10\u003c/sub\u003e/ml ± SD. *, p \u0026lt; 0.01; **, p \u0026lt; 0.001; ***, p \u0026lt; 0.0001. \u003cstrong\u003ec\u003c/strong\u003e. Schematic depicting the outline of the experiment. Dox was introduced after the establishment of the infection i.e. on day 14. BALB/c mice were infected with 100 CFU/mice of \u003cem\u003eRv\u003c/em\u003e or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e, and the infection was established for 14 days. Dox was administrated to \u003cem\u003eRv\u003c/em\u003e and in one set of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e (n=5) infected mice, while the other set was left untreated. CFU was enumerated on days 1 and 2-, 6- and 10- weeks p.i in the lung and spleen homogenates. \u003cstrong\u003ed. \u003c/strong\u003eData information: Each data point indicates CFU log\u003csub\u003e10\u003c/sub\u003e/ lung or spleen obtained from one mice and the error bar represents the mean CFU log10/lung or spleen ± SD. Statistical significance was drawn in comparison with \u003cem\u003eRv\u003c/em\u003e using one-way ANOVA (Tukey test; GraphPad prism 9). p \u0026lt; 0.01; **, p \u0026lt; 0.001; ***, p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/50b928a8df5ae62ae25d17fa.png"},{"id":44148043,"identity":"b20b0018-b90e-4196-92aa-984a22e93be6","added_by":"auto","created_at":"2023-10-05 15:45:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":57473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eDepletion of GlmM induces host protective immune response against Mtb. \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ea.\u003c/strong\u003e Schematic of the experiment showing C57BL/6 mice challenged via the aerosol route with a low-dose inoculum of ~110 CFU/mouse with H37\u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRvGlmMkD\u003c/em\u003e strains, Dox treatment was started one day onwards for the next 60 days. Mice were sacrificed and lungs and spleen were harvested for estimation of bacterial burden and analysis of immune responses. \u003cstrong\u003eb.\u003c/strong\u003e CFU from lung and spleen homogenates at 60 days post-treatment. \u003cstrong\u003ec.\u003c/strong\u003e Activation profile of T cells (CD4+ and CD8+) in the spleen of mice infected with H37\u003cem\u003eRv\u003c/em\u003e and glmMkD (-ATc and +ATc). \u003cstrong\u003ed-e\u003c/strong\u003e. cytokine profile (IFN-γ and IL-17) of CD4\u003csup\u003e+\u003c/sup\u003e T cells in the spleen of different groups of mice.\u0026nbsp; \u003cstrong\u003ef-g\u003c/strong\u003e. cytokine profile (IFN-γ and IL-17) of CD8\u003csup\u003e+\u003c/sup\u003e T cells in the spleen of different groups of mice infected with H37\u003cem\u003eRv\u003c/em\u003e and glmMkD. \u003cstrong\u003eh\u003c/strong\u003e. RT-PCR data to show expression of macrophage activation markers CD86 and MHCII at the transcriptional level in the spleen of different groups of mice infected with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRvGlmMkD\u003c/em\u003e. \u003cstrong\u003ei.\u003c/strong\u003e Profiling of intracellular cytokines (IL-1β, IL-12, IL-6, IL-10, and TNF-α) in splenocytes of different groups of mice infected with H37\u003cem\u003eRv\u003c/em\u003e and glmMkD (-ATc and +ATc). Data is a representation of two independent experiments.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/a0edf8ee26bd6fc35b5dbf6c.png"},{"id":61925800,"identity":"e8c201ff-c3af-40a2-80c0-3703a02235db","added_by":"auto","created_at":"2024-08-07 07:07:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1622853,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/3a22ba70-4159-4890-805d-234a0f11c7ac.pdf"},{"id":44145939,"identity":"6805efd7-4968-4efb-b206-c08622da40ef","added_by":"auto","created_at":"2023-10-05 15:29:06","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":530363,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-3364986/v1/165c5e16ec9b2b02182a888e.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Essential mycobacterial gene glmM as an immunotherapeutic target against tuberculosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTuberculosis (TB) is a deadly disease caused by one of the most successful and terrifying human pathogens, \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e), that silently encompasses most of the human population. Even though anti-tuberculosis therapy (ATT) can eradicate drug-sensitive strains of \u003cem\u003eMtb\u003c/em\u003e in 6\u0026ndash;8 months of treatment directly observed treatment short course (DOTS), failure in the implementation of the full course becomes the reason for emerging DR (drug resistant) strains \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The major drawback of ATT is that it does not have an immune modulator as suggested by the WHO to control contrary effects on the host (WHO. 2007). Therefore, innovative therapeutic strategies are urgently needed involving the identification of new drug targets and the impact of their inhibition on the host immune system to achieve the END TB target by 2030 (WHO. 2021). Post-infection \u003cem\u003eMtb\u003c/em\u003e is phagocytosed by antigen-presenting cells (APCs), which activate T lymphocytes to upregulate protective pro-inflammatory cytokines \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. A complex immunological response is involved in the case of TB that decides the fate of infection predominantly governed by subsets of T lymphocytes \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTo survive inside stressful conditions offered by host pathogens have developed various mechanisms, for that mycobacterial species have a unique cell wall structure that plays a key role in its growth, virulence, survival inside the host, and escape from immune responses \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The impermeability of cell walls is one major concern that affects the efficacy of existing antibiotics \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Therefore, identifying targets that can affect the strength of the cell wall or make it more pores could be an important strategy to deal with the pathogen. Hence, the enzymes involved in cell wall synthesis offer potential targets for new anti-tuberculosis drugs. It is composed of three layers of outer mycolic acid (MA), which is connected to the lower peptidoglycan (PG) layer via middle arabinogalactan (AG). PG is a repeat disaccharide unit (N-acetylmuramic acid-N-acetyl glucosamine) attached to AG through a disaccharide linker (a-L-rhamnosyl-a-D-N-acetylglucosaminosyl-1-phosphate). UDP-N-acetylglucosamine (UDP-GlcNAc) is a direct glycosyl donor of the disaccharide linker and a precursor for PG synthesis, also involved in various reactions \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Hence, its biosynthesis is crucial which starts from a glycolytic intermediate D-fructose-6-phosphate \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. First, Glucosamine-6-phosphate synthase (GlmS) converts fructose-6-phosphate into glucosamine-6-phosphate, which becomes glucosamine-1-phosphate by Phosphoglucosamine mutase (GlmM) activity during the second reaction. Subsequently, glucosamine-1-phosphate acetyltransferase/N-acetylglucosamine-1- phosphate uridyltransferase (GlmU) converts glucosamine-1-phosphate into N-acetylglucosamine-1-phosphate by acetyltransferase activity followed by its uridyltransferase activity and the final product UDP-GlcNAc forms. However, in eukaryotes, glucosamine-6-phosphate converts into N-acetylglucosamine-6-phosphate by the activity of GAT (acetyl-CoA: D-glucosamine-6-phosphate N-acetyltransferase) which further converts into N-acetylglucosamine-1-phosphate by GNA1 (glucose-6-phosphate acetyltransferase; UAP1, UDP-N-Acetylglucosamine Pyrophosphorylase) \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. The reactions catalyzed by GlmM and the first reaction (acetyltransferase activity) of GlmU are unique to prokaryotes, making them attractive therapeutic targets. By this prediction, GlmU\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e has been studied thoroughly, and effective inhibitors have been designed, which are under further investigation \u003csup\u003e\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePreviously, the importance of GlmM was identified in \u003cem\u003eE. coli\u003c/em\u003e, where its inactivation resulted in disturbed morphology and cell lysis \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Subsequently, it was studied that \u003cem\u003eureC\u003c/em\u003e from \u003cem\u003eHelicobacter pylori\u003c/em\u003e restored the lethal effects of \u003cem\u003eglmM\u003c/em\u003e mutant in \u003cem\u003eE. coli\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. A mutation in \u003cem\u003eglmM\u003c/em\u003e affects cell growth, morphology, biofilm formation, and sensitivity to penicillin with increased polymorphonuclear