Isolation of the symbiotic bacterium Brevundimonas aurantiaca and its regulatory effect on the autogeny of Culex pipiens pallens

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-04 · read from full text

The study examined whether a gut-specific symbiotic bacterium isolated from autogenous Culex pipiens pallens—identified as Brevundimonas aurantiaca—can colonize the midgut and modulate mosquito autogeny across multiple generations. Autogenous mosquitoes were used to isolate and culture gut bacteria, confirm midgut colonization and vertical transmission with GFP labeling and qRT-PCR, and measure reproductive gene expression changes (including vitellogenins, VgR, EcR, and ILPR) using relative qRT-PCR. Continuous multi-generational bacterial treatment led by the fifth generation to altered reproductive and developmental phenotypes, including reduced blood-feeding and increased oviposition with a prolonged larval development period. The paper is a preprint and explicitly notes it has not been peer reviewed. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Background Culex pipiens pallens is a significant vector of mosquito-borne diseases, and its autogenous trait exerts a critical impact on population expansion and disease transmission risks. Understanding the regulatory effect of gut-specific symbiotic bacteria on the autogeny of Cx. pipiens pallens will provide a microbial perspective to elucidate the mechanisms underlying the formation of autogenous reproductive strategies and provide a theoretical basis for the development of novel mosquito-borne disease control. Methods Autogenous Cx. pipiens pallens were utilized to isolate and culture gut-specific symbiotic bacteria. Green fluorescent protein (GFP) labeling technology and absolute quantitative real-time polymerase chain reaction (qRT-PCR) were used to confirm the colonization ability of the symbiotic bacteria in the guts of anautogenous Cx. pipiens pallens . The alterations in the expression levels of reproductive-related genes were verified by relative qRT-PCR. Continuous multi-generational treatment was applied to anautogenous Cx. pipiens pallens to evaluate transgenerational effects. Larval stage, pupation rate, pupal stage, emergence rate, male:female ratio, blood-feeding rate, oviposition rate, and hatching rate were recorded to assess the effects of the symbiotic bacteria on the reproductive and developmental phenotypes in the anautogenous Cx. pipiens pallens . Results The gut-specific symbiotic bacterium isolated from autogenous Cx. pipiens pallens was identified as Brevundimonas aurantiaca , a gram-negative rod-shaped bacterium that forms orange-yellow circular colonies on Caulobacter Medium and exhibits a smooth, intact surface and a characteristic rod morphology arranged in short chains. B. aurantiaca successfully colonized in the midgut of anautogenous Cx. pipiens pallens and achieved vertical transmission. qRT-PCR analysis revealed that B. aurantiaca significantly upregulated the expression of several key reproductive genes in anautogenous Cx. pipiens pallens , including vitellogenin ( Vg1 , Vg3 ), vitellogenin receptor ( VgR ), ecdysone receptor ( EcR ), and insulin-like peptide receptor ( ILPR ). After several generations of symbiotic bacteria treatment, the reproductive phenotype of anautogenous Cx. pipiens pallens was significantly altered. By the fifth generation, the blood-feeding rate of adult mosquitoes was reduced to 87.72%, while the oviposition rate increased to 58.71%, and the larval development period was significantly prolonged. Conclusions The symbiotic bacterium B. aurantiaca reshapes the reproductive strategy of anautogenous Cx. pipiens pallens by modulating the reproductive endocrine and nutritional signaling pathways of mosquitoes. These findings not only provide an important microbial regulatory perspective for understanding the molecular mechanisms underlying autogeny in mosquitoes, but also offer potential targets for the development of novel symbiont-based biocontrol strategies against mosquito-borne diseases.
Full text 147,778 characters · extracted from preprint-html · click to expand
Isolation of the symbiotic bacterium Brevundimonas aurantiaca and its regulatory effect on the autogeny of Culex pipiens pallens | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Isolation of the symbiotic bacterium Brevundimonas aurantiaca and its regulatory effect on the autogeny of Culex pipiens pallens Xin-Mei Wang, Xiu-Xia Guo, Peng Cheng, Hai-Fang Wang, Gang Li, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8983038/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Background Culex pipiens pallens is a significant vector of mosquito-borne diseases, and its autogenous trait exerts a critical impact on population expansion and disease transmission risks. Understanding the regulatory effect of gut-specific symbiotic bacteria on the autogeny of Cx. pipiens pallens will provide a microbial perspective to elucidate the mechanisms underlying the formation of autogenous reproductive strategies and provide a theoretical basis for the development of novel mosquito-borne disease control. Methods Autogenous Cx. pipiens pallens were utilized to isolate and culture gut-specific symbiotic bacteria. Green fluorescent protein (GFP) labeling technology and absolute quantitative real-time polymerase chain reaction (qRT-PCR) were used to confirm the colonization ability of the symbiotic bacteria in the guts of anautogenous Cx. pipiens pallens . The alterations in the expression levels of reproductive-related genes were verified by relative qRT-PCR. Continuous multi-generational treatment was applied to anautogenous Cx. pipiens pallens to evaluate transgenerational effects. Larval stage, pupation rate, pupal stage, emergence rate, male:female ratio, blood-feeding rate, oviposition rate, and hatching rate were recorded to assess the effects of the symbiotic bacteria on the reproductive and developmental phenotypes in the anautogenous Cx. pipiens pallens . Results The gut-specific symbiotic bacterium isolated from autogenous Cx. pipiens pallens was identified as Brevundimonas aurantiaca , a gram-negative rod-shaped bacterium that forms orange-yellow circular colonies on Caulobacter Medium and exhibits a smooth, intact surface and a characteristic rod morphology arranged in short chains. B. aurantiaca successfully colonized in the midgut of anautogenous Cx. pipiens pallens and achieved vertical transmission. qRT-PCR analysis revealed that B. aurantiaca significantly upregulated the expression of several key reproductive genes in anautogenous Cx. pipiens pallens , including vitellogenin ( Vg1 , Vg3 ), vitellogenin receptor ( VgR ), ecdysone receptor ( EcR ), and insulin-like peptide receptor ( ILPR ). After several generations of symbiotic bacteria treatment, the reproductive phenotype of anautogenous Cx. pipiens pallens was significantly altered. By the fifth generation, the blood-feeding rate of adult mosquitoes was reduced to 87.72%, while the oviposition rate increased to 58.71%, and the larval development period was significantly prolonged. Conclusions The symbiotic bacterium B. aurantiaca reshapes the reproductive strategy of anautogenous Cx. pipiens pallens by modulating the reproductive endocrine and nutritional signaling pathways of mosquitoes. These findings not only provide an important microbial regulatory perspective for understanding the molecular mechanisms underlying autogeny in mosquitoes, but also offer potential targets for the development of novel symbiont-based biocontrol strategies against mosquito-borne diseases. Culex pipiens pallens autogeny symbiotic bacteria Brevundimonas aurantiaca Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Culex pipiens pallens (Diptera: Culicidae) is the dominant mosquito species in regions north of 33°N in China. It also serves as a major vector for various pathogens including Japanese encephalitis virus, Bancroftian filaria, and West Nile virus. Fluctuations in its population directly influence the transmission risk and epidemic intensity of mosquito-borne diseases[ 1 – 2 ]. Blood-feeding by mosquitoes facilitates viral transmission among hosts, thus triggering the outbreak and prevalence of mosquito-borne diseases. Additionally, the reproductive strategies of mosquitoes are closely associated with their disease transmission capacity. Female mosquitoes normally require a blood meal to acquire protein nutrients essential for ovarian development, but some mosquito species or populations possess an autogenous trait, which allows these females mosquitoes to complete ovarian development and oviposition without blood-feeding[ 3 ]. Differences in the autogenous and anautogenous reproductive strategies not only relate to the ecological adaptability of mosquito populations but also provide an ideal biological model for investigating the regulatory mechanisms underlying mosquito reproductive development[ 4 ]. Currently, mosquito species showing autogenous behavior are known to span 15 genera and 68 species[ 5 ], including Aedes albopictus [ 6 ], Culiseta longiareolata [ 7 ], Ae. atropalpu s[ 8 ], Ae. caspius [ 9 ],and Cx. pipiens molestus [ 10 ]. Autogeny in mosquitoes not only facilitates the rapid establishment and persistence of populations and reduces their dependence on exogenous blood sources but may also decrease the proportion of pathogen infected individuals within populations, thus conferring significant ecological and epidemiological implications[ 11 – 13 ]. Although autogeny has been demonstrated to be regulated by genetic, nutritional, and hormonal factors[ 8 , 14 – 15 ], its underlying molecular mechanisms remain incompletely understood. In recent years, research on the symbiotic relationships between insects and microorganisms have advanced considerably, and the gut microbiota have been found to be extensively involved in key biological processes of the host, including growth and development, nutrient metabolism, immune defense, and reproductive regulation[ 14 , 16 – 19 ]. Specific gut microbiota have been reported to mediate the reproductive capacity of mosquitoes by influencing nutrient supply, hormone synthesis, and signaling pathways[ 20 ]. For example, Rahnella aquatilis impedes ovarian development and fecundity in Ae. albopictus by decreasing the levels of ecdysone and vitellogenin in the mosquito[ 21 ]. In Ae. aegypti , certain gut bacteria capable of synthesizing vitamin B are essential for the normal reproductive function of the host[ 22 ]. Sterilization decreases the production of ecdysone and the synthesis of vitellogenin in the fat body of Ae. aegypti ovaries, leading to reduced egg production[ 23 ]. Lysinibacillus sphaericus downregulates Vg expression by inhibiting lysosomal function and the TOR signaling pathway, thereby substantially suppressing oviposition in female Anopheles dirus [ 24 ]. Together, these studies suggest that the gut microbiota may be one of the key factors driving the differentiation of mosquito reproductive strategies and their adaptive evolution. The autogenous strain of Cx. pipiens pallens utilized in this study was derived from a laboratory-domesticated anautogenous strain. Our preliminary experiments found distinct differences in the composition and function of the gut microbiota between the autogenous and anautogenous strains, and Brevundimonas aurantiaca was identified as one of the gut-specific bacteria in autogenous mosquitoes[ 25 ]. Based on our preliminary analysis of digestive enzyme experiments, B. aurantiaca does not secrete digestive enzymes such as amylase and protease, suggesting that it may be involved in the regulation of autogeny in Cx. pipiens pallens through a non-digestive enzyme-mediated regulatory pathway. Therefore, we hypothesized that B. aurantiaca may influence the blood-feeding behavior, ovarian development, and reproductive output in mosquitoes by regulating host genes and physiological pathways related to reproduction. Furthermore, the symbiotic bacterial community in mosquitoes is a dynamic and unstable system, whereby newly acquired symbionts are often unable to stably colonize the host over long-term and, as such, may be lost during subsequent developmental or reproductive processes[ 26 – 28 ]. A single generational treatment with the bacteria may only induce a transient physiological response in the host, therefore, a multi-generational continuous treatment with the strain was applied to anautogenous Cx. pipiens pallens in our experimental designed in order to assess its transgenerational effects. The findings of this study are expected to elucidate the mechanisms underlying the formation of autogenous reproductive strategies in Cx. pipiens pallens from the perspective of microbe-host interactions, thereby providing a theoretical basis for the development of novel mosquito-borne disease control strategies based on microbial regulation. Methods Test insect source The Cx. pipiens pallens used in the experiments was a routinely reared strain from Shandong Institute of Parasitic Diseases. The autogenous strain was domesticated from this parental strain in the laboratory and has been maintained for 36 consecutive generations to date. Mosquitoes were reared under the following standard conditions: temperature of (25 ± 2) °C, relative humidity of 60% ± 5%, and a photoperiod of 12 h light:12 h dark (L:D = 12:12). Larvae were fed a mixture of pork liver powder and yeast powder at a ratio of 1:3, while adult mosquitoes were provided with a 10% glucose solution. Isolation and identification of the symbiotic bacterium B. aurantiaca Autogenous adult female mosquitoes of Cx. pipiens pallens were collected and divided into groups of 10, with three biological replicates per group. After being anesthetized with CO 2 , mosquitoes were immersed in 75% ethanol for 20 s and then washed three times with sterile 0.9% saline. The midgut tissue was harvested by aseptic dissection and placed in a sterile 1. 5-mL centrifuge tube. Then, 500 µL of 0.9% saline solution was added, and the sample was thoroughly homogenized. The homogenate was sequentially at 10 − 4 and 10 − 5 concentrations, and then 100 µL of each dilution was spread evenly onto a 9-cm-diameter Caulobacter Medium (CM) agar plate (Bacto peptone, 2.0 g/L; Yeast extract, 1.0 g/L; MgSO₄·7H₂O, 0.2 g/L; Agar, 15.0 g/L). The plate was inverted and incubated at 30°C in a constant-temperature incubator for 24 h. Based on characteristics such as colony size, morphology, and color, a single colony was picked and streaked into three zones on fresh CM medium for purification, continuing until a morphologically uniform single colony was obtained. Purified colonies were inoculated into 15-mL centrifuge tubes containing 3 mL of CM liquid medium and incubated by shaking at 30°C and 180 rpm for 24 h to obtain the bacterial culture. The bacterial culture samples were sent to Sangon Biotechnology Co., Ltd. (Shanghai, China) for 16S rRNA gene sequencing. The resulting sequences were subjected to BLAST alignment in the National Center for Biotechnology Information (NCBI) database ( https://www.ncbi.nlm.nih.gov ). Using sequences from reference strains with ≥ 97% homology as templates, a phylogenetic tree was created utilizing the Neighbor-Joining (NJ) method with MEGA 11.0 software. Bootstrap analysis was conducted with 1000 repetitions to evaluate tree reliability[ 29 ]. The taxonomic status of the strains was determined by integrating sequence homology alignment results with the phylogenetic tree analysis. After the bacteria were treated according to previous methods[ 30 ], the morphology of the bacteria was observed by scanning electron microscopy. Determination of B. aurantiaca growth curve and physiological and biochemical tests The growth curve of the strains was determined by spectrophotometry. A single colony of B. aurantiaca was inoculated into 5 mL of CM liquid medium, followed by shaking incubation at 180 rpm in a 30°C incubator for 16 h to obtain a seed culture in the logarithmic growth phase. The seed culture was then transferred into Erlenmeyer flasks containing fresh CM liquid medium at an inoculum size of 2% (v/v), with three biological replicates set for each group. A tube with uninoculated medium served as the blank control. The inoculated cultures were incubated continuously in a constant temperature shaking incubator at 30°C and 180 rpm for 48 h. The samples were collected at 1-h intervals, starting from the initial incubation time (0 