LAPTM4B-35 promotes the progression of salivary gland mucoepidermoid carcinoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LAPTM4B-35 promotes the progression of salivary gland mucoepidermoid carcinoma Wei Liu, Jiaying Guan, Xiaofeng Qi, Jiaxin Yang, Jianlin Fan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3165341/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Mucoepidermoid carcinoma (MEC) is the most common type of malignancy affecting the salivary glands. Previous studies have suggested the involvement of lysosome-associated transmembrane protein 4β (LAPTM4B) in the development and progression of various tumors. However, its specific role in MEC has not been fully elucidated. In this study, we aimed to investigate the expression of LAPTM4B-35 in MEC tissue samples and explore its association with clinicopathological features. Additionally, we sought to inhibit the expression of LAPTM4B-35 in an MEC cell line and assess its impact on proliferation, invasion, apoptosis, and cell cycle. Our findings revealed upregulated expression of LAPTM4B-35 protein in MEC tissues. Furthermore, we observed that LAPTM4B-35 overexpression correlated with high histological grade and advanced clinical stages in MEC patients. To determine the functional significance of LAPTM4B-35, we performed knockdown experiments in MEC cells, which resulted in reduced proliferation and invasion ability, increased apoptosis rates, and altered cell cycle distribution. Taken together, these results suggest that LAPTM4B-35 may play a crucial role in the development of MEC and could potentially serve as a target for individualized therapy. LAPTM4B‑35 salivary gland mucoepidermoid carcinoma apoptosis invasion cell cycle Figures Figure 1 Figure 2 Figure 3 Introduction Mucoepidermoid carcinoma (MEC) is a type of malignancy that can arise in various glandular tissues, and it is the most common malignant salivary gland tumor in both children and adults. MEC accounts for approximately 30% of all salivary gland malignancies 1 , 2 . The parotid gland is the most frequent site of occurrence, followed by the palatal small salivary gland and submandibular gland. MEC tumors are composed of mucin-secreting cells, squamous cells, and intermediate cells, often exhibiting varying degrees of cyst structure. While low and intermediate histological grades of MEC have lower morbidity and mortality rates, cases of low-grade MEC with metastasis have been reported. Patients with high-grade, advanced, metastatic MEC have limited treatment options and a poor prognosis 3 . Therefore, the identification of novel and promising therapeutic targets is still needed. Lysosome-associated protein transmembrane 4β (LAPTM4B) was first cloned in human hepatocellular carcinoma (HCC). Its expression levels vary among different human tissues, with high expression observed in the testis and muscles, while other tissues exhibit relatively low levels 4 . LAPTM4B-35, a specific isoform of LAPTM4B, is upregulated in various carcinomas and has been associated with poor prognosis in patients with HCC, breast cancer, gastric cancer, and acute myeloid leukemia 5 – 8 . It is known to influence cellular functions by modulating multiple signaling pathways 9 , 10 . LAPTM4B has been implicated in promoting cancer cell proliferation and invasion, inducing autophagy, inhibiting apoptosis, and conferring drug resistance 11 , 12 . Additionally, mutations in LAPTM4B have been linked to serious genetic diseases, such as Myocardial Ischemia/Reperfusion Injury 13 . However, the clinical significance of LAPTM4B-35 in MEC and its role in the malignant phenotype of MEC remain unclear. In this study, we aimed to investigate the expression of LAPTM4B-35 in MEC and its potential association with clinicopathological features. Our findings revealed that LAPTM4B-35 overexpression in MEC was correlated with high histological grade and advanced clinical stage. Furthermore, the knockdown of LAPTM4B significantly inhibited cell proliferation, invasion, and apoptosis while affecting the cell cycle. These results collectively suggest that LAPTM4B may play a role in the progression of MEC and could serve as a potential biomarker and therapeutic target for MEC. Materials and methods Tissue specimens: A total of 85 MEC and adjacent tissue samples were collected between January 2010 and December 2017 from patients who underwent surgery at The Second Affiliated Hospital of Soochow University and other external institutes. Clinicopathological information, including age, sex, clinical stage, and tumor grade, was collected for each patient. This study was approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University, and written consent was obtained from all participating patients. Antibody and Immunohistochemistry (IHC): The Anti-LAPTM4B-35 antibody was generously provided by Professor Rouli Zhou from the Department of Cell Biology, School of Basic Medicine, Peking University School of Medicine. Immunohistochemistry was performed on paraffin-embedded MEC tissue specimens to detect LAPTM4B-35 expression. Semi-quantitative analysis of LAPTM4B-35 staining was scored as previously described. The anti-β-actin mouse monoclonal antibody for Western blotting was purchased from Abcam, while the goat anti-rabbit IgG secondary antibody was purchased from Beijing Zhongshan Golden Bridge Biotechnology. Cell culture and transfection: Human lung mucoepidermoid carcinoma cells (H292 cells) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco, US) and 1% antibiotics (streptomycin and penicillin) and cultured at 37°C in a humidified incubator with 5% CO2. To investigate the functional role of LAPTM4B in cellular processes, the endogenous expression of LAPTM4B was suppressed using small interfering RNA (siRNA) technology. Four siRNAs and a negative control (NC-FAM) were purchased from GenePharma (Shanghai, China), and the sequences are listed in Supplementary Table 1. H292 cells were seeded at a density of 5×10 5 cells per well in 6-well plates, and two groups were used: the Si LAPTM4B group and the Si NC group. After 18 to 24 hours of growth, the cells were transfected when they reached approximately 80% confluence. A mixture containing oligo (60 pmol) and Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific; 3 µL) was added to each well for 6 hours of transfection. The cells were further cultured for 24 hours and then harvested for detection. The efficiency of siRNA interference was determined by reverse transcription quantitative PCR (RT-qPCR) and Western blotting. The siRNAs that significantly knocked down LAPTM4B were selected for subsequent in vitro assays. Real-time RT-PCR: Total RNA was extracted from transfected H292 cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). The extracted RNA was reverse transcribed using M-MLV reverse transcriptase at 42°C for 45 minutes (Promega Corporation). Real-time PCR was performed using SYBR Green Master Mix (TaKaRa, Kyoto, Japan) with HACTB serving as the endogenous reference gene. The primer sequences were as follows: LAPTM4B forward primer: 5' CCCCCAAATCTGATGGACCTA 3', reverse primer: 5' GAGAGGGAACAGAGAGAAAAATGC 3'. HACTB forward primer: 5' CGTGGACATCCGCAAAGA 3', reverse primer: 5' GAAGGTGGACAG Protein extraction and western blotting: Transfected and control MEC cells were dissociated using a 0.25% trypsin solution and then lysed with RIPA lysis solution (Beyotime Biotechnology, Shanghai, China). The protein concentration was determined using the bicinchoninic acid protein assay kit. A total of 10 µg of protein samples was loaded per lane and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, the proteins were transferred onto a polyvinylidene difluoride membrane (Millipore, Sigma). The membranes were then blocked with 5% skimmed milk for 1 hour at room temperature, followed by overnight incubation with the primary antibodies at 4℃. Afterward, the membranes were incubated with the secondary antibody (rabbit Zhongshan Golden Bridge Company) for 1 hour at room temperature. Protein bands were visualized using an ECL kit (GE Healthcare), and actin was used as the internal