leukocyte (PMN)-dependent killing in \u003cem\u003eStreptococcus gordonii\u003c/em\u003e (2008, FEMS, 2009 FEMS). In \u003cem\u003eBacillus anthracis\u003c/em\u003e, crystal structure revealed key residues that play a role in catalysis and specificity \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. GlmM was identified as a modulator of c-di-AMP levels in \u003cem\u003eLactococcus lactis\u003c/em\u003e and \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, where C-di-AMP synthesis enzyme CdaA and DacA was shown to be inhibited by direct binding of GlmM \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. GlmM from \u003cem\u003eM. smegmatis, MSMEG_1556\u003c/em\u003e, and \u003cem\u003eMtb\u003c/em\u003e, \u003cem\u003eRv\u003c/em\u003e3441c have been identified, and the effects of mutation on biofilm formation and antimicrobial susceptibilities have been studied in \u003cem\u003eM. smegmatis\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we set out to answer if \u003cem\u003eglmM\u003c/em\u003e\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e is essential for bacterial survival and virulence and to what extent. We have performed \u003cem\u003ein vitro\u003c/em\u003e, \u003cem\u003eex vivo\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments to examine the importance of this gene in the growth of bacteria outside and inside the host and found that GlmM is essential in all three conditions. Furthermore, we analyzed the host's immune response in the case of mutant and control. Interestingly, we have observed increased pro-inflammatory immune response from macrophages and enhanced Th1 and Th17 cell activation in the spleen of mice in the case of mutants compared to controls. It suggests that GlmM plays a crucial role in mycobacterial virulence, and suppressed expression of GlmM causes a better immune response. Together, the data presented here demonstrate that GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e is a viable and promising target for therapeutic intervention against tuberculosis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eGlmM\u003c/b\u003e \u003csub\u003e \u003cem\u003eMtb\u003c/em\u003e \u003c/sub\u003e \u003cb\u003eis essential for bacterial growth.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHigh-throughput transposon-based mutagenesis studies suggested \u003cem\u003eglmM\u003c/em\u003e\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e to be an essential gene for the \u003cem\u003ein vitro\u003c/em\u003e growth of the bacteria \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Thus to understand the requirement of GlmM, we generated knockdown strains of \u003cem\u003eMtb H37Rv\u003c/em\u003e by using the CRISPRi-based approach described earlier \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The strain \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e thus generated shows depletion of GlmM in an anhydrotetracycline (ATc)\u0026ndash;dependent manner, wherein the addition of ATc results in a knockdown. To confirm, we grew the \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e in the liquid cultures in the presence and absence of ATc, which showed the inability of the \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain to sustain growth in the presence of ATc (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). To validate that observed growth defects are due to the down-regulation of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e, we compared RNA and protein expression levels in the presence and absence of ATc. Data revealed\u0026thinsp;~\u0026thinsp;50 and ~\u0026thinsp;85% suppression at the RNA level in the presence of 25 and 50 (ng/ml) of ATc, respectively, while the level of \u003cem\u003eglmM\u003c/em\u003e\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e in the absence of ATc was comparable to \u003cem\u003eRv\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Western blot analysis showed that in the presence of ATc, the protein levels were significantly lower by the 4th day, which became undetectable 7th day (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec), confirming the generation of \u003cem\u003eglmM\u003c/em\u003e\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e knockdown strain. In all subsequent experiments, we used 50 ng/ml ATc.\u003c/p\u003e \u003cp\u003eNext, we analyzed the growth profile of the \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain in the presence and absence of ATc by absorbance (A\u003csub\u003e600\u003c/sub\u003e) and colony-forming unit (CFU) over seven days. As presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, control cultures achieved A\u003csub\u003e600\u003c/sub\u003e of ~\u0026thinsp;4.3, while depleted \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures failed to grow beyond A\u003csub\u003e600\u003c/sub\u003e of ~\u0026thinsp;0.27 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). CFU enumeration indicated\u0026thinsp;\u0026gt;\u0026thinsp;2 log\u003csub\u003e10\u003c/sub\u003e folds (100 fold) compromised growth in the mutant strain on the 4th day and \u0026gt;\u0026thinsp;4 log\u003csub\u003e10\u003c/sub\u003e fold differences 6 days post-ATc addition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). An ideal target of therapeutic intervention should be essential at different stages of growth, and early intervention should result in pathogen clearance. To evaluate the impact of GlmM depletion at different growth stages, we added ATc on either the day 0, 2nd, 4\u003csup\u003eth,\u003c/sup\u003e or 6th-day post-inoculation. We observed a substantial reduction in growth even when ATc was added 4 days post-inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ef). Collectively, results suggest the importance of GlmM at early and late stages of bacterial growth in the extracellular conditions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGlmM is essential for growth in hypoxic conditions.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSurvival in hypoxic conditions is crucial for being a successful pathogen. It was previously observed that GlmM plays an important role in biofilm formation in \u003cem\u003eM. smegmatis\u003c/em\u003e, whose core is hypoxic \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. Hence, we examined the survival of the \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain in the modified Wayne\u0026rsquo;s model \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Hypoxia was first established (for 20 days), followed by depletion of GlmM by the addition of ATc for 10 and 20 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The addition of ATc resulted in significantly reduced growth at both time points (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), indicating the importance of GlmM in hypoxic conditions.\u003c/p\u003e \u003cp\u003ePrevious studies showed that orthologs of GlmM are involved in cell wall synthesis, and its depletion distorts the morphology of the cell \u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. To determine the impact of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e depletion on cellular morphology, we performed TEM (transmission electron microscopy) and SEM (scanning electron microscopy) imaging analysis of \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cells grown for 96 h in the absence and presence of ATc. The addition of ATc did not impact the cell morphology in the case of \u003cem\u003eRv\u003c/em\u003e. On the other hand, in the absence of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e (+\u0026thinsp;ATc condition), cells were crumbled and fused (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). TEM analysis indicated that in the case of \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -ATc, the cell wall thickness is comparable. However, there we observed a significant decrease in the cell wall thickness in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +ATc samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-e). Together data suggests that the absence of GlmM results in decreased cell wall thickness, eventually crumbling and death.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGlmM depletion induces protective immunity inside macrophages.