h), and the absorbance value at a wavelength of 600 nm (OD600) was measured utilizing a microplate reader. The growth curve of B. aurantiaca in CM medium was plotted with incubation time (h) as the abscissa and OD600 value as the ordinate. The physiological and biochemical characteristics of this strain were determined using the API 20NE test strips (bioMérieux) for the identification of non-fastidious, non-enteric gram-negative bacilli, with the experimental procedures performed strictly in accordance with the manufacturer’s instructions. Construction of GFP-labeled bacteria and its colonization in the gut of anautogenous Cx. pipiens pallens To understand the colonization of B. aurantiaca in the intestinal tract of anautogenous Cx. pipiens pallens , the target strain B. aurantiaca isolated and identified in this study was employed as the host strain. A fluorescent expression plasmid carrying the green fluorescent protein (sfGFP)-coding gene and kanamycin resistance (50 µg/mL) screening marker was constructed and termed pET28(+) -sfGFP (General Biol (Anhui, China) Co., Ltd‌). Competent cells of B. aurantiaca were prepared via a modified rubidium chloride method following the instructions of the Ultra-Competent Cell Preps Kit (Sangon Biotech, Shanghai, China). The fluorescent plasmid pET28(+)-sfGFP was then transformed into the competent cells. Positive transformants were inoculated into CM liquid medium supplemented with 50 µg/mL kanamycin and cultured with shaking at 180 rpm and 30°C for 12 h to yield a large quantity of sfGFP-expressing bacteria. The final bacterial concentration was approximately 3.6 × 10 10 colony-forming units (CFU)/mL. The culture was centrifuged at 6000 rpm for 10 min to pellet the bacteria. The pellet was then washed three times with sterile PBS and mixed with a 10% sucrose solution at a 1:9 ratio (3.6 × 10 9 CFU/mL) to produce the bacterial-sucrose mixture feeding solution[31]. Newly emerged female mosquitoes were selected for the experiment. Mosquitoes in the experimental group were continuously fed the aforementioned bacteria-sucrose suspension for 3 consecutive days with fresh suspensions replaced daily, and then were separated into two groups and fed either blood or sterilized 10% glucose solution for 3 days. Mosquitoes in the control group were fed with a sterile 10% glucose solution throughout the entire experimental period, with a subgroup offered a blood meal on the third day. Egg rafts oviposited following blood feeding were transferred to sterile water and hatched larvae were reared to the second instar. On the third day after the switch to the sterile glucose solution, the midguts of mosquitoes in each group were dissected and placed on glass slides with 10 µL of sterile PBS added. Green fluorescence was observed utilizing the BioTek Cytation 1 Full-Automatic Imaging System (BioTek, USA) and Gen5 CHS 3.05 software. Absolute qRT-PCR detection of the symbiotic bacterium B. aurantiaca during the development of the autogenous Cx. pipiens pallens and cross-strain colonization Egg masses, larvae, pupae, and newly emerged female adults of autogenous Cx. pipiens pallens were selected for analysis. The bacterial load was determined in one-day-old emerged female F1 progeny of anautogenous Cx. pipiens pallens treated with B. aurantiaca (the bacterial treatment was performed as described in the fourth section). Each developmental stage had three biological replicates, with each replicate consisting of 10 test mosquitoes and one egg mass. Total DNA was isolated from all samples utilizing the SteadyPure Universal Genomic DNA Extraction Kit (Accurate Biotechnology (Hunan, China) Co., Ltd.). The abundance of B. aurantiaca was quantified via absolute quantitative real-time polymerase chain reaction (qRT-PCR). Primers were designed for the strain-specific gene crtW (Table 1 ), and the amplified fragment was inserted into the pUC56 plasmid to construct a standard template. The standard template was subjected to 10-fold serial dilution to produce a concentration gradient ranging from 3.29 × 10 8 to 3.29 × 10 1 copies. qRT-PCR reactions were conducted in a 20-µL reaction system utilizing the serially diluted standard template as the template, with the reaction conditions as follows: initial denaturation at 95°C for 180 s; 50 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s; and a final melting curve at 95°C for 10 s, 65°C for 60 s, and 97°C for 1 s. A standard curve was graphed with the logarithm of the copy number of the standard template as the abscissa and the corresponding cycle threshold (Ct) value as the ordinate. Sample DNA was utilized as the template for the qRT-PCR reactions, which was performed in parallel with the plasmid standard template for standard curve construction. After obtaining the Ct values of the samples, the log10 copy number was calculated according to the standard curve to determine the abundance of B. aurantiaca in each sample. Table 1 qRT-PCR primers used to measure bacterial colonization and reproductive gene expression Primer name Forward Primer (5′-3′) Reverse Primer(5′-3′) crtW CCTGCTCACCTGTTTCCACTTCG CCAGCCCTGAATCAAGACTCG β-actin AGCGTGAACTGACGGCTCTTG ACTCGTCGTACTCCTGCTTGG Vg1 TTCCCACCGTATTTTCCCCC CGATAGCAAGGCCATAGAACAAAG Vg3 CCAATCCGTGCTTCAACGAG GATCGAGTTTAGGCCATTGGG VgR CTGTGATGCGGTGAATGGGA TTGCCTTCGTCTTTGCCATC Met [ 32 ] AACCAAAACTACCCGCCACCTC CATCTGATGCCCATAACTGACCC EcR TCTATTCAAGTACGCGCTCCT ACAAATCTGGCAACACTTCGG ILPR CGGCTTACACCTTGGTAATGACA AAATACATGCTTCCCGCCAAC Preliminary study on the molecular mechanism of the symbiotic bacterium B. aurantiaca mediating the reproduction of Cx. pipiens pallens To investigate the initial effects of B. aurantiaca on the ovarian development of anautogenous female mosquitoes, an experimental group (FZYB group) was created. Newly emerged female mosquitoes were fed with a glucose solution supplemented with a bacterial culture (bacterial treatment method identical to that presented in the fourth section). A control group (FZY group) was established by feeding newly emerged female mosquitoes with a 10% sterile glucose solution. Cotton balls were replaced daily to ensure continuous supply. Female mosquito samples were collected at various time points. After removing the head and thorax, total RNA was isolated from the abdomen. RNA extraction was conducting utilizing the SteadyPure RNA Extraction Kit (Accurate Biotechnology (Hunan, China) Co., Ltd.), and total RNA quantification was performed using the NanoDrop OneC Micro UV-Vis spectrophotometer (Thermo Scientific, USA). Subsequently, RNA was reverse transcribed into cDNA for qRT-PCR analysis. The reaction system (20µL) comprised the following: master mix (10 µL), 10 µM forward primer (0.5 µL), 10 µM reverse primer (0.5 µL), cDNA (500 ng), and ddH2O added to a final volume of 20 µL. The program settings were as follows: 95°C for 180 s, followed by 45 cycles at95°C for 10 s, 59°C for 30 s; 95°C for 10 s, 65°C for 60 s, 97°C for 1 s. This method was utilized to determine alterations in the relative expression levels of reproductive-related genes in the FZYB group and FZY group from days 1 to 7 after mosquito emergence. The reproduction-related genes detected were: vitellogenin ( Vg1 , Gene ID: LOC120413209; Vg3 , Gene ID: LOC120428119), vitellogenin receptor ( VgR , Gene ID: LOC120420237), juvenile hormone receptor ( Met , Gene ID: LOC120412890), ecdysone receptor ( EcR , Gene ID: LOC120415091), and insulin-like peptide receptor ( ILPR , Gene ID: LOC120418613). β-actin (Gene ID: LOC120432082) from Cx. pipiens pallens was used as the internal control (Table 1 ). The relative expression levels of each target gene in the FZY and FZYB groups were analyzed using the 2 −ΔΔ Ct method. All experiments were performed with three biological replicates. Effects of the symbiotic bacterium B. aurantiaca on the autogeny of anautogenous mosquitoes To investigate the modulatory impact of B. aurantiaca on the autogeny of anautogenous Cx. pipiens pallens , a continuous colonization approach across all developmental stages was adopted for bacterial treatment in this study. Specifically, the strain was continuously introduced to anautogenous mosquitoes at the egg, larval, pupal, and adult stages to ensure its stable colonization throughout the different developmental stages of the mosquitoes. The negative control group was a routinely reared anautogenous mosquito population. During the experiment, the culture water containing fresh bacterial suspension was renewed every 2 days for larvae, and the sucrose-soaked cotton balls with bacterial suspension were replaced daily for adult mosquitoes[ 18 ]. To assess the long-term effects, the bacteria-treated group was continuously reared up to the 5th generation. Additionally, life history traits were measured, including larval developmental duration, pupation rate, pupal duration, eclosion rate, and male-to-female sex ratio. A blood meal was provided to adult mosquitoes at 3 days post-treatment, and reproduction-related parameters were recorded, including blood-feeding rate, oviposition rate, and hatching rate. Statistical analysis This study used GraphPad Prism 10.1.2 software for statistical analysis and chart creation. For continuous variables such as gene relative expression levels, larval duration, and pupal duration, which followed a normal distribution, two independent sample t -tests were utilized for comparisons between groups. For variables that did not follow a normal distribution or had unequal variances, the Mann-Whitney test was utilized for comparisons between groups. For categorical variables such as pupation rate, emergence rate, sex ratio, blood-sucking rate, egg-laying rate, and hatching rate, the χ 2 test was used for comparisons. All statistical analyses were conducted at a significance level of α = 0.05. Results Morphological and molecular identification of the symbiotic bacterium B. aurantiaca The isolated strain was a gram-negative bacterium with red, rod-shaped cells of irregular arrangement. On CM agar plates, the bacterium formed orange-yellow, opaque, circular colonies with a convex, smooth surface and an entire margin (Fig. 1 A). Scanning electron microscopy (SEM) observations revealed that the isolated bacterial strain exhibited a typical rod-shaped morphology, mostly arranged in short chains with an intact and smooth surface. No flagella, pili, or other obvious surface appendages were observed, and strain had an approximate length of 1.0–1.5 µm and a diameter of 0.4–0.6 µm (Fig. 1 B). 16S rRNA gene sequencing and BLAST analysis demonstrated that the amplified sequence of the strain had the highest similarity (99.63%) with that of B. aurantiaca strain (NR_028888.1). Phylogenetic tree analysis further revealed that the isolated strains clustered into a stable and independent branch with the members of the genus Brevundimonas , and they naturally clustered into the same evolutionary branch with B. aurantiaca (NR_028888.1) (bootstrap value = 100). This supports its taxonomic status as this species. Based on the above results, the isolated strain was named B. aurantiaca -Cx (Fig. 1 C). Growth curve and physiological and biochemical identification of the symbiotic bacterium B. aurantiaca The strain exhibited relatively slow growth, entering the logarithmic growth phase 10 h post-inoculation. The OD 600 significantly increased from 0.29 to 1.70, and the proliferation rate reached the maximum. At 33–39 h after inoculation, the growth of the isolated strain plateaued, with the OD 600 maintaining at approximately 1.70. The growth of the strain then entered the decline stage (Fig. 2 ). The isolated strain tested positive in the oxidase reaction and negative in the arginine dihydrolase, indole, nitrate reduction, glucose fermentation, and urease tests. It was unable to assimilate arabinose, mannose, mannitol, N-acetylglucosamine, gluconate, adipic acid, and phenylacetic acid, but it was able to assimilate glucose, maltose, capric acid, malic acid, and citric acid, and hydrolyze PNPG, gelatin, and aesculin. Based on the description of Brevundimonas in the Bergey's Manual of Systematic Bacteriology[ 33 ] and the aforementioned molecular biological identification results, the isolated strain was identified as B. aurantiaca . Dynamic distribution and cross-strain colonization of the symbiotic bacterium B. aurantiaca during the development of autogenous Cx. pipiens pallens Based on absolute qRT-PCR results, the bacterium was detectable at all developmental stages of the autogenous Cx. pipiens pallens . Bacterial counts (Log 10 copy number) in egg clusters, larvae, pupae, and adult mosquitoes were 1.70 ± 0.11, 2.18 ± 0.03, 2.76 ± 0.25, and 3.08 ± 0.07, respectively, showing an enrichment trend in newly emerged female mosquitoes. The bacterium was also detected in newly emerged F1 female mosquitoes from the bacterial treatment group (2.41 ± 0.16) (Fig. 3 A B). The plasmid expressing GFP was successfully introduced into B. aurantiaca by chemical transformation, and the transformed bacteria were successfully colonized in adult mosquitoes after feeding (Fig. 3 C). B. aurantiaca colonized the midgut of anautogenous Cx. pipiens pallens and possessed the capacity of vertical transmission (Fig. 3 D). The symbiotic bacterium B. aurantiaca promotes mosquito reproduction via multiple reproduction-related genes Within 7 days of adult mosquito emergence, we systematically assessed the relative expression levels of the Vg1 , Vg3 , VgR , Met , EcR , and ILPR genes. qRT-PCR analysis found that the expression dynamics of major reproductive genes exhibited substantial alterations in the bacteria-colonized experimental group (FZYB) as compared with the non-inoculated control group (FZY) during the observation period (Fig. 4 ). Specifically, Vg3 expression was significantly upregulated on day 1 (t-test, t (4) = −3.008, P = 0.04), with levels markedly higher than those in the FZY group at the same time point. Although its expression fluctuated thereafter, Vg3 remained elevated relative to the FZY group at most time points. Vg1 expression was significantly upregulated on day 2 (t-test, t (4) = −3.901, P = 0.018), and VgR expression was also significantly increased in the experimental group than in the control group on day 2 (t-test, t (4) = -15.038, P < 0.001), indicating a synchronous enhancement in signal reception capacity during the peak period of vitellin synthesis. Furthermore, the expression of the ecdysone receptor gene EcR in the FZYB group peaked on day 3, with it being significantly elevated as compared to the FZY group (t-test, t (4) = −4.457, P = 0.011). Even though its expression gradually declined thereafter, EcR expression remained at a relatively high level, suggesting an enhanced sensitivity to 20-hydroxyecdysone (20E), the main hormone initiating vitellogenesis. In contrast, the expression of Met , the key mediator gene mediating the juvenile hormone JH signaling pathway, remained relatively stable. Although a slight increasing trend was observed in the FZYB group on day 2 and day 7, no statistically significant difference was observed between the two groups at any time point. Notably, the expression of the insulin-like peptide receptor gene ILPR was significantly enhanced in the FZYB group, with a significant increase detected on day 2 (t-test, t (4) = −4.138, P = 0.014). This expression change coincided with the peak expression time of VgR and Vg1 , indicating that B. aurantiaca may simultaneously activate the nutrient-sensing pathway and the insulin signaling pathway to synergistically promote the production of vitellogenin, thereby regulating mosquito reproductive physiology. Effects of the symbiotic bacterium B. aurantiaca on the fitness of anautogenous mosquitoes Changes in the indicators of mosquito life history in the various treatment groups (anautogenous mosquitoes, bacteria-treated first generation, and bacteria-treated fifth generation) are shown in Table 2 . There was no significant difference in larval development time between the first generation of bacteria treatment and the control group, but the larval stage of the fifth generation was significantly prolonged (Mann-Whitney U-test, U = 3789.5, Z = −4.504, P < 0.001), indicating that the delayed effect of bacteria on larval development gradually appeared after long-term passage. After B. aurantiaca treatment, the pupation rate and emergence rate of mosquitoes exhibited an upward trend, and remained stable in the fifth generation, indicating that B. aurantiaca treatment could promote the metamorphosis and development of mosquitoes, and the effect was stable in passage. There was no substantial difference in the duration of pupal stage and the ratio of male to female between the treatment and control groups. Regarding blood-feeding behavior, the control group had the highest blood-feeding rate. After B. aurantiaca treatment, the blood-feeding rate was significantly reduced, with the first generation of mosquitoes decreasing to 91.81% (Chi-square test, χ 2 = 6.073, df = 1, P = 0.014) and the fifth generation further decreasing to 87.72% (Chi-square test, χ 2 = 10.161, df = 1, P = 0.0014). In contrast, the rate of oviposition increased after B. aurantiaca treatment. There was no substantial difference in the hatching rate of eggs among the three groups, indicating that the bacteria had no observable impact on the fertilization and embryonic development of eggs. Table 2 Comparison of life history traits among anautogenous, bacteria-treated F1, and bacteria-treated F5 mosquito groups Life history trait Anautogenous mosquito Bacteria-treated F1 Bacteria-treated F5 Larval stage (d) 7.39 ± 0.93 7.20 ± 0.84 8.27 ± 1.47** Pupation rate (%) 86.67 ± 9.81 90.00 ± 5.45 92.50 ± 3.19 Pupal stage (d) 1.41 ± 0.43 1.36 ± 0.46 1.46 ± 0.36 Emergence rate (%) 87.59 ± 5.72 91.79 ± 5.36 91.89 ± 3.50 Male:female ratio 1: 1.28 1: 1.25 1: 1.27 ** P < 0.001 compared with anautogenous mosquito group. Table 3 Comparison of reproductive traits among anautogenous, bacteria-treated F1, and bacteria-treated F5 mosquito groups Reproductive trait Anautogenous mosquito Bacteria-treated F1 Bacteria-treated F5 Blood-feeding rate (%) 96.31 ± 2.71 91.81 ± 1.92* 87.72 ± 3.05** Oviposition rate (%) 48.17 ± 4.03 54.85 ± 3.76 58.71 ± 1.52 Hatching rate (%) 97.69 ± 2.39 96.04 ± 1.40 96.97 ± 1.60 * P < 0.05, ** P < 0.01 compared with anautogenous mosquito group. Discussion Compared with the anautogenous mosquito species, the autogenous mosquitoes rapidly initiated the reproductive cycle after emergence without going through the host-seeking and blood-feeding risk period[ 3 ]. Autogenous females have increased nutrient storage efficiency during the larval stage. The primary difference between autogenous and anautogenous mosquitoes lies in the differentiation of reproductive and nutritional strategies, which is a systematic phenotypic feature of the synergistic effect of genetic regulation and environmental adaptation, and this differentiation demonstrates obvious differences in physiological metabolism, molecular regulation, and environmental adaptation[ 15 , 34 – 36 ]. Several factors can influence the expression of reproductive genes and thus affect the reproductive status of insects. As a key symbiotic system in insects, the gut microbiota play an irreplaceable role in the modulation of insect growth and reproduction, which includes vitellogenesis, ovarian development, oviposition behavior and offspring survival, forming a co-evolution mechanism between host and microorganisms[ 37 – 41 ]. Specific intestinal bacteria can directly interfere with reproductive development through metabolic regulation or signaling pathways. For instance, Rahnella aquatilis hinders fecundity and ovarian maturation in female Ae. albopictus by decreasing the production of ecdysone and vitellogenin[ 21 ], whereas lactic acid bacteria in the gut of honey bee ( Apis cerana ) queens mediate ovarian metabolism via the purine metabolic pathway to drive ovarian activation[ 42 ]. Some intestinal bacteria can also indirectly enhance reproductive success by regulating host behaviors. For example, Citrobacter in the gut of the oriental fruit fly ( Bactrocera dorsalis ) produces 3-hexenyl acetate, which attracts hosts to oviposit at suitable sites, achieving precise matching between vertical bacterial transmission and host reproduction[ 43 ]. Klebsiella generates 2-ethylhexanol and 2,4-di-tert-butylphenol, which induce oviposition in gravid Ae. aegypti by mimicking oviposition signals[ 44 ]. In this study, we isolated and identified the gut-specific symbiotic bacterium B. aurantiaca from autogenous Cx. pipiens pallens . We found that the bacterium can stably colonize the autogenous Cx. pipiens pallens and that it possesses the ability for vertical transmission, exerting systemic effects on the growth, development and reproductive physiology of mosquitoes. Absolute qRT-PCR and green fluorescence observation confirmed that this bacterium could be consistently detected across all developmental stages of autogenous Cx. pipiens pallens and that it exhibited enriched abundance in newly emerged female adults, indicating its successful adaptation to distinct microenvironments within the host, as well as its potential to proliferate during the adult stage and persist in mosquito populations. Colonization by B. aurantiaca altered the expression dynamics of key reproductive genes ( Vg , VgR , EcR , ILPR ) in mosquitoes. The expression of Vg and its receptor VgR serves as a central marker for reproductive initiation and oocyte maturation in female mosquitoes, and is precisely mediated by Met , EcR , and ILPR signaling pathways[ 45 – 47 ]. Our findings confirmed that colonization by B. aurantiaca induced the coordinated upregulation of Vg1 and VgR in mosquitoes, suggesting that the bacterium not only promotes vitellogenin synthesis but also synchronously enhances signal reception capacity. Additionally, the expression of Vg3 peaked and remained at a high level at most subsequent time points. The significant upregulation of Vg3 further indicates the global activation of the vitellogenin synthetic pathway. Collectively, these results suggest that colonization by B. aurantiaca may provide a more sufficient material basis for oocyte development by promoting the synthesis and transport of vitellogenin. In terms of hormone signaling pathway, B. aurantiaca colonization significantly upregulated the expression of EcR , which is a key regulator of ecdysone signaling. This suggests that B. aurantiaca is more sensitive to 20E, a major hormone that initiates vitellogenesis. This finding is consistent with previous reports that bacteria can influence the host juvenile hormone-ecdysone axis[ 48 – 49 ]. Most importantly, we observed that this bacterium could substantially increase the expression of ILPR , and the peak of ILPR expression coincided with the peak of Vg1 and VgR . The insulin signaling pathway is the core hub linking nutritional status and reproduction[ 50 – 51 ]. After emergence, the insulin signaling pathway is activated to initiate vitellogenesis, driving the massive synthesis of vitellogenin in the fat body and prioritizing reproductive development over other metabolic activities, such as flight muscle development or glycogen storage[ 4 , 8 , 15 ]. It has been reported that bacteria can mimic or enhance the insulin signaling pathway to promote host nutrient sensing and distribution, thereby promoting yolk synthesis[ 52 – 53 ]. The results of this study suggest that B. aurantiaca may interfere with the nutrient sensing and insulin signaling pathway in the host and synergize with 20E signaling to drive the occurrence of vitellogenesis. In contrast, the expression of Met , a key gene in the juvenile hormone signaling pathway, was not significantly altered, indicating that B. aurantiaca influenced growth and reproduction in the mosquito in a pathway-specific manner. Our results further confirm that the effects of B. aurantiaca on the developmental and reproductive phenotypes of Cx. pipiens pallens exhibit a transgenerational effect. Long-term exposure to B. aurantiaca can gradually delay the development of mosquito larvae, but promote the subsequent transformation process—that is, substantially decrease the blood feeding rate of female mosquitoes, but enhance the oviposition rate. This effect was stable after passage, which was consistent with the developmental phenomenon of autogenous mosquitoes observed in our study. Combined with the dynamic changes in reproductive gene expression, it can be inferred that under the host's reduced blood-feeding behavior, bacterial colonization improves the host's efficiency in converting available resources into reproductive output through the optimization of reproductive gene expression and physiological regulation. As a vertically transmissible symbiotic bacterium, the interaction between B. aurantiaca and Cx. pipiens pallens may represent a microecological adaptation that lies between symbiosis and mild regulation, whereby the bacterium modulates host reproduction-related pathways to influence the growth dynamics and reproductive potential of host populations. The long-term effects of this bacterium on mosquito populations are manifested in two specific aspects. First, it decreases the contact frequency between mosquitoes and humans via decreased blood-feeding rates, thereby directly lowering the risk of disease transmission. Second, it alters the mosquito life-history strategy, which in turn, alters the adaptive capacity and growth potential of the population in the environment. Therefore, the findings of this study provide a novel perspective for exploring microbe-based novel strategies for mosquito vector regulation. Conclusion In this study, we successfully isolated the unique commensal bacterium B. aurantiaca from the intestinal tract of autogenous Cx. pipiens pallens , characterized its morphological, physiological and biochemical characteristics, and confirmed that the bacterium could stably colonize and achieve vertical transmission in anautogenous Cx. pipiens pallens . B. aurantiaca colonization was found to significantly upregulate the expression of reproduction-related genes in anautogenous Cx. pipiens pallens , and activate vitellogenesis, ecdysone signaling and insulin nutrition signaling pathways, thereby driving changes in the reproductive phenotype of the host. After several generations of treatment, the blood-feeding rate of anautogenous Cx. pipiens pallens decreased, while the oviposition rate increased, indicating that the bacterium could gradually reshape the reproductive and nutritional strategy of the host, and steer the anautogenous Cx. pipiens pallens to autogeny. This study confirmed that B. aurantiaca , an intestinal symbiotic bacterium, is a key factor modulating autogeny in Cx. pipiens pallens , and its regulatory mechanism is closely associated with the modulation of host reproductive endocrine and nutrient metabolic pathways, thus enriching the microbe-driven theory underlying the formation of autogenous traits in mosquitoes. Furthermore, this bacterium decreased the blood-feeding rate of mosquitoes, providing a novel insight into the prevention and control of mosquito-borne diseases via intestinal microbiota modulation. For future studies, a germ-free Cx. pipiens pallens model should be constructed and utilized to further elucidate the host-microbe interaction mechanisms between B. aurantiaca and its host. Field trials should also be performed to verify the regulatory effects of this bacterium in natural environments, thereby laying a solid foundation for its practical application. Declarations Ethical approval and consent to participate This study did not involve ethical approval and patient informed consent. Consent for publication Not applicable. Competing interests The authors have no competing interests to declare. Funding The study was financially supported by the National Natural Science Foundation of China (Grant No.81902096); the Innovation Project of Shandong Academy of Medical Sciences; Joint Innovation Team for Clinical & Basic Research(202407). Author Contribution LJL and MQG conceived and designed the study. XMW and XXG wrote the manuscript. PC, HFW, GL, HX, YXS and JJL participated in the experiment and analyzed the data. All authors read and approved the final version of the manuscript. Acknowledgement The authors would like to thank all the reviewers who participated in the review and LetPub (www.letpub.com.cn) for its linguistic assistance during the preparation of this manuscript. Data Availability The datasets supporting the findings of this article are included within the paper. References Liu B, Gao X, Zheng K, Ma J, Jiao Z, Xiao J, et al. The potential distribution and dynamics of important vectors Culex pipiens pallens and Culex pipiens quinquefasciatus in China under climate change scenarios: an ecological niche modelling approach. Pest Manag Sci. 2020;76:3096–3107. Rochlin I, Faraji A, Healy K, Andreadis TG. West Nile virus mosquito vectors in North America. J Med Entomol. 2019;56:1475–1490. Roubaud E. Cycle autogéne d'attente et générations hivernales suractives in-apparentes chez le moustique commun Culex pipiens . C. R. Acad. Sci., Paris. 1929:188:735–738. Attardo GM, Hansen IA, Raikhel AS. Nutritional regulation of vitellogenesis in mosquitoes: implications for anautogeny. Insect Biochem Mol Biol. 2005;35:661–675. Clements AN. The biology of mosquitoes:Volume 1:Development Nutrition And Reproduction. London: Chapman & Hall; 1992. p. 237–240. Aardema ML, Zimmerman KI. The establishment of a new autogenous line of the Asian tiger mosquito, Aedes albopictus , from its current northern range limit in the United States. J Vector Ecol. 2021;46:112–115. Khaligh FG, Naghian A, Soltanbeiglou S, Gholizadeh S. Autogeny in Culiseta longiareolata (Culicidae: Diptera) mosquitoes in laboratory conditions in Iran. BMC Res Notes. 2020;13:81. Martinson EO, Chen K, Valzania L, Brown MR, Strand MR. Insulin-like peptide 3 stimulates hemocytes to proliferate in anautogenous and facultatively autogenous mosquitoes. J Exp Biol. 2022;225:jeb243460. Ahmed AM. Mosquito autogeny in Aedes caspius (Diptera: Culicidae): alterations of larval nourishments reservation upon bacterial infection. Insect Sci. 2013;20:472–484. Gao Q, Su F, Zhou Y, Chu W, Cao H, Song L, et al. Autogeny, Fecundity, and Other Life History Traits of Culex pipiens molestus (Diptera: Culicidae) in Shanghai, China. J Med Entomol. 2019;56:656–664. Reisen WK, Milby MM, Meyer RP. Population dynamics of adult Culex mosquitoes (Diptera: Culicidae) along the Kern River, Kern County, California, in 1990. J Med Entomol. 1992;29:531–543. Spielman A. Bionomics of autogenous mosquitoes. Annu Rev Entomol. 1971;16: 231–248. Soliman BA, Wassim NM, Tewfick MK. Comparative susceptibility of autogenous and anautogenous Aedes caspius pallas (Diptera: Culicidae) to filaria parasite Wuchereria bancrofti (Filariidea: Dipetalonematidae). Egypt. J. Exp. Biol. (Zoo.). 2014;10: 67–70. Mori A, Romero-Severson J, Black WC 4th, Severson DW. Quantitative trait loci determining autogeny and body size in the Asian tiger mosquito ( Aedes albopictus ). Heredity (Edinb). 2008;101:75–82. Jarvela AMC, Bell KL, Noreuil A, Fritz ML. Autogenous and anautogenous Culex pipiens bioforms exhibit insulin-like peptide signaling pathway gene expression differences that are not dependent upon larval nutri-tion. bioRxiv. 2021;06:449144. Lei Q, Wang Y, Deng P, Zhang J, Qin Y, Li Z, et al. Enterococcus casseliflavus regulates amino acid metabolism in edible insect Clanis bilineata tsingtauica : a functional metagenomics study. Front Microbiol. 2024;15:1343265. Zeng T, Fu Q, Luo F, Dai J, Fu R, Qi X, et al. Lactic acid bacteria modulate the CncC pathway to enhance resistance to β-cypermethrin in the oriental fruit fly. ISME J. 2024;18:wrae058. Zhang L, Wang D, Shi P, Li J, Niu J, Chen J, et al. A naturally isolated symbiotic bacterium suppresses flavivirus transmission by Aedes mosquitoes. Science. 2024;384:eadn9524. Fu J, Wang J, Huang X, Guan B, Feng Q, Deng H. Composition and diversity of gut microbiota across developmental stages of S podoptera frugiperda and its effect on the reproduction. Front Microbiol. 2023;14:1237684. Schmidt K, Engel P. Mechanisms underlying gut microbiota-host interactions in insects. J Exp Biol. 2021;224:jeb207696. Gu L, Li L, Sun J, Zhao Y, Wan K, Zhang M, et al. Rahnella aquatilis isolated from Aedes albopictus impairs mosquito reproduction capacity. Insects. 2025;16:257. Wang Y, Eum JH, Harrison RE, Valzania L, Yang X, Johnson JA, et al. Riboflavin instability is a key factor underlying the requirement of a gut microbiota for mosquito development. Proc Natl Acad Sci U S A. 2021;118:e2101080118. Harrison RE, Yang X, Eum JH, Martinson VG, Dou X, Valzania L, et al. The mosquito Aedes aegypti requires a gut microbiota for normal fecundity, longevity and vector competence. Commun Biol. 2023;6:1154. Yu S, Liu Z, Wang J, Zheng H, Han S, Zheng F, et al. Lysinibacillus sphaericus exposure impedes Anopheles dirus 's oviposition via downregulating vitellogenin. Parasit Vectors. 2025;18:111. Lei J, Lv W, Wang W, Wang H, Guo X, Cheng P, et al. Comparison of the microbiota diversity between autogenous and anautogenous Culex pipiens pallens . Chin. J. Schistosomiasis Control. 2024;36:52–58. Saab SA, Dohna HZ, Nilsson LKJ, Onorati P, Nakhleh J, Terenius O, et al. The environment and species affect gut bacteria composition in laboratory co-cultured Anopheles gambiae and Aedes albopictus mosquitoes. Sci Rep. 2020;10:3352. Akorli J, Namaali PA, Ametsi GW, Egyirifa RK, Pels NAP. Generational conservation of composition and diversity of field-acquired midgut microbiota in Anopheles gambiae (sensu lato) during colonization in the laboratory. Parasit Vectors. 2019;12:27. Moll RM, Romoser WS, Modrzakowski MC, Moncayo AC, Lerdthusnee K. Meconial peritrophic membranes and the fate of midgut bacteria during mosquito (Diptera: Culicidae) metamorphosis. J Med Entomol. 2001;38:29–32. Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38:3022–3027. Gao, H., Jiang, Y., Wang, L, Wang G, Hu W, Dong L, et al. Outer membrane vesicles from a mosquito commensal mediate targeted killing of Plasmodium parasites via the phosphatidylcholine scavenging pathway. Nat Commun, 2023;14:5157. Sun X, Wang Y, Yuan F, Zhang Y, Kang X, Sun J, et al. Gut symbiont-derived sphingosine modulates vector competence in Aedes mosquitoes. Nat Commun. 2024;15:8221. Zhou C, Guan Q, Dai Y, Liu H, Qian K. Expression characterization and functional analysis of juvenile hormone receptor gene CpMet in Culex pipiens pallens . Chin J Vector Biol & Control, 2021, 32: 680–685. Vancanneyt M, Segers P, Abraham WR, De Vos P. Brevundimonas. In: Bergey's Manual of Systematic Bacteriology, 2nd ed., Vol. 2, Part C; Garrity GM, Ed.; Springer: New York, NY, USA, 2005; pp. 308–316. Tung GA, Fonseca DM. Internal and external drivers interact to create highly dynamic mosquito blood-feeding behaviour. Proc Biol Sci. 2024;291:20241105. Ariani CV, Smith SC, Osei-Poku J, Short K, Juneja P, Jiggins FM. Environmental and genetic factors determine whether the mosquito Aedes aegypti lays eggs without a blood meal. Am J Trop Med Hyg. 2015;92:715–721. O'Meara GF, Larson VL, Mook DH. Blood feeding and autogeny in the peridomestic mosquito Aedes bahamensis (Diptera: Culicidae). J Med Entomol. 1993;30:378–383. Coon KL, Brown MR, Strand MR. Gut bacteria differentially affect egg production in the anautogenous mosquito Aedes aegypti and facultatively autogenous mosquito Aedes atropalpus (Diptera: Culicidae). Parasit Vectors. 2016;9:375. Taracena-Agarwal ML, Walter-Nuno AB, Bottino-Rojas V, Mejia APG, Xu K, Segal S, et al. Juvenile Hormone as a contributing factor in establishing midgut microbiota for fecundity and fitness enhancement in adult female Aedes aegypti . Commun Biol. 2024;7:687. Liu H, Yin J, Huang X, Zang C, Zhang Y, Cao J, et al. Mosquito gut microbiota: a review. Pathogens. 2024;13:691. Zhao SY, Sommer AJ, Bartlett D, Harbison JE, Irwin P, Coon KL. Microbiota composition associates with mosquito productivity outcomes in belowground larval habitats. Mol Ecol. 2025;34:e17614. Díaz S, Avila FW, Coon KL. Differential fitness effects of gut and reproductive tract bacteria in larval and adult stages of the yellow fever mosquito, Aedes aegypti . Acta Trop. 2025;265:107615. Zhao C, Peng Y, Li W, Raza MF, Wang W, Zhang Y, et al. The role of gut microbiota-gonadal axis in ovary activation of Asian honey bee ( Apis cerana ) queens. NPJ Biofilms Microbiomes. 2025;11:97. He M, Chen H, Yang X, Gao Y, Lu Y, Cheng D. Gut bacteria induce oviposition preference through ovipositor recognition in fruit fly. Commun Biol. 2022;5:973. Mosquera KD, Khan Z, Wondwosen B, Alsanius B, Hill SR, Ignell R, et al. Odor-mediated response of gravid Aedes aegypti to mosquito-associated symbiotic bacteria. Acta Trop. 2023;237:106730. Wu Z, Yang L, He Q, Zhou S. Regulatory mechanisms of vitellogenesis in insects. Front Cell Dev Biol. 2021;8:593613. Roy S, Saha TT, Zou Z, Raikhel AS. Regulatory pathways controlling female insect reproduction. Annu Rev Entomol. 2018;63:489–511. Ling L, Raikhel AS. Cross-talk of insulin-like peptides, juvenile hormone, and 20-hydroxyecdysone in regulation of metabolism in the mosquito Aedes aegypti . Proc Natl Acad Sci U S A. 2021;118:e2023470118. Wang X, Geng D, Shi K, Qi Q, Lyu X, Sun X, et al. Genomic and insulin-mediated control of metabolic homeostasis by the mosquito ecdysone-induced gene E93. Proc Natl Acad Sci U S A. 2025;122:e2511572122. Roy SG, Hansen IA, Raikhel AS. Effect of insulin and 20-hydroxyecdysone in the fat body of the yellow fever mosquito, Aedes aegypti . Insect Biochem Mol Biol. 2007;37:1317–1326. Nässel DR, Vanden Broeck J. Insulin/IGF signaling in Drosophila and other insects: factors that regulate production, release and post-release action of the insulin-like peptides. Cell Mol Life Sci. 2016;73:271–290. Dou X, Chen K, Brown MR, Strand MR. Multiple endocrine factors regulate nutrient mobilization and storage in Aedes aegypti during a gonadotrophic cycle. Insect Sci. 2023;30:425–442. Gulia-Nuss M, Robertson AE, Brown MR, Strand MR. Insulin-like peptides and the target of rapamycin pathway coordinately regulate blood digestion and egg maturation in the mosquito Aedes aegypti . PLoS One. 2011;6:e20401. Das De T, Sharma P, Tevatiya S, Chauhan C, Kumari S, Yadav P, et al. Bidirectional microbiome-gut-brain-axis communication influences metabolic switch-associated responses in the mosquito Anopheles culicifacies . Cells. 2022;11:1798. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 25 Mar, 2026 Reviews received at journal 23 Mar, 2026 Reviews received at journal 17 Mar, 2026 Reviewers agreed at journal 04 Mar, 2026 Reviewers agreed at journal 03 Mar, 2026 Reviewers agreed at journal 03 Mar, 2026 Reviewers invited by journal 02 Mar, 2026 Editor assigned by journal 02 Mar, 2026 Submission checks completed at journal 02 Mar, 2026 First submitted to journal 26 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8983038","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":600839255,"identity":"edcc3816-4b44-41ad-a98d-1bd8d0b7a49b","order_by":0,"name":"Xin-Mei Wang","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xin-Mei","middleName":"","lastName":"Wang","suffix":""},{"id":600839256,"identity":"433d6afb-9a2a-402d-8e44-6f3fc0e6f890","order_by":1,"name":"Xiu-Xia Guo","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Xiu-Xia","middleName":"","lastName":"Guo","suffix":""},{"id":600839257,"identity":"11aca2fc-9c18-4b4a-88f7-b85f91aff222","order_by":2,"name":"Peng Cheng","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Cheng","suffix":""},{"id":600839258,"identity":"1d1a0466-362b-4f13-beaf-76b27a143254","order_by":3,"name":"Hai-Fang Wang","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hai-Fang","middleName":"","lastName":"Wang","suffix":""},{"id":600839259,"identity":"a482f2ac-118c-401c-936f-68cc259d2d73","order_by":4,"name":"Gang Li","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Li","suffix":""},{"id":600839260,"identity":"94ff9b78-8f1f-4dc8-8baf-eb43388a707d","order_by":5,"name":"Hui Xu","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Xu","suffix":""},{"id":600839261,"identity":"a652418c-ff70-4caf-8076-a49f2fd4a77c","order_by":6,"name":"Yu-Xiu Shang","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Yu-Xiu","middleName":"","lastName":"Shang","suffix":""},{"id":600839262,"identity":"6a523a66-b420-4171-a287-fbb4df92dd8b","order_by":7,"name":"Jing-Jing Lei","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Jing-Jing","middleName":"","lastName":"Lei","suffix":""},{"id":600839263,"identity":"292bd6d9-a814-4400-a56d-c5ad4c49e6c0","order_by":8,"name":"Mao-Qing Gong","email":"","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mao-Qing","middleName":"","lastName":"Gong","suffix":""},{"id":600839264,"identity":"2f21995b-73fa-4634-aa61-9452a4d712fe","order_by":9,"name":"Li-Juan Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYBACPmYGxgMJPEAWewODRAVYLAG/FjZmBgaIFp4DDBJniNICxAfALIkEYrWw8xgceCBzWN5c8vnDGwdzDjPws+cYMPzcgc9hQC0JPIcNd87OMbY4uO0wg2TPGwPG3jOEtTBuuJ3DJv0RqMXgRo4BM2MbYS32G24efyYBssWeWC2JG24wmIG1GEgQ1MJWANSSnrzhDNgv6TwSZ54VHOzFo4Wf//DGhz97rG03HD8ODLFt1nL87ckbH/zEowUMGHsQbFCsQmMKL/hBWMkoGAWjYBSMYAAAIgFTDYHCkygAAAAASUVORK5CYII=","orcid":"","institution":"Shandong First Medical University \u0026 Shandong Academy of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Li-Juan","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2026-02-27 03:38:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8983038/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8983038/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104403756,"identity":"a9d10337-7342-42e8-b65a-a5ba7ac99c3a","added_by":"auto","created_at":"2026-03-11 12:18:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":119448,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMorphological characteristics, gram staining (A), scanning electron microscopy (SEM) (B), and phylogenetic tree (C) of the isolated strain.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8983038/v1/caf4c7f7ea6ba3b4ca0af4d8.jpg"},{"id":104104563,"identity":"b6f94fd0-b71f-4ea1-a3ce-79a280a4170e","added_by":"auto","created_at":"2026-03-06 21:17:36","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":30872,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth curve of \u003cem\u003eB. aurantiaca\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8983038/v1/bc59b077ffaf765b5dc54322.jpg"},{"id":104104565,"identity":"69ca8635-a280-4816-bd1f-f90e55a567ba","added_by":"auto","created_at":"2026-03-06 21:17:36","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":155955,"visible":true,"origin":"","legend":"\u003cp\u003eColonization of fluorescently labeled \u003cem\u003eB. aurantiaca\u003c/em\u003e in anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e and its distribution across different developmental stages of autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e. \u003cstrong\u003eA\u003c/strong\u003e Absolute qRT-PCR standard curve. \u003cstrong\u003eB\u003c/strong\u003e Abundance of the bacterium (Log\u003csub\u003e10\u003c/sub\u003e copy number) in egg masses, larvae, pupae and female adults of autogenous Cx. pipiens pallens, as well as in newly emerged female F1 progeny of the bacteria-treated experimental group. \u003cstrong\u003eC \u003c/strong\u003eMosquito midgut of the bacteria-treated experimental group.\u003cstrong\u003e D\u003c/strong\u003e 2nd-instar larvae of the F1 progeny from the bacteria-treated experimental group.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8983038/v1/1860b46a348eea57c8e41049.jpg"},{"id":104104566,"identity":"b82d998c-e489-4f1c-aad1-f178fae367c4","added_by":"auto","created_at":"2026-03-06 21:17:36","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":184619,"visible":true,"origin":"","legend":"\u003cp\u003eExpression levels of reproduction-related genes in the control group (FZY) and bacteria-treated group (FZYB) from day 1 to day 7 after mosquito emergence. A–F represent the relative expression levels of \u003cem\u003eVg1\u003c/em\u003e, \u003cem\u003eVg3\u003c/em\u003e, \u003cem\u003eVgR\u003c/em\u003e, \u003cem\u003eMet\u003c/em\u003e, \u003cem\u003eEcR\u003c/em\u003e and \u003cem\u003eILPR\u003c/em\u003e in the FZY and FZYB groups from day 1 to day 7 after mosquito emergence, respectively. *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8983038/v1/3aa4df29db8077daf0b55a39.jpg"},{"id":104834942,"identity":"ae2db7f0-d89a-436c-bc55-9158c4a4b4b0","added_by":"auto","created_at":"2026-03-17 17:36:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1817937,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8983038/v1/264b62e5-09ad-4ba2-b35c-90d5f9814f0e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Isolation of the symbiotic bacterium Brevundimonas aurantiaca and its regulatory effect on the autogeny of Culex pipiens pallens","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003eCulex pipiens pallens\u003c/em\u003e (Diptera: Culicidae) is the dominant mosquito species in regions north of 33\u0026deg;N in China. It also serves as a major vector for various pathogens including Japanese encephalitis virus, Bancroftian filaria, and West Nile virus. Fluctuations in its population directly influence the transmission risk and epidemic intensity of mosquito-borne diseases[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Blood-feeding by mosquitoes facilitates viral transmission among hosts, thus triggering the outbreak and prevalence of mosquito-borne diseases. Additionally, the reproductive strategies of mosquitoes are closely associated with their disease transmission capacity. Female mosquitoes normally require a blood meal to acquire protein nutrients essential for ovarian development, but some mosquito species or populations possess an autogenous trait, which allows these females mosquitoes to complete ovarian development and oviposition without blood-feeding[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Differences in the autogenous and anautogenous reproductive strategies not only relate to the ecological adaptability of mosquito populations but also provide an ideal biological model for investigating the regulatory mechanisms underlying mosquito reproductive development[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Currently, mosquito species showing autogenous behavior are known to span 15 genera and 68 species[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], including \u003cem\u003eAedes albopictus\u003c/em\u003e[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], \u003cem\u003eCuliseta longiareolata\u003c/em\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], \u003cem\u003eAe. atropalpu\u003c/em\u003es[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e],\u003cem\u003eAe. caspius\u003c/em\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e],and \u003cem\u003eCx. pipiens molestus\u003c/em\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Autogeny in mosquitoes not only facilitates the rapid establishment and persistence of populations and reduces their dependence on exogenous blood sources but may also decrease the proportion of pathogen infected individuals within populations, thus conferring significant ecological and epidemiological implications[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Although autogeny has been demonstrated to be regulated by genetic, nutritional, and hormonal factors[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], its underlying molecular mechanisms remain incompletely understood.\u003c/p\u003e \u003cp\u003eIn recent years, research on the symbiotic relationships between insects and microorganisms have advanced considerably, and the gut microbiota have been found to be extensively involved in key biological processes of the host, including growth and development, nutrient metabolism, immune defense, and reproductive regulation[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Specific gut microbiota have been reported to mediate the reproductive capacity of mosquitoes by influencing nutrient supply, hormone synthesis, and signaling pathways[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. For example, \u003cem\u003eRahnella aquatilis\u003c/em\u003e impedes ovarian development and fecundity in \u003cem\u003eAe. albopictus\u003c/em\u003e by decreasing the levels of ecdysone and vitellogenin in the mosquito[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In \u003cem\u003eAe. aegypti\u003c/em\u003e, certain gut bacteria capable of synthesizing vitamin B are essential for the normal reproductive function of the host[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Sterilization decreases the production of ecdysone and the synthesis of vitellogenin in the fat body of \u003cem\u003eAe. aegypti\u003c/em\u003e ovaries, leading to reduced egg production[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. \u003cem\u003eLysinibacillus sphaericus\u003c/em\u003e downregulates \u003cem\u003eVg\u003c/em\u003e expression by inhibiting lysosomal function and the TOR signaling pathway, thereby substantially suppressing oviposition in female \u003cem\u003eAnopheles dirus\u003c/em\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Together, these studies suggest that the gut microbiota may be one of the key factors driving the differentiation of mosquito reproductive strategies and their adaptive evolution.\u003c/p\u003e \u003cp\u003eThe autogenous strain of \u003cem\u003eCx. pipiens pallens\u003c/em\u003e utilized in this study was derived from a laboratory-domesticated anautogenous strain. Our preliminary experiments found distinct differences in the composition and function of the gut microbiota between the autogenous and anautogenous strains, and \u003cem\u003eBrevundimonas aurantiaca\u003c/em\u003e was identified as one of the gut-specific bacteria in autogenous mosquitoes[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Based on our preliminary analysis of digestive enzyme experiments, \u003cem\u003eB. aurantiaca\u003c/em\u003e does not secrete digestive enzymes such as amylase and protease, suggesting that it may be involved in the regulation of autogeny in \u003cem\u003eCx. pipiens pallens\u003c/em\u003e through a non-digestive enzyme-mediated regulatory pathway. Therefore, we hypothesized that \u003cem\u003eB. aurantiaca\u003c/em\u003e may influence the blood-feeding behavior, ovarian development, and reproductive output in mosquitoes by regulating host genes and physiological pathways related to reproduction. Furthermore, the symbiotic bacterial community in mosquitoes is a dynamic and unstable system, whereby newly acquired symbionts are often unable to stably colonize the host over long-term and, as such, may be lost during subsequent developmental or reproductive processes[\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. A single generational treatment with the bacteria may only induce a transient physiological response in the host, therefore, a multi-generational continuous treatment with the strain was applied to anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e in our experimental designed in order to assess its transgenerational effects. The findings of this study are expected to elucidate the mechanisms underlying the formation of autogenous reproductive strategies in \u003cem\u003eCx. pipiens pallens\u003c/em\u003e from the perspective of microbe-host interactions, thereby providing a theoretical basis for the development of novel mosquito-borne disease control strategies based on microbial regulation.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eTest insect source\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eCx. pipiens pallens\u003c/em\u003e used in the experiments was a routinely reared strain from Shandong Institute of Parasitic Diseases. The autogenous strain was domesticated from this parental strain in the laboratory and has been maintained for 36 consecutive generations to date. Mosquitoes were reared under the following standard conditions: temperature of (25\u0026thinsp;\u0026plusmn;\u0026thinsp;2) \u0026deg;C, relative humidity of 60% \u0026plusmn; 5%, and a photoperiod of 12 h light:12 h dark (L:D\u0026thinsp;=\u0026thinsp;12:12). Larvae were fed a mixture of pork liver powder and yeast powder at a ratio of 1:3, while adult mosquitoes were provided with a 10% glucose solution.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation and identification of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAutogenous adult female mosquitoes of \u003cem\u003eCx. pipiens pallens\u003c/em\u003e were collected and divided into groups of 10, with three biological replicates per group. After being anesthetized with CO\u003csub\u003e2\u003c/sub\u003e, mosquitoes were immersed in 75% ethanol for 20 s and then washed three times with sterile 0.9% saline. The midgut tissue was harvested by aseptic dissection and placed in a sterile 1. 5-mL centrifuge tube. Then, 500 \u0026micro;L of 0.9% saline solution was added, and the sample was thoroughly homogenized. The homogenate was sequentially at 10\u003csup\u003e\u0026minus;\u0026thinsp;4\u003c/sup\u003e and 10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e concentrations, and then 100 \u0026micro;L of each dilution was spread evenly onto a 9-cm-diameter Caulobacter Medium (CM) agar plate (Bacto peptone, 2.0 g/L; Yeast extract, 1.0 g/L; MgSO₄\u0026middot;7H₂O, 0.2 g/L; Agar, 15.0 g/L). The plate was inverted and incubated at 30\u0026deg;C in a constant-temperature incubator for 24 h. Based on characteristics such as colony size, morphology, and color, a single colony was picked and streaked into three zones on fresh CM medium for purification, continuing until a morphologically uniform single colony was obtained. Purified colonies were inoculated into 15-mL centrifuge tubes containing 3 mL of CM liquid medium and incubated by shaking at 30\u0026deg;C and 180 rpm for 24 h to obtain the bacterial culture. The bacterial culture samples were sent to Sangon Biotechnology Co., Ltd. (Shanghai, China) for 16S rRNA gene sequencing. The resulting sequences were subjected to BLAST alignment in the National Center for Biotechnology Information (NCBI) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Using sequences from reference strains with \u0026ge;\u0026thinsp;97% homology as templates, a phylogenetic tree was created utilizing the Neighbor-Joining (NJ) method with MEGA 11.0 software. Bootstrap analysis was conducted with 1000 repetitions to evaluate tree reliability[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The taxonomic status of the strains was determined by integrating sequence homology alignment results with the phylogenetic tree analysis. After the bacteria were treated according to previous methods[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], the morphology of the bacteria was observed by scanning electron microscopy.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetermination of\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003egrowth curve and physiological and biochemical tests\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe growth curve of the strains was determined by spectrophotometry. A single colony of \u003cem\u003eB. aurantiaca\u003c/em\u003e was inoculated into 5 mL of CM liquid medium, followed by shaking incubation at 180 rpm in a 30\u0026deg;C incubator for 16 h to obtain a seed culture in the logarithmic growth phase. The seed culture was then transferred into Erlenmeyer flasks containing fresh CM liquid medium at an inoculum size of 2% (v/v), with three biological replicates set for each group. A tube with uninoculated medium served as the blank control. The inoculated cultures were incubated continuously in a constant temperature shaking incubator at 30\u0026deg;C and 180 rpm for 48 h. The samples were collected at 1-h intervals, starting from the initial incubation time (0 h), and the absorbance value at a wavelength of 600 nm (OD600) was measured utilizing a microplate reader. The growth curve of \u003cem\u003eB. aurantiaca\u003c/em\u003e in CM medium was plotted with incubation time (h) as the abscissa and OD600 value as the ordinate.\u003c/p\u003e \u003cp\u003eThe physiological and biochemical characteristics of this strain were determined using the API 20NE test strips (bioM\u0026eacute;rieux) for the identification of non-fastidious, non-enteric gram-negative bacilli, with the experimental procedures performed strictly in accordance with the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eConstruction of GFP-labeled bacteria and its colonization in the gut of anautogenous\u003c/b\u003e \u003cb\u003eCx. pipiens pallens\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo understand the colonization of \u003cem\u003eB. aurantiaca\u003c/em\u003e in the intestinal tract of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, the target strain \u003cem\u003eB. aurantiaca\u003c/em\u003e isolated and identified in this study was employed as the host strain. A fluorescent expression plasmid carrying the green fluorescent protein (sfGFP)-coding gene and kanamycin resistance (50 \u0026micro;g/mL) screening marker was constructed and termed pET28(+) -sfGFP (General Biol (Anhui, China) Co., Ltd\u0026zwnj;). Competent cells of \u003cem\u003eB. aurantiaca\u003c/em\u003e were prepared via a modified rubidium chloride method following the instructions of the Ultra-Competent Cell Preps Kit (Sangon Biotech, Shanghai, China). The fluorescent plasmid pET28(+)-sfGFP was then transformed into the competent cells. Positive transformants were inoculated into CM liquid medium supplemented with 50 \u0026micro;g/mL kanamycin and cultured with shaking at 180 rpm and 30\u0026deg;C for 12 h to yield a large quantity of sfGFP-expressing bacteria. The final bacterial concentration was approximately 3.6 \u0026times; 10\u003csup\u003e10\u003c/sup\u003e colony-forming units (CFU)/mL. The culture was centrifuged at 6000 rpm for 10 min to pellet the bacteria. The pellet was then washed three times with sterile PBS and mixed with a 10% sucrose solution at a 1:9 ratio (3.6 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e CFU/mL) to produce the bacterial-sucrose mixture feeding solution[31]. Newly emerged female mosquitoes were selected for the experiment. Mosquitoes in the experimental group were continuously fed the aforementioned bacteria-sucrose suspension for 3 consecutive days with fresh suspensions replaced daily, and then were separated into two groups and fed either blood or sterilized 10% glucose solution for 3 days. Mosquitoes in the control group were fed with a sterile 10% glucose solution throughout the entire experimental period, with a subgroup offered a blood meal on the third day. Egg rafts oviposited following blood feeding were transferred to sterile water and hatched larvae were reared to the second instar. On the third day after the switch to the sterile glucose solution, the midguts of mosquitoes in each group were dissected and placed on glass slides with 10 \u0026micro;L of sterile PBS added. Green fluorescence was observed utilizing the BioTek Cytation 1 Full-Automatic Imaging System (BioTek, USA) and Gen5 CHS 3.05 software.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAbsolute qRT-PCR detection of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003eduring the development of the autogenous\u003c/b\u003e \u003cb\u003eCx. pipiens pallens\u003c/b\u003e \u003cb\u003eand cross-strain colonization\u003c/b\u003e\u003c/p\u003e \u003cp\u003eEgg masses, larvae, pupae, and newly emerged female adults of autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e were selected for analysis. The bacterial load was determined in one-day-old emerged female F1 progeny of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e treated with \u003cem\u003eB. aurantiaca\u003c/em\u003e (the bacterial treatment was performed as described in the fourth section). Each developmental stage had three biological replicates, with each replicate consisting of 10 test mosquitoes and one egg mass. Total DNA was isolated from all samples utilizing the SteadyPure Universal Genomic DNA Extraction Kit (Accurate Biotechnology (Hunan, China) Co., Ltd.). The abundance of \u003cem\u003eB. aurantiaca\u003c/em\u003e was quantified via absolute quantitative real-time polymerase chain reaction (qRT-PCR). Primers were designed for the strain-specific gene \u003cem\u003ecrtW\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and the amplified fragment was inserted into the pUC56 plasmid to construct a standard template. The standard template was subjected to 10-fold serial dilution to produce a concentration gradient ranging from 3.29 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e to 3.29 \u0026times; 10\u003csup\u003e1\u003c/sup\u003e copies. qRT-PCR reactions were conducted in a 20-\u0026micro;L reaction system utilizing the serially diluted standard template as the template, with the reaction conditions as follows: initial denaturation at 95\u0026deg;C for 180 s; 50 cycles of denaturation at 95\u0026deg;C for 10 s and annealing/extension at 60\u0026deg;C for 30 s; and a final melting curve at 95\u0026deg;C for 10 s, 65\u0026deg;C for 60 s, and 97\u0026deg;C for 1 s. A standard curve was graphed with the logarithm of the copy number of the standard template as the abscissa and the corresponding cycle threshold (Ct) value as the ordinate. Sample DNA was utilized as the template for the qRT-PCR reactions, which was performed in parallel with the plasmid standard template for standard curve construction. After obtaining the Ct values of the samples, the log10 copy number was calculated according to the standard curve to determine the abundance of \u003cem\u003eB. aurantiaca\u003c/em\u003e in each sample.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eqRT-PCR primers used to measure bacterial colonization and reproductive gene expression\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse Primer(5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecrtW\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGCTCACCTGTTTCCACTTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eCCAGCCCTGAATCAAGACTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCGTGAACTGACGGCTCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eACTCGTCGTACTCCTGCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVg1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCCACCGTATTTTCCCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eCGATAGCAAGGCCATAGAACAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVg3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAATCCGTGCTTCAACGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eGATCGAGTTTAGGCCATTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eVgR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGTGATGCGGTGAATGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eTTGCCTTCGTCTTTGCCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMet\u003c/em\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACCAAAACTACCCGCCACCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eCATCTGATGCCCATAACTGACCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEcR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTATTCAAGTACGCGCTCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eACAAATCTGGCAACACTTCGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eILPR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCTTACACCTTGGTAATGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eAAATACATGCTTCCCGCCAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePreliminary study on the molecular mechanism of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003emediating the reproduction of\u003c/b\u003e \u003cb\u003eCx. pipiens pallens\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate the initial effects of \u003cem\u003eB. aurantiaca\u003c/em\u003e on the ovarian development of anautogenous female mosquitoes, an experimental group (FZYB group) was created. Newly emerged female mosquitoes were fed with a glucose solution supplemented with a bacterial culture (bacterial treatment method identical to that presented in the fourth section). A control group (FZY group) was established by feeding newly emerged female mosquitoes with a 10% sterile glucose solution. Cotton balls were replaced daily to ensure continuous supply. Female mosquito samples were collected at various time points. After removing the head and thorax, total RNA was isolated from the abdomen. RNA extraction was conducting utilizing the SteadyPure RNA Extraction Kit (Accurate Biotechnology (Hunan, China) Co., Ltd.), and total RNA quantification was performed using the NanoDrop OneC Micro UV-Vis spectrophotometer (Thermo Scientific, USA). Subsequently, RNA was reverse transcribed into cDNA for qRT-PCR analysis. The reaction system (20\u0026micro;L) comprised the following: master mix (10 \u0026micro;L), 10 \u0026micro;M forward primer (0.5 \u0026micro;L), 10 \u0026micro;M reverse primer (0.5 \u0026micro;L), cDNA (500 ng), and ddH2O added to a final volume of 20 \u0026micro;L. The program settings were as follows: 95\u0026deg;C for 180 s, followed by 45 cycles at95\u0026deg;C for 10 s, 59\u0026deg;C for 30 s; 95\u0026deg;C for 10 s, 65\u0026deg;C for 60 s, 97\u0026deg;C for 1 s. This method was utilized to determine alterations in the relative expression levels of reproductive-related genes in the FZYB group and FZY group from days 1 to 7 after mosquito emergence. The reproduction-related genes detected were: vitellogenin (\u003cem\u003eVg1\u003c/em\u003e, Gene ID: LOC120413209; \u003cem\u003eVg3\u003c/em\u003e, Gene ID: LOC120428119), vitellogenin receptor (\u003cem\u003eVgR\u003c/em\u003e, Gene ID: LOC120420237), juvenile hormone receptor (\u003cem\u003eMet\u003c/em\u003e, Gene ID: LOC120412890), ecdysone receptor (\u003cem\u003eEcR\u003c/em\u003e, Gene ID: LOC120415091), and insulin-like peptide receptor (\u003cem\u003eILPR\u003c/em\u003e, Gene ID: LOC120418613). \u003cem\u003eβ-actin\u003c/em\u003e (Gene ID: LOC120432082) from \u003cem\u003eCx. pipiens pallens\u003c/em\u003e was used as the internal control (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The relative expression levels of each target gene in the FZY and FZYB groups were analyzed using the 2\u003csup\u003e\u0026minus;ΔΔ\u003cem\u003eCt\u003c/em\u003e\u003c/sup\u003e method. All experiments were performed with three biological replicates.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003eon the autogeny of anautogenous mosquitoes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate the modulatory impact of \u003cem\u003eB. aurantiaca\u003c/em\u003e on the autogeny of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, a continuous colonization approach across all developmental stages was adopted for bacterial treatment in this study. Specifically, the strain was continuously introduced to anautogenous mosquitoes at the egg, larval, pupal, and adult stages to ensure its stable colonization throughout the different developmental stages of the mosquitoes. The negative control group was a routinely reared anautogenous mosquito population. During the experiment, the culture water containing fresh bacterial suspension was renewed every 2 days for larvae, and the sucrose-soaked cotton balls with bacterial suspension were replaced daily for adult mosquitoes[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. To assess the long-term effects, the bacteria-treated group was continuously reared up to the 5th generation. Additionally, life history traits were measured, including larval developmental duration, pupation rate, pupal duration, eclosion rate, and male-to-female sex ratio. A blood meal was provided to adult mosquitoes at 3 days post-treatment, and reproduction-related parameters were recorded, including blood-feeding rate, oviposition rate, and hatching rate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThis study used GraphPad Prism 10.1.2 software for statistical analysis and chart creation. For continuous variables such as gene relative expression levels, larval duration, and pupal duration, which followed a normal distribution, two independent sample \u003cem\u003et\u003c/em\u003e-tests were utilized for comparisons between groups. For variables that did not follow a normal distribution or had unequal variances, the Mann-Whitney test was utilized for comparisons between groups. For categorical variables such as pupation rate, emergence rate, sex ratio, blood-sucking rate, egg-laying rate, and hatching rate, the χ\u003csup\u003e2\u003c/sup\u003e test was used for comparisons. All statistical analyses were conducted at a significance level of α\u0026thinsp;=\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eMorphological and molecular identification of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe isolated strain was a gram-negative bacterium with red, rod-shaped cells of irregular arrangement. On CM agar plates, the bacterium formed orange-yellow, opaque, circular colonies with a convex, smooth surface and an entire margin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Scanning electron microscopy (SEM) observations revealed that the isolated bacterial strain exhibited a typical rod-shaped morphology, mostly arranged in short chains with an intact and smooth surface. No flagella, pili, or other obvious surface appendages were observed, and strain had an approximate length of 1.0\u0026ndash;1.5 \u0026micro;m and a diameter of 0.4\u0026ndash;0.6 \u0026micro;m (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). 16S rRNA gene sequencing and BLAST analysis demonstrated that the amplified sequence of the strain had the highest similarity (99.63%) with that of \u003cem\u003eB. aurantiaca\u003c/em\u003e strain (NR_028888.1). Phylogenetic tree analysis further revealed that the isolated strains clustered into a stable and independent branch with the members of the genus \u003cem\u003eBrevundimonas\u003c/em\u003e, and they naturally clustered into the same evolutionary branch with \u003cem\u003eB. aurantiaca\u003c/em\u003e (NR_028888.1) (bootstrap value\u0026thinsp;=\u0026thinsp;100). This supports its taxonomic status as this species. Based on the above results, the isolated strain was named \u003cem\u003eB. aurantiaca\u003c/em\u003e-Cx (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGrowth curve and physiological and biochemical identification of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe strain exhibited relatively slow growth, entering the logarithmic growth phase 10 h post-inoculation. The OD\u003csub\u003e600\u003c/sub\u003e significantly increased from 0.29 to 1.70, and the proliferation rate reached the maximum. At 33\u0026ndash;39 h after inoculation, the growth of the isolated strain plateaued, with the OD\u003csub\u003e600\u003c/sub\u003e maintaining at approximately 1.70. The growth of the strain then entered the decline stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The isolated strain tested positive in the oxidase reaction and negative in the arginine dihydrolase, indole, nitrate reduction, glucose fermentation, and urease tests. It was unable to assimilate arabinose, mannose, mannitol, N-acetylglucosamine, gluconate, adipic acid, and phenylacetic acid, but it was able to assimilate glucose, maltose, capric acid, malic acid, and citric acid, and hydrolyze PNPG, gelatin, and aesculin. Based on the description of \u003cem\u003eBrevundimonas\u003c/em\u003e in the Bergey's Manual of Systematic Bacteriology[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and the aforementioned molecular biological identification results, the isolated strain was identified as \u003cem\u003eB. aurantiaca\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDynamic distribution and cross-strain colonization of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003eduring the development of autogenous\u003c/b\u003e \u003cb\u003eCx. pipiens pallens\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBased on absolute qRT-PCR results, the bacterium was detectable at all developmental stages of the autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e. Bacterial counts (Log\u003csub\u003e10\u003c/sub\u003e copy number) in egg clusters, larvae, pupae, and adult mosquitoes were 1.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11, 2.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03, 2.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25, and 3.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07, respectively, showing an enrichment trend in newly emerged female mosquitoes. The bacterium was also detected in newly emerged F1 female mosquitoes from the bacterial treatment group (2.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA B). The plasmid expressing GFP was successfully introduced into \u003cem\u003eB. aurantiaca\u003c/em\u003e by chemical transformation, and the transformed bacteria were successfully colonized in adult mosquitoes after feeding (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). \u003cem\u003eB. aurantiaca\u003c/em\u003e colonized the midgut of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e and possessed the capacity of vertical transmission (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003epromotes mosquito reproduction via multiple reproduction-related genes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWithin 7 days of adult mosquito emergence, we systematically assessed the relative expression levels of the \u003cem\u003eVg1\u003c/em\u003e, \u003cem\u003eVg3\u003c/em\u003e, \u003cem\u003eVgR\u003c/em\u003e, \u003cem\u003eMet\u003c/em\u003e, \u003cem\u003eEcR\u003c/em\u003e, and \u003cem\u003eILPR\u003c/em\u003e genes. qRT-PCR analysis found that the expression dynamics of major reproductive genes exhibited substantial alterations in the bacteria-colonized experimental group (FZYB) as compared with the non-inoculated control group (FZY) during the observation period (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Specifically, \u003cem\u003eVg3\u003c/em\u003e expression was significantly upregulated on day 1 (t-test, \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u0026minus;3.008, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.04), with levels markedly higher than those in the FZY group at the same time point. Although its expression fluctuated thereafter, \u003cem\u003eVg3\u003c/em\u003e remained elevated relative to the FZY group at most time points. \u003cem\u003eVg1\u003c/em\u003e expression was significantly upregulated on day 2 (t-test, \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u0026minus;3.901, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.018), and \u003cem\u003eVgR\u003c/em\u003e expression was also significantly increased in the experimental group than in the control group on day 2 (t-test, \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e = -15.038, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), indicating a synchronous enhancement in signal reception capacity during the peak period of vitellin synthesis.\u003c/p\u003e \u003cp\u003eFurthermore, the expression of the ecdysone receptor gene \u003cem\u003eEcR\u003c/em\u003e in the FZYB group peaked on day 3, with it being significantly elevated as compared to the FZY group (t-test, \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u0026minus;4.457, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.011). Even though its expression gradually declined thereafter, \u003cem\u003eEcR\u003c/em\u003e expression remained at a relatively high level, suggesting an enhanced sensitivity to 20-hydroxyecdysone (20E), the main hormone initiating vitellogenesis. In contrast, the expression of \u003cem\u003eMet\u003c/em\u003e, the key mediator gene mediating the juvenile hormone JH signaling pathway, remained relatively stable. Although a slight increasing trend was observed in the FZYB group on day 2 and day 7, no statistically significant difference was observed between the two groups at any time point. Notably, the expression of the insulin-like peptide receptor gene \u003cem\u003eILPR\u003c/em\u003e was significantly enhanced in the FZYB group, with a significant increase detected on day 2 (t-test, \u003cem\u003et\u003c/em\u003e\u003csub\u003e(4)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;\u0026minus;4.138, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014). This expression change coincided with the peak expression time of \u003cem\u003eVgR\u003c/em\u003e and \u003cem\u003eVg1\u003c/em\u003e, indicating that \u003cem\u003eB. aurantiaca\u003c/em\u003e may simultaneously activate the nutrient-sensing pathway and the insulin signaling pathway to synergistically promote the production of vitellogenin, thereby regulating mosquito reproductive physiology.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of the symbiotic bacterium\u003c/b\u003e \u003cb\u003eB. aurantiaca\u003c/b\u003e \u003cb\u003eon the fitness of anautogenous mosquitoes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eChanges in the indicators of mosquito life history in the various treatment groups (anautogenous mosquitoes, bacteria-treated first generation, and bacteria-treated fifth generation) are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. There was no significant difference in larval development time between the first generation of bacteria treatment and the control group, but the larval stage of the fifth generation was significantly prolonged (Mann-Whitney U-test, \u003cem\u003eU\u003c/em\u003e\u0026thinsp;=\u0026thinsp;3789.5, \u003cem\u003eZ\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u0026minus;4.504, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001), indicating that the delayed effect of bacteria on larval development gradually appeared after long-term passage. After \u003cem\u003eB. aurantiaca\u003c/em\u003e treatment, the pupation rate and emergence rate of mosquitoes exhibited an upward trend, and remained stable in the fifth generation, indicating that \u003cem\u003eB. aurantiaca\u003c/em\u003e treatment could promote the metamorphosis and development of mosquitoes, and the effect was stable in passage. There was no substantial difference in the duration of pupal stage and the ratio of male to female between the treatment and control groups.\u003c/p\u003e \u003cp\u003eRegarding blood-feeding behavior, the control group had the highest blood-feeding rate. After \u003cem\u003eB. aurantiaca\u003c/em\u003e treatment, the blood-feeding rate was significantly reduced, with the first generation of mosquitoes decreasing to 91.81% (Chi-square test, \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;6.073, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.014) and the fifth generation further decreasing to 87.72% (Chi-square test, \u003cem\u003eχ\u003c/em\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;10.161, \u003cem\u003edf\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0014). In contrast, the rate of oviposition increased after \u003cem\u003eB. aurantiaca\u003c/em\u003e treatment. There was no substantial difference in the hatching rate of eggs among the three groups, indicating that the bacteria had no observable impact on the fertilization and embryonic development of eggs.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of life history traits among anautogenous, bacteria-treated F1, and bacteria-treated F5 mosquito groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLife history trait\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnautogenous mosquito\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBacteria-treated F1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBacteria-treated F5\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLarval stage (d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.39\u0026thinsp;\u0026plusmn;\u0026thinsp;0.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.27\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePupation rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e86.67\u0026thinsp;\u0026plusmn;\u0026thinsp;9.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90.00\u0026thinsp;\u0026plusmn;\u0026thinsp;5.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePupal stage (d)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEmergence rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e87.59\u0026thinsp;\u0026plusmn;\u0026thinsp;5.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e91.79\u0026thinsp;\u0026plusmn;\u0026thinsp;5.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e91.89\u0026thinsp;\u0026plusmn;\u0026thinsp;3.50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale:female ratio\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1: 1.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1: 1.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1: 1.27\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 compared with anautogenous mosquito group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of reproductive traits among anautogenous, bacteria-treated F1, and bacteria-treated F5 mosquito groups\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReproductive trait\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAnautogenous mosquito\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBacteria-treated F1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBacteria-treated F5\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBlood-feeding rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e96.31\u0026thinsp;\u0026plusmn;\u0026thinsp;2.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e91.81\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e87.72\u0026thinsp;\u0026plusmn;\u0026thinsp;3.05**\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOviposition rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e48.17\u0026thinsp;\u0026plusmn;\u0026thinsp;4.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54.85\u0026thinsp;\u0026plusmn;\u0026thinsp;3.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e58.71\u0026thinsp;\u0026plusmn;\u0026thinsp;1.52\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHatching rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e97.69\u0026thinsp;\u0026plusmn;\u0026thinsp;2.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e96.04\u0026thinsp;\u0026plusmn;\u0026thinsp;1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e96.97\u0026thinsp;\u0026plusmn;\u0026thinsp;1.60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e* \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 compared with anautogenous mosquito group.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCompared with the anautogenous mosquito species, the autogenous mosquitoes rapidly initiated the reproductive cycle after emergence without going through the host-seeking and blood-feeding risk period[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Autogenous females have increased nutrient storage efficiency during the larval stage. The primary difference between autogenous and anautogenous mosquitoes lies in the differentiation of reproductive and nutritional strategies, which is a systematic phenotypic feature of the synergistic effect of genetic regulation and environmental adaptation, and this differentiation demonstrates obvious differences in physiological metabolism, molecular regulation, and environmental adaptation[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Several factors can influence the expression of reproductive genes and thus affect the reproductive status of insects. As a key symbiotic system in insects, the gut microbiota play an irreplaceable role in the modulation of insect growth and reproduction, which includes vitellogenesis, ovarian development, oviposition behavior and offspring survival, forming a co-evolution mechanism between host and microorganisms[\u003cspan additionalcitationids=\"CR38 CR39 CR40\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Specific intestinal bacteria can directly interfere with reproductive development through metabolic regulation or signaling pathways. For instance, \u003cem\u003eRahnella aquatilis\u003c/em\u003e hinders fecundity and ovarian maturation in female \u003cem\u003eAe. albopictus\u003c/em\u003e by decreasing the production of ecdysone and vitellogenin[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], whereas lactic acid bacteria in the gut of honey bee (\u003cem\u003eApis cerana\u003c/em\u003e) queens mediate ovarian metabolism via the purine metabolic pathway to drive ovarian activation[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Some intestinal bacteria can also indirectly enhance reproductive success by regulating host behaviors. For example, \u003cem\u003eCitrobacter\u003c/em\u003e in the gut of the oriental fruit fly (\u003cem\u003eBactrocera dorsalis\u003c/em\u003e) produces 3-hexenyl acetate, which attracts hosts to oviposit at suitable sites, achieving precise matching between vertical bacterial transmission and host reproduction[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. \u003cem\u003eKlebsiella\u003c/em\u003e generates 2-ethylhexanol and 2,4-di-tert-butylphenol, which induce oviposition in gravid \u003cem\u003eAe. aegypti\u003c/em\u003e by mimicking oviposition signals[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, we isolated and identified the gut-specific symbiotic bacterium \u003cem\u003eB. aurantiaca\u003c/em\u003e from autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e. We found that the bacterium can stably colonize the autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e and that it possesses the ability for vertical transmission, exerting systemic effects on the growth, development and reproductive physiology of mosquitoes. Absolute qRT-PCR and green fluorescence observation confirmed that this bacterium could be consistently detected across all developmental stages of autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e and that it exhibited enriched abundance in newly emerged female adults, indicating its successful adaptation to distinct microenvironments within the host, as well as its potential to proliferate during the adult stage and persist in mosquito populations. Colonization by \u003cem\u003eB. aurantiaca\u003c/em\u003e altered the expression dynamics of key reproductive genes (\u003cem\u003eVg\u003c/em\u003e, \u003cem\u003eVgR\u003c/em\u003e, \u003cem\u003eEcR\u003c/em\u003e, \u003cem\u003eILPR\u003c/em\u003e) in mosquitoes. The expression of \u003cem\u003eVg\u003c/em\u003e and its receptor \u003cem\u003eVgR\u003c/em\u003e serves as a central marker for reproductive initiation and oocyte maturation in female mosquitoes, and is precisely mediated by \u003cem\u003eMet\u003c/em\u003e, \u003cem\u003eEcR\u003c/em\u003e, and \u003cem\u003eILPR\u003c/em\u003e signaling pathways[\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Our findings confirmed that colonization by \u003cem\u003eB. aurantiaca\u003c/em\u003e induced the coordinated upregulation of \u003cem\u003eVg1\u003c/em\u003e and \u003cem\u003eVgR\u003c/em\u003e in mosquitoes, suggesting that the bacterium not only promotes vitellogenin synthesis but also synchronously enhances signal reception capacity. Additionally, the expression of \u003cem\u003eVg3\u003c/em\u003e peaked and remained at a high level at most subsequent time points. The significant upregulation of \u003cem\u003eVg3\u003c/em\u003e further indicates the global activation of the vitellogenin synthetic pathway. Collectively, these results suggest that colonization by \u003cem\u003eB. aurantiaca\u003c/em\u003e may provide a more sufficient material basis for oocyte development by promoting the synthesis and transport of vitellogenin.\u003c/p\u003e \u003cp\u003eIn terms of hormone signaling pathway, \u003cem\u003eB. aurantiaca\u003c/em\u003e colonization significantly upregulated the expression of \u003cem\u003eEcR\u003c/em\u003e, which is a key regulator of ecdysone signaling. This suggests that \u003cem\u003eB. aurantiaca\u003c/em\u003e is more sensitive to 20E, a major hormone that initiates vitellogenesis. This finding is consistent with previous reports that bacteria can influence the host juvenile hormone-ecdysone axis[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Most importantly, we observed that this bacterium could substantially increase the expression of \u003cem\u003eILPR\u003c/em\u003e, and the peak of \u003cem\u003eILPR\u003c/em\u003e expression coincided with the peak of \u003cem\u003eVg1\u003c/em\u003e and \u003cem\u003eVgR\u003c/em\u003e. The insulin signaling pathway is the core hub linking nutritional status and reproduction[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. After emergence, the insulin signaling pathway is activated to initiate vitellogenesis, driving the massive synthesis of vitellogenin in the fat body and prioritizing reproductive development over other metabolic activities, such as flight muscle development or glycogen storage[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It has been reported that bacteria can mimic or enhance the insulin signaling pathway to promote host nutrient sensing and distribution, thereby promoting yolk synthesis[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. The results of this study suggest that \u003cem\u003eB. aurantiaca\u003c/em\u003e may interfere with the nutrient sensing and insulin signaling pathway in the host and synergize with 20E signaling to drive the occurrence of vitellogenesis. In contrast, the expression of \u003cem\u003eMet\u003c/em\u003e, a key gene in the juvenile hormone signaling pathway, was not significantly altered, indicating that \u003cem\u003eB. aurantiaca\u003c/em\u003e influenced growth and reproduction in the mosquito in a pathway-specific manner.\u003c/p\u003e \u003cp\u003eOur results further confirm that the effects of \u003cem\u003eB. aurantiaca\u003c/em\u003e on the developmental and reproductive phenotypes of \u003cem\u003eCx. pipiens pallens\u003c/em\u003e exhibit a transgenerational effect. Long-term exposure to \u003cem\u003eB. aurantiaca\u003c/em\u003e can gradually delay the development of mosquito larvae, but promote the subsequent transformation process\u0026mdash;that is, substantially decrease the blood feeding rate of female mosquitoes, but enhance the oviposition rate. This effect was stable after passage, which was consistent with the developmental phenomenon of autogenous mosquitoes observed in our study. Combined with the dynamic changes in reproductive gene expression, it can be inferred that under the host's reduced blood-feeding behavior, bacterial colonization improves the host's efficiency in converting available resources into reproductive output through the optimization of reproductive gene expression and physiological regulation.\u003c/p\u003e \u003cp\u003eAs a vertically transmissible symbiotic bacterium, the interaction between \u003cem\u003eB. aurantiaca\u003c/em\u003e and \u003cem\u003eCx. pipiens pallens\u003c/em\u003e may represent a microecological adaptation that lies between symbiosis and mild regulation, whereby the bacterium modulates host reproduction-related pathways to influence the growth dynamics and reproductive potential of host populations. The long-term effects of this bacterium on mosquito populations are manifested in two specific aspects. First, it decreases the contact frequency between mosquitoes and humans via decreased blood-feeding rates, thereby directly lowering the risk of disease transmission. Second, it alters the mosquito life-history strategy, which in turn, alters the adaptive capacity and growth potential of the population in the environment. Therefore, the findings of this study provide a novel perspective for exploring microbe-based novel strategies for mosquito vector regulation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn this study, we successfully isolated the unique commensal bacterium \u003cem\u003eB. aurantiaca\u003c/em\u003e from the intestinal tract of autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, characterized its morphological, physiological and biochemical characteristics, and confirmed that the bacterium could stably colonize and achieve vertical transmission in anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e. \u003cem\u003eB. aurantiaca\u003c/em\u003e colonization was found to significantly upregulate the expression of reproduction-related genes in anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, and activate vitellogenesis, ecdysone signaling and insulin nutrition signaling pathways, thereby driving changes in the reproductive phenotype of the host. After several generations of treatment, the blood-feeding rate of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e decreased, while the oviposition rate increased, indicating that the bacterium could gradually reshape the reproductive and nutritional strategy of the host, and steer the anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e to autogeny.\u003c/p\u003e \u003cp\u003eThis study confirmed that \u003cem\u003eB. aurantiaca\u003c/em\u003e, an intestinal symbiotic bacterium, is a key factor modulating autogeny in \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, and its regulatory mechanism is closely associated with the modulation of host reproductive endocrine and nutrient metabolic pathways, thus enriching the microbe-driven theory underlying the formation of autogenous traits in mosquitoes. Furthermore, this bacterium decreased the blood-feeding rate of mosquitoes, providing a novel insight into the prevention and control of mosquito-borne diseases via intestinal microbiota modulation. For future studies, a germ-free \u003cem\u003eCx. pipiens pallens\u003c/em\u003e model should be constructed and utilized to further elucidate the host-microbe interaction mechanisms between \u003cem\u003eB. aurantiaca\u003c/em\u003e and its host. Field trials should also be performed to verify the regulatory effects of this bacterium in natural environments, thereby laying a solid foundation for its practical application.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthical approval and consent to participate\u003c/strong\u003e \u003cp\u003eThis study did not involve ethical approval and patient informed consent.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors have no competing interests to declare.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe study was financially supported by the National Natural Science Foundation of China (Grant No.81902096); the Innovation Project of Shandong Academy of Medical Sciences; Joint Innovation Team for Clinical \u0026amp; Basic Research(202407).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eLJL and MQG conceived and designed the study. XMW and XXG wrote the manuscript. PC, HFW, GL, HX, YXS and JJL participated in the experiment and analyzed the data. All authors read and approved the final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors would like to thank all the reviewers who participated in the review and LetPub (www.letpub.com.cn) for its linguistic assistance during the preparation of this manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets supporting the findings of this article are included within the paper.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eLiu B, Gao X, Zheng K, Ma J, Jiao Z, Xiao J, et al. The potential distribution and dynamics of important vectors \u003cem\u003eCulex pipiens pallens\u003c/em\u003e and \u003cem\u003eCulex pipiens quinquefasciatus\u003c/em\u003e in China under climate change scenarios: an ecological niche modelling approach. Pest Manag Sci. 2020;76:3096\u0026ndash;3107.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRochlin I, Faraji A, Healy K, Andreadis TG. West Nile virus mosquito vectors in North America. J Med Entomol. 2019;56:1475\u0026ndash;1490.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoubaud E. Cycle autog\u0026eacute;ne d'attente et g\u0026eacute;n\u0026eacute;rations hivernales suractives in-apparentes chez le moustique commun \u003cem\u003eCulex pipiens\u003c/em\u003e. C. R. Acad. Sci., Paris. 1929:188:735\u0026ndash;738.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAttardo GM, Hansen IA, Raikhel AS. Nutritional regulation of vitellogenesis in mosquitoes: implications for anautogeny. Insect Biochem Mol Biol. 2005;35:661\u0026ndash;675.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClements AN. The biology of mosquitoes:Volume 1:Development Nutrition And Reproduction. London: Chapman \u0026amp; Hall; 1992. p. 237\u0026ndash;240.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAardema ML, Zimmerman KI. The establishment of a new autogenous line of the Asian tiger mosquito, \u003cem\u003eAedes albopictus\u003c/em\u003e, from its current northern range limit in the United States. J Vector Ecol. 2021;46:112\u0026ndash;115.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhaligh FG, Naghian A, Soltanbeiglou S, Gholizadeh S. Autogeny in \u003cem\u003eCuliseta longiareolata\u003c/em\u003e (Culicidae: Diptera) mosquitoes in laboratory conditions in Iran. BMC Res Notes. 2020;13:81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinson EO, Chen K, Valzania L, Brown MR, Strand MR. Insulin-like peptide 3 stimulates hemocytes to proliferate in anautogenous and facultatively autogenous mosquitoes. J Exp Biol. 2022;225:jeb243460.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed AM. Mosquito autogeny in \u003cem\u003eAedes caspius\u003c/em\u003e (Diptera: Culicidae): alterations of larval nourishments reservation upon bacterial infection. Insect Sci. 2013;20:472\u0026ndash;484.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Q, Su F, Zhou Y, Chu W, Cao H, Song L, et al. Autogeny, Fecundity, and Other Life History Traits of \u003cem\u003eCulex pipiens molestus\u003c/em\u003e (Diptera: Culicidae) in Shanghai, China. J Med Entomol. 2019;56:656\u0026ndash;664.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReisen WK, Milby MM, Meyer RP. Population dynamics of adult \u003cem\u003eCulex mosquitoes\u003c/em\u003e (Diptera: Culicidae) along the Kern River, Kern County, California, in 1990. J Med Entomol. 1992;29:531\u0026ndash;543.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpielman A. Bionomics of autogenous mosquitoes. Annu Rev Entomol. 1971;16: 231\u0026ndash;248.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoliman BA, Wassim NM, Tewfick MK. Comparative susceptibility of autogenous and anautogenous \u003cem\u003eAedes caspius pallas\u003c/em\u003e (Diptera: Culicidae) to filaria parasite \u003cem\u003eWuchereria bancrofti\u003c/em\u003e (Filariidea: Dipetalonematidae). Egypt. J. Exp. Biol. (Zoo.). 