DNA polymerase beta connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of Per1

preprint OA: closed
Full text JSON View at publisher

Abstract

The circadian-controlled DNA repair exhibits a strong diurnal rhythm. Disruption in circadian clock and DNA repair is closely linked with hepatocellular carcinoma (HCC) progression, but the mechanism remains unknown. Here, we show that polymerase beta (Polb), a critical enzyme in the DNA base excision repair pathway, is rhythmically expressed at the translational level in mouse livers. Hepatic Polb dysfunction dampens clock homeostasis, whereas retards HCC progression, through methylation of the 4 th CpG island on the 5'UTR of clock gene Per1 . Clinically, POLB is overexpressed in human PolbHCC samples and positively associated with poor prognosis. Furthermore, the hepatic rhythmicity of Polb protein expression is orchestrated by Calreticulin (Calr). Our findings provide important insights into the molecular mechanism underlying the synergy between clock and food signals on the Polb-driven BER system and reveal new clock-dependent carcinogenetic effects of Polb. Therefore, chronobiological modulation of Polb may help to promote precise interventions for HCC.
Full text 166,579 characters · extracted from preprint-html · click to expand
DNA polymerase beta connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of Per1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article DNA polymerase beta connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of Per1 Chang Liu, Siyu Chen, Wenxiang Zhang, Xiao Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3350322/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Jan, 2024 Read the published version in Cell Death & Disease → Version 1 posted 10 You are reading this latest preprint version Abstract The circadian-controlled DNA repair exhibits a strong diurnal rhythm. Disruption in circadian clock and DNA repair is closely linked with hepatocellular carcinoma (HCC) progression, but the mechanism remains unknown. Here, we show that polymerase beta (Polb), a critical enzyme in the DNA base excision repair pathway, is rhythmically expressed at the translational level in mouse livers. Hepatic Polb dysfunction dampens clock homeostasis, whereas retards HCC progression, through methylation of the 4 th CpG island on the 5'UTR of clock gene Per1 . Clinically, POLB is overexpressed in human PolbHCC samples and positively associated with poor prognosis. Furthermore, the hepatic rhythmicity of Polb protein expression is orchestrated by Calreticulin (Calr). Our findings provide important insights into the molecular mechanism underlying the synergy between clock and food signals on the Polb-driven BER system and reveal new clock-dependent carcinogenetic effects of Polb. Therefore, chronobiological modulation of Polb may help to promote precise interventions for HCC. Biological sciences/Molecular biology/Epigenetics/DNA methylation Health sciences/Diseases/Cancer/Gastrointestinal cancer/Liver cancer DNA base excision repair Circadian homeostasis Hepatocellular carcinoma Epigenetic modification Core clock components Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction The genome is sensitive to a variety of endogenous and exogenous DNA-damaging agents that modify DNA bases and deoxyribose phosphate (dRP) groups, as well as directly break DNA backbone(Ciccia & Elledge, 2010 ). To repair these damages, organisms have evolved multiple DNA repair mechanisms, which are essential to preserve the integrity of genomic DNA(Ciccia & Elledge, 2010 ). Malfunctions in DNA repair systems lead to a series of serious consequences, including heightened sensitivity to environmental changes, increased susceptibility to tumorigenesis, and accelerated ageing(Jackson & Bartek, 2009 ). Of all the DNA repair pathways, base excision repair (BER) performs a crucial role in governing eukaryotic DNA stability in a location-dependent manner according to the type of damage. The BER process begins with the elimination of a damaged base by a DNA glycosylase, which results in an abasic or apurinic/apyrimidinic (AP) site(Mullins et al, 2019 ). The AP site is then cleaved at its 5' side by AP endonuclease 1 (APEX1), generating a 3'-OH and a 5'-dRP(Antoniali et al, 2017 ). This intermediate structure can be further processed through either the short patch BER (SP-BER) or the long patch BER (LP-BER) pathway(Antoniali et al., 2017 ). In the SP-BER process, DNA polymerase beta (Polb) fills in the single-nucleotide gap and removes the dRP moiety with its dRP lyase activity, resulting in a ligatable nick that can be sealed by X-ray repair cross-complementing protein 1 (XRCC1)/ligase IIIα(Parsons et al, 2005 ). In the LP-BER process, Polb, δ or ε incorporates 2–15 nucleotides, displacing the strand containing the lesion. The generated DNA flap is then cleaved by flap endonuclease 1 (FEN1), and the nick is sealed by a DNA ligase(Fan & Wilson, 2005 ). As a key factor, Polb is essentially required for all forms of BER. It is a 39kDa protein with both DNA polymerase and dRP lyase activities, which are responsible for the incorporation of new deoxybibonucleotides and the removal of the dRP group, respectively (Barakat et al, 2012 ; Wallace et al, 2012 ). In addition, Polb interacts with many partner proteins, such as APEX1, FEN1, and proliferating cell nuclear antigen (PCNA) (Ray et al, 2013 ). These interactions are important for the coordination of the BER process and ensure its efficiency and accuracy. Given the importance of Polb in the BER machinery, abnormalities in its expression and activity are closely correlated with tumorigenesis. For example, Polb was found to be overexpressed in approximately one-third of a diverse range of matched tumor samples (Wallace et al., 2012 ). Aberrantly high levels of Polb could potentially destabilize other cellular processes and eventually lead to tumorigenesis or progression. On the other hand, Polb mutations with lower enzymatic activities have also been detected in most types of human cancers (Ray et al., 2013 ). Such Polb variants may result in BER deficiencies and increase the risk of cancer development. In particular, three germline polymorphic variants of Polb with single amino acid substitution have been identified in the human population. These variants include R137Q, P242R and Q8R variants, all of which have been reported to be associated with cancer pathogenesis (Guo et al, 2009 ). Among them, R137Q variant is of particular interest because the amino acid substitution of Arg by Gln leads to a net positive charge loss, potentially causing significant changes in the biochemical and physiological properties of the enzyme (Guo et al., 2009 ). The Polb R137Q variant has been shown to exhibit decreased DNA synthesis activity and impaired interaction with PCNA, further leading to cellular hypersensitivity to DNA damaging agents (Guo et al., 2009 ). In addition, R137Q knock-in mice have been found to exhibit retarded embryo development and a high mortality rate (Pan et al, 2016 ). Although R137 is a key amino acid site for proper Polb function in maintaining genomic DNA stability and physiological homeostasis, the causal relationship between the Polb R137Q mutant and cancer development remains unknown. Of note, the risk of DNA damage is not constant throughout the day. Factors such as UV light, which potentially triggering DNA damage, vary significantly depending on the light/dark cycles induced by the Earth’s autorotation, thus leading to the fluctuation in the risk of DNA damage (Sancar et al, 2015 ). In fact, nearly all behavioral and physiological activities in organisms exhibit oscillations in response to diurnal changes of environmental light and food availability. This adaptation is controlled by the circadian clock system, which is based on interconnecting transcriptional-translational loops of clock genes/proteins that are ubiquitously expressed in cells (Harmer et al, 2001 ). In the core loop of the circadian clock system, the transcriptional activators of circadian locomotor output cycles kaput (CLOCK) and brain and muscle ARNT-like 1 (BMAL1) form heterodimers and activate the expression of repressors encoded by three Period (Per1-3) and two Cryptochrome (Cry1/2) genes. As the day progresses, protein complexes consisting of Per and Cry translocate into the nucleus and inhibit CLOCK/BMAL1-mediated transcription. Because of their instability, the protein and mRNA levels of these repressors rapidly decrease below the threshold required for autorepression, allowing for a new cycle to begin (Asher & Schibler, 2011 ; Panda, 2016 ; Ripperger & Schibler, 2006 ). A growing body of epidemiologic data suggests that circadian clock disruption predisposes humans to cancer. For instance, certain lifestyle choices and occupations that disrupt the day-night rhythm have been linked to a higher incidence of colorectal carcinoma, breast cancer, lung cancer, and prostate cancer in humans (Chen et al, 2020 ; Hu et al, 2020 ; Marcheva et al, 2013 ; Shi et al, 2020 ). Consistent with this, circadian dysfunction induces spontaneous hepatocarcinogenesis (Kettner et al, 2016 ). Conversely, cancer development also disrupts the circadian clock. At the molecular level, the circadian clock regulates various genes involved in important steps during tumorigenesis, such as cell cycle re-entry, proliferation, invasion and metastasis (Xuan et al, 2021 ). Collectively, the circadian clock and cancer pathogenesis are tightly integrated and are reciprocally regulated. Considering that perturbations in both the circadian rhythm and DNA repair are implicated in the development of hepatocellular carcinoma (HCC) (Ghaderi-Zefrehi et al, 2021 ; Qu et al, 2023 ), while Polb serves as a crucial mediator of DNA synthesis and cellular susceptibility to DNA-damaging agents (Kaufman & Van Houten, 2017 ), we aimed to examine the involvement of Polb and the biological clock in the coordinated regulation of HCC pathophysiology. We found that Polb exhibited diurnal rhythmicity and was post-translationally regulated by Calreticulin (Calr) in a circadian manner. Hepatic Polb served as a critical component for maintaining circadian homeostasis and was clinically overexpressed in the HCC patients, driving cancer progression through demethylation of the 4th CpG island on the 5'UTR of clock gene Per1 . Our findings furnish key insights into the molecular mechanism that drives the synergistic effects of clock and food signals on the Polb-driven BER system, and uncover the novel clock-linked carcinogenic effects of Polb in the liver. Therefore, chronobiological modulation of Polb may present a promising avenue for the precise interventions targeting HCC. Results Hepatic Polb responses to peripheral clocks and food signals Given the liver is the largest metabolic organ with an active DNA damage/repair cycle during a day, we firstly examined the 24-h expression rhythmicity of Polb in the mouse liver. As shown in Fig. 1 A, the mRNA expression of hepatic Polb exhibited a diurnal oscillation pattern, which reached to its nadir at ZT1 and gradually increased to its peak at ZT21. In contrast, the oscillation pattern of Polb protein expression peaked at ZT13 (Fig. 1 B and Table S1 ). As food intake is a crucial Zeitgeber for the entrainment of circadian clocks in peripheral tissues, we also examined hepatic Polb expression in response to food signals by using mice subjected to fasting/re-feeding cycles and