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eMacrophages are the key cellular source of cytokines that impact the commencement of both innate and adaptive immune arms. It is established from the previous studies that for survival and pathogenesis, \u003cem\u003eMtb\u003c/em\u003e escapes this immune attack by modulating the macrophage defense in its own favor \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Macrophages can polarize in two ways M1 and M2; while M1 secretes pro-inflammatory cytokines like IL-1β, IL-6, IL-12, and TNF-α that promotes resistance against \u003cem\u003eMtb\u003c/em\u003e, M2 induces an anti-inflammatory response like IL-10 that favours \u003cem\u003eMtb\u003c/em\u003e growth \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eMtb\u003c/em\u003e is known to favor M2 polarization and suppress the M1 response \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. To evaluate the impact of GlmM depletion on bacterial survival in macrophages, we infected peritoneal macrophages (PФ) isolated from C57BL6 mice with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekd\u003c/em\u003e\u003c/sub\u003e. GlmM was depleted from one set of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekd\u003c/em\u003e\u003c/sub\u003e infected cells by adding ATc in the culture media at 4 h post-infection (p.i) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The infected cells were analyzed at different time point\u0026rsquo;s p.i for different purposes such as CFU analysis, cytokine profiling and FACS, western blot, and qRT-PCR experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). We observed compromised survival of knockdown strain in the presence of ATc compared to controls (\u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e-ATc\u003c/em\u003e). Whereas \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -ATc showed 4 and 4.2 log\u003csub\u003e10\u003c/sub\u003e CFU values at 96 h p.i the log\u003csub\u003e10\u003c/sub\u003e CFU value of 2 was observed in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +ATc infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eWe subsequently examined macrophage activation markers in \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain using qRT-PCR and FACS analysis and found significant upregulation of CD86 and MHCII (major histocompatibility complex II) in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +ATc infected cells compared with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -ATc infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-F). Moreover, \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain in the presence of ATc showed increased levels of M1- specific pro-inflammatory cytokines viz. IL-1β, IL-12, TNF-α, IL-6, IL-22 with simultaneous down-regulation of IL-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg). To delineate the molecular mechanism behind this M1-macrophage response, we have investigated MAPK and ERK signaling pathways known to be involved in the production of pro-inflammatory cytokines and the modulation of macrophage polarization \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. MAPK phosphorylation in macrophages is associated with Th1 cell activation and differentiation, which is crucial for protecting against \u003cem\u003eMtb\u003c/em\u003e infection \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. We find that activation of P38 and ERK1/2 pathways as demonstrated by higher levels of phosphorylated proteins in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +ATc infected cells compared with either Rv or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -ATc infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eh). However, decreased phosphorylation of AKT was observed upon GlmM depletion. Since mTORC and AKT signaling are tightly connected and AKT activation through phosphorylation activates mTORC1 responsible for reduced autophagy supports \u003cem\u003eMtb\u003c/em\u003e survival \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Therefore, less phosphorylation of AKT further strengthened the hypothesis that depletion of GlmM improved the anti-mycobacterial response. Collectively, this data suggested that reduction in GlmM expression causes Compromised bacterial survival in macrophages, and it also stimulates pro-inflammatory responses, probably via MAPK signaling.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGlmM\u003c/b\u003e \u003csub\u003e \u003cb\u003eMtb\u003c/b\u003e \u003c/sub\u003e \u003cb\u003eis indispensable for Mtb survival and pathogenesis in vivo.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eGlmM is an important enzyme involved in the synthesis of UDP-GlcNAc, a critical component of cell wall synthesis. Few pathogens are known to use GlcNAc from the host for the synthesis of UDP-GlcNAc, and others are dependent on cell wall recycling for the same in the absence of the UDP-GlcNAc biosynthesis pathway \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. However, this information is not available in the case of \u003cem\u003eMtb\u003c/em\u003e. The essentiality of GlmU has been established in previous studies of the lab \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. If \u003cem\u003eMtb\u003c/em\u003e can utilize the GlcNAc from the host, the activities of GlmS and GlmM may not be essential (Figure. S1). Hence, to investigate the possible presence of alternate pathways, we examined the \u003cem\u003ein vivo\u003c/em\u003e survival and pathogenicity of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e in a murine infection model. Mice were challenged with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains through the aerosol route (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). CFU enumeration 24 h pi suggested efficient and equivalent deposition of both the strains \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e in the lungs of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). Depletion of GlmM was initiated 1 day p.i by providing doxycycline (Dox) through drinking water, and CFUs were enumerated four weeks p.i. The bacillary load was significantly lower in the lungs and spleen of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e infected mice treated with Dox compared with the absence of Dox treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). \u003cem\u003eRv\u003c/em\u003e-infected mice treated with Dox were used as the reference control mice for CFU enumeration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eSubsequently, we sought to investigate the impact of GlmM depletion from an established infection. Mice were infected with \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e,\u003c/sub\u003e and the infection was allowed to be established for two weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Subsequently, \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e mice were divided into two group\u0026rsquo;s one group was given Dox for 4 or 8 weeks to deplete GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e. CFUs were comparable for \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e at 1-day and 2 weeks p.i. CFUs enumerated 4- and 8-weeks post Dox treatment in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e showed\u0026thinsp;~\u0026thinsp;2.5 and 4 log\u003csub\u003e10\u003c/sub\u003e fold decrease, respectively, compared with mice untreated with Dox (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). A similar trend was observed in the spleen as well. Gross pathology and histopathology data strengthened the observation wherein no significant granuloma formation was observed in the \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +Dox samples (Figure S2). Together, this data suggest that GlmM is critical for the survival of \u003cem\u003eMtb\u003c/em\u003e within the host at acute and chronic stage of infections.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDepletion of GlmM induces host protective immune response against Mtb\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eStrength of host immune system and pathogen determine the eventual outcome of an infection. It is apparent from the data presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e that the depletion of \u003cem\u003eglmM\u003c/em\u003e significantly decreased bacillary load suggesting that the strength of pathogen is lower, vis v vis host immune system. Thus, we set out to examine the host immune response in the mice infected with \u003cem\u003eRv\u003c/em\u003e or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e in the absence and presence of Dox. Towards this, we infected C57BL6 mice with a low dose of \u003cem\u003eRv\u003c/em\u003e or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003eglmM\u003c/em\u003e was depleted in one set for a period of 60 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). As anticipated in Rv\u0026thinsp;+\u0026thinsp;Dox or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -Dox infected samples the bacillary load was comparable, while the \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +Dox infected mice did not show any CFUs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Antigen-presenting cells and Th1 cells are the key players contributing to the immunological control of \u003cem\u003eMtb\u003c/em\u003e infection \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Hence, we profiled various immune cells in the spleen of infected mice.