control. The bands were scanned using an image analysis system (Tanon-4200, Science and Technology Ltd.), and the gray values were determined for densitometry. Cell proliferation assay: To assess cell proliferation, H292 cells transfected with siRNA and the control were subjected to a cell counting assay using the Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). At 24 hours, 48 hours, and 72 hours after transfection, 10 µL of CCK-8 solution was added to each well and incubated for 1 hour at 37℃. The absorbance of each well was then measured at 450 nm using a microplate reader, following the manufacturer's instructions (BioTek Instruments, Inc., Winooski, VT, USA). Transwell invasion assay: Transfected H292 cells were utilized for the Transwell invasion assay. The upper chambers were coated with 20% Matrigel in RPMI 1640 medium and incubated at 37°C overnight. Subsequently, a total of 1×10 3 cells suspended in 100 µL of serum-free medium were added to the upper chamber, while 500 µL of RPMI-1640 with 15% FBS was added to the bottom chamber to induce cell invasion. After 24 hours of incubation at 37°C, cells on the upper surface of the membrane were removed. The remaining cells were fixed with 4% paraformaldehyde for 20 minutes at room temperature, stained with crystal violet for 30 minutes at room temperature, and then counted by averaging cell counts from six separate fields under an inverted fluorescence microscope (NIKO, Japan). Annexin V apoptosis assay: Following the RT-PCR results, siRNA-667 was selected for apoptosis analysis. After a 48-hour incubation period, the transfected H292 cells were collected. Apoptosis analysis was performed using the PE-Annexin V Apoptosis Detection Kit (BD Biosciences) and a FACSCalibur flow cytometer (BD Biosciences), following the manufacturer's instructions. Cell cycle analysis: After transfection, H292 cells were harvested and fixed in 70% ethanol at -20°C overnight. The cells were then washed twice with PBS and treated with RNaseA (0.25 mg/ml) for 30 minutes at 37°C. Subsequently, the cells were incubated with a buffer containing 0.1% Triton X-100 and 0.02 mg/ml propidium iodide. The cell cycle distribution was analyzed using a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) and FlowJo software (Tree Star, Inc., Ashland, OR, USA). Statistical analysis: The association between LAPTM4B expression and clinicopathological characteristics of MEC tissues was assessed using the chi-squared test. Measurement data between the groups were compared using the Student's t-test. A significance level of P < 0.05 was considered statistically significant. Results The expression of LAPTM4B-35 was analyzed in a total of 85 cases of MEC. Among the patients, there were 34 males and 51 females, ranging in age from 7 to 76 years, with a median age of 48 years. Histologically, 13 patients (15.29%) had grade I tumors, 45 patients (52.94%) had grade II tumors, and 27 patients (31.76%) had grade III tumors. Table I presents the main characteristics of the patients. LAPTM4B-35 expression was observed to be low in 48 out of 85 patients (56.47%) and high in 37 out of 85 patients (43.53%). Notably, high LAPTM4B-35 expression was detected in 2 out of 13 samples (13.95%) of grade I tumors, 15 out of 45 samples (33.33%) of grade II tumors, and 20 out of 27 samples (74.07%) of grade III tumors, respectively. As previously reported 14 , non-tumor tissues exhibited varying levels of LAPTM4B-35 expression. Table I. Relationship between LAPTM4B-35 overexpression and clinicopathological features of MEC Variables cases LAPTM4B-35 protein p value total over-expression (n) n percentage All cases 85 Sex Male 34 16 47.06 0.59 Female 51 21 41.18 Age (years) ≤48 43 17 39.53 0.45 >48 42 20 47.62 Tumor location Major salivary gland 57 22 38.60 0.19 Minor salivary gland 28 15 53.57 Tumor size ≤2 cm 52 19 36.54 0.1 >2 cm 33 18 54.55 Histopathological grade G1 13 2 15.38 0.0003 G2 45 15 33.33 G3 27 20 74.07 TNM stage I,II 52 11 19.48 <0.00001 III, IV 33 26 44.44 LAPTM4B, lysosome‑associated protein transmembrane‑4β; MEC, mucoepidermoid carcinoma The clinicopathological features of MEC patients were analyzed in relation to the expression levels of LAPTM4B-35. As depicted in Fig. 2 , LAPTM4B-35 immunoreactivity showed a significant association with histological grade (P = 0.0003). To further analyze this association, grade I and II tumors were grouped as low grade, while grade III tumors were classified as high grade. The expression level of LAPTM4B in MEC tumor tissues was significantly associated with high-grade tumors (P = 0.0001). Furthermore, a significant difference was observed between high LAPTM4B-35 expression and advanced clinical stage (P = 0.026). Although no statistically significant differences were found between LAPTM4B-35 expression and age or sex, there was a trend indicating that high LAPTM4B-35 expression was more common in larger tumors (P = 0.10). Identification of specific and efficient miRNA sequences targeting LAPTM4B-35. In order to investigate the regulatory mechanism of LAPTM4B-35 in the progression of MEC, we designed siRNA molecules (siLAPTM4B) to downregulate the endogenous levels of LAPTM4B-35 in H292 cells. The knockdown efficiency was confirmed through real-time RT-PCR and Western blot analyses. Successful transient transfection of the NC-FAM plasmids into the H292 cell line was validated by detecting GFP expression using fluorescence microscopy. Our results demonstrated that siRNA-667 and siRNA-959 exhibited a more significant suppression of LAPTM4B-35 expression. The silencing efficiencies at the mRNA level were 95% and 86%, respectively (both P < 0.01) (Fig. 2 A). Consequently, both siRNAs were selected for further investigation. Association of LAPTM4B with MEC cell proliferation and invasion in vitro. To assess the potential impact of LAPTM4B on MEC proliferation, siRNA-667 and siRNA-959 were transfected into H292 cells. Our findings indicated that cells subjected to LAPTM4B-35 knockdown exhibited decreased proliferation compared to the control group, as determined by the CCK-8 assay (Fig. 3 A). Furthermore, we investigated the effects of LAPTM4B-35 on the invasion of H292 cells. As expected, the results showed that knockdown with siRNA-667 transfection significantly reduced the number of invasive cells (p = 0.018, Fig. 3 B). These observations suggest that LAPTM4B is involved in the invasion of MEC cells. Analysis of apoptosis and cell cycle regulation using flow cytometry. To evaluate the effects of LAPTM4B-35 knockdown on H292 cell apoptosis and cell cycle progression, flow cytometry analysis was performed. As depicted in Fig. 3 E, the percentage of cells in the G1 phase decreased to 32.2% in Si-667 cells compared to 47.8% in negative control cells. Moreover, the percentage of cells in the S phase was reduced in Si-667 cells, while an increase was observed in the G2 phase compared to negative control cells. These findings indicate that cell cycle progression, particularly the G1 transition and G2 arrest, was promoted in LAPTM4B-35 inhibited cells. Additionally, cells subjected to LAPTM4B knockdown exhibited a significantly higher percentage of late apoptotic or dead cells compared to untreated cells. These results suggest that LAPTM4B knockdown promotes apoptosis and alters cell cycle distribution in H292 cells. Discussion Salivary mucoepidermoid carcinoma (MEC) is a relatively rare malignancy in the head and neck region. Prognosis factors of the tumor includes age, sex, comorbidity score, histological grade, clinical stage, nodal metastasis and positive margins 15 . Despite most patients being diagnosed at an early stage, ongoing tumor growth is a common characteristic across all stages. One of the challenges in treating MEC is its close proximity to vital structures, which can make achieving complete tumor resection difficult and contribute to relapse. Currently, surgical management is the mainstay approach for resectable tumors, while radiotherapy is utilized for local disease control. However, conventional chemotherapies have limited effectiveness against MEC due to inherent