time-restricted feeding. We found that the mRNA expression levels of Polb were unaltered in these mice, whereas Polb protein expression was significantly decreased in the liver of refed mice (Fig. 1 C-D). Furthermore, the oscillation of Polb protein expression was reversed by restricted feeding, suggesting that this protein is controlled by both food and clock signals (Fig. 1 E-F). In addition, the expression of other core BER components, such as Fen1, Apex1 and Xrcc1, was insensitive to these signals and was kept stable in our settings (Figure S1 A-C and Table S1 -2). The dysfunction of Polb impairs hepatic circadian homeostasis in vivo and in vitro To evaluate the potential role of Polb in maintaining the circadian homeostasis, we first examined the wheel-running activity of Polb R137Q mice. As shown in Fig. 2 A-C, the Polb R137Q mice were hyperactive accompanied with a slightly prolonged period under constant dark compared to the WT mice. In contrast, the food intake and body weight of Polb R137Q and WT mice were similar (Figure S2A). At the molecular level, the circadian oscillation patterns of mRNA expression of core clock genes, including Bmal1 , Cry1 and Per1 , were dampened in the livers of Polb R137Q mice (Fig. 2 D and Table S3). In detail, Meta2d analysis indicated that the amplitudes of Cry1 and Per1 oscillation were decreased in these mutant mice (Table S4). As expected, the rhythmicity of these clock genes in the suprachiasmatic nucleus remained unaltered (Figure S2B and Table S3-4). To confirm the effects of Polb on clock homeostasis, we challenged human WT and POLB KO Bmal1 ::U2OS cells (the validation of POLB KO efficiency was presented in Figure S2C) with a dexamethasone shock, followed by real-time bioluminescence analysis. We found that Polb deficiency led to a significant prolonged period (24.27 ± 0.54 h vs . 26.03 ± 0.18 h, P = 0.0001), while the amplitude of activity rhythms was slightly decreased (Fig. 2 E-G). To achieve a more physiological relevance, we repeated above experiments in HepG2 cells with POLB deficiency (POLB KO efficiency was presented in Figure S3A). As shown in Fig. 2 H, dexamethasone shock induced a robust oscillation of all examined clock genes, including Bmal1 , Cry1 and Per1 . However, Polb deficiency disrupted the circadian patterns of these genes (Fig. 2 H and Table S5). In detail, the circadian amplitudes of Bmal1 and Cry1 were increased, whereas Per1 was decreased (Table S6). To globally identify downstream molecular events in Polb-orchestrated transcriptional network, we performed the transcriptome analysis and found that mRNA expression levels of total 101 genes were altered in the livers of Polb R137Q mice (Fig. 2 I). Notably, these genes were mostly enriched into the circadian clock-associated pathway (Fig. 2 J). Dysfunction of Polb reduces HCC progression in a circadian manner in vivo Since both Polb-driven BER process and circadian clock are extensively involved in cancer development, we next evaluated the impacts of Polb on HCC progression from a chronobiological view. To induce HCC, Polb R137Q mice and WT littermates were subjected to DEN plus CCl 4 treatment at ZT1 and ZT13, respectively (Fig. 3 A). As shown in Fig. 3 B-C, the number of liver tumors was reduced in Polb R137Q mice compared to WT mice. Consistently, the liver weight and the serum alanine aminotransferase (ALT)/aspartate transaminase (AST) levels were significantly decreased in mutant mice (Fig. 3 D-F and Table S7). Histologically, H&E staining analysis showed that the tumors in the WT group were composed of densely packed cells, whereas the Polb R137Q group showed reduced tumor cell density and blurred cell borders (Fig. 3 G). Sirius red analysis indicated a marked alleviation in hepatic portal fibrosis in Polb R137Q mice (Fig. 3 H). Notably, the retardation of HCC progression by Polb R137Q mutation was more apparent when the carcinogen was injected at ZT13. For instance, the liver weight was decreased by 21.54% in Polb R137Q mice at ZT1, while it was decreased to 54.87% at ZT13. Similarly, the reduction percentage of serological AST levels was 53.26% at ZT13 compared to 29.82% at ZT1. To identify downstream molecular events globally, high-throughput RNA-seq analysis was performed in these HCC samples. Volcano analysis indicated that mRNA expression levels of total 802 genes were altered in the liver tumor samples of Polb R137Q mice at ZT1 (Fig. 3 I). GO enrichment analysis revealed that these genes were clustered into the lipid metabolism pathway (Fig. 3 J). Meanwhile, a cluster of 1485 genes was significantly changed at ZT13 (Fig. 3 K). Importantly, the biological rhythmic pathway was also enriched in the liver of Polb R137Q mice carrying HCC at ZT13 (Fig. 3 L). It is worthwhile to point out that Polb is a DNA polymerase functionally located in the nucleus, we thus analyzed the cellular location of these downstream genes and found that only clock-associated genes were mostly enriched in the nucleus (Table S8), suggesting the modulation of circadian clock is a critical pathophysiological output of Polb, therefore the Polb R137Q mutant alleviated HCC progression in a circadian-dependent manner, especially at ZT13. To confirm the roles of Polb in tumorigenesis in vitro , we evaluated cell behaviors in both POLB KO and WT HepG2 cells. As shown in Figure S3B, Polb deficiency significantly decreased the cell proliferation rate. These results were confirmed by using an EdU incorporation assay (Figure S3C, D). As is known, cell proliferation is tightly related to the cell cycle re-entry. Coincided with above findings, Polb deficiency arrested more cells at the G0-G1 phase and blocked the S phase entry (Figure S3E). Moreover, a subcutaneous xenograft tumor model established by POLB KO HepG2 cells exhibited reduced tumor volumes and weights (Figure S3F-H). Therefore, Polb is a bona fide oncogene involved in the pathogenesis of liver cancer. Polb activates Per1 mRNA expression by inducing epigenetic CpG demethylation Since Polb is rhythmically expressed in the liver and it is reciprocally required for clock homeostasis, we performed venn analysis to investigate downstream circadian effectors. Seven genes were identified to be consistently regulated in the liver of Polb R137Q HCC and non-tumor mice. An independent RT-qPCR analysis confirmed the mRNA expression patterns of Bmal1 , Cry1 and Per1 (Fig. 4 A). It should be noted that Polb is involved in the DNA demethylation process to activate genetic transcription(Wang et al, 2020 ), therefore we hypothesize that Polb R137Q mutant may reasonably repress downstream gene expression. Given that Per1 was the only downregulated gene, it may serve as the authentic target in the Polb-driven cascade flux. In this sense, we analyzed the CpG islands on the proximal promoter and 5'UTR, which were closed to the transcriptional start site of Per1. As shown in Fig. 4 B, eight CpG islands were predicted by Ensembl and MethPrimer. MedIP analysis revealed that the 4th CpG island presented on the 5'UTR of Per1 was hypermethylated in the liver tissues of Polb R137Q mice at ZT13 (Fig. 4 B). Such a hypermethylation was further confirmed by bisulfite sequencing PCR (BSP) analysis (Fig. 4 C). Coincidence with these results, ChIP assays indicated that Polb was located near the 4th CpG island on the 5'UTR of Per1 , while Polb R137Q significantly reduced such recruitment (Fig. 4 D). In addition to the epigenetic modification of CpG islands, it has been documented that an E-box motif residing in the 5'UTR also regulates the gene transcriptional activity(Kim et al, 2001 ). We found that three E-box motifs were present in this region (-79 ~ + 983 bp). To clarify Polb’s demethylation function, we constructed a Per1 luciferase reporter containing both the 4th CpG island and the mutated E-box motifs. Reporter gene assays demonstrated that as expected, Bmal1 robustly activated Per1 transcription. Similarly, overexpression of Polb also promoted Per1 transcription even when the E-boxes were mutated, suggesting an E-box independent regulation in Per1 gene transcription by Polb (Fig. 4 E). To dissect the role of Per1 in mediating Polb’s function, we recapitulated Per1 expression in POLB KO HepG2 cells. As shown in Fig. 4 F-H, overexpression of Per1 partially relieved the inhibition of cell proliferation triggered by Polb deficiency. Similar results were observed in cell cycle analysis (Fig. 4 I). All these findings suggest that Polb/Per1 axis positively contributes to the HCC progression. To further confirm this hypothesis, we knocked out PER1 in HepG2 cells (PER1 KO efficiency was presented in Figure S4A) and found that Per1 deficiency led to a reduced cell proliferation rate (Figure S4B-D). In vivo xenograft tumor assays revealed that PER1 KO reduced tumor volumes and weights in HCC-bearing mice (Figure S4E-G). The expression of POLB is increased in HCC specimens The TCGA analysis revealed that mRNA expression levels of POLB were increased in liver hepatocellular carcinoma (LIHC) samples (374 cases) compared to their adjacent normal tissue samples (50 cases) (Fig. 5 A). Although low expression levels of POLB did not affected the overall survival of HCC patients, they were positively correlated with disease-free survival, as evidenced using the public database KM plotter (Fig. 5 B and 5 C). To validate the database results, we examined POLB mRNA expression in a cohort of 21 paired HCC and matched adjacent normal tissue samples. Patients’ detailed clinical and pathological information were presented in Table S9. Our results revealed that the mRNA and protein expression of POLB was significantly increased in HCC tissues compared to their adjacent normal controls (Fig. 5 D-E). Polb is post-translationally regulated by Calr Although the Polb/Per1 axis has been successfully established and its function in HCC progression has been clarified in the above studies, how the rhythmicity of Polb is achieved remains unknown. To answer this question, we performed Co-immunoprecipitation (Co-IP, IP: anti-Polb) and label-free proteomics analyses by using mouse liver samples obtained at ZT1 and ZT13. As shown in Fig. 6 A, a total of 50 genes was changed according to the circadian time. We next clustered them with our previous RNA-seq database (GSE133342), which is a collection of hepatic gene profiles in response to the constant darkness and fasting/refeeding cycles (Chen et al, 2019 ) (Fig. 6 B). Using Metacycle analysis, we identified four genes (Got1, Rpl23a, Rack1 and Calr) as potential candidates with a robust rhythmic expression pattern (Table S10). Among which, only Got1 and Calr were found to be responsive to the refeeding signals (Table S2). Reactome analysis ( https://reactome.org ) further narrowed down these two factors and indicated that only Calr was involved in the post-translational protein modification pathway. In addition, we found that the mRNA and protein expression levels of hepatic Calr exhibited robust diurnal fluctuations, and that Calr was sensitive to both fasting/refeeding and time-restricted feeding signals and exhibited opposite expression patterns compared to the Polb protein (Figure S5A-C). Therefore, we selected Calr as the target mediator of the synergy between food and peripheral clock signals on the Polb protein expression. To confirm this, we performed an independent Co-IP analysis, which showed that Calr abundantly bound with Polb in the mouse liver and PHs. Note that their binding was decreased