\u003c/p\u003e \u003cp\u003eThe gating strategy used in this study is depicted in Figure S3. Increased percentage of CD11b\u003csup\u003e+\u003c/sup\u003e cells with enhanced expression of co-stimulatory molecules CD86\u003csup\u003e+\u003c/sup\u003e and MHCII\u003csup\u003e+\u003c/sup\u003e was observed in the spleen of \u003cem\u003eRvΔglmM\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Dox infected mice compared to \u003cem\u003eRv\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Dox or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -Dox (Figure S4). We also observed a significant increase in CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells in the spleen of mutant-infected mice (Figure S4). Presence of increased CD69 surface expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec), suggests activation of both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Differentiation of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e cells into protective Th1 and Th17 subsets was evident by the significant increase in gamma interferon (INFɣ) and Interleukin 17 (IL-17) levels in the splenic T cells of \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +Dox infected mice compared to \u003cem\u003eRv\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Dox or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -Dox (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-g).\u003c/p\u003e \u003cp\u003eRT PCR analysis of spleenocytes demonstrated increased expression of macrophage activation markers CD86, MHCII, and pro-inflammatory cytokines IL-1β, IL-12, TNF-α, IL-6, while no significant change in IL-10 in \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +Dox infected samples compared with \u003cem\u003eRv\u003c/em\u003e\u0026thinsp;+\u0026thinsp;Dox or \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -Dox (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh-i). Th17 cell responses play an important role in establishing protective immune responses against TB \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e and do not majorly contribute to primary immune response \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. We think that activation of Th17 response by targeting GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e can also help the host in recall responses. Together these results suggests a shift in the immune response in favor of host upon GlmM depletion.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe mycobacterium cell wall is composed of a complex structure comprising highly impermeable mycolyl-arabinogalactan-peptidoglycan (mAGP) complex, that play an important role in survival and maintaining a cell shape. Due to the presence of such protective wall \u003cem\u003eMtb\u003c/em\u003e is able to replicate in the hostile environment of macrophages and resist the action of several therapeutic agents \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. PG of this complex seems unexceptional but it contains various molecular subtleties that help \u003cem\u003eMtb\u003c/em\u003e to enter into the non-replicative dormant stage \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Most of the β-lactam antibiotics are ineffective in case of \u003cem\u003eMtb\u003c/em\u003e due to impermeability and highly active β-lactamase (BlaC) that efficiently hydrolyses many β-lactam drugs to render them ineffective \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Fosfomycin, a MurA inhibitor does not work in the case of \u003cem\u003eMtb\u003c/em\u003e due to alteration in single amino acid in mycobacterial MurA \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. D-Cycloserine prevents L-alanine racemase (alr) and dipeptidyl synthetase (ddl) resulting into hindered formation of pent peptide side chains of PG but due to toxic effects on the central nervous system, its use is severely limited to MDR-TB \u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. A large proportion of the cell wall PG is cross-linked by non-classical l,d-transpeptidases, which are intrinsically impervious to these antibiotics \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. Hence, the enzymes that catalyze the PG biosynthesis pathway are essential to bacterial cells and their restriction to the prokaryotes collectively makes them an attractive target for the development of new antibiotics.\u003c/p\u003e \u003cp\u003eBiosynthesis of UDP-GlcNAc, a central metabolite for both PG and AG synthesis are involves three enzymes, GlmS, GlmM, and GlmU. In this study, we generated a knockdown of \u003cem\u003eglmM\u003c/em\u003e in \u003cem\u003eMtb\u003c/em\u003e and examined its impact on growth and survival in \u003cem\u003ein vitro, ex vivo, and in vivo.\u003c/em\u003e In compliance with the earlier studies reported for \u003cem\u003eM. smegmatis\u003c/em\u003e, the closest nonpathogenic homolog of \u003cem\u003eMtb\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e was also found essential for the \u003cem\u003ein vitro\u003c/em\u003e growth of bacteria (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). GlmM is part of cell wall synthesis machinery and its role in morphology has been demonstrated in orthologs \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Here, SEM and TEM analysis revealed the crumpling of \u003cem\u003eMtb\u003c/em\u003e cells and diluted cell wall, respectively in the case of mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Mycobacterial cell wall undergoes cell wall remodeling during hypoxia to adapt to the environment. Hence, we speculate that GlmM may play some role in hypoxic conditions since its role in biofilm formation has been shown earlier with orthologs \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In line with this hypothesis, bacterial survival was significantly reduced in hypoxic condition upon GlmM depletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition to the \u003cem\u003ede novo\u003c/em\u003e pathway wherein fructose-6-phosphate an intermediate of glycolysis changed into UDP-GlcNAc, salvage pathway is known to occur in some other bacteria and parasites \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. In the salvage pathway, GlcNAc is taken from the host or available through cell wall recycling to the cytosol \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. GlcNAc gets phosphorylated and converted into GlcNAc-6-phosphate and then GlcNAc-1-phosphate or directly to GlcNAc-1-phosphate which can enter in different parts of the synthesis. Therefore, the lack of information on such pathways in \u003cem\u003eMtb\u003c/em\u003e makes us interested to investigate the essentiality of GlmM for \u003cem\u003eMtb\u003c/em\u003e survival inside the host. Here we speculate, if a salvage pathway exists in \u003cem\u003eMtb\u003c/em\u003e for the synthesis of UDP-GlcNAc, in the absence of isomerase enzyme GlmM, bacteria should survive in the mutant. However, it was not reflected in \u003cem\u003eex vivo\u003c/em\u003e experiments performed using peritoneal macrophages, and \u003cem\u003eMtb\u003c/em\u003e survival was compromised in the absence of GlmM (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). To further authenticate our \u003cem\u003eex vivo\u003c/em\u003e results we used the murine infection model for \u003cem\u003ein vivo\u003c/em\u003e experiments and found reduced GlmM expression result in less bacterial survival and pathogenicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Moreover, GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e was crucial for bacterial survival in all the stages of infection including before and after the establishment of infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Hence, it is conceivable that GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e is essential for bacterial survival in \u003cem\u003ein vitro, ex vivo\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e conditions.