resistance. Therefore, there is a growing interest in exploring novel biomarkers and targeted therapies for this disease. Recent research has identified several molecular markers in MEC. The t(11;19)(q21;p13) translocation is the most commonly detected translocation in MEC and is associated with a favorable prognosis 16 , 17 . This translocation results in the expression of the fusion protein MECT1/MAML2, which can activate the cAMP/CREB pathway, crucial for tumor cell growth. Moreover, it has been observed that t(11;19)(q21;p13)-positive tumors exhibit few or no chromosomal aberrations, while translocation-negative tumors show multiple changes 18 . Additionally, high expression of EGFR in high-grade MEC has been associated with poor clinical outcomes. These findings contribute to our understanding of the molecular landscape of MEC and offer potential targets for therapeutic interventions 19 . In this study, we have provided the first evidence linking LAPTM4B-35 expression with the pathologic grade and clinical stage of MEC. Through a loss-of-function approach using RNA interference (RNAi) to knock down LAPTM4B-35 in H292 cells, we have investigated the biological functions of LAPTM4B-35 in MEC tumorigenesis. Our findings demonstrate that silencing LAPTM4B-35 in H292 cells significantly enhances tumor cell apoptosis, suppresses cell proliferation and invasion, and alters cell cycle distribution. These results indicate that LAPTM4B may hold promise as a potential prognostic marker and therapeutic target for MEC. Previous studies have reported the upregulation of LAPTM4B in various human cancers, suggesting its potential as a prognostic biomarker in different malignancies 14 , 20 . Notably, LAPTM4B overexpression has been associated with mesenchymal transition (MET) in gastric tumors and correlated with the mutation status of the epidermal growth factor receptor (EGFR) gene in lung adenocarcinoma (LAC) 20 , 21 . LAPTM4B-35, one of the protein isoforms encoded by the LAPTM4B gene, has been shown to be associated with clinicopathological features in salivary adenoid cystic carcinoma 14 . Furthermore, elevated LAPTM4B-35 protein levels have been observed in the blood of patients with hepatocellular carcinoma (HCC), pancreatic ductal adenocarcinoma (PDAC), and lung adenocarcinoma (LAC), suggesting its potential as a novel cancer biomarker 20 , 22 , 23 . Additionally, the downregulation of LAPTM4B has been implicated in myocardial ischemia/reperfusion-induced injury through the unopposed activation of the mTORC1/TFEB signaling pathway, highlighting its involvement in non-tumor conditions 24 . There are several limitations to consider in our study. Firstly, the sample size of our population was relatively small, and larger collaborative studies are necessary to validate and strengthen our findings. Additionally, the underlying mechanism responsible for the dysregulation of LAPTM4B-35 protein remains unclear and requires further investigation. Moreover, the potential therapeutic implications of targeting LAPTM4B in MEC need to be elucidated. In summary, our study highlights the correlation between LAPTM4B expression and aggressive clinicopathological features of MEC. Furthermore, functional assays revealed the significant involvement of LAPTM4B in tumor proliferation, metastasis, and apoptosis in MEC. These findings suggest that LAPTM4B may serve as a crucial biomarker and a novel therapeutic target for MEC. However, additional research is warranted to address the aforementioned limitations and fully comprehend the clinical significance and therapeutic potential of LAPTM4B in MEC. Declarations Acknowledgements Not applicable. Funding This study was supported by grants from the Suzhou science and technology development plan projects (No. SYSD2020104), The Second Affiliated Hospital of Soochow University Research Fund (SDFEYGJ2007) and Suzhou Medical key supporting discipline(SZFCXK202124). Authors' contributions WL, JG, and JF conceived, performed and participated in the writing of the manuscript. XQ and JY performed the statistical analysis and confirmed the authenticity of all the raw data. All authors read and approved the final manuscript. Ethics approval and consent to participate The study was approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University, China. Signed informed consents were obtained from the patients or the guardians. Patient consent for publication Not applicable. Declaration of Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. References Pires FR, Pringle GA, de Almeida OP, Chen SY. Intra-oral minor salivary gland tumors: a clinicopathological study of 546 cases. Oral Oncol . 2007; 43 (5):463-70. Xu W, Wang Y, Qi X, Xie J, Wei Z, Yin X, et al. Prognostic factors of palatal mucoepidermoid carcinoma: a retrospective analysis based on a double-center study. Sci Rep . 2017; 7 :43907. Katabi N, Ghossein R, Ali S, Dogan S, Klimstra D, Ganly I. Prognostic features in mucoepidermoid carcinoma of major salivary glands with emphasis on tumour histologic grading. Histopathology . 2014; 65 (6):793-804. Liu X, Xiong F, Wei X, Yang H, Zhou R. LAPTM4B-35, a novel tetratransmembrane protein and its PPRP motif play critical roles in proliferation and metastatic potential of hepatocellular carcinoma cells. Cancer Sci . 2009; 100 (12):2335-40. Yang H, Xiong F, Qi R, Liu Z, Lin M, Rui J, et al. LAPTM4B-35 is a novel prognostic factor of hepatocellular carcinoma. J Surg Oncol . 2010; 101 (5):363-9. Xiao M, Jia S, Wang H, Wang J, Huang Y, Li Z. Overexpression of LAPTM4B: an independent prognostic marker in breast cancer. J Cancer Res Clin Oncol . 2013; 139 (4):661-7. Zhang H, Tian B, Yu H, Yao H, Gao Z. LAPTM4B-35 protein as a potential therapeutic target in gastric cancer. Tumour Biol . 2014; 35 (12):12737-42. Lebovitz CB, Robertson AG, Goya R, Jones SJ, Morin RD, Marra MA, et al. Cross-cancer profiling of molecular alterations within the human autophagy interaction network. Autophagy . 2015; 11 (9):1668-87. Blom T, Li S, Dichlberger A, Back N, Kim YA, Loizides-Mangold U, et al. LAPTM4B facilitates late endosomal ceramide export to control cell death pathways. Nat Chem Biol . 2015; 11 (10):799-806. Zhang H, Qi S, Zhang T, Wang A, Liu R, Guo J, et al. miR-188-5p inhibits tumour growth and metastasis in prostate cancer by repressing LAPTM4B expression. Oncotarget . 2015; 6 (8):6092-104. Tian M, Chen Y, Tian D, Qiao X, Ma Z, Li J. Beclin1 antagonizes LAPTM4B-mediated EGFR overactivation in gastric cancer cells. Gene . 2017; 626 :48-53. Li Y, Zhang Q, Tian R, Wang Q, Zhao JJ, Iglehart JD, et al. Lysosomal transmembrane protein LAPTM4B promotes autophagy and tolerance to metabolic stress in cancer cells. Cancer Res . 2011; 71 (24):7481-9. Meng Y, Wang L, Chen D, Chang Y, Zhang M, Xu JJ, et al. LAPTM4B: an oncogene in various solid tumors and its functions. Oncogene . 2016; 35 (50):6359-65. Fan J, Yang J, Qiao W, Liu W, Xing C. LAPTM4B-35 expression is associated with pathological grades and clinical stages in salivary adenoid cystic carcinoma. Oncol Lett . 2020; 19 (1):317-22. Ellis MA, Graboyes EM, Day TA, Neskey DM. Prognostic factors and occult nodal disease in mucoepidermoid carcinoma of the oral cavity and oropharynx: An analysis of the National Cancer Database. Oral Oncol . 2017; 72 :174-8. Tonon G, Modi S, Wu L, Kubo A, Coxon AB, Komiya T, et al. t(11;19)(q21;p13) translocation in mucoepidermoid carcinoma creates a novel fusion product that disrupts a Notch signaling pathway. Nat Genet . 2003; 33 (2):208-13. Cipriani NA, Lusardi JJ, McElherne J, Pearson AT, Olivas AD, Fitzpatrick C, et al. Mucoepidermoid Carcinoma: A Comparison of Histologic Grading Systems and Relationship to MAML2 Rearrangement and Prognosis. Am J Surg Pathol . 2019; 43 (7):885-97. Matse JH, Veerman ECI, Bolscher JGM, Leemans CR, Ylstra B, Bloemena E. High number of chromosomal copy number aberrations inversely relates to t(11;19)(q21;p13) translocation status in mucoepidermoid carcinoma of the salivary glands. Oncotarget . 2017; 8 (41):69456-64. Cros J, Sbidian E, Hans S, Roussel H, Scotte F, Tartour E, et al. Expression and mutational status of treatment-relevant targets and key oncogenes in 123 malignant salivary gland tumours. Ann Oncol . 