at ZT13, when compared to ZT1 (Fig. 6 C-D and Figure S5D, E). Moreover, overexpression of Calr in mouse PHs led to a dose-dependent decrease in the Polb protein expression (Fig. 6 E and Figure S5F). To further investigate the mechanism by which Calr regulates Polb protein levels, we performed a cycloheximide (CHX) chase experiment, which showed that overexpression of Calr accelerated the protein degradation of Polb, while knockdown of Calr using shRNA blocked such a degradation (Fig. 6 F). Accordingly, the ubiquitination of Polb was found to be dramatically increased in mouse primary hepatocytes (PHs) transfected with Calr-expressing plasmids (Fig. 6 G). In conclusion, Calr is finely orchestrated by both food and peripheral clock signals, and consequently triggers protein ubiquitination of Polb, culminating in the circadian fluctuation of Polb protein. Discussion The circadian clock is implicated in various cellular functions, including DNA repair, through a transcription-translation feedback loop. A decade ago, researchers already found that the expression levels of XPA, one of the key components in the nucleotide excision repair system, exhibited robust diurnal oscillation, providing the first piece of evidence that DNA repair is controlled by the circadian clock (Kang, 2021 ). However, the circadian oscillation of BER is still unclear. In our present study, we analyzed the expression pattern of core components in the BER system throughout a day, and found that while the expression levels of Xrcc1, Fen1 and Apex1 were roughly stable, Polb possessed a precise circadian expression pattern and was responsive to food signals, especially at its protein level. Moreover, the pathophysiological activities of both Polb R137Q mutant mice and POLB KO HepG2 cells exhibited a dampened circadian pattern, and more importantly, Polb dysfunction retarded HCC progression in a circadian-dependent manner. Coincided with these findings, Polb expression was upregulated in human HCC samples and was positively correlated with poor prognosis. At the molecular level, Polb demethylated the 4th CpG island on the 5'UTR of core clock gene Per1 and activated its transcription, leading to enhanced tumorigenicity. Besides, considering the nadir and peak times of hepatic Polb protein expression at ZT1 and ZT13, we later performed proteomics and bioinformatics clustering analysis with our previous database and screened out Calr as an important regulator that triggered Polb protein ubiquitination in response to both clock and food signals. Hence, our findings provide important insights into the molecular mechanism underlying the synergy between clock and food signals on the Polb-driven BER system and new clock-dependent carcinogenetic effects of Polb (Fig. 7 ). Chronobiological modulation of Polb may help to promote precise interventions for HCC. Epidemiologic studies indicate that circadian dysfunction among night-shift workers and individuals suffering from sleep dyspnea is a significant risk factor for the development of cancers, including HCC (Bass & Takahashi, 2010 ; Fu & Kettner, 2013 ; Kettner et al., 2016 ). Consistently, chronic circadian misalignment is sufficient to induce spontaneous hepatocarcinogenesis in mice (Kettner et al., 2016 ). Furthermore, mice exposed to the UV carcinogen at 4:00 a.m. exhibit a decreased latency and an approximately 5-fold increased multiplicity of skin cancer compared to mice exposed to UV at 4:00 p.m. (Gaddameedhi et al, 2011 ). All these phenomena indicates that the circadian clock plays a vital role in carcinogenesis. However, studies are lacking to identify direct molecule targets that relay the clock signals to tumorigenicity. To filling in this missing piece of the puzzle, we established a mouse HCC model by injection of DEN and CCl 4 according to the peak and nadir time points of Polb protein expression, and revealed a time-dependent on the chemical-induced hepatocarcinogenesis at ZT1 and ZT13. In particular, HCC mice established by chemical injection at ZT13 exhibited more severe tumorigenesis phenotypes, when compared to HCC mice established at ZT1. More importantly, Polb dysfunction with R137Q mutant significantly alleviated the HCC progression, and its anti-tumor effects were more profound at ZT13, indicating the circadian clock is potentially involved in relaying the oncogenic signal of Polb. Indeed, the transcriptome data from the liver of normal and tumor-baring mice were clustered, and the circadian rhythm was identified as the most responsive pathway to Polb signals. These results implied that disrupted clocks contributed to the circadian discrepancy of anti-tumor properties observed in the Polb-deficiency background on HCC progression. Currently, the roles of Polb in the tumorigenesis are still in debate. On one hand, the expression levels of Polb have been found to be elevated in certain tumors, including lung cancer, breast cancer, and colon cancer (Iwatsuki et al, 2009 ; Wang et al., 2020 ). On the other hand, Polb variants with low catalytic activity are also linked to an increased risk of cellular transformation and cancer susceptibility (Bergoglio et al, 2002 ; Guo et al., 2009 ; Zhou et al , 2016). Overexpression of Polb decreases the metastasis and invasion of lung and breast cancers (Wang et al., 2020 ). Of note, Polb is a core component in BER system, and inhibition of BER pathway has been proven to decrease the prostate cancer cell proliferation and is a potential therapeutic strategy for prostate cancer treatment (Vasquez et al, 2020 ). Consistently, we found that genetic mutation of Polb (reduced enzymatic activity) reduced the liver tumorigenesis, and in vitro studies further confirmed the anti-tumor properties of Polb dysfunction. Therefore, at least in our study, Polb’s role in HCC progression is positive and it serves as a promising integrator linking the circadian clock signals to liver cancer development. Accumulating evidence have demonstrated that epigenetic modification, such as DNA methylation, play an important role in cancer progression (Barcena-Varela et al, 2019 ; Sun et al, 2022 ). Moreover, DNA methylation on the promoter of core circadian genes controls their mRNA expression levels, thus maintaining the circadian clock homeostasis (Satou et al, 2013 ). Inhibition of DNA methylation can modify chromatin structure and affect gene expression, influencing cell fate decision (Raggi et al, 2014 ). Notably, the BER system is essential for the AP-site repair generated by TDG, potentially involving in the TET1-TDG-BER-mediated DNA demethylation (Chen & Riggs, 2011 ). Active global DNA demethylation was de facto found to be associated with the activity of BER, while BER proteins participate in the process of DNA demethylation (Hajkova et al, 2010 ; Weber et al, 2016 ). Polb, as a core component of BER system, has been shown to exert demethylation abilities closely associated with lung and breast cancer metastasis (Wang et al., 2020 ). In addition to the classic DNA methylation region existed on the gene promoter, the 5'UTR is another important region for DNA methylation modification (Beltran et al, 2008 ; Lim et al, 2018 ). Our results revealed that Polb demethylates the 5'UTR of Per1 , further activating its mRNA expression. Functionally, overexpression of Per1 partially abolished the Polb deficiency-induced cell proliferation and G0/G1 phase cell cycle arrest of HepG2. Since the amount of endogenous Polb protein was rhythmically enriched, the demethylation function of Polb was different at each time point, producing a time discrepancy of chemical-induced HCC progression. For instance, when the hepatic Polb protein level reached its peak time at ZT13, the abundant Polb executed its demethylation function on the 5'UTR of Per1 , further aggravating HCC progression. More importantly, such a demethylation-triggered Per1 transcription was persistent even when the E-box were mutated, indicating that Polb-mediated 5'UTR demethylation is a non-classical pathway that activates Per1 transcription independent of the Bmal1/Clock heterodimer. This non-classical pathway may explain the inconsistent results of cancer chronochemotherapy based on the circadian pattern of key clock genes, including Bmal1 and Clock. Protein posttranslational modification is a critical process that determines protein function, localization, stability, and interaction with other molecules (Lin et al, 2021 ). In the present study, a significant circadian misalignment of Polb was observed at its transcriptional and translational levels. Hence, we speculated that such an uncoupling is potentially caused by protein posttranslational ubiquitination, which is orchestrated by the reciprocal synergy between food and clock signals. Taking advantages of proteomics and bioinformatics analyses, we identified that Calr is responsible for triggering Polb protein ubiquitination. Calr is a calcium-binding endoplasmic reticulum protein that plays multiple roles in the government of protein folding, and facilitation of their secretion and insertion in the plasma membrane, thus contributing to the maintenance of cellular homeostasis when unfolded proteins accumulate within the endoplasmic reticulum (Fucikova et al, 2021 ). Given that excessive unfolded protein accumulation disrupts the circadian oscillation in the mouse liver and inhibits fasting-induced gluconeogenesis, we hypothesized that Calr is potentially regulated by clock and nutritional signals. Indeed, the expression levels of hepatic Calr exhibited robust circadian rhythmicity and were actively responsive to fasting/refeeding cycles. Hence, Calr may serve as an integrator linking the peripheral clock and food signals to regulate Polb in a circadian-dependent manner. On the other hand, Calr exhibited an anti-phase expression pattern compared to that of Polb in healthy liver cells, contradictory to the facts that Calr actually is an oncogene during HCC progression and both Calr and Polb are consistently up-regulated in human HCC condition. Such a paradox can be explained by the different cellular location and functions of Calr in the normal and tumor settings. It has been revealed that cancer cells succumb to immunogenic cell death and then expose intracellular Calr to the surface of their cell membranes (Fucikova et al., 2021 ). This process facilitates the uptake of cell corpses by specialized phagocytes and ultimately triggers the onset of anti-cancer immunity (Fucikova et al., 2021 ). Such a translocation of Calr and its dissociation from Polb exhibit some degree of heterogeneity that is linked to cell type and initiating trigger, resulting in varying expression and functions of Calr in different types of normal and cancer settings. In conclusion, our study focused on the role of Polb in the regulating the circadian clock and HCC progression. Our findings shed some light on the mechanism by which Polb maintains circadian homeostasis, and triggers the HCC progression in a circadian-dependent manner via demethylation on the 5'UTR of Per1 . Because Polb is clinically upregulated in human HCC samples and positively correlated with patient poor prognosis, targeting Polb from a chronobiological perspective could be an attractive strategy for the precise intervention in HCC. Materials and Methods Animals All animal procedures in this investigation conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication No. 85 − 23, revised 1996) and the approved regulations set by the Laboratory Animal Care Committee at China Pharmaceutical University (Permit number SYXK-2021-0011). All mice were maintained in a 12 h light/dark cycle and in a temperature- and humidity-controlled environment. Zeitgeber time zero (ZT0) referred to lights on. To establish the circadian mouse model, as well as the starvation and re-feeding mouse model and time-restricted feeding mouse model, 8-week-old male mice in the C57BL6/J background were used, as previously reported (Chen et al., 2019 ). To investigate the role of Polb in HCC progression, we constructed HCC mouse models using Polb R137Q male mice and their wild-type (WT) littermate in the 129S1 background. We selected the Polb R137Q variant as it had only 30% primer extension activity compared to the WT enzyme, whereas global Polb knockout (KO) causes mouse embryonic death (Pan et al., 2016 ). These mice were generously provided by Professor Zhigang Guo’s lab (Nanjing Normal University, Nanjing, Jiangsu, China). To create the HCC mouse model, 14-day-old male male mice were given a single injection ( i.p. ) of 30 mg/kg diethylnitrosamine (DEN) at either ZT1 or ZT13. 