\u003c/p\u003e \u003cp\u003eDuring \u003cem\u003eMtb\u003c/em\u003e infection, the immune system plays a critical role to control the replication and survival of the mycobacteria inside the host, in the presence of a strong immune response \u003cem\u003eMtb\u003c/em\u003e enters into dormant a non-replicative stage. It is established that \u003cem\u003eMtb\u003c/em\u003e infection is more prevalent in the absence of an appropriate Th1 immune response \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. The extent of \u003cem\u003eMtb\u003c/em\u003e infection correlates with the dynamics of pro- and anti-inflammatory responses which stimulate T helper cell differentiation. Interestingly, we found that down-regulation of GlmM not only inhibits \u003cem\u003eMtb\u003c/em\u003e growth it simultaneously encourages the host immune system to fight better against infection. For that it stimulates macrophage towards the M1 response that secretes pro-inflammatory cytokines like IL-1β, IL-12, IL-6, IL-22, and TNFα (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). However, the expression of anti-inflammatory cytokine IL-10 which promotes \u003cem\u003eMtb\u003c/em\u003e growth was less. To deepen more in the mechanism via which this pro-inflammatory response is occurring we observed the activation of p38 and ERK by phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). P38 and ERK are MAPK which are known to stimulate the expression of proinflammatory cytokines and multiple effector molecules that will aid in protective host immunity during \u003cem\u003eMtb\u003c/em\u003e infection. Furthermore, activation of IFNɣ and IL-17 was observed in the isolated spleen of \u003cem\u003eglmM\u003c/em\u003e mutant infected mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe development of novel inhibitors for essential and conserved \u003cem\u003eMtb\u003c/em\u003e pathways is one potential strategy to shorten the duration of TB chemotherapy and eradicate drug-resistant TB. With the advancement of genome sequencing and molecular biology of mycobacteria it is possible to identify essential bacterial pathways for drug development. Enzymes of UDP-GlcNAc pathway, especially GlmM due to its uniqueness to bacteria indeed offer an attractive target for new TB drug development. Here, in this study by giving a host immune angel we have suggested a distinct cause for importance of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e. The present study has given deep insight knowledge about the potential of GlmM enzyme for designing inhibitors, which will be further used together with current TB drugs for more effective TB treatment.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cp\u003e \u003cb\u003eMaterials and growth conditions.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOligonucleotides (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were procured from Sigma. Doxycycline hydrochloride was purchased from Bio-chem Pharmaceutical. Antibodies used in this study; Anti-Mouse: CD3-Pacific Blue, CD4-QR, CD8-APCCy7, CD69-PE, IFNγ-BV510, IL17-BV650, CD11b-APCCy7, CD86-PerCPCy5.5, MHCII-PE from Biolegend, USA. Anti-human/anti-mouse: ERK, p-ERK, AKT, p-AKT, p38, P-p38, β-Actin were purchased from Cell Signaling Technologies. 7H9 medium supplemented with 10% ADC (NaCl, dextrose, bovine serum albumin, and catalase), 0.2% glycerol, and 0.1% Tween 80 was used for the liquid growth of \u003cem\u003eMtb\u003c/em\u003e strains. 7H11 agar with 10% OADC (ADC and oleic acid) and 0.2% glycerol were used for \u003cem\u003eMtb\u003c/em\u003e strain growth on plates. \u003cem\u003eMtb\u003c/em\u003e recombinants were selected on kanamycin (25 mg/mL). Medium components were from BD Difco, Sigma-Aldrich, and Hi-Media. Molecular grade reagents were procured from Merck, Ameresco, or Sigma; restriction-modification enzymes were from NEB; and SEM chemicals were from Electron Microscopy Sciences.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of the Primers used in the study:\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL10 Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGGGTCTTGGGAAGAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL10 Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTGGCCACAGTTTTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL6 Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGAGAGGAGACTTCACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL6 Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCACGATTTCCCAGAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNFα Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGCCAGGAGGGAGAACAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNFα Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTTCTGGAGGGAGATGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACTTTGGCATTGTGGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATGCAGGGATGATGTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL1β Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCAAGCAATACCCAAAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL1β Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTGTGCTCTGCTTGTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL22 Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGAGGAGTCAGTGCTAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL22 Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGTAGGGCTGGAACCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL12p40 Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGAACAGTGGGTGTCCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL12p40 Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGAGACACCAGCAAAACGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD86 Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTTTCCGTGGAGACGCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD86 Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGAGCCTTTGTAAATGGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMHCII(H2-AB) Forward Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCCCATCACTGTGGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMHCII(H2-AB) Reverse Primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGCCGCTCAACATCTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eglmM Forward RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGATCGACTCACCTTGACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eglmM Reverse RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCACCGGCCTCTTTCATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esigA Forward RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATCCCGAAAAGGAAGACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003esigA Reverse RT primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGAGGTCTGGTTCAGCGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of knockdown strains using CRISPRi\u003c/h2\u003e \u003cp\u003eTo achieve the repression of \u003cem\u003eRv3441c\u003c/em\u003e (\u003cem\u003eglmM\u003c/em\u003e) gene, a pair of complementary oligonucleotides specific to the target ORFs near the 5\u0026rsquo;-end were synthesized, annealed, and cloned in pDCas9\u0026thinsp;+\u0026thinsp;at AflII\u0026ndash;AcII sites. This plasmid contains Dcas9, as described previously \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. Recombinants were electroporated in \u003cem\u003eMtb\u003c/em\u003e H37\u003cem\u003eRv\u003c/em\u003e to generate Kan\u003csup\u003eR\u003c/sup\u003e knockdown strains. Since the plasmid contained a tetracycline-inducible promoter suppression was achieved by treatment of bacterial cultures with ATc.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGrowth rate kinetics.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eExponential-phase cultures of \u003cem\u003eRv\u003c/em\u003e, \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e -ATc, and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e +ATc strains grown in Middlebrook 7H9-ADC medium were seeded at an optical density at 600 nm (OD600) of;0.05 in 7H9 medium. OD600 was monitored every 24 h, and the CFU were enumerated by serially diluting the cultures and plating them on 7H11 agar.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003e \u003cem\u003eRv\u003c/em\u003e, \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains grown in the absence of ATc were seeded at OD\u0026thinsp;~\u0026thinsp;0.05 in the absence or presence of 50 ng/ml ATc. 1 Whole-cell lysates (WCLs) were prepared as described previously \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e at different times points according to the Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. RIPA buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1.0% NP-40, 0.5% Sodium deoxycholate, 0.1% SDS) freshly supplemented with complete protease inhibitor and PhosSTOP purchased from Roche was used to prepare WCLs of peritoneal macrophages. Concentrations of WCLs were estimated using the Bradford protein estimation method, Samples were electrophoresed on SDS-PAGE and electro-blotted onto nitrocellulose membranes (Bio-Rad). After blocking with 5% BSA prepared in PBST (PBS and 0.05% Tween-20), blots were probed for different proteins using corresponding antibodies acquired from CST (Anti-human/anti-mouse: ERK, p-ERK, AKT, p-AKT, p38, P-p38, β-Actin ) except α-GlmM, α-GroEL1 which were \u003cem\u003ein-house\u003c/em\u003e generated. Blots were developed on autoradiograms using chemiluminescent HRP substrate (ECL, Millipore).\u003c/p\u003e \u003cp\u003e \u003cb\u003eRNA isolation and qPCR analysis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eFor bacteria, total RNA was isolated from exponentially growing bacteria cells as described in \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Briefly, to isolate total RNA, cells were inoculated at 0.05 OD in the presence or absence of ATc and allowed to grow for three days. Cells were re-suspended in trizol reagent (Invitrogen), and total RNA was isolated from following mycobacterial cells followed by cDNA synthesis using iScript cDNA synthesis kit (Bio-Rad). qRT-PCRs was performed using the respective primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). For peritoneal macrophages and splenocytes, total RNA was isolated using standard RNA isolation protocol followed by cDNA synthesis. Real-time PCR was performed using SYBR Green Master Mix (Bio-Rad). Bio-Rad Real-Time thermal cycler (BioRad, USA) was used for Real-time quantitative RT-PCR analysis. The list of Primers used in the study is provided in the Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHypoxia experiment.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eIn vitro\u003c/em\u003e, hypoxia stress was assessed through a modified Wayne\u0026rsquo;s hypoxia model as described earlier \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Briefly, bacterial strains were inoculated in 7H9-ADC at an OD\u003csub\u003e600\u003c/sub\u003e of; 0.1; 1.5 mg/mL of methylene blue was added to a visual redox indicator. The experiment was carried out in tightly sealed glass tubes with 15% headspace at 37\u0026deg;C without agitation. ATc (50 ng/ml) were injected into the cultures on 20th day and the number of CFUs was determined at different time points. For that Bacterial cells were serially diluted and plated on 7H11-OADC agar, and after 15 days colonies appeared and counted.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePeritoneal macrophage infections.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBALB/c and C57BL6 mice of 4\u0026ndash;6 weeks were maintained in the Animal facility at ICGEB, New Delhi, India. Mice were accessed and obtained for experimental procedures from the facility. C57BL/6 mice were injected intra-peritoneally with 2 ml of 4% thioglycollate (Sigma). Five days later, ice-cold PBS was injected into the peritoneal cavity to extract macrophages. Cells were counted and seeded in RPMI-1640 medium supplemented with 10% fetal bovine serum, (FBS) (Thermo fisher scientific Inc or Hyclone). Cells were washed with PBS to remove non-adherent cells after overnight incubation at 37˚C and 5% CO2. For infection, single cell suspensions were prepared from Log phase cultures of \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains by passing through a 26 gauge needle 5 times. Cells were infected at MOI of 1:10 (cell: bacteria). 4 h post-infection (p.i) media was removed, cells were washed twice to remove extracellular bacteria. The cells were replenished with RPMI media containing 10% FBS with or without 50 ng/ml ATc. 24, 48, 72, or 96 h pi; cells were lysed in 100 \u0026micro;l of 0.02% SDS and CFUs were enumerated in different dilutions on OADC-containing 7H11 agar plates\u003c/p\u003e \u003cp\u003e \u003cb\u003eMurine infection experiment.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e cultures were revived and grown up to exponential phase OD\u003csub\u003e600 ~\u003c/sub\u003e 0.8, cultures were washed and re-suspended in the 1X sterile PBS, and single-cell suspensions were prepared by passing the culture five times through a 26 gauge needle. Bacterial cell suspension (1.5 * 10\u003csup\u003e6\u003c/sup\u003e cells per ml) total volume of 15 ml was placed in the nebulizer of the Madison aerosol chamber. Mice were grouped and labeled according to the experiment. First, bacterial deposition was checked in the lungs at 24 hpi. Doxycycline hydrochloride, (1 mg/ kg with 5% dextrose in drinking water) was provided as specified in the figures/ legends, either from the time of the infection (day 1) or after establishment of infection (21 days pi). 5\u0026ndash;6 mice from each group were sacrificed at different time points and organs (lungs and spleen) were harvested, homogenized in 0.2 \u0026micro;m filtered PBS, plated in different dilutions onto 7H11 Middlebrooks (Difco\u0026trade;) plates comprising 10% oleic acid, albumin, dextrose, and catalase (OADC) and incubated at 37\u0026deg;C for 21\u0026ndash;28 days. \u003cem\u003eMtb\u003c/em\u003e colonies were counted on different dilutions and CFUs were estimated as per dilution. Half the lung and spleen tissues were used for immune cell profiling. For histology1/4th portion of lung tissues were fixed in 10% neutral buffered formalin solution and coated with wax for sectioning followed by hematoxylin and eosin (H and E) staining and examine under a microscope. Granulomas for each animal in every group were screened in 5 different fields. Images in figures are illustrative of visualized section images.\u003c/p\u003e \u003cp\u003e \u003cb\u003eScanning electron microscopy and transmission electron microscopy.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eRv\u003c/em\u003e and \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strains were grown in the absence and presence of ATc at an OD\u003csub\u003e600\u003c/sub\u003e of; 0.6, harvested from 10-mL cultures. Scanning and Transmission electron microscopy (SEM \u0026amp; TEM) analysis of these samples were performed as described earlier \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Briefly, for TEM, cells were fixed, gradually dehydrated, and polymerized using Epson 812 resin; 63-nm sections were cut using an ultramicrotome (Leica) and subsequently stained using uranyl acetate and lead citrate for visualization under a Tecnai G2 20 twin (FEI) transmission electron microscope (). Cell length, width, and thickness were quantified with the help of Smart TIFF software and Carl Zeiss Tiff Annotation Editor.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eHistology\u003c/h2\u003e \u003cp\u003eLung tissues were fixed in formalin solution and coated with wax for sectioning. Sections were stained with Hematoxylin and Eosin (H and E) dyes and slides were scored for granulomas by analyzing under a light microscope\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry: surface and intracellular staining\u003c/h2\u003e \u003cp\u003eFor \u003cem\u003eex vivo\u003c/em\u003e experiments, infected macrophages were taken out 48h pi and stained for different surface markers and intracellular cytokines as described in \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. Briefly, macrophages were surface stained with CD11b (APC/Cy7), CD86 (PerCPCy5.5), and MHC-II (PE). For \u003cem\u003ein vivo\u003c/em\u003e infections spleen and lungs from mice of different group were isolated and macerated in ice-cold RPMI 1640 (Hyclone) media supplemented with 10% FBS using frosted glass slides to make single cell suspension. RBC lyse was done using RBC lysis buffer, and cells were washed with 10% RPMI 1640. Cells were counted and 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells per well were seeded in 12 well plates for staining. Cells were activated using 10 \u0026micro;g/ml cell surface antigen (CSA) stimulation. Subsequently, 0.5 \u0026micro;g/ml Brefeldin and Monensin solutions (Bio Legend) were added during the last 4 hrs of culture. After treatment cells were washed with FACS buffer (PBS\u0026thinsp;+\u0026thinsp;3% FBS) twice followed by antibody staining against surface markers and then 30 min fixation with 100 \u0026micro;l fixation buffer (Bio Legend). In the case of intracellular staining cells were first permeabilized using permeabilizing buffer (Bio Legend) then staining was done with fluorescently labeled anti-cytokine antibodies. Anti-Mouse: CD3-Pacific Blue, CD4-QR, CD8-APCCy7, CD69-PE, IFNγ-BV510, IL17-BV650, from Biolegend, USA.\u003c/p\u003e \u003cp\u003eThe intensity of fluorochromes was assessed by flow cytometry (BD LSRFortessa Cell Analyzer\u0026mdash;Flow Cytometers, BD Biosciences) followed by data analysis via FlowJo (Tree Star, USA).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe acknowledge the support of the DBT-supported Tuberculosis Aerosol Challenge Facility at the International Centre for Genetic Engineering and Biotechnology (ICGEB), New Delhi, India, and their staff in accomplishing this work. This work was supported by the funding provided by the Department of Biotechnology, Government of India (BT/PR13522/COE/34/27/2015) to VKN. \u0026nbsp;M.A. acknowledges the DST-INSPIRE Faculty Fellowship, DST, and the Government of India (DST/INSPIRE/04/2019/002743). A.B. receives a DST-INSPIRE Faculty Fellowship from the Department of Science and Technology (DST), Government of India, and an HGK-IYBA Fellowship from the Department of Biotechnology, Government of India.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData curation: Meetu Agarwal, Biplab Singha, Archna Singh, Shivam Chaturvedi, Ashima Bhaskar, Nisheeth Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori\u003c/p\u003e\n\u003cp\u003eFormal analysis: Meetu Agarwal, Ashima Bhaskar, Biplab singha, Archna Singh, Ved Prakash Dwivedi, Vinay Kumar Nandicoori\u003c/p\u003e\n\u003cp\u003eFunding acquisition: Meetu Agarwal, Vinay Kumar Nandicoori.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eInvestigation: Meetu Agarwal, Biplab Singha, Ashima Bhaskar, Ved Prakash Dwivedi, Methodology: Meetu Agarwal, Biplab singha, Shivam Chaturvedi, Archna Singh, Ashima Bhaskar, Ved Prakash Dwivedi,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSupervision: Meetu Agarwal, Vinay Kumar Nandicoori.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eValidation: Meetu Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eVisualization: Meetu Agarwal, Vinay Kumar Nandicoori.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWriting \u0026ndash; original draft: Meetu Agarwal\u003c/p\u003e\n\u003cp\u003eWriting \u0026ndash; review \u0026amp; editing: Meetu Agarwal, Ved Prakash Dwivedi, Vinay Kumar Nandicoori.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics statement\u003c/strong\u003e. Animal experimentation: Animal experiments were carried out in accordance with the guidelines approved by the Animal Ethics Committee of National Institute of Immunology (NII, Approval ID: IAEC#462/18), New Delhi, India, International Centre for Genetic Engineering and Biotechnology (ICGEB, approval ICGEB/IAEC/18092021/IMB-19), New Delhi, India and the Department of Biotechnology (DBT) Government of India. Mice were ethically sacrificed according to institutional and DBT regulations.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLaurenzi, M., Ginsberg, A. \u0026amp; Spigelman, M. Challenges associated with current and future TB treatment. \u003cem\u003eInfect. Disord. Drug Targets\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 105\u0026ndash;119 (2007).\u003c/li\u003e\n\u003cli\u003eChoi, H.-G. \u003cem\u003eet al.\u003c/em\u003e Antigen-Specific IFN-\u0026gamma;/IL-17-Co-Producing CD4+ T-Cells Are the Determinants for Protective Efficacy of Tuberculosis Subunit Vaccine. \u003cem\u003eVaccines\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 300 (2020).\u003c/li\u003e\n\u003cli\u003eKhader, S. A. \u003cem\u003eet al.\u003c/em\u003e IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. \u003cem\u003eNat. Immunol.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 369\u0026ndash;377 (2007).\u003c/li\u003e\n\u003cli\u003eCadena, A. M., Flynn, J. L. \u0026amp; Fortune, S. M. The Importance of First Impressions: Early Events in Mycobacterium tuberculosis Infection Influence Outcome. \u003cem\u003emBio\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e00342-00316 (2016).\u003c/li\u003e\n\u003cli\u003eAlderwick, L. J., Harrison, J., Lloyd, G. S. \u0026amp; Birch, H. L. The Mycobacterial Cell Wall--Peptidoglycan and Arabinogalactan. \u003cem\u003eCold Spring Harb. Perspect. Med.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, a021113 (2015).\u003c/li\u003e\n\u003cli\u003eBrennan, P. J. \u0026amp; Nikaido, H. The envelope of mycobacteria. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 29\u0026ndash;63 (1995).\u003c/li\u003e\n\u003cli\u003eJacobo-Delgado, Y. M., Rodr\u0026iacute;guez-Carlos, A., Serrano, C. J. \u0026amp; Rivas-Santiago, B. Mycobacterium tuberculosis cell-wall and antimicrobial peptides: a mission impossible? \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1194923 (2023).\u003c/li\u003e\n\u003cli\u003eSoni, V., Rosenn, E. H. \u0026amp; Venkataraman, R. Insights into the central role of N-acetyl-glucosamine-1-phosphate uridyltransferase (GlmU) in peptidoglycan metabolism and its potential as a therapeutic target. \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e480\u003c/strong\u003e, 1147\u0026ndash;1164 (2023).\u003c/li\u003e\n\u003cli\u003eMilewski, S., Gabriel, I. \u0026amp; Olchowy, J. Enzymes of UDP-GlcNAc biosynthesis in yeast. \u003cem\u003eYeast Chichester Engl.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 1\u0026ndash;14 (2006).\u003c/li\u003e\n\u003cli\u003eHan, X. \u003cem\u003eet al.\u003c/em\u003e Action of Dicumarol on Glucosamine-1-Phosphate Acetyltransferase of GlmU and Mycobacterium tuberculosis. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 1799 (2019).\u003c/li\u003e\n\u003cli\u003eSingh, M., Kempanna, P. \u0026amp; Bharatham, K. Identification of Mtb GlmU Uridyltransferase Domain Inhibitors by Ligand-Based and Structure-Based Drug Design Approaches. \u003cem\u003eMol. Basel Switz.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 2805 (2022).\u003c/li\u003e\n\u003cli\u003eSoni, V. \u003cem\u003eet al.\u003c/em\u003e Depletion of M. tuberculosis GlmU from Infected Murine Lungs Effects the Clearance of the Pathogen. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, e1005235 (2015).\u003c/li\u003e\n\u003cli\u003eMengin-Lecreulx, D. \u0026amp; van Heijenoort, J. Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e271\u003c/strong\u003e, 32\u0026ndash;39 (1996).\u003c/li\u003e\n\u003cli\u003eDe Reuse, H., Labigne, A. \u0026amp; Mengin-Lecreulx, D. The Helicobacter pylori ureC gene codes for a phosphoglucosamine mutase. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cstrong\u003e179\u003c/strong\u003e, 3488\u0026ndash;3493 (1997).\u003c/li\u003e\n\u003cli\u003eMehra-Chaudhary, R., Mick, J. \u0026amp; Beamer, L. J. Crystal Structure of Bacillus anthracis Phosphoglucosamine Mutase, an Enzyme in the Peptidoglycan Biosynthetic Pathway ▿. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cstrong\u003e193\u003c/strong\u003e, 4081\u0026ndash;4087 (2011).\u003c/li\u003e\n\u003cli\u003eTosi, T. \u003cem\u003eet al.\u003c/em\u003e Inhibition of the Staphylococcus aureus c-di-AMP cyclase DacA by direct interaction with the phosphoglucosamine mutase GlmM. \u003cem\u003ePLoS Pathog.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, e1007537 (2019).\u003c/li\u003e\n\u003cli\u003eZhu, Y. \u003cem\u003eet al.\u003c/em\u003e Cyclic-di-AMP synthesis by the diadenylate cyclase CdaA is modulated by the peptidoglycan biosynthesis enzyme GlmM in Lactococcus lactis. \u003cem\u003eMol. Microbiol.\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 1015\u0026ndash;1027 (2016).\u003c/li\u003e\n\u003cli\u003eKang, J. \u003cem\u003eet al.\u003c/em\u003e Effect of phosphoglucosamine mutase on biofilm formation and antimicrobial susceptibilities in M. smegmatis glmM gene knockdown strain. \u003cem\u003ePloS One\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e61589 (2013).\u003c/li\u003e\n\u003cli\u003eLi, S. \u003cem\u003eet al.\u003c/em\u003e Identification of M. tuberculosis Rv3441c and M. smegmatis MSMEG_1556 and essentiality of M. smegmatis MSMEG_1556. \u003cem\u003ePloS One\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e42769 (2012).\u003c/li\u003e\n\u003cli\u003eGriffin, J. E. \u003cem\u003eet al.\u003c/em\u003e High-Resolution Phenotypic Profiling Defines Genes Essential for Mycobacterial Growth and Cholesterol Catabolism. \u003cem\u003ePLOS Pathog.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, e1002251 (2011).\u003c/li\u003e\n\u003cli\u003eLevendosky, K., Janisch, N. \u0026amp; Quadri, L. E. N. Comprehensive essentiality analysis of the Mycobacterium kansasii genome by saturation transposon mutagenesis and deep sequencing. \u003cem\u003emBio\u003c/em\u003e e0057323 (2023) doi:10.1128/mbio.00573-23.\u003c/li\u003e\n\u003cli\u003eChoudhary, E., Thakur, P., Pareek, M. \u0026amp; Agarwal, N. Gene silencing by CRISPR interference in mycobacteria. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 6267 (2015).\u003c/li\u003e\n\u003cli\u003eWayne, L. G. \u0026amp; Hayes, L. G. An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 2062\u0026ndash;2069 (1996).\u003c/li\u003e\n\u003cli\u003eShimazu, K. \u003cem\u003eet al.\u003c/em\u003e Identification of the Streptococcus gordonii glmM gene encoding phosphoglucosamine mutase and its role in bacterial cell morphology, biofilm formation, and sensitivity to antibiotics. \u003cem\u003eFEMS Immunol. Med. Microbiol.\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 166\u0026ndash;177 (2008).\u003c/li\u003e\n\u003cli\u003eUrano-Tashiro, Y., Saiki, K., Yamanaka, Y., Ishikawa, Y. \u0026amp; Takahashi, Y. Streptococcus gordonii DL1 evades polymorphonuclear leukocyte-mediated killing via resistance to lysozyme. \u003cem\u003ePLoS ONE\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, e0261568 (2021).\u003c/li\u003e\n\u003cli\u003eYajima, A. \u003cem\u003eet al.\u003c/em\u003e Contribution of phosphoglucosamine mutase to the resistance of Streptococcus gordonii DL1 to polymorphonuclear leukocyte killing. \u003cem\u003eFEMS Microbiol. Lett.\u003c/em\u003e \u003cstrong\u003e297\u003c/strong\u003e, 196\u0026ndash;202 (2009).\u003c/li\u003e\n\u003cli\u003eFlynn, J. L., Chan, J. \u0026amp; Lin, P. L. Macrophages and control of granulomatous inflammation in tuberculosis. \u003cem\u003eMucosal Immunol.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 271\u0026ndash;278 (2011).\u003c/li\u003e\n\u003cli\u003eSaqib, U. \u003cem\u003eet al.\u003c/em\u003e Phytochemicals as modulators of M1-M2 macrophages in inflammation. \u003cem\u003eOncotarget\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 17937\u0026ndash;17950 (2018).\u003c/li\u003e\n\u003cli\u003eThiriot, J. D., Martinez-Martinez, Y. B., Endsley, J. J. \u0026amp; Torres, A. G. Hacking the host: exploitation of macrophage polarization by intracellular bacterial pathogens. \u003cem\u003ePathog. Dis.\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, ftaa009 (2020).\u003c/li\u003e\n\u003cli\u003eCho, J.-E., Park, S., Cho, S.-N., Lee, H. \u0026amp; Kim, Y. S. c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (p38 MAPK) are involved in Mycobacterium tuberculosis-induced expression of Leukotactin-1. \u003cem\u003eBMB Rep.\u003c/em\u003e \u003cstrong\u003e45\u003c/strong\u003e, 583\u0026ndash;588 (2012).\u003c/li\u003e\n\u003cli\u003ePasquinelli, V. \u003cem\u003eet al.\u003c/em\u003e Phosphorylation of mitogen-activated protein kinases contributes to interferon \u0026gamma; production in response to Mycobacterium tuberculosis. \u003cem\u003eJ. Infect. Dis.\u003c/em\u003e \u003cstrong\u003e207\u003c/strong\u003e, 340\u0026ndash;350 (2013).\u003c/li\u003e\n\u003cli\u003eAshwell, J. D. The many paths to p38 mitogen-activated protein kinase activation in the immune system. \u003cem\u003eNat. Rev. Immunol.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 532\u0026ndash;540 (2006).\u003c/li\u003e\n\u003cli\u003eCovarrubias, A. J., Aksoylar, H. I. \u0026amp; Horng, T. Control of macrophage metabolism and activation by mTOR and Akt signaling. \u003cem\u003eSemin. Immunol.\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 286\u0026ndash;296 (2015).\u003c/li\u003e\n\u003cli\u003eGisin, J., Schneider, A., N\u0026auml;gele, B., Borisova, M. \u0026amp; Mayer, C. A cell wall recycling shortcut that bypasses peptidoglycan de novo biosynthesis. \u003cem\u003eNat. Chem. Biol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 491\u0026ndash;493 (2013).\u003c/li\u003e\n\u003cli\u003eSonnenburg, J. L. \u003cem\u003eet al.\u003c/em\u003e Glycan foraging in vivo by an intestine-adapted bacterial symbiont. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e307\u003c/strong\u003e, 1955\u0026ndash;1959 (2005).\u003c/li\u003e\n\u003cli\u003eKhader, S. A. \u0026amp; Cooper, A. M. IL-23 and IL-17 in tuberculosis. \u003cem\u003eCytokine\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 79\u0026ndash;83 (2008).\u003c/li\u003e\n\u003cli\u003eBatt, S. M., Burke, C. E., Moorey, A. R. \u0026amp; Besra, G. S. Antibiotics and resistance: the two-sided coin of the mycobacterial cell wall. \u003cem\u003eCell Surf. Amst. Neth.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 100044 (2020).\u003c/li\u003e\n\u003cli\u003eBush, K. \u0026amp; Bradford, P. A. \u0026beta;-Lactams and \u0026beta;-Lactamase Inhibitors: An Overview. \u003cem\u003eCold Spring Harb. Perspect. Med.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, a025247 (2016).\u003c/li\u003e\n\u003cli\u003eSilver, L. L. Fosfomycin: Mechanism and Resistance. \u003cem\u003eCold Spring Harb. Perspect. Med.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, a025262 (2017).\u003c/li\u003e\n\u003cli\u003ede Chiara, C. \u003cem\u003eet al.\u003c/em\u003e D-Cycloserine destruction by alanine racemase and the limit of irreversible inhibition. \u003cem\u003eNat. Chem. Biol.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 686\u0026ndash;694 (2020).\u003c/li\u003e\n\u003cli\u003eMaitra, A. \u003cem\u003eet al.\u003c/em\u003e Cell wall peptidoglycan in Mycobacterium tuberculosis: An Achilles\u0026rsquo; heel for the TB-causing pathogen. \u003cem\u003eFEMS Microbiol. Rev.\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 548\u0026ndash;575 (2019).\u003c/li\u003e\n\u003cli\u003eBiwi, J., Biot, C., Guerardel, Y., Vercoutter-Edouart, A.-S. \u0026amp; Lefebvre, T. The Many Ways by Which O-GlcNAcylation May Orchestrate the Diversity of Complex Glycosylations. \u003cem\u003eMol. Basel Switz.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 2858 (2018).\u003c/li\u003e\n\u003cli\u003eJankute, M., Cox, J. A. G., Harrison, J. \u0026amp; Besra, G. S. Assembly of the Mycobacterial Cell Wall. \u003cem\u003eAnnu. Rev. Microbiol.\u003c/em\u003e \u003cstrong\u003e69\u003c/strong\u003e, 405\u0026ndash;423 (2015).\u003c/li\u003e\n\u003cli\u003eChandra, P., Grigsby, S. J. \u0026amp; Philips, J. A. Immune evasion and provocation by Mycobacterium tuberculosis. \u003cem\u003eNat. Rev. Microbiol.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 750\u0026ndash;766 (2022).\u003c/li\u003e\n\u003cli\u003eAgarwal, M., Soni, V., Kumar, S., Singha, B. \u0026amp; Nandicoori, V. K. Unique C-terminal extension and interactome of Mycobacterium tuberculosis GlmU impacts it\u0026rsquo;s in vivo function and the survival of pathogen. \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e478\u003c/strong\u003e, 2081\u0026ndash;2099 (2021).\u003c/li\u003e\n\u003cli\u003eSingha, B. \u003cem\u003eet al.\u003c/em\u003e The unique N-terminal region of Mycobacterium tuberculosis sigma factor A plays a dominant role in the essential function of this protein. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e299\u003c/strong\u003e, 102933 (2023).\u003c/li\u003e\n\u003cli\u003ePahuja, I. \u003cem\u003eet al.\u003c/em\u003e Berberine governs NOTCH3/AKT signaling to enrich lung-resident memory T cells during tuberculosis. \u003cem\u003ePLOS Pathog.\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, e1011165 (2023).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3364986/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3364986/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe limitations of TB treatment are the long duration and immune-dampening effects of anti-tuberculosis therapy. The cell wall of mycobacteria helps in its survival, pathogenicity, and virulence and provides resistance against different antibiotics. Hence, cell wall biosynthesis pathways and the enzymes involved are crucial and, thus, are good therapeutic targets. Here, we identify \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e) GlmM, (GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e) involved in the UDP-GlcNAc synthesis pathway as an essential enzyme. Using the CRISPR interference-mediated gene silencing approach, we generated a conditional knockdown strain, \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e. Depletion of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e affects the morphology and thickness of the cell wall. The \u003cem\u003eRv-glmM\u003c/em\u003e\u003csub\u003e\u003cem\u003ekD\u003c/em\u003e\u003c/sub\u003e strain attenuated \u003cem\u003eMtb\u003c/em\u003e survival \u003cem\u003ein vitro\u003c/em\u003e, in the host macrophages (\u003cem\u003eex vivo\u003c/em\u003e), and in a murine mice infection model (\u003cem\u003ein vivo\u003c/em\u003e). Results suggest that the depletion of GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e induces M1 macrophage polarization, prompting a pro-inflammatory cytokine response, apparent from the upregulation of activation markers, including IFNɣ and IL-17 that resists the growth of \u003cem\u003eMtb\u003c/em\u003e. Collectively, these observations provide a rationale for exploring GlmM\u003csub\u003e\u003cem\u003eMtb\u003c/em\u003e\u003c/sub\u003e as a potential therapeutic target.\u003c/p\u003e","manuscriptTitle":"Essential mycobacterial gene glmM as an immunotherapeutic target against tuberculosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-05 15:29:01","doi":"10.21203/rs.3.rs-3364986/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"communications-biology","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"commsbio","sideBox":"Learn more about [Communications Biology](http://www.nature.com/commsbio/)","snPcode":"","submissionUrl":"","title":"Communications Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Communications Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"56d553de-1e9c-4eb2-a2dd-b4a2803db8b2","owner":[],"postedDate":"October 5th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-07T07:07:42+00:00","versionOfRecord":{"articleIdentity":"rs-3364986","link":"https://doi.org/10.1038/s42003-024-06620-9","journal":{"identity":"communications-biology","isVorOnly":false,"title":"Communications Biology"},"publishedOn":"2024-08-06 04:00:00","publishedOnDateReadable":"August 6th, 2024"},"versionCreatedAt":"2023-10-05 15:29:01","video":"","vorDoi":"10.1038/s42003-024-06620-9","vorDoiUrl":"https://doi.org/10.1038/s42003-024-06620-9","workflowStages":[]},"version":"v1","identity":"rs-3364986","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3364986","identity":"rs-3364986","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.