2013; 24 (10):2624-9. Wang L, Meng Y, Zhang QY. LAPTM4B is a novel diagnostic and prognostic marker for lung adenocarcinoma and associated with mutant EGFR. BMC Cancer . 2019; 19 (1):293. Zhou S, Chen H, Yuan P, Shi N, Wang X, Hu J, et al. Helicobacter pylori infection promotes epithelial-to-mesenchymal transition of gastric cells by upregulating LAPTM4B. Biochem Biophys Res Commun . 2019; 514 (3):893-900. Pang Y, Zhang S, Yang H, Zhou RL. [Serum LAPTM4B-35 protein as a novel diagnostic marker for hepatocellular carcinoma]. Beijing Da Xue Xue Bao Yi Xue Ban . 2021; 53 (4):710-5. Yang Z, Senninger N, Flammang I, Ye Q, Dhayat SA. Clinical impact of circulating LAPTM4B-35 in pancreatic ductal adenocarcinoma. J Cancer Res Clin Oncol . 2019; 145 (5):1165-78. Gu S, Tan J, Li Q, Liu S, Ma J, Zheng Y, et al. Downregulation of LAPTM4B Contributes to the Impairment of the Autophagic Flux via Unopposed Activation of mTORC1 Signaling During Myocardial Ischemia/Reperfusion Injury. Circ Res . 2020; 127 (7):e148-e65. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3165341","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":218185593,"identity":"41ff172a-774d-4424-b4c5-d6b4fd5002de","order_by":0,"name":"Wei Liu","email":"","orcid":"","institution":"the First Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Liu","suffix":""},{"id":218185594,"identity":"c876934d-962b-4e24-8424-5af30d9c438d","order_by":1,"name":"Jiaying Guan","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Jiaying","middleName":"","lastName":"Guan","suffix":""},{"id":218185595,"identity":"548abc29-fd34-40c3-94e2-ddd4f4ef9d60","order_by":2,"name":"Xiaofeng Qi","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Xiaofeng","middleName":"","lastName":"Qi","suffix":""},{"id":218185596,"identity":"cf54d11c-c470-4a79-aba0-febd49cdd6db","order_by":3,"name":"Jiaxin Yang","email":"","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":false,"prefix":"","firstName":"Jiaxin","middleName":"","lastName":"Yang","suffix":""},{"id":218185597,"identity":"4a2b3449-8155-4957-8567-ff7270739544","order_by":4,"name":"Jianlin Fan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYBACfvbmgw8SDP7LsckfPkCcFsmeY8kGHwqYjfkl2BKI02Jww8dMcsYH5sSZM3gMiHTZDR5jYx4DNsYNt3s+3njDYCen20BAB+PstsLHPAY8zAZ3zm62nMOQbGx2gIAWZpnDm4G2SLAZHMjdJs3DcCBxGyEtbBIJZtI8BgY8BgdynhGnhUciBeh9gwQJyRk5bMRpkeABBbLBAQN+nmPGlnMMiPCL/XFQVP45UN/G3vzwxpsKOzmCWtCsJDZqkLSQqmMUjIJRMApGBAAAmbdD3YoOX6IAAAAASUVORK5CYII=","orcid":"","institution":"the Second Affiliated Hospital of Soochow University","correspondingAuthor":true,"prefix":"","firstName":"Jianlin","middleName":"","lastName":"Fan","suffix":""}],"badges":[],"createdAt":"2023-07-13 02:29:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3165341/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3165341/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":40138600,"identity":"709e0a79-a13b-4320-b6c8-1cd323079cd7","added_by":"auto","created_at":"2023-07-17 14:24:28","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":278552,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative immunohistochemical staining patterns showing the levels of lysosome-associated protein transmembrane-4β-35 (LAPTM4B-35) in 4 μm thick paraffin-embedded sections of MEC tissue samples. Low expression of LAPTM4B-35 in grade 1 MEC (B, A for H\u0026amp;E), moderate expression in grade 2 (D, C for H\u0026amp;E) and high expression in grade 3 tumors (F, E for H\u0026amp;E). Original magnification, ×100.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3165341/v1/b7a4c15c0e582bd8d9964a36.jpeg"},{"id":40138598,"identity":"f1779b6f-7fc1-4f86-8746-d8abd090822f","added_by":"auto","created_at":"2023-07-17 14:24:28","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":47045,"visible":true,"origin":"","legend":"\u003cp\u003eLAPTM4B expression was effectively knocked down in the H292 human MEC cancer cell lines following transfection with four siRNAs. A compared with the controls, the mRNA level of LAPTM4B-35 was more significantly downregulated in cells transfected with siRNA-667 and siRNA-559. B Western blotting analysis of LAPTM4B expression in H292 cells after SiRNA transfection. GAPDH was used as the internal control. C The protein levels were measured. The expression level of LAPTM4B in blank control was set to 1.0.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3165341/v1/1b485eaf009dbed6d553d7ea.jpeg"},{"id":40138599,"identity":"3e66c205-daa2-4aaf-8d92-8dc22b07856f","added_by":"auto","created_at":"2023-07-17 14:24:28","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":220067,"visible":true,"origin":"","legend":"\u003cp\u003eLAPTM4B promotes the proliferation, invasion and affects cell cycle of MEC cells. A In CCK-8 assays, knockdown of LAPTM4B significantly reduced the growth rate of H292 cells. B knockdown of LAPTM4B reduced invasion ability by transwell assay. C Knockdown of LAPTM4B decreased cell death by flow cytometry. D The late apoptotic cells or dead cells were decreased after Si667-RNA transfection. E Cell-cycle distributions was performed by flow cytometry analyses. F The histograms were analyzed, and the proportions of cells in G1 phase, S-phase, and G2 were shown, respectively.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3165341/v1/d31d954351013f25442aa539.jpeg"},{"id":42316249,"identity":"5196158c-f947-48e1-9fda-2c2d01f68736","added_by":"auto","created_at":"2023-08-29 15:52:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":534653,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3165341/v1/d48f9fff-62b5-4231-bc57-31c53885f808.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LAPTM4B-35 promotes the progression of salivary gland mucoepidermoid carcinoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMucoepidermoid carcinoma (MEC) is a type of malignancy that can arise in various glandular tissues, and it is the most common malignant salivary gland tumor in both children and adults. MEC accounts for approximately 30% of all salivary gland malignancies\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The parotid gland is the most frequent site of occurrence, followed by the palatal small salivary gland and submandibular gland. MEC tumors are composed of mucin-secreting cells, squamous cells, and intermediate cells, often exhibiting varying degrees of cyst structure. While low and intermediate histological grades of MEC have lower morbidity and mortality rates, cases of low-grade MEC with metastasis have been reported. Patients with high-grade, advanced, metastatic MEC have limited treatment options and a poor prognosis\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Therefore, the identification of novel and promising therapeutic targets is still needed.\u003c/p\u003e \u003cp\u003eLysosome-associated protein transmembrane 4β (LAPTM4B) was first cloned in human hepatocellular carcinoma (HCC). Its expression levels vary among different human tissues, with high expression observed in the testis and muscles, while other tissues exhibit relatively low levels\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. LAPTM4B-35, a specific isoform of LAPTM4B, is upregulated in various carcinomas and has been associated with poor prognosis in patients with HCC, breast cancer, gastric cancer, and acute myeloid leukemia\u003csup\u003e\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. It is known to influence cellular functions by modulating multiple signaling pathways\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. LAPTM4B has been implicated in promoting cancer cell proliferation and invasion, inducing autophagy, inhibiting apoptosis, and conferring drug resistance\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Additionally, mutations in LAPTM4B have been linked to serious genetic diseases, such as Myocardial Ischemia/Reperfusion Injury\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. However, the clinical significance of LAPTM4B-35 in MEC and its role in the malignant phenotype of MEC remain unclear.\u003c/p\u003e \u003cp\u003eIn this study, we aimed to investigate the expression of LAPTM4B-35 in MEC and its potential association with clinicopathological features. Our findings revealed that LAPTM4B-35 overexpression in MEC was correlated with high histological grade and advanced clinical stage. Furthermore, the knockdown of LAPTM4B significantly inhibited cell proliferation, invasion, and apoptosis while affecting the cell cycle. These results collectively suggest that LAPTM4B may play a role in the progression of MEC and could serve as a potential biomarker and therapeutic target for MEC.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eTissue specimens:\u003c/p\u003e \u003cp\u003eA total of 85 MEC and adjacent tissue samples were collected between January 2010 and December 2017 from patients who underwent surgery at The Second Affiliated Hospital of Soochow University and other external institutes. Clinicopathological information, including age, sex, clinical stage, and tumor grade, was collected for each patient. This study was approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University, and written consent was obtained from all participating patients.\u003c/p\u003e \u003cp\u003eAntibody and Immunohistochemistry (IHC):\u003c/p\u003e \u003cp\u003e The Anti-LAPTM4B-35 antibody was generously provided by Professor Rouli Zhou from the Department of Cell Biology, School of Basic Medicine, Peking University School of Medicine. Immunohistochemistry was performed on paraffin-embedded MEC tissue specimens to detect LAPTM4B-35 expression. Semi-quantitative analysis of LAPTM4B-35 staining was scored as previously described. The anti-β-actin mouse monoclonal antibody for Western blotting was purchased from Abcam, while the goat anti-rabbit IgG secondary antibody was purchased from Beijing Zhongshan Golden Bridge Biotechnology.\u003c/p\u003e \u003cp\u003eCell culture and transfection:\u003c/p\u003e \u003cp\u003eHuman lung mucoepidermoid carcinoma cells (H292 cells) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco, US) and 1% antibiotics (streptomycin and penicillin) and cultured at 37\u0026deg;C in a humidified incubator with 5% CO2. To investigate the functional role of LAPTM4B in cellular processes, the endogenous expression of LAPTM4B was suppressed using small interfering RNA (siRNA) technology. Four siRNAs and a negative control (NC-FAM) were purchased from GenePharma (Shanghai, China), and the sequences are listed in Supplementary Table\u0026nbsp;1. H292 cells were seeded at a density of 5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells per well in 6-well plates, and two groups were used: the Si LAPTM4B group and the Si NC group. After 18 to 24 hours of growth, the cells were transfected when they reached approximately 80% confluence. A mixture containing oligo (60 pmol) and Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific; 3 \u0026micro;L) was added to each well for 6 hours of transfection. The cells were further cultured for 24 hours and then harvested for detection. The efficiency of siRNA interference was determined by reverse transcription quantitative PCR (RT-qPCR) and Western blotting. The siRNAs that significantly knocked down LAPTM4B were selected for subsequent in vitro assays.\u003c/p\u003e \u003cp\u003eReal-time RT-PCR:\u003c/p\u003e \u003cp\u003eTotal RNA was extracted from transfected H292 cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). The extracted RNA was reverse transcribed using M-MLV reverse transcriptase at 42\u0026deg;C for 45 minutes (Promega Corporation). Real-time PCR was performed using SYBR Green Master Mix (TaKaRa, Kyoto, Japan) with HACTB serving as the endogenous reference gene. The primer sequences were as follows: LAPTM4B forward primer: 5' CCCCCAAATCTGATGGACCTA 3', reverse primer: 5' GAGAGGGAACAGAGAGAAAAATGC 3'. HACTB forward primer: 5' CGTGGACATCCGCAAAGA 3', reverse primer: 5' GAAGGTGGACAG\u003c/p\u003e \u003cp\u003eProtein extraction and western blotting:\u003c/p\u003e \u003cp\u003eTransfected and control MEC cells were dissociated using a 0.25% trypsin solution and then lysed with RIPA lysis solution (Beyotime Biotechnology, Shanghai, China). The protein concentration was determined using the bicinchoninic acid protein assay kit. A total of 10 \u0026micro;g of protein samples was loaded per lane and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, the proteins were transferred onto a polyvinylidene difluoride membrane (Millipore, Sigma). The membranes were then blocked with 5% skimmed milk for 1 hour at room temperature, followed by overnight incubation with the primary antibodies at 4℃. Afterward, the membranes were incubated with the secondary antibody (rabbit Zhongshan Golden Bridge Company) for 1 hour at room temperature. Protein bands were visualized using an ECL kit (GE Healthcare), and actin was used as the internal control. The bands were scanned using an image analysis system (Tanon-4200, Science and Technology Ltd.), and the gray values were determined for densitometry.\u003c/p\u003e \u003cp\u003eCell proliferation assay:\u003c/p\u003e \u003cp\u003eTo assess cell proliferation, H292 cells transfected with siRNA and the control were subjected to a cell counting assay using the Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan). At 24 hours, 48 hours, and 72 hours after transfection, 10 \u0026micro;L of CCK-8 solution was added to each well and incubated for 1 hour at 37℃. The absorbance of each well was then measured at 450 nm using a microplate reader, following the manufacturer's instructions (BioTek Instruments, Inc., Winooski, VT, USA).\u003c/p\u003e \u003cp\u003eTranswell invasion assay:\u003c/p\u003e \u003cp\u003eTransfected H292 cells were utilized for the Transwell invasion assay. The upper chambers were coated with 20% Matrigel in RPMI 1640 medium and incubated at 37\u0026deg;C overnight. Subsequently, a total of 1\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells suspended in 100 \u0026micro;L of serum-free medium were added to the upper chamber, while 500 \u0026micro;L of RPMI-1640 with 15% FBS was added to the bottom chamber to induce cell invasion. After 24 hours of incubation at 37\u0026deg;C, cells on the upper surface of the membrane were removed. The remaining cells were fixed with 4% paraformaldehyde for 20 minutes at room temperature, stained with crystal violet for 30 minutes at room temperature, and then counted by averaging cell counts from six separate fields under an inverted fluorescence microscope (NIKO, Japan).\u003c/p\u003e \u003cp\u003eAnnexin V apoptosis assay:\u003c/p\u003e \u003cp\u003eFollowing the RT-PCR results, siRNA-667 was selected for apoptosis analysis. After a 48-hour incubation period, the transfected H292 cells were collected. Apoptosis analysis was performed using the PE-Annexin V Apoptosis Detection Kit (BD Biosciences) and a FACSCalibur flow cytometer (BD Biosciences), following the manufacturer's instructions.\u003c/p\u003e \u003cp\u003eCell cycle analysis:\u003c/p\u003e \u003cp\u003eAfter transfection, H292 cells were harvested and fixed in 70% ethanol at -20\u0026deg;C overnight. The cells were then washed twice with PBS and treated with RNaseA (0.25 mg/ml) for 30 minutes at 37\u0026deg;C. Subsequently, the cells were incubated with a buffer containing 0.1% Triton X-100 and 0.02 mg/ml propidium iodide. The cell cycle distribution was analyzed using a FACScan flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) and FlowJo software (Tree Star, Inc., Ashland, OR, USA).\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis:\u003c/h2\u003e \u003cp\u003eThe association between LAPTM4B expression and clinicopathological characteristics of MEC tissues was assessed using the chi-squared test. Measurement data between the groups were compared using the Student's t-test. A significance level of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe expression of LAPTM4B-35 was analyzed in a total of 85 cases of MEC. Among the patients, there were 34 males and 51 females, ranging in age from 7 to 76 years, with a median age of 48 years. Histologically, 13 patients (15.29%) had grade I tumors, 45 patients (52.94%) had grade II tumors, and 27 patients (31.76%) had grade III tumors. Table I presents the main characteristics of the patients. LAPTM4B-35 expression was observed to be low in 48 out of 85 patients (56.47%) and high in 37 out of 85 patients (43.53%). Notably, high LAPTM4B-35 expression was detected in 2 out of 13 samples (13.95%) of grade I tumors, 15 out of 45 samples (33.33%) of grade II tumors, and 20 out of 27 samples (74.07%) of grade III tumors, respectively. As previously reported\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, non-tumor tissues exhibited varying levels of LAPTM4B-35 expression.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"643\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\" style=\"width: 54.7707%;\"\u003e\n \u003cp\u003eTable I. Relationship between LAPTM4B-35 overexpression and clinicopathological features of MEC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" rowspan=\"3\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003eVariables\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003ecases \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"36.70295489891135%\" colspan=\"2\" style=\"width: 23.1456%;\"\u003e\n \u003cp\u003eLAPTM4B-35 protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"3\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e\u003cem\u003ep\u0026nbsp;\u003c/em\u003evalue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.59090909090909%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003etotal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"67.04545454545455%\" colspan=\"2\" style=\"width: 23.1456%;\"\u003e\n \u003cp\u003eover-expression\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"21.59090909090909%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e(n)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"32.10227272727273%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003en\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.94318181818182%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003epercentage\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003eAll cases\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eSex\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;Male\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e47.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"2\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e0.59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;Female\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e41.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eAge (years)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u0026le;48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e39.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"2\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e0.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u0026gt;48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e47.62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eTumor location\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;Major salivary gland\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e38.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"2\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp;Minor salivary gland\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e53.57\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eTumor size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026le;2 cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e36.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"2\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026gt;2 cm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e54.55\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eHistopathological grade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; G1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e15.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"3\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e0.0003\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; G2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e33.33\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; G3\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e74.07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.38724727838258%\" colspan=\"3\" style=\"width: 45.1113%;\"\u003e\n \u003cp\u003eTNM stage\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.993779160186627%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; I,II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"11.81959564541213%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.573872472783826%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.12908242612753%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e19.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.262830482115085%\" rowspan=\"2\" style=\"width: 5.6276%;\"\u003e\n \u003cp\u003e\u0026lt;0.00001\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"33.83458646616541%\" style=\"width: 17.6088%;\"\u003e\n \u003cp\u003e\u0026nbsp; III, IV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"14.285714285714286%\" style=\"width: 11.3459%;\"\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.2406015037594%\" style=\"width: 16.1566%;\"\u003e\n \u003cp\u003e26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"23.1203007518797%\" style=\"width: 7.0798%;\"\u003e\n \u003cp\u003e44.44\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"5\" style=\"width: 58.2725%;\"\u003e\n \u003cp\u003eLAPTM4B, lysosome‑associated protein transmembrane‑4\u0026beta;; MEC, mucoepidermoid carcinoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe clinicopathological features of MEC patients were analyzed in relation to the expression levels of LAPTM4B-35. As depicted in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, LAPTM4B-35 immunoreactivity showed a significant association with histological grade (P\u0026thinsp;=\u0026thinsp;0.0003). To further analyze this association, grade I and II tumors were grouped as low grade, while grade III tumors were classified as high grade. The expression level of LAPTM4B in MEC tumor tissues was significantly associated with high-grade tumors (P\u0026thinsp;=\u0026thinsp;0.0001). Furthermore, a significant difference was observed between high LAPTM4B-35 expression and advanced clinical stage (P\u0026thinsp;=\u0026thinsp;0.026). Although no statistically significant differences were found between LAPTM4B-35 expression and age or sex, there was a trend indicating that high LAPTM4B-35 expression was more common in larger tumors (P\u0026thinsp;=\u0026thinsp;0.10).\u003c/p\u003e\n\u003cp\u003eIdentification of specific and efficient miRNA sequences targeting LAPTM4B-35.\u003c/p\u003e\n\u003cp\u003eIn order to investigate the regulatory mechanism of LAPTM4B-35 in the progression of MEC, we designed siRNA molecules (siLAPTM4B) to downregulate the endogenous levels of LAPTM4B-35 in H292 cells. The knockdown efficiency was confirmed through real-time RT-PCR and Western blot analyses. Successful transient transfection of the NC-FAM plasmids into the H292 cell line was validated by detecting GFP expression using fluorescence microscopy. Our results demonstrated that siRNA-667 and siRNA-959 exhibited a more significant suppression of LAPTM4B-35 expression. The silencing efficiencies at the mRNA level were 95% and 86%, respectively (both P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA). Consequently, both siRNAs were selected for further investigation.\u003c/p\u003e\n\u003cp\u003eAssociation of LAPTM4B with MEC cell proliferation and invasion in vitro.\u003c/p\u003e\n\u003cp\u003eTo assess the potential impact of LAPTM4B on MEC proliferation, siRNA-667 and siRNA-959 were transfected into H292 cells. Our findings indicated that cells subjected to LAPTM4B-35 knockdown exhibited decreased proliferation compared to the control group, as determined by the CCK-8 assay (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA). Furthermore, we investigated the effects of LAPTM4B-35 on the invasion of H292 cells. As expected, the results showed that knockdown with siRNA-667 transfection significantly reduced the number of invasive cells (p\u0026thinsp;=\u0026thinsp;0.018, Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eB). These observations suggest that LAPTM4B is involved in the invasion of MEC cells.\u003c/p\u003e\n\u003cp\u003eAnalysis of apoptosis and cell cycle regulation using flow cytometry.\u003c/p\u003e\n\u003cp\u003eTo evaluate the effects of LAPTM4B-35 knockdown on H292 cell apoptosis and cell cycle progression, flow cytometry analysis was performed. As depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE, the percentage of cells in the G1 phase decreased to 32.2% in Si-667 cells compared to 47.8% in negative control cells. Moreover, the percentage of cells in the S phase was reduced in Si-667 cells, while an increase was observed in the G2 phase compared to negative control cells. These findings indicate that cell cycle progression, particularly the G1 transition and G2 arrest, was promoted in LAPTM4B-35 inhibited cells. Additionally, cells subjected to LAPTM4B knockdown exhibited a significantly higher percentage of late apoptotic or dead cells compared to untreated cells. These results suggest that LAPTM4B knockdown promotes apoptosis and alters cell cycle distribution in H292 cells.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSalivary mucoepidermoid carcinoma (MEC) is a relatively rare malignancy in the head and neck region. Prognosis factors of the tumor includes age, sex, comorbidity score, histological grade, clinical stage, nodal metastasis and positive margins\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Despite most patients being diagnosed at an early stage, ongoing tumor growth is a common characteristic across all stages. One of the challenges in treating MEC is its close proximity to vital structures, which can make achieving complete tumor resection difficult and contribute to relapse. Currently, surgical management is the mainstay approach for resectable tumors, while radiotherapy is utilized for local disease control. However, conventional chemotherapies have limited effectiveness against MEC due to inherent resistance. Therefore, there is a growing interest in exploring novel biomarkers and targeted therapies for this disease.\u003c/p\u003e \u003cp\u003eRecent research has identified several molecular markers in MEC. The t(11;19)(q21;p13) translocation is the most commonly detected translocation in MEC and is associated with a favorable prognosis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. This translocation results in the expression of the fusion protein MECT1/MAML2, which can activate the cAMP/CREB pathway, crucial for tumor cell growth. Moreover, it has been observed that t(11;19)(q21;p13)-positive tumors exhibit few or no chromosomal aberrations, while translocation-negative tumors show multiple changes\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Additionally, high expression of EGFR in high-grade MEC has been associated with poor clinical outcomes. These findings contribute to our understanding of the molecular landscape of MEC and offer potential targets for therapeutic interventions\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we have provided the first evidence linking LAPTM4B-35 expression with the pathologic grade and clinical stage of MEC. Through a loss-of-function approach using RNA interference (RNAi) to knock down LAPTM4B-35 in H292 cells, we have investigated the biological functions of LAPTM4B-35 in MEC tumorigenesis. Our findings demonstrate that silencing LAPTM4B-35 in H292 cells significantly enhances tumor cell apoptosis, suppresses cell proliferation and invasion, and alters cell cycle distribution. These results indicate that LAPTM4B may hold promise as a potential prognostic marker and therapeutic target for MEC.\u003c/p\u003e \u003cp\u003ePrevious studies have reported the upregulation of LAPTM4B in various human cancers, suggesting its potential as a prognostic biomarker in different malignancies\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Notably, LAPTM4B overexpression has been associated with mesenchymal transition (MET) in gastric tumors and correlated with the mutation status of the epidermal growth factor receptor (EGFR) gene in lung adenocarcinoma (LAC) \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. LAPTM4B-35, one of the protein isoforms encoded by the LAPTM4B gene, has been shown to be associated with clinicopathological features in salivary adenoid cystic carcinoma\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Furthermore, elevated LAPTM4B-35 protein levels have been observed in the blood of patients with hepatocellular carcinoma (HCC), pancreatic ductal adenocarcinoma (PDAC), and lung adenocarcinoma (LAC), suggesting its potential as a novel cancer biomarker\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Additionally, the downregulation of LAPTM4B has been implicated in myocardial ischemia/reperfusion-induced injury through the unopposed activation of the mTORC1/TFEB signaling pathway, highlighting its involvement in non-tumor conditions\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThere are several limitations to consider in our study. Firstly, the sample size of our population was relatively small, and larger collaborative studies are necessary to validate and strengthen our findings. Additionally, the underlying mechanism responsible for the dysregulation of LAPTM4B-35 protein remains unclear and requires further investigation. Moreover, the potential therapeutic implications of targeting LAPTM4B in MEC need to be elucidated.\u003c/p\u003e \u003cp\u003eIn summary, our study highlights the correlation between LAPTM4B expression and aggressive clinicopathological features of MEC. Furthermore, functional assays revealed the significant involvement of LAPTM4B in tumor proliferation, metastasis, and apoptosis in MEC. These findings suggest that LAPTM4B may serve as a crucial biomarker and a novel therapeutic target for MEC. However, additional research is warranted to address the aforementioned limitations and fully comprehend the clinical significance and therapeutic potential of LAPTM4B in MEC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from the Suzhou science and technology development plan projects (No. SYSD2020104), The Second Affiliated Hospital of Soochow University Research Fund (SDFEYGJ2007) and Suzhou Medical key supporting discipline(SZFCXK202124).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAuthors\u0026apos; contributions\u003c/p\u003e\n\u003cp\u003eWL, JG, and JF conceived, performed and participated in the writing of the manuscript. XQ and JY performed the statistical analysis and confirmed the authenticity of all the raw data. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University, China. Signed informed consents were obtained from the patients or the guardians.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePatient consent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eDeclaration of Interest\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePires FR, Pringle GA, de Almeida OP, Chen SY. Intra-oral minor salivary gland tumors: a clinicopathological study of 546 cases. \u003cem\u003eOral Oncol\u003c/em\u003e. 2007;\u003cstrong\u003e43\u003c/strong\u003e(5):463-70.\u003c/li\u003e\n\u003cli\u003eXu W, Wang Y, Qi X, Xie J, Wei Z, Yin X, et al. Prognostic factors of palatal mucoepidermoid carcinoma: a retrospective analysis based on a double-center study. \u003cem\u003eSci Rep\u003c/em\u003e. 2017;\u003cstrong\u003e7\u003c/strong\u003e:43907.\u003c/li\u003e\n\u003cli\u003eKatabi N, Ghossein R, Ali S, Dogan S, Klimstra D, Ganly I. Prognostic features in mucoepidermoid carcinoma of major salivary glands with emphasis on tumour histologic grading. \u003cem\u003eHistopathology\u003c/em\u003e. 2014;\u003cstrong\u003e65\u003c/strong\u003e(6):793-804.\u003c/li\u003e\n\u003cli\u003eLiu X, Xiong F, Wei X, Yang H, Zhou R. LAPTM4B-35, a novel tetratransmembrane protein and its PPRP motif play critical roles in proliferation and metastatic potential of hepatocellular carcinoma cells. \u003cem\u003eCancer Sci\u003c/em\u003e. 2009;\u003cstrong\u003e100\u003c/strong\u003e(12):2335-40.\u003c/li\u003e\n\u003cli\u003eYang H, Xiong F, Qi R, Liu Z, Lin M, Rui J, et al. LAPTM4B-35 is a novel prognostic factor of hepatocellular carcinoma. \u003cem\u003eJ Surg Oncol\u003c/em\u003e. 2010;\u003cstrong\u003e101\u003c/strong\u003e(5):363-9.\u003c/li\u003e\n\u003cli\u003eXiao M, Jia S, Wang H, Wang J, Huang Y, Li Z. Overexpression of LAPTM4B: an independent prognostic marker in breast cancer. \u003cem\u003eJ Cancer Res Clin Oncol\u003c/em\u003e. 2013;\u003cstrong\u003e139\u003c/strong\u003e(4):661-7.\u003c/li\u003e\n\u003cli\u003eZhang H, Tian B, Yu H, Yao H, Gao Z. LAPTM4B-35 protein as a potential therapeutic target in gastric cancer. \u003cem\u003eTumour Biol\u003c/em\u003e. 2014;\u003cstrong\u003e35\u003c/strong\u003e(12):12737-42.\u003c/li\u003e\n\u003cli\u003eLebovitz CB, Robertson AG, Goya R, Jones SJ, Morin RD, Marra MA, et al. Cross-cancer profiling of molecular alterations within the human autophagy interaction network. \u003cem\u003eAutophagy\u003c/em\u003e. 2015;\u003cstrong\u003e11\u003c/strong\u003e(9):1668-87.\u003c/li\u003e\n\u003cli\u003eBlom T, Li S, Dichlberger A, Back N, Kim YA, Loizides-Mangold U, et al. LAPTM4B facilitates late endosomal ceramide export to control cell death pathways. \u003cem\u003eNat Chem Biol\u003c/em\u003e. 2015;\u003cstrong\u003e11\u003c/strong\u003e(10):799-806.\u003c/li\u003e\n\u003cli\u003eZhang H, Qi S, Zhang T, Wang A, Liu R, Guo J, et al. miR-188-5p inhibits tumour growth and metastasis in prostate cancer by repressing LAPTM4B expression. \u003cem\u003eOncotarget\u003c/em\u003e. 2015;\u003cstrong\u003e6\u003c/strong\u003e(8):6092-104.\u003c/li\u003e\n\u003cli\u003eTian M, Chen Y, Tian D, Qiao X, Ma Z, Li J. Beclin1 antagonizes LAPTM4B-mediated EGFR overactivation in gastric cancer cells. \u003cem\u003eGene\u003c/em\u003e. 2017;\u003cstrong\u003e626\u003c/strong\u003e:48-53.\u003c/li\u003e\n\u003cli\u003eLi Y, Zhang Q, Tian R, Wang Q, Zhao JJ, Iglehart JD, et al. Lysosomal transmembrane protein LAPTM4B promotes autophagy and tolerance to metabolic stress in cancer cells. \u003cem\u003eCancer Res\u003c/em\u003e. 2011;\u003cstrong\u003e71\u003c/strong\u003e(24):7481-9.\u003c/li\u003e\n\u003cli\u003eMeng Y, Wang L, Chen D, Chang Y, Zhang M, Xu JJ, et al. LAPTM4B: an oncogene in various solid tumors and its functions. \u003cem\u003eOncogene\u003c/em\u003e. 2016;\u003cstrong\u003e35\u003c/strong\u003e(50):6359-65.\u003c/li\u003e\n\u003cli\u003eFan J, Yang J, Qiao W, Liu W, Xing C. LAPTM4B-35 expression is associated with pathological grades and clinical stages in salivary adenoid cystic carcinoma. \u003cem\u003eOncol Lett\u003c/em\u003e. 2020;\u003cstrong\u003e19\u003c/strong\u003e(1):317-22.\u003c/li\u003e\n\u003cli\u003eEllis MA, Graboyes EM, Day TA, Neskey DM. Prognostic factors and occult nodal disease in mucoepidermoid carcinoma of the oral cavity and oropharynx: An analysis of the National Cancer Database. \u003cem\u003eOral Oncol\u003c/em\u003e. 2017;\u003cstrong\u003e72\u003c/strong\u003e:174-8.\u003c/li\u003e\n\u003cli\u003eTonon G, Modi S, Wu L, Kubo A, Coxon AB, Komiya T, et al. t(11;19)(q21;p13) translocation in mucoepidermoid carcinoma creates a novel fusion product that disrupts a Notch signaling pathway. \u003cem\u003eNat Genet\u003c/em\u003e. 2003;\u003cstrong\u003e33\u003c/strong\u003e(2):208-13.\u003c/li\u003e\n\u003cli\u003eCipriani NA, Lusardi JJ, McElherne J, Pearson AT, Olivas AD, Fitzpatrick C, et al. Mucoepidermoid Carcinoma: A Comparison of Histologic Grading Systems and Relationship to MAML2 Rearrangement and Prognosis. \u003cem\u003eAm J Surg Pathol\u003c/em\u003e. 2019;\u003cstrong\u003e43\u003c/strong\u003e(7):885-97.\u003c/li\u003e\n\u003cli\u003eMatse JH, Veerman ECI, Bolscher JGM, Leemans CR, Ylstra B, Bloemena E. High number of chromosomal copy number aberrations inversely relates to t(11;19)(q21;p13) translocation status in mucoepidermoid carcinoma of the salivary glands. \u003cem\u003eOncotarget\u003c/em\u003e. 2017;\u003cstrong\u003e8\u003c/strong\u003e(41):69456-64.\u003c/li\u003e\n\u003cli\u003eCros J, Sbidian E, Hans S, Roussel H, Scotte F, Tartour E, et al. Expression and mutational status of treatment-relevant targets and key oncogenes in 123 malignant salivary gland tumours. \u003cem\u003eAnn Oncol\u003c/em\u003e. 2013;\u003cstrong\u003e24\u003c/strong\u003e(10):2624-9.\u003c/li\u003e\n\u003cli\u003eWang L, Meng Y, Zhang QY. LAPTM4B is a novel diagnostic and prognostic marker for lung adenocarcinoma and associated with mutant EGFR. \u003cem\u003eBMC Cancer\u003c/em\u003e. 2019;\u003cstrong\u003e19\u003c/strong\u003e(1):293.\u003c/li\u003e\n\u003cli\u003eZhou S, Chen H, Yuan P, Shi N, Wang X, Hu J, et al. Helicobacter pylori infection promotes epithelial-to-mesenchymal transition of gastric cells by upregulating LAPTM4B. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e. 2019;\u003cstrong\u003e514\u003c/strong\u003e(3):893-900.\u003c/li\u003e\n\u003cli\u003ePang Y, Zhang S, Yang H, Zhou RL. [Serum LAPTM4B-35 protein as a novel diagnostic marker for hepatocellular carcinoma]. \u003cem\u003eBeijing Da Xue Xue Bao Yi Xue Ban\u003c/em\u003e. 2021;\u003cstrong\u003e53\u003c/strong\u003e(4):710-5.\u003c/li\u003e\n\u003cli\u003eYang Z, Senninger N, Flammang I, Ye Q, Dhayat SA. Clinical impact of circulating LAPTM4B-35 in pancreatic ductal adenocarcinoma. \u003cem\u003eJ Cancer Res Clin Oncol\u003c/em\u003e. 2019;\u003cstrong\u003e145\u003c/strong\u003e(5):1165-78.\u003c/li\u003e\n\u003cli\u003eGu S, Tan J, Li Q, Liu S, Ma J, Zheng Y, et al. Downregulation of LAPTM4B Contributes to the Impairment of the Autophagic Flux via Unopposed Activation of mTORC1 Signaling During Myocardial Ischemia/Reperfusion Injury. \u003cem\u003eCirc Res\u003c/em\u003e. 2020;\u003cstrong\u003e127\u003c/strong\u003e(7):e148-e65.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"LAPTM4B‑35, salivary gland mucoepidermoid carcinoma, apoptosis, invasion, cell cycle","lastPublishedDoi":"10.21203/rs.3.rs-3165341/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3165341/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMucoepidermoid carcinoma (MEC) is the most common type of malignancy affecting the salivary glands. Previous studies have suggested the involvement of lysosome-associated transmembrane protein 4β (LAPTM4B) in the development and progression of various tumors. However, its specific role in MEC has not been fully elucidated. In this study, we aimed to investigate the expression of LAPTM4B-35 in MEC tissue samples and explore its association with clinicopathological features. Additionally, we sought to inhibit the expression of LAPTM4B-35 in an MEC cell line and assess its impact on proliferation, invasion, apoptosis, and cell cycle. Our findings revealed upregulated expression of LAPTM4B-35 protein in MEC tissues. Furthermore, we observed that LAPTM4B-35 overexpression correlated with high histological grade and advanced clinical stages in MEC patients. To determine the functional significance of LAPTM4B-35, we performed knockdown experiments in MEC cells, which resulted in reduced proliferation and invasion ability, increased apoptosis rates, and altered cell cycle distribution. Taken together, these results suggest that LAPTM4B-35 may play a crucial role in the development of MEC and could potentially serve as a target for individualized therapy.\u003c/p\u003e","manuscriptTitle":"LAPTM4B-35 promotes the progression of salivary gland mucoepidermoid carcinoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-07-17 14:24:23","doi":"10.21203/rs.3.rs-3165341/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a63ed980-e605-46bf-b942-6b646a037739","owner":[],"postedDate":"July 17th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-08-29T15:44:15+00:00","versionOfRecord":[],"versionCreatedAt":"2023-07-17 14:24:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3165341","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3165341","identity":"rs-3165341","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.