6-week later, these mice received CCl 4 (0.5mL/kg) injection ( i.p. ) twice a week at either ZT1 or ZT13 (Chuang et al, 2000 ). To investigate the effect of Polb on xenograft tumor growth in vivo , POLB -deficient (POLB KO) HepG2 cells (5×10 6 cells per mouse) were injected subcutaneously into the right flanks of male BALB/C nude mice (GenePharmatech, Nanjing, Jiangsu, China). Tumor volumes (V = length × width × width/2) were measured every three days. RT-qPCR and Western blot analyses Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA), reverse transcribed, and analyzed by qPCR using SYBR Green (Vazyme, Nanjing, Jiangsu, China) and the LightCycler® 480 System (Roche, Basal, Switzerland). The primers for human β-ACTIN and mouse 36B4 were included for normalization when indicated. A complete list of PCR primers is shown in Table S11. For protein expression analysis, liver tissues were homogenized, and the cells were lysed in RIPA buffer. Equal amounts of protein were loaded and separated by 10% SDS-PAGE, then transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were incubated overnight with appropriate primary antibodies and bound antibodies were then visualized using HRP-conjugated secondary antibodies. A quantitative analysis was performed by using AlphaEaseFC software (AlphaInnotech, San Leando, CA, USA). The antibodies against Polb (Cat. No. ab26343; 1:1000 dilution) and Calr (Cat. No. ab2907; 1:1000 dilution) were purchased from Abcam (Cambridge, MA, USA). Antibodies against Xrcc1 (Cat. No. 21468-1-AP; 1:1000 dilution), Apex1 (Cat. No. 10203-1-AP; 1:1000 dilution), Fen1 (Cat. No. 14768-1-AP; 1:1000 dilution), and GAPDH (Cat. No. 60004-1-AP; 1:5000 dilution) were purchased from Proteintech (Chicago, IL, USA). Cell culture Mouse primary hepatocytes were isolated from mice by using the collagenase IV (Gibco, Grand Island, NY, USA) perfusion method as described previously and cultured in a humidified atmosphere containing 5% CO 2 at 37°C (Chen et al, 2014 ). Both POLB KO, PER1 KO HepG2 cells and POLB KO human Bmal1 :: Luc U2OS cells were established using a CRISPR/Cas9 system according to the standard protocol provided by Zhang’s lab (Konermann et al, 2015 ). Briefly, we designed the single guide RNA (sgRNA) using the online CRISPR design Tool ( http://crispr.mit.edu/ ) and cloned them into SpCas9-2A-puro vector (PX459). After confirming the cutting efficiency of the sgRNA, we transfected the SpCas9 vectors into cells. Puromycin-resistant cells were sorted and seeded onto 96-well plates for monoclonal colonization. After four weeks, cell clones derived from single cells were screened for gene expression by DNA sequencing. The following sgRNA sequences targeting human POLB and PER1 were used. sgRNA for POLB knockout were: GAGTCTAGAGGCGCATCTCAG; sgRNA for PER1 knockout were: GTGCTAACCTGTGAGCATGT. Rhythmicity of gene expression The rhythmicity of gene expression was assessed using the “meta2d” function in the “Metacycle” R package (Wu et al, 2016 ). “Metacycle” is designed to detect periodic signals and integrate the results from the ARSER, JKT-CYCLE, and Lomb-Scargle methods. In this study, genes were considered rhythmically expressed when the meta2d_pvalue was < 0.05. Wheel-running activity Ten-week-old mice were housed in standard mouse cages equipped with infrared sensors to detect locomotor activity. After being synchronized to a 12-h light/dark cycle for at least 7 days, the mice were transferred into light/dark for 15 days, followed by constant dark for another 15 days. Wheel revolutions were recorded in 6-min intervals by using ClockLab system (Actimetrics, Wilmette, IL, USA). The circadian period and phase shift in DD were determined using ClockLab analysis software (Actimetrics, Wilmette, IL, USA) (Xu et al, 2005 ; Xu et al, 2007 ). Real-time monitoring assay For the real-time monitoring assay, human Bmal1 :: Luc U2OS cells (a gift from Zhang Eric Erquan (Zhang et al, 2009 ), National Institute of Biological Sciences, Beijing, China) were plated onto 35-mm dishes (6 × 10 5 cells/dish) were cultured at 37℃ and 5% CO 2 -95% air in high-glucose DMEM supplemented with 10% FBS for 5 days, and then the culture medium was then changed into serum-free DMEM for an additional 24 h, followed by a 2-h dexamethasone shock. To achieve real-time circadian variation, the medium was replaced with recording medium and raw data were analyzed as previously described (Izumo et al, 2003 ). The period length and amplitude were calculated from the raw data derived from 24 to 120 h after synchronization using MATLAB software (9.0 Version R2016a, MathWorks Inc., MA, USA) (Chen et al., 2019 ). Dexamethasone shock To perform the dexamethasone shock, HepG2 cells were cultured with DMEM plus 100 nM dexamethasone for 2 h. Following this, the HepG2 cells were washed once with PBS and incubated with serum-free DMEM (Time point = 0 h). Cell samples were collected at 4-h intervals, and total RNA was extracted and processed for RT-qPCR analysis. High-throughput RNA sequencing Liver samples were collected to screen out candidate genes that mediate the role of Polb in regulating the liver clock and HCC. Total RNA was isolated from the liver samples for construction of RNA-seq libraries. The RNA libraries were sequenced using a HiSeq 3000 sequencing platform (Illumina Company, USA) by RiboBio (Guangzhou, Guang Dong, China). For additional statistics, Fragments Per Kilobase of transcript per Million mapped reads (FPKM) were calculated. All reads were mapped to the mouse genome (GRCm38/mm10). The DAVID tool was used for pathway enrichment and gene cluster analysis ( https://david.ncifcrf.gov/ ). Serological analysis Blood samples were collected in non-heparinized tubes and centrifuged at 4000 rpm for 10 min at 4°C. The serum levels of ALT and AST were determined spectrophotometrically using commercial kits (Jiancheng Institute of Biotechnology, Nanjing, Jiangsu, China). H&E and Sirius red staining Liver samples from both human and mouse HCC were isolated, fixed in 4% paraformaldehyde solution for 24 h in situ , processed for paraffin embedding, and cut into 4 µm transverse sections. H&E and Sirius red staining were performed on the sections. The slides were scanned using a Pannoramic Flash 250 scanner (Perkin Elmer, Waltham, MA, USA) and viewed using the Pannoramic viewer software program (3D Histech, Waltham, MA, USA). Proliferation assay To analyze cell proliferation, CCK-8 and EdU assays were performed. For the CCK-8 assay, cells were seeded in 96-well plates at a density of 5×10 3 cells per well. Subsequently, 10 µL CCK-8 reagent (Beyotime Biotechnology, Nantong, Jiangsu, China) was added to each well and incubated for 2 h. Cell proliferation was assessed by measuring the absorbance at 450 nm using a microplate reader. For EdU incorporation, HepG2 cells were seeded in 12-well plates at a density of 5×10 4 cells per well for the indicated times. Then, the cells were incubated with 10 µM EdU (RiboBio, Guangzhou, Guangdong, China) for 2 h. Afterward, the cells were fixed with 4% paraformaldehyde and were double stained with DAPI (Sigma-Aldrich, St. Louis, MO, USA). Signals were visualized using a fluorescence microscope, and the average ratios between EdU-positive (red) and total DAPI-stained nuclei (blue) were calculated for statistical analyses. Flow cytometry To analyze the cell cycle of HepG2 cells, the following steps were performed. The cells were fixed with 70% ethanol overnight, washed twice with PBS, and stained with 500 µL of propidium iodide (PI) (50 µg/mL PI in the sample buffer containing 0.1% Triton X-100, 0.1 mmol/L EDTA, and 100 µg/ml RNase A). After 1 h, the fluorescence of the PI-DNA complex in each nucleus was measured using a FACSCalibur instrument (Becton-Dickinson, Sunnyvale, CA, USA). The rates of the G 0 /G 1 , S, and G 2 /M phases of the cell cycle were determined using the Modfit LT software. CpG island analysis The CpG sites in the promoter (-2000bp ~ + 1bp) and 5'UTR of mouse Per1 were predicted by Ensembl ( http://www.ensembl.org/index.html ) and MethPrimer ( http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ). DNA methylation were detected by MedIP and BSP. For MedIP, 10 µg liver genomic DNA was sonicated and then heat denatured. 5% of the DNA was reserved as the input, while the remaining portion was divided equally. To each portion, 2 µg of IgG or 5-mC antibody was added and incubated at 4°C overnight. Protein G beads were added to capture the complexes, and the eluted DNA was subsequently used for PCR analysis. The primer sequences were presented in the Table S1 . For BSP analysis, 2 µg of genomic DNA was denatured using 0.3 M NaOH for 10 min at 37°C. After adding hydroquinone and sodium bisulfate, the samples were incubated at 50°C for 16 h. The modified DNA was then purified and amplified by PCR. The PCR products were further purified and cloned into the pTG19-T cloning vector (Generay, Shanghai, China). At least ten positive clones from each product were selected for sequencing. ChIP assay ChIP assays were performed in mouse livers essentially as described previously. Briefly, chromatin lysates were prepared, pre-cleared with Protein-A/G agarose beads, and immunoprecipitated with antibodies against Polb or normal mouse IgG (Cat. No. SC-2025, Santa Cruz, Dallas, TX, USA) in the presence of BSA and salmon sperm DNA. The beads were extensively washed before reverse cross-linking. The DNA was purified using a PCR purification kit (Qiagen, Valencia, CA, USA) and subsequently analyzed by PCR using primers flanking the 4th CpG island on the 5'UTR of Per1 . The primer sequences were the same to the primers used in MedIP analysis. Transfection and reporter gene assays The E-box binding sites that were proximal to the key CpG island on the 5'UTR of mouse Per1 were mutated and synthesized by Tsingke (Beijing, China). All transient transfections were conducted using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. For Calr knockdown, shRNA targeting mouse Calr were designed, validated, and synthesized by GenePharma (Shanghai, China). Detailed shRNA sequences were: 5'- GCAAGAATGTGCTGATCAATTCAAGAGATTGATCAGCACATTCTTGCTTTTTT-3' for Calr; 5'- GTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTT-3' for scramble. For the luciferase reporter assays, 200 ng of reporter plasmids were mixed with 500 ng of expression constructs