2014;10: 67\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMori A, Romero-Severson J, Black WC 4th, Severson DW. Quantitative trait loci determining autogeny and body size in the Asian tiger mosquito (\u003cem\u003eAedes albopictus\u003c/em\u003e). Heredity (Edinb). 2008;101:75\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJarvela AMC, Bell KL, Noreuil A, Fritz ML. Autogenous and anautogenous \u003cem\u003eCulex pipiens\u003c/em\u003e bioforms exhibit insulin-like peptide signaling pathway gene expression differences that are not dependent upon larval nutri-tion. bioRxiv. 2021;06:449144.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei Q, Wang Y, Deng P, Zhang J, Qin Y, Li Z, et al. \u003cem\u003eEnterococcus casseliflavus\u003c/em\u003e regulates amino acid metabolism in edible insect \u003cem\u003eClanis bilineata tsingtauica\u003c/em\u003e: a functional metagenomics study. Front Microbiol. 2024;15:1343265.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng T, Fu Q, Luo F, Dai J, Fu R, Qi X, et al. Lactic acid bacteria modulate the CncC pathway to enhance resistance to β-cypermethrin in the oriental fruit fly. ISME J. 2024;18:wrae058.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L, Wang D, Shi P, Li J, Niu J, Chen J, et al. A naturally isolated symbiotic bacterium suppresses flavivirus transmission by \u003cem\u003eAedes\u003c/em\u003e mosquitoes. Science. 2024;384:eadn9524.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu J, Wang J, Huang X, Guan B, Feng Q, Deng H. Composition and diversity of gut microbiota across developmental stages of S\u003cem\u003epodoptera frugiperda\u003c/em\u003e and its effect on the reproduction. Front Microbiol. 2023;14:1237684.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt K, Engel P. Mechanisms underlying gut microbiota-host interactions in insects. J Exp Biol. 2021;224:jeb207696.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu L, Li L, Sun J, Zhao Y, Wan K, Zhang M, et al. \u003cem\u003eRahnella aquatilis\u003c/em\u003e isolated from \u003cem\u003eAedes albopictus\u003c/em\u003e impairs mosquito reproduction capacity. Insects. 2025;16:257.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Eum JH, Harrison RE, Valzania L, Yang X, Johnson JA, et al. Riboflavin instability is a key factor underlying the requirement of a gut microbiota for mosquito development. Proc Natl Acad Sci U S A. 2021;118:e2101080118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarrison RE, Yang X, Eum JH, Martinson VG, Dou X, Valzania L, et al. The mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e requires a gut microbiota for normal fecundity, longevity and vector competence. Commun Biol. 2023;6:1154.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu S, Liu Z, Wang J, Zheng H, Han S, Zheng F, et al. \u003cem\u003eLysinibacillus sphaericus\u003c/em\u003e exposure impedes \u003cem\u003eAnopheles dirus\u003c/em\u003e's oviposition via downregulating vitellogenin. Parasit Vectors. 2025;18:111.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei J, Lv W, Wang W, Wang H, Guo X, Cheng P, et al. Comparison of the microbiota diversity between autogenous and anautogenous \u003cem\u003eCulex pipiens pallens\u003c/em\u003e. Chin. J. Schistosomiasis Control. 2024;36:52\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaab SA, Dohna HZ, Nilsson LKJ, Onorati P, Nakhleh J, Terenius O, et al. The environment and species affect gut bacteria composition in laboratory co-cultured \u003cem\u003eAnopheles gambiae\u003c/em\u003e and \u003cem\u003eAedes albopictus\u003c/em\u003e mosquitoes. Sci Rep. 2020;10:3352.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkorli J, Namaali PA, Ametsi GW, Egyirifa RK, Pels NAP. Generational conservation of composition and diversity of field-acquired midgut microbiota in \u003cem\u003eAnopheles gambiae\u003c/em\u003e (sensu lato) during colonization in the laboratory. Parasit Vectors. 2019;12:27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoll RM, Romoser WS, Modrzakowski MC, Moncayo AC, Lerdthusnee K. Meconial peritrophic membranes and the fate of midgut bacteria during mosquito (Diptera: Culicidae) metamorphosis. J Med Entomol. 2001;38:29\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38:3022\u0026ndash;3027.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao, H., Jiang, Y., Wang, L, Wang G, Hu W, Dong L, et al. Outer membrane vesicles from a mosquito commensal mediate targeted killing of \u003cem\u003ePlasmodium\u003c/em\u003e parasites via the phosphatidylcholine scavenging pathway. Nat Commun, 2023;14:5157.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun X, Wang Y, Yuan F, Zhang Y, Kang X, Sun J, et al. Gut symbiont-derived sphingosine modulates vector competence in \u003cem\u003eAedes\u003c/em\u003e mosquitoes. Nat Commun. 2024;15:8221.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou C, Guan Q, Dai Y, Liu H, Qian K. Expression characterization and functional analysis of juvenile hormone receptor gene \u003cem\u003eCpMet\u003c/em\u003e in \u003cem\u003eCulex pipiens pallens\u003c/em\u003e. Chin J Vector Biol \u0026amp; Control, 2021, 32: 680\u0026ndash;685.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVancanneyt M, Segers P, Abraham WR, De Vos P. Brevundimonas. In: Bergey's Manual of Systematic Bacteriology, 2nd ed., Vol. 2, Part C; Garrity GM, Ed.; Springer: New York, NY, USA, 2005; pp. 308\u0026ndash;316.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTung GA, Fonseca DM. Internal and external drivers interact to create highly dynamic mosquito blood-feeding behaviour. Proc Biol Sci. 2024;291:20241105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAriani CV, Smith SC, Osei-Poku J, Short K, Juneja P, Jiggins FM. Environmental and genetic factors determine whether the mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e lays eggs without a blood meal. Am J Trop Med Hyg. 2015;92:715\u0026ndash;721.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO'Meara GF, Larson VL, Mook DH. Blood feeding and autogeny in the peridomestic mosquito \u003cem\u003eAedes bahamensis\u003c/em\u003e (Diptera: Culicidae). J Med Entomol. 1993;30:378\u0026ndash;383.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoon KL, Brown MR, Strand MR. Gut bacteria differentially affect egg production in the anautogenous mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e and facultatively autogenous mosquito \u003cem\u003eAedes atropalpus\u003c/em\u003e (Diptera: Culicidae). Parasit Vectors. 2016;9:375.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaracena-Agarwal ML, Walter-Nuno AB, Bottino-Rojas V, Mejia APG, Xu K, Segal S, et al. Juvenile Hormone as a contributing factor in establishing midgut microbiota for fecundity and fitness enhancement in adult female \u003cem\u003eAedes aegypti\u003c/em\u003e. Commun Biol. 2024;7:687.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Yin J, Huang X, Zang C, Zhang Y, Cao J, et al. Mosquito gut microbiota: a review. Pathogens. 2024;13:691.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao SY, Sommer AJ, Bartlett D, Harbison JE, Irwin P, Coon KL. Microbiota composition associates with mosquito productivity outcomes in belowground larval habitats. Mol Ecol. 2025;34:e17614.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026iacute;az S, Avila FW, Coon KL. Differential fitness effects of gut and reproductive tract bacteria in larval and adult stages of the yellow fever mosquito, \u003cem\u003eAedes aegypti\u003c/em\u003e. Acta Trop. 2025;265:107615.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao C, Peng Y, Li W, Raza MF, Wang W, Zhang Y, et al. The role of gut microbiota-gonadal axis in ovary activation of Asian honey bee (\u003cem\u003eApis cerana\u003c/em\u003e) queens. NPJ Biofilms Microbiomes. 2025;11:97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe M, Chen H, Yang X, Gao Y, Lu Y, Cheng D. Gut bacteria induce oviposition preference through ovipositor recognition in fruit fly. Commun Biol. 2022;5:973.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMosquera KD, Khan Z, Wondwosen B, Alsanius B, Hill SR, Ignell R, et al. Odor-mediated response of gravid \u003cem\u003eAedes aegypti\u003c/em\u003e to mosquito-associated symbiotic bacteria. Acta Trop. 2023;237:106730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Yang L, He Q, Zhou S. Regulatory mechanisms of vitellogenesis in insects. Front Cell Dev Biol. 2021;8:593613.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoy S, Saha TT, Zou Z, Raikhel AS. Regulatory pathways controlling female insect reproduction. Annu Rev Entomol. 2018;63:489\u0026ndash;511.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing L, Raikhel AS. Cross-talk of insulin-like peptides, juvenile hormone, and 20-hydroxyecdysone in regulation of metabolism in the mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e. Proc Natl Acad Sci U S A. 2021;118:e2023470118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Geng D, Shi K, Qi Q, Lyu X, Sun X, et al. Genomic and insulin-mediated control of metabolic homeostasis by the mosquito ecdysone-induced gene E93. Proc Natl Acad Sci U S A. 2025;122:e2511572122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoy SG, Hansen IA, Raikhel AS. Effect of insulin and 20-hydroxyecdysone in the fat body of the yellow fever mosquito, \u003cem\u003eAedes aegypti\u003c/em\u003e. Insect Biochem Mol Biol. 2007;37:1317\u0026ndash;1326.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eN\u0026auml;ssel DR, Vanden Broeck J. Insulin/IGF signaling in \u003cem\u003eDrosophila\u003c/em\u003e and other insects: factors that regulate production, release and post-release action of the insulin-like peptides. Cell Mol Life Sci. 2016;73:271\u0026ndash;290.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDou X, Chen K, Brown MR, Strand MR. Multiple endocrine factors regulate nutrient mobilization and storage in \u003cem\u003eAedes aegypti\u003c/em\u003e during a gonadotrophic cycle. Insect Sci. 2023;30:425\u0026ndash;442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGulia-Nuss M, Robertson AE, Brown MR, Strand MR. Insulin-like peptides and the target of rapamycin pathway coordinately regulate blood digestion and egg maturation in the mosquito \u003cem\u003eAedes aegypti\u003c/em\u003e. PLoS One. 2011;6:e20401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas De T, Sharma P, Tevatiya S, Chauhan C, Kumari S, Yadav P, et al. Bidirectional microbiome-gut-brain-axis communication influences metabolic switch-associated responses in the mosquito \u003cem\u003eAnopheles culicifacies\u003c/em\u003e. Cells. 2022;11:1798.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Culex pipiens pallens, autogeny, symbiotic bacteria, Brevundimonas aurantiaca","lastPublishedDoi":"10.21203/rs.3.rs-8983038/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8983038/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eCulex pipiens pallens\u003c/em\u003e is a significant vector of mosquito-borne diseases, and its autogenous trait exerts a critical impact on population expansion and disease transmission risks. Understanding the regulatory effect of gut-specific symbiotic bacteria on the autogeny of \u003cem\u003eCx. pipiens pallens\u003c/em\u003e will provide a microbial perspective to elucidate the mechanisms underlying the formation of autogenous reproductive strategies and provide a theoretical basis for the development of novel mosquito-borne disease control.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eAutogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e were utilized to isolate and culture gut-specific symbiotic bacteria. Green fluorescent protein (GFP) labeling technology and absolute quantitative real-time polymerase chain reaction (qRT-PCR) were used to confirm the colonization ability of the symbiotic bacteria in the guts of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e. The alterations in the expression levels of reproductive-related genes were verified by relative qRT-PCR. Continuous multi-generational treatment was applied to anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e to evaluate transgenerational effects. Larval stage, pupation rate, pupal stage, emergence rate, male:female ratio, blood-feeding rate, oviposition rate, and hatching rate were recorded to assess the effects of the symbiotic bacteria on the reproductive and developmental phenotypes in the anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe gut-specific symbiotic bacterium isolated from autogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e was identified as \u003cem\u003eBrevundimonas aurantiaca\u003c/em\u003e, a gram-negative rod-shaped bacterium that forms orange-yellow circular colonies on Caulobacter Medium and exhibits a smooth, intact surface and a characteristic rod morphology arranged in short chains. \u003cem\u003eB. aurantiaca\u003c/em\u003e successfully colonized in the midgut of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e and achieved vertical transmission. qRT-PCR analysis revealed that \u003cem\u003eB. aurantiaca\u003c/em\u003e significantly upregulated the expression of several key reproductive genes in anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e, including vitellogenin (\u003cem\u003eVg1\u003c/em\u003e, \u003cem\u003eVg3\u003c/em\u003e), vitellogenin receptor (\u003cem\u003eVgR\u003c/em\u003e), ecdysone receptor (\u003cem\u003eEcR\u003c/em\u003e), and insulin-like peptide receptor (\u003cem\u003eILPR\u003c/em\u003e). After several generations of symbiotic bacteria treatment, the reproductive phenotype of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e was significantly altered. By the fifth generation, the blood-feeding rate of adult mosquitoes was reduced to 87.72%, while the oviposition rate increased to 58.71%, and the larval development period was significantly prolonged.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe symbiotic bacterium \u003cem\u003eB. aurantiaca\u003c/em\u003e reshapes the reproductive strategy of anautogenous \u003cem\u003eCx. pipiens pallens\u003c/em\u003e by modulating the reproductive endocrine and nutritional signaling pathways of mosquitoes. These findings not only provide an important microbial regulatory perspective for understanding the molecular mechanisms underlying autogeny in mosquitoes, but also offer potential targets for the development of novel symbiont-based biocontrol strategies against mosquito-borne diseases.\u003c/p\u003e","manuscriptTitle":"Isolation of the symbiotic bacterium Brevundimonas aurantiaca and its regulatory effect on the autogeny of Culex pipiens pallens","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-06 21:17:31","doi":"10.21203/rs.3.rs-8983038/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-25T12:37:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-23T07:32:44+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-17T19:22:49+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219948064478951616651632988794396679624","date":"2026-03-04T19:52:05+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"288323143081448796302047819860554418590","date":"2026-03-03T12:02:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59379707280681211245367486360705586259","date":"2026-03-03T05:03:05+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-02T13:27:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-02T12:32:20+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-02T11:04:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Parasites \u0026 Vectors","date":"2026-02-27T03:25:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"parasites-and-vectors","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"parv","sideBox":"Learn more about [Parasites \u0026 Vectors](http://parasitesandvectors.biomedcentral.com/)","snPcode":"13071","submissionUrl":"https://submission.nature.com/new-submission/13071/3","title":"Parasites \u0026 Vectors","twitterHandle":"@bugbittentweets","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"79c6e3cc-8c6d-470e-b3a2-e28c580042fc","owner":[],"postedDate":"March 6th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-03-25T12:53:32+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-06 21:17:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8983038","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8983038","identity":"rs-8983038","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00