for either Bmal1 or Polb. Equal amounts of DNA were used for all transfection combinations by adding the appropriate vector DNA. Relative luciferase activities were determined 48 h following transfection using the Luciferase System (Promega, Madison, WI, USA). The data were representative of at least four independent experiments. Clinical samples from public database/TCGA database analysis HCC samples (374 cases) and adjacent normal tissue samples (50 cases) were downloaded from the TCGA-Liver hepatocellular carcinoma (LIHC) database and Polb expression was assessed. To compare the percentage survival between different Polb expression groups, Kaplan-Meier survival curves were generated. Additionally, we also assessed the impact of Polb on survival using the public database KMplotter ( https://kmplot.com ). Human subjects and IHC analysis HCC tissue samples and the paired adjacent non-tumor tissues used in RT-qPCR and IHC analysis were surgically dissected from patients at First Affiliated Hospital of Nanjing Medical University. The study was approved by the Institutional Ethics Committee of the First Affiliated Hospital of Nanjing Medical University. Informed consent for tissue analysis was obtained before the liver biopsy or surgery. Co-IP analysis The liver tissues were homogenized, and the cells were lysed in the IP lysis buffer. After centrifugation, 40 µg of protein lysate was incubated with 20 µL of Protein-A/G agarose beads (Roche, Basal, Switzerland) and 1 µg of anti-Polb antibody. Following a 12-h incubation, the immune complexes were centrifuged and washed four times with ice-cold IP wash buffer. The immunoprecipitated protein was then analyzed by using a western blot assay. Label-free quantification and protein identification To identify the candidate gene that mediates the clock-dependent ubiquitination of hepatic Polb, we conducted label-free proteomics analysis using Co-IP samples (immunoprecipitated with the anti-Polb antibody) from the livers of mice sacrificed at ZT1 and ZT13. Detailed proteomics analysis was performed according to standard protein digestion and LC-MS/MS analyses by Shanghai Applied Protein Technology Co (Shanghai, China). The resulting MS raw data for each sample were consolidated and analyzed for identification and quantitation using the MaxQuant (Version 1.6.14) software. Protein half-life and ubiquitination analyses The half-life of Polb protein was determined using the cycloheximide (CHX) chase assay. Mouse primary hepatocytes (PHs) were transfected with the indicated plasmids. After 36 h, DMEM medium containing 10 µg/mL CHX (Sigma-Aldrich, St. Louis, MO, USA) were added. Cells were harvested at the specified time-points and subjected to western blot analysis. The ubiquitination of Polb protein was measured by a Co-IP assay. Mouse PHs were similarly transfected with indicated plasmids for 36 h, followed by the treatment with 10 µM MG132 (Sigma-Aldrich, St. Louis, MO, USA) for 6 h. Cells were lysed and lysates were precipitated with anti-Polb antibody and pre-cleared protein A/G PLUS-Agarose beads (Roche, Basal, Switzerland). Ubiquitinated proteins within the IP were detected by western blot using a monoclonal anti-ubiquitin antibody (Cat. No. sc-8017; 1:200 dilution, Santa Cruz, Dallas, TX, USA). Statistical analysis Statistical analysis was conducted using Graphpad (version 9.5, San Diego, CA, USA). The data were presented as mean ± SD (standard deviation) for each group. One-way or two-way ANOVA followed by Bonferroni’s posthoc test was used to analyze time series data. A P -value < 0.05 was considered statistically significant. When comparing only two groups, Student's t -test was used unless otherwise specified. Declarations Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (92057112), National Key R&D Program of China (2021YFF0702000, 2022YFA0807200), the Natural Science Foundation of Jiangsu Province (BK20220151), the Project of State Key Laboratory of Natural Medicines, China Pharmaceutical University (SKLNMZZ202214), the “Double First-Class” University Project (CPU2022QZ30), the Fundamental Research Funds for the Central Universities (2632022ZD08). The authors thank Professor Guo Zhigang for providing Polb R137Q mice and Zhang Eric Erquan for providing human Bmal1 :: Luc U2OS cells. Author contributions SYC, WXZ and CL designed the experiments and conceived the project. SYC, WXZ and XL performed the experiments and prepared the figures. XL provided the clinical samples. SYC, WXZ and CL wrote the manuscript, and was responsible for data compilation and integration. All authors have reviewed to the final version of the manuscript. Disclosure and competing interests statement The authors declare that they have no conflicts to disclose. Data availability The data that support this study are available within the article and its supplementary data files or available from the authors upon request. References Antoniali G, Malfatti MC, Tell G (2017) Unveiling the non-repair face of the Base Excision Repair pathway in RNA processing: A missing link between DNA repair and gene expression? DNA Repair (Amst) 56: 65-74 Asher G, Schibler U (2011) Crosstalk between components of circadian and metabolic cycles in mammals. Cell Metab 13: 125-137 Barakat KH, Gajewski MM, Tuszynski JA (2012) DNA polymerase beta (pol beta) inhibitors: a comprehensive overview. Drug Discov Today 17: 913-920 Barcena-Varela M, Caruso S, Llerena S, Alvarez-Sola G, Uriarte I, Latasa MU, Urtasun R, Rebouissou S, Alvarez L, Jimenez M et al (2019) Dual Targeting of Histone Methyltransferase G9a and DNA-Methyltransferase 1 for the Treatment of Experimental Hepatocellular Carcinoma. Hepatology 69: 587-603 Bass J, Takahashi JS (2010) Circadian integration of metabolism and energetics. Science 330: 1349-1354 Beltran M, Puig I, Pena C, Garcia JM, Alvarez AB, Pena R, Bonilla F, de Herreros AG (2008) A natural antisense transcript regulates Zeb2/Sip1 gene expression during Snail1-induced epithelial-mesenchymal transition. Genes Dev 22: 756-769 Bergoglio V, Pillaire MJ, Lacroix-Triki M, Raynaud-Messina B, Canitrot Y, Bieth A, Gares M, Wright M, Delsol G, Loeb LA et al (2002) Deregulated DNA polymerase beta induces chromosome instability and tumorigenesis. Cancer Res 62: 3511-3514 Chen J, Liu A, Lin Z, Wang B, Chai X, Chen S, Lu W, Zheng M, Cao T, Zhong M et al (2020) Downregulation of the circadian rhythm regulator HLF promotes multiple-organ distant metastases in non-small cell lung cancer through PPAR/NF-kappab signaling. Cancer Lett 482: 56-71 Chen S, Feng M, Zhang S, Dong Z, Wang Y, Zhang W, Liu C (2019) Angptl8 mediates food-driven resetting of hepatic circadian clock in mice. Nat Commun 10: 3518 Chen S, Zhang W, Tang C, Tang X, Liu L, Liu C (2014) Vanin-1 is a key activator for hepatic gluconeogenesis. Diabetes 63: 2073-2085 Chen ZX, Riggs AD (2011) DNA methylation and demethylation in mammals. J Biol Chem 286: 18347-18353 Chuang SE, Kuo ML, Hsu CH, Chen CR, Lin JK, Lai GM, Hsieh CY, Cheng AL (2000) Curcumin-containing diet inhibits diethylnitrosamine-induced murine hepatocarcinogenesis. Carcinogenesis 21: 331-335 Ciccia A, Elledge SJ (2010) The DNA damage response: making it safe to play with knives. Mol Cell 40: 179-204 Fan J, Wilson DM, 3rd (2005) Protein-protein interactions and posttranslational modifications in mammalian base excision repair. Free Radic Biol Med 38: 1121-1138 Fu L, Kettner NM (2013) The circadian clock in cancer development and therapy. Prog Mol Biol Transl Sci 119: 221-282 Fucikova J, Spisek R, Kroemer G, Galluzzi L (2021) Calreticulin and cancer. Cell Res 31: 5-16 Gaddameedhi S, Selby CP, Kaufmann WK, Smart RC, Sancar A (2011) Control of skin cancer by the circadian rhythm. Proc Natl Acad Sci U S A 108: 18790-18795 Ghaderi-Zefrehi H, Rezaei M, Sadeghi F, Heiat M (2021) Genetic polymorphisms in DNA repair genes and hepatocellular carcinoma risk. DNA Repair (Amst) 107: 103196 Guo Z, Zheng L, Dai H, Zhou M, Xu H, Shen B (2009) Human DNA polymerase beta polymorphism, Arg137Gln, impairs its polymerase activity and interaction with PCNA and the cellular base excision repair capacity. Nucleic Acids Res 37: 3431-3441 Hajkova P, Jeffries SJ, Lee C, Miller N, Jackson SP, Surani MA (2010) Genome-wide reprogramming in the mouse germ line entails the base excision repair pathway. Science 329: 78-82 Harmer SL, Panda S, Kay SA (2001) Molecular bases of circadian rhythms. Annu Rev Cell Dev Biol 17: 215-253 Hu L, Harper A, Heer E, McNeil J, Cao C, Park Y, Martell K, Gotto G, Shen-Tu G, Peters C et al (2020) Social Jetlag and Prostate Cancer Incidence in Alberta's Tomorrow Project: A Prospective Cohort Study. Cancers (Basel) 12 Iwatsuki M, Mimori K, Yokobori T, Tanaka F, Tahara K, Inoue H, Baba H, Mori M (2009) A platinum agent resistance gene, POLB, is a prognostic indicator in colorectal cancer. J Surg Oncol 100: 261-266 Izumo M, Johnson CH, Yamazaki S (2003) Circadian gene expression in mammalian fibroblasts revealed by real-time luminescence reporting: temperature compensation and damping. Proc Natl Acad Sci U S A 100: 16089-16094 Jackson SP, Bartek J (2009) The DNA-damage response in human biology and disease. Nature 461: 1071-1078 Kang TH (2021) Circadian Rhythm of NER and ATR Pathways. Biomolecules 11 Kaufman BA, Van Houten B (2017) POLB: A new role of DNA polymerase beta in mitochondrial base excision repair. DNA Repair (Amst) 60: A1-A5 Kettner NM, Voicu H, Finegold MJ, Coarfa C, Sreekumar A, Putluri N, Katchy CA, Lee C, Moore DD, Fu L (2016) Circadian Homeostasis of Liver Metabolism Suppresses Hepatocarcinogenesis. Cancer Cell 30: 909-924 Kim CH, Ardayfio P, Kim KS (2001) An E-box motif residing in the exon/intron 1 junction regulates both transcriptional activation and splicing of the human norepinephrine transporter gene. J Biol Chem 276: 24797-24805 Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H et al (2015) Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517: 583-588 Lim KH, Park ES, Kim DH, Cho KC, Kim KP, Park YK, Ahn SH, Park SH, Kim KH, Kim CW et al (2018) Suppression of interferon-mediated anti-HBV response by single CpG methylation in the 5'-UTR of TRIM22. Gut 67: 166-178 Lin J, Bao X, Li XD (2021) A tri-functional amino acid enables mapping of binding sites for posttranslational-modification-mediated protein-protein interactions. Mol Cell 81: 2669-2681 e2669 Marcheva B, Ramsey KM, Peek CB, Affinati A, Maury E, Bass J (2013) Circadian clocks and metabolism. Handb Exp Pharmacol : 127-155 Mullins EA, Rodriguez AA, Bradley NP, Eichman BF (2019) Emerging Roles of DNA Glycosylases and the Base Excision Repair Pathway. Trends Biochem Sci 44: 765-781 Pan F, Zhao J, Zhou T, Kuang Z, Dai H, Wu H, Sun H, Zhou X, Wu X, Hu Z et al (2016) Mutation of DNA Polymerase beta R137Q Results in Retarded Embryo Development Due to Impaired DNA Base Excision Repair in Mice. Sci Rep 6: 28614 Panda S (2016) Circadian physiology of metabolism. Science 354: 1008-1015 Parsons JL, Dianova, II, Allinson SL, Dianov GL (2005) DNA polymerase beta promotes recruitment of DNA ligase III alpha-XRCC1 to sites of base excision repair. Biochemistry 44: 10613-10619 Qu M, Zhang G, Qu H, Vu A, Wu R, Tsukamoto H, Jia Z, Huang W, Lenz HJ, Rich JN et al (2023) Circadian regulator BMAL1::CLOCK promotes cell proliferation in hepatocellular carcinoma by controlling apoptosis and cell cycle. Proc Natl Acad Sci U S A 120: e2214829120 Raggi C, Factor VM, Seo D, Holczbauer A, Gillen MC, Marquardt JU, Andersen JB, Durkin M, Thorgeirsson SS (2014) Epigenetic reprogramming modulates malignant properties of human liver cancer. Hepatology 59: 2251-2262 Ray S, Menezes MR, Senejani A, Sweasy JB (2013) Cellular roles of DNA polymerase beta. Yale J Biol Med 86: 463-469 Ripperger JA, Schibler U (2006) Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions. Nat Genet 38: 369-374 Sancar A, Lindsey-Boltz LA, Gaddameedhi S, Selby CP, Ye R, Chiou YY, Kemp MG, Hu J, Lee JH, Ozturk N (2015) Circadian clock, cancer, and chemotherapy. Biochemistry 54: 110-123 Satou R, Sugihara N, Ishizuka Y, Matsukubo T, Onishi Y (2013) DNA methylation of the BMAL1 promoter. Biochem Biophys Res Commun 440: 449-453 Shi Y, Liu L, Hamada T, Nowak JA, Giannakis M, Ma Y, Song M, Nevo D, Kosumi K, Gu M et al (2020) Night-Shift Work Duration and Risk of Colorectal Cancer According to IRS1 and IRS2 Expression. Cancer Epidemiol Biomarkers Prev 29: 133-140 Sun L, Zhang H, Gao P (2022) Metabolic reprogramming and epigenetic modifications on the path to cancer. Protein Cell 13: 877-919 Vasquez JL, Lai Y, Annamalai T, Jiang Z, Zhang M, Lei R, Zhang Z, Liu Y, Tse-Dinh YC, Agoulnik IU (2020) Inhibition of base excision repair by natamycin suppresses prostate cancer cell proliferation. Biochimie 168: 241-250 Wallace SS, Murphy DL, Sweasy JB (2012) Base excision repair and cancer. Cancer Lett 327: 73-89 Wang M, Long K, Li E, Li L, Li B, Ci S, He L, Pan F, Hu Z, Guo Z (2020) DNA polymerase beta modulates cancer progression via enhancing CDH13 expression by promoter demethylation. Oncogene 39: 5507-5519 Weber AR, Krawczyk C, Robertson AB, Kusnierczyk A, Vagbo CB, Schuermann D, Klungland A, Schar P (2016) Biochemical reconstitution of TET1-TDG-BER-dependent active DNA demethylation reveals a highly coordinated mechanism. Nat Commun 7: 10806 Wu G, Anafi RC, Hughes ME, Kornacker K, Hogenesch JB (2016) MetaCycle: an integrated R package to evaluate periodicity in large scale data. Bioinformatics 32: 3351-3353 Xu Y, Padiath QS, Shapiro RE, Jones CR, Wu SC, Saigoh N, Saigoh K, Ptacek LJ, Fu YH (2005) Functional consequences of a CKIdelta mutation causing familial advanced sleep phase syndrome. Nature 434: 640-644 Xu Y, Toh KL, Jones CR, Shin JY, Fu YH, Ptacek LJ (2007) Modeling of a human circadian mutation yields insights into clock regulation by PER2. Cell 128: 59-70 Xuan W, Khan F, James CD, Heimberger AB, Lesniak MS, Chen P (2021) Circadian regulation of cancer cell and tumor microenvironment crosstalk. Trends Cell Biol 31: 940-950 Zhang EE, Liu AC, Hirota T, Miraglia LJ, Welch G, Pongsawakul PY, Liu X, Atwood A, Huss JW, 3rd, Janes J et al (2009) A genome-wide RNAi screen for modifiers of the circadian clock in human cells. Cell 139: 199-210 Zhou T, Pan F, Cao Y, Han Y, Zhao J, Sun H, Zhou X, Wu X, He L, Hu Z et al (2016) R152C DNA Pol beta mutation impairs base excision repair and induces cellular transformation. Oncotarget 7: 6902-6915 Additional Declarations (Not answered) Supplementary Files SupplementalMaterials.docx Cite Share Download PDF Status: Published Journal Publication published 20 Jan, 2024 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 07 Nov, 2023 Review # 2 received at journal 17 Oct, 2023 Review # 1 received at journal 16 Oct, 2023 Reviewer # 2 agreed at journal 04 Oct, 2023 Reviewer # 1 agreed at journal 03 Oct, 2023 Reviewers invited by journal 02 Oct, 2023 Submission checks completed at journal 14 Sep, 2023 First submitted to journal 13 Sep, 2023 Unknown event 13 Sep, 2023 Editor assigned by journal 12 Sep, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3350322","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":237377976,"identity":"e217b642-3b89-4f71-a2bc-49f4056cec6a","order_by":0,"name":"Chang Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYDACCRBRIMHAD+EyE6vFQIJBsoFELUB0gFgt/LObnz38YmCRuPn42WMSDBXWiQ3sZw/gt+TOMXNjGQOJxG1n8tIkGM6kJzbw5CXg1WIgkWAmLQHScoPHTIKx7XBigwSPAQEt6d/AWjbPAGn5R5SWHDPJD0AtGyRAWhqI0CJxI6dMGqjReMaZvGSLhGPpxm08Ofi18M9I3yb5o6JOtr/97MEbH2qsZfvZz+DXAgLMPGAKSCYAKTaC6oGA8QdMyygYBaNgFIwCbAAAkxY9pcLu3lAAAAAASUVORK5CYII=","orcid":"","institution":"China Pharmaceutical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Chang","middleName":"","lastName":"Liu","suffix":""},{"id":237377977,"identity":"ef4bc42f-99d3-4f2e-ad14-8a460333a9d0","order_by":1,"name":"Siyu Chen","email":"","orcid":"","institution":"China Pharmaceutical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Siyu","middleName":"","lastName":"Chen","suffix":""},{"id":237377978,"identity":"49426f5c-ca2f-451e-a05d-6a82886a82fc","order_by":2,"name":"Wenxiang Zhang","email":"","orcid":"","institution":"China Pharmaceutical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Wenxiang","middleName":"","lastName":"Zhang","suffix":""},{"id":237377979,"identity":"38dae87d-2aac-4c29-8d8c-a8e08de45fe5","order_by":3,"name":"Xiao Li","email":"","orcid":"","institution":"First Affiliated Hospital with Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiao","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2023-09-13 03:20:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3350322/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3350322/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-024-06462-7","type":"published","date":"2024-01-20T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":44215026,"identity":"64d0e3e7-7929-4fe3-898a-77f71a1ecc18","added_by":"auto","created_at":"2023-10-06 21:17:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1175181,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHepatic Polb responses to peripheral clocks and food signals.\u003c/strong\u003e RT-qPCR (A) and Western blot (B) analyses of Polb\u003cem\u003e \u003c/em\u003eexpression in the liver of mice subjected to ZT. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01, peak \u003cem\u003evs.\u003c/em\u003e nadir, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. RT-qPCR (C) and Western blot (D) analyses of Polb\u003cem\u003e \u003c/em\u003eexpression in the liver of mice subjected to 16-h fasting or 16-h fasting, followed by 20-h refeeding. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003efasted 16 h group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. RT-qPCR (E) and Western blot (F) analyses of Polb\u003cem\u003e \u003c/em\u003eexpression in the liver of mice subjected to time-restricted feeding. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 NF12 \u003cem\u003evs.\u003c/em\u003e NF0, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 DF12 \u003cem\u003evs.\u003c/em\u003e DF0, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. NF, night feeding; DF, day feeding.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/7eb6a3837a08412f173393c7.jpg"},{"id":44215033,"identity":"d9740ba8-ee1b-435d-9b47-a82861c3872f","added_by":"auto","created_at":"2023-10-06 21:17:08","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3371721,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe dysfunction of Polb impairs hepatic circadian homeostasis\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e in vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vitro\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A)\u003cstrong\u003e \u003c/strong\u003eRepresentative actograms of wheel-running activities of WT and Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. (B) The calculation of mouse daily counts in Fig. 2A. (C) The calculation of mouse free-running period Fig. 2A. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. (D) RT-qPCR analyses of clock genes expression in the liver of WT and Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. (E) Representative luminescence traces of WT and POLB KO \u003cem\u003eBmal1\u003c/em\u003e::\u003cem\u003eLuc\u003c/em\u003e U2OS cells stimulated with dexamethasone for 2 h. The periods (F) and amplitudes (G) of circadian transcriptional activities of \u003cem\u003eBmal1 \u003c/em\u003epromoter in WT and POLB KO \u003cem\u003eBmal1\u003c/em\u003e::\u003cem\u003eLuc\u003c/em\u003e U2OS cells stimulated with dexamethasone for 2 h.\u003csup\u003e **\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs\u003c/em\u003e. WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. (H) RT-qPCR analyses of time-course expression of clock genes in WT and POLB KO HepG2 cells similarly treated in Fig. 2E. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=3. (I) Volcano plot showing differentially expressed genes in the liver of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. (J) GO analysis of biological pathways. n=3. All values are presented as the mean ± SD.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/ddde08fee295d82a54a3cc0b.jpg"},{"id":44215028,"identity":"06727da7-f6f7-44fd-ad1d-1c65764d7659","added_by":"auto","created_at":"2023-10-06 21:17:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4902454,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe dysfunction of Polb reduced HCC progression in a circadian manner \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e(A) A schematic diagram illustrating the HCC mouse model. Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice and WT littermates were subjected to DEN plus CCl\u003csub\u003e4\u003c/sub\u003e treatment at ZT1 and ZT13 respectively. (B) Liver images. (C) Tumor numbers. (D) Liver weight. (E) Serum ALT. (F) Serum AST.\u003csup\u003e *\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=7. All values are presented as the mean ± SD. (G) Representative images of H\u0026amp;E staining for liver sections. Scale bar = 500 μm (left), 100 μm (right). (H) Representative images of Sirius red staining for liver sections. Scale bar=200 μm. (I) Volcano plot showing differentially expressed genes in the liver tumor tissues of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice at ZT1. (J) GO analysis of biological pathways at ZT1. (K) Volcano plot showing differentially expressed genes in the liver tumor tissues of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice at ZT13. (L) GO analysis of biological pathways at ZT13. n=2. ZT: Zeitgeber time.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/abf04e5a359f1d3c9bd36f07.jpg"},{"id":44215032,"identity":"e80a12e1-6750-47a4-8e7b-98fd6b2f4fee","added_by":"auto","created_at":"2023-10-06 21:17:08","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3238943,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePolb activates \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePer1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mRNA expression by inducing epigenetic CpG demethylation. \u003c/strong\u003e(A) Heatmap of genes enriched in biological rhythm pathway from the liver of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e HCC (left) and non-tumor mice (right) at ZT13. Middle: Venn analysis and RT-qPCR validation for mRNA expression levels of five clustered genes. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e Vehicle WT group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e DEN+CCl\u003csub\u003e4\u003c/sub\u003e group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5~7. (B) Up: a schematic outline of the eight CpG islands in the promoter (-2000bp~+1bp) and 5'UTR of mouse \u003cem\u003ePer1\u003c/em\u003e. Down: MedIP analysis of methylation level of each CpG island in the liver of WT and Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.05 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5~7. (C) BSP analysis of the methylation level of 4\u003csup\u003eth\u003c/sup\u003e CpG island in the liver of WT and Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. (D) ChIP assays with indicated antibodies in in the liver of WT and Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. The enrichment of Polb was quantified by RT-qPCR analysis. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e WT group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5~7. (E) Reporter gene assays in mouse PHs transfected with indicated plasmids. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e the basal levels, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs.\u003c/em\u003e co-transfection of \u003cem\u003ePer1\u003c/em\u003e-luc and Bmal1 group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=4. POLB KO HepG2 cells were infected with adenoviruses encoding GFP (Ad-GFP) or Per1 (Ad-Per1) for 48 h. (F) CCK-8 assays were performed 24-h later after adenoviruses infected to detected cell proliferation. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003eWT+Ad-GFP group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003ePOLB KO+Ad-GFP group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=6. (G) EdU incorporation assay used to measure cell proliferation. (H) Quantification of the EdU incorporation assay presented in Fig. 4G. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003eWT+Ad-GFP group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003ePOLB KO +Ad-GFP group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=5. (I) Assessment of the cell cycle progression by flow cytometry. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt;0.01 \u003cem\u003evs. \u003c/em\u003eWT+Ad-GFP group, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 \u003cem\u003evs. \u003c/em\u003ePOLB KO+Ad-GFP group, one-way ANOVA followed by Bonferroni’s \u003cem\u003eposthoc\u003c/em\u003e test, n=3. All values are presented as the mean ± SD.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/d26847d490f0e8f264238619.jpg"},{"id":44215027,"identity":"edb80f88-d6d6-43f1-abe0-aac5857f951f","added_by":"auto","created_at":"2023-10-06 21:17:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4498031,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of Polb is increased in HCC specimens.\u0026nbsp;\u003c/strong\u003e(A) The expression of POLB in HCC tissues (n=372) and adjacent normal liver tissue (n=50) from Cancer Genome Atlas database.\u0026nbsp;\u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt;0.001\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;normal group,\u0026nbsp;one-way ANOVA followed by Bonferroni’s\u0026nbsp;\u003cem\u003eposthoc\u003c/em\u003e\u0026nbsp;test. (B) Kaplan-Meier overall survival curves for all 364 patients with HCC stratified by high and low expression of POLB. (C) Kaplane-Meier survival analysis of patients with HCC using KMplot (http://kmplot.com). (D) RT-qPCR analysis of\u0026nbsp;\u003cem\u003ePOLB\u003c/em\u003e\u0026nbsp;mRNA expression from HCC tumor and adjacent non-tumor tissues.\u0026nbsp;\u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u0026nbsp;\u003c/em\u003e\u0026lt;0.01\u0026nbsp;\u003cem\u003evs.\u003c/em\u003e\u0026nbsp;adjacent group,\u0026nbsp;one-way ANOVA followed by Bonferroni’s\u0026nbsp;\u003cem\u003eposthoc\u003c/em\u003e\u0026nbsp;test, n=21. (E) Representative H\u0026amp;E staining and IHC analysis of POLB expression in HCC tumor and adjacent non- tumor tissues.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/a43464773c1a9d9ee07eda01.jpg"},{"id":44215029,"identity":"b8cd2e62-2be4-4133-90bb-0a4a7b647d7c","added_by":"auto","created_at":"2023-10-06 21:17:08","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1562507,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePolb is post-translationally regulated by Calr. \u003c/strong\u003e(A) Heatmap of genes derived from label-free proteomics analyses. (B) A schematic model of the bioinformatics screening for Calr. (C) Co-IP assays in the liver lysates from ZT1 and ZT13 mice. Immunoblots of precipitated proteins were performed by using indicated antibodies. n=3. (D) Co-IP assays in mouse PHs. Immunoblots of precipitated proteins were performed by using indicated antibodies. n=3. (E) Western blot analyses of Polb and Calr expression in mouse PHs transfected with indicated amounts of plasmids encoding mouse Calr. n=3. (F) The Calr-induced degradation of Polb protein were assessed by CHX chase experiments. n=3. (G) Ubiquitination of Polb protein were detected by Western blot. All values are presented as the mean ± SD.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/70043279cdbdf629b51575af.jpg"},{"id":44216813,"identity":"c86cd365-1b79-424f-9bff-bcc964bd8ce1","added_by":"auto","created_at":"2023-10-06 21:25:08","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4634519,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA schematic model illustrating DNA Polb connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePer1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/92b510c469cc55f89aab4a11.jpg"},{"id":49925154,"identity":"04a6d5c0-568a-4f0f-bcc5-dc89f8a363c5","added_by":"auto","created_at":"2024-01-21 08:11:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1675900,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/cab33dbd-3458-4cd1-b3b5-2452ab29dd89.pdf"},{"id":44215034,"identity":"c1119aae-0657-4b92-887e-af46d042b473","added_by":"auto","created_at":"2023-10-06 21:17:08","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":9222094,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalMaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-3350322/v1/61704a11cfe76f256a5060bf.docx"}],"financialInterests":"(Not answered)","formattedTitle":"DNA polymerase beta connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of \u003ci\u003ePer1\u003c/i\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe genome is sensitive to a variety of endogenous and exogenous DNA-damaging agents that modify DNA bases and deoxyribose phosphate (dRP) groups, as well as directly break DNA backbone(Ciccia \u0026amp; Elledge, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). To repair these damages, organisms have evolved multiple DNA repair mechanisms, which are essential to preserve the integrity of genomic DNA(Ciccia \u0026amp; Elledge, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Malfunctions in DNA repair systems lead to a series of serious consequences, including heightened sensitivity to environmental changes, increased susceptibility to tumorigenesis, and accelerated ageing(Jackson \u0026amp; Bartek, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Of all the DNA repair pathways, base excision repair (BER) performs a crucial role in governing eukaryotic DNA stability in a location-dependent manner according to the type of damage. The BER process begins with the elimination of a damaged base by a DNA glycosylase, which results in an abasic or apurinic/apyrimidinic (AP) site(Mullins et al, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The AP site is then cleaved at its 5' side by AP endonuclease 1 (APEX1), generating a 3'-OH and a 5'-dRP(Antoniali et al, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This intermediate structure can be further processed through either the short patch BER (SP-BER) or the long patch BER (LP-BER) pathway(Antoniali et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In the SP-BER process, DNA polymerase beta (Polb) fills in the single-nucleotide gap and removes the dRP moiety with its dRP lyase activity, resulting in a ligatable nick that can be sealed by X-ray repair cross-complementing protein 1 (XRCC1)/ligase IIIα(Parsons et al, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In the LP-BER process, Polb, δ or ε incorporates 2\u0026ndash;15 nucleotides, displacing the strand containing the lesion. The generated DNA flap is then cleaved by flap endonuclease 1 (FEN1), and the nick is sealed by a DNA ligase(Fan \u0026amp; Wilson, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs a key factor, Polb is essentially required for all forms of BER. It is a 39kDa protein with both DNA polymerase and dRP lyase activities, which are responsible for the incorporation of new deoxybibonucleotides and the removal of the dRP group, respectively (Barakat et al, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Wallace et al, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In addition, Polb interacts with many partner proteins, such as APEX1, FEN1, and proliferating cell nuclear antigen (PCNA) (Ray et al, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). These interactions are important for the coordination of the BER process and ensure its efficiency and accuracy. Given the importance of Polb in the BER machinery, abnormalities in its expression and activity are closely correlated with tumorigenesis. For example, Polb was found to be overexpressed in approximately one-third of a diverse range of matched tumor samples (Wallace et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Aberrantly high levels of Polb could potentially destabilize other cellular processes and eventually lead to tumorigenesis or progression. On the other hand, Polb mutations with lower enzymatic activities have also been detected in most types of human cancers (Ray et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Such Polb variants may result in BER deficiencies and increase the risk of cancer development. In particular, three germline polymorphic variants of Polb with single amino acid substitution have been identified in the human population. These variants include R137Q, P242R and Q8R variants, all of which have been reported to be associated with cancer pathogenesis (Guo et al, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Among them, R137Q variant is of particular interest because the amino acid substitution of Arg by Gln leads to a net positive charge loss, potentially causing significant changes in the biochemical and physiological properties of the enzyme (Guo et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The Polb R137Q variant has been shown to exhibit decreased DNA synthesis activity and impaired interaction with PCNA, further leading to cellular hypersensitivity to DNA damaging agents (Guo et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In addition, R137Q knock-in mice have been found to exhibit retarded embryo development and a high mortality rate (Pan et al, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Although R137 is a key amino acid site for proper Polb function in maintaining genomic DNA stability and physiological homeostasis, the causal relationship between the Polb R137Q mutant and cancer development remains unknown.\u003c/p\u003e \u003cp\u003eOf note, the risk of DNA damage is not constant throughout the day. Factors such as UV light, which potentially triggering DNA damage, vary significantly depending on the light/dark cycles induced by the Earth\u0026rsquo;s autorotation, thus leading to the fluctuation in the risk of DNA damage (Sancar et al, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In fact, nearly all behavioral and physiological activities in organisms exhibit oscillations in response to diurnal changes of environmental light and food availability. This adaptation is controlled by the circadian clock system, which is based on interconnecting transcriptional-translational loops of clock genes/proteins that are ubiquitously expressed in cells (Harmer et al, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In the core loop of the circadian clock system, the transcriptional activators of circadian locomotor output cycles kaput (CLOCK) and brain and muscle ARNT-like 1 (BMAL1) form heterodimers and activate the expression of repressors encoded by three Period (Per1-3) and two Cryptochrome (Cry1/2) genes. As the day progresses, protein complexes consisting of Per and Cry translocate into the nucleus and inhibit CLOCK/BMAL1-mediated transcription. Because of their instability, the protein and mRNA levels of these repressors rapidly decrease below the threshold required for autorepression, allowing for a new cycle to begin (Asher \u0026amp; Schibler, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Panda, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ripperger \u0026amp; Schibler, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). A growing body of epidemiologic data suggests that circadian clock disruption predisposes humans to cancer. For instance, certain lifestyle choices and occupations that disrupt the day-night rhythm have been linked to a higher incidence of colorectal carcinoma, breast cancer, lung cancer, and prostate cancer in humans (Chen et al, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Hu et al, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Marcheva et al, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Shi et al, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Consistent with this, circadian dysfunction induces spontaneous hepatocarcinogenesis (Kettner et al, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Conversely, cancer development also disrupts the circadian clock. At the molecular level, the circadian clock regulates various genes involved in important steps during tumorigenesis, such as cell cycle re-entry, proliferation, invasion and metastasis (Xuan et al, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Collectively, the circadian clock and cancer pathogenesis are tightly integrated and are reciprocally regulated.\u003c/p\u003e \u003cp\u003eConsidering that perturbations in both the circadian rhythm and DNA repair are implicated in the development of hepatocellular carcinoma (HCC) (Ghaderi-Zefrehi et al, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Qu et al, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), while Polb serves as a crucial mediator of DNA synthesis and cellular susceptibility to DNA-damaging agents (Kaufman \u0026amp; Van Houten, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), we aimed to examine the involvement of Polb and the biological clock in the coordinated regulation of HCC pathophysiology. We found that Polb exhibited diurnal rhythmicity and was post-translationally regulated by Calreticulin (Calr) in a circadian manner. Hepatic Polb served as a critical component for maintaining circadian homeostasis and was clinically overexpressed in the HCC patients, driving cancer progression through demethylation of the 4th CpG island on the 5'UTR of clock gene \u003cem\u003ePer1\u003c/em\u003e. Our findings furnish key insights into the molecular mechanism that drives the synergistic effects of clock and food signals on the Polb-driven BER system, and uncover the novel clock-linked carcinogenic effects of Polb in the liver. Therefore, chronobiological modulation of Polb may present a promising avenue for the precise interventions targeting HCC.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eHepatic Polb responses to peripheral clocks and food signals\u003c/h2\u003e \u003cp\u003eGiven the liver is the largest metabolic organ with an active DNA damage/repair cycle during a day, we firstly examined the 24-h expression rhythmicity of Polb in the mouse liver. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, the mRNA expression of hepatic \u003cem\u003ePolb\u003c/em\u003e exhibited a diurnal oscillation pattern, which reached to its nadir at ZT1 and gradually increased to its peak at ZT21. In contrast, the oscillation pattern of Polb protein expression peaked at ZT13 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). As food intake is a crucial Zeitgeber for the entrainment of circadian clocks in peripheral tissues, we also examined hepatic Polb expression in response to food signals by using mice subjected to fasting/re-feeding cycles and time-restricted feeding. We found that the mRNA expression levels of \u003cem\u003ePolb\u003c/em\u003e were unaltered in these mice, whereas Polb protein expression was significantly decreased in the liver of refed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-D). Furthermore, the oscillation of Polb protein expression was reversed by restricted feeding, suggesting that this protein is controlled by both food and clock signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F). In addition, the expression of other core BER components, such as Fen1, Apex1 and Xrcc1, was insensitive to these signals and was kept stable in our settings (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA-C and Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe dysfunction of Polb impairs hepatic circadian homeostasis\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the potential role of Polb in maintaining the circadian homeostasis, we first examined the wheel-running activity of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C, the Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice were hyperactive accompanied with a slightly prolonged period under constant dark compared to the WT mice. In contrast, the food intake and body weight of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e and WT mice were similar (Figure S2A). At the molecular level, the circadian oscillation patterns of mRNA expression of core clock genes, including \u003cem\u003eBmal1\u003c/em\u003e, \u003cem\u003eCry1\u003c/em\u003e and \u003cem\u003ePer1\u003c/em\u003e, were dampened in the livers of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and Table S3). In detail, Meta2d analysis indicated that the amplitudes of \u003cem\u003eCry1\u003c/em\u003e and \u003cem\u003ePer1\u003c/em\u003e oscillation were decreased in these mutant mice (Table S4). As expected, the rhythmicity of these clock genes in the suprachiasmatic nucleus remained unaltered (Figure S2B and Table S3-4). To confirm the effects of Polb on clock homeostasis, we challenged human WT and POLB KO \u003cem\u003eBmal1\u003c/em\u003e::U2OS cells (the validation of POLB KO efficiency was presented in Figure S2C) with a dexamethasone shock, followed by real-time bioluminescence analysis. We found that Polb deficiency led to a significant prolonged period (24.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.54 h \u003cem\u003evs\u003c/em\u003e. 26.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 h, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001), while the amplitude of activity rhythms was slightly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE-G). To achieve a more physiological relevance, we repeated above experiments in HepG2 cells with POLB deficiency (POLB KO efficiency was presented in Figure S3A). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, dexamethasone shock induced a robust oscillation of all examined clock genes, including \u003cem\u003eBmal1\u003c/em\u003e, \u003cem\u003eCry1\u003c/em\u003e and \u003cem\u003ePer1\u003c/em\u003e. However, Polb deficiency disrupted the circadian patterns of these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH and Table S5). In detail, the circadian amplitudes of \u003cem\u003eBmal1\u003c/em\u003e and \u003cem\u003eCry1\u003c/em\u003e were increased, whereas \u003cem\u003ePer1\u003c/em\u003e was decreased (Table S6).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo globally identify downstream molecular events in Polb-orchestrated transcriptional network, we performed the transcriptome analysis and found that mRNA expression levels of total 101 genes were altered in the livers of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). Notably, these genes were mostly enriched into the circadian clock-associated pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ).\u003c/p\u003e \u003cp\u003e \u003cb\u003eDysfunction of Polb reduces HCC progression in a circadian manner\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSince both Polb-driven BER process and circadian clock are extensively involved in cancer development, we next evaluated the impacts of Polb on HCC progression from a chronobiological view. To induce HCC, Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice and WT littermates were subjected to DEN plus CCl\u003csub\u003e4\u003c/sub\u003e treatment at ZT1 and ZT13, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-C, the number of liver tumors was reduced in Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice compared to WT mice. Consistently, the liver weight and the serum alanine aminotransferase (ALT)/aspartate transaminase (AST) levels were significantly decreased in mutant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-F and Table S7). Histologically, H\u0026amp;E staining analysis showed that the tumors in the WT group were composed of densely packed cells, whereas the Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e group showed reduced tumor cell density and blurred cell borders (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Sirius red analysis indicated a marked alleviation in hepatic portal fibrosis in Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Notably, the retardation of HCC progression by Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mutation was more apparent when the carcinogen was injected at ZT13. For instance, the liver weight was decreased by 21.54% in Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice at ZT1, while it was decreased to 54.87% at ZT13. Similarly, the reduction percentage of serological AST levels was 53.26% at ZT13 compared to 29.82% at ZT1. To identify downstream molecular events globally, high-throughput RNA-seq analysis was performed in these HCC samples. Volcano analysis indicated that mRNA expression levels of total 802 genes were altered in the liver tumor samples of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice at ZT1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI). GO enrichment analysis revealed that these genes were clustered into the lipid metabolism pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ). Meanwhile, a cluster of 1485 genes was significantly changed at ZT13 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK). Importantly, the biological rhythmic pathway was also enriched in the liver of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice carrying HCC at ZT13 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eL). It is worthwhile to point out that Polb is a DNA polymerase functionally located in the nucleus, we thus analyzed the cellular location of these downstream genes and found that only clock-associated genes were mostly enriched in the nucleus (Table S8), suggesting the modulation of circadian clock is a critical pathophysiological output of Polb, therefore the Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mutant alleviated HCC progression in a circadian-dependent manner, especially at ZT13.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm the roles of Polb in tumorigenesis \u003cem\u003ein vitro\u003c/em\u003e, we evaluated cell behaviors in both POLB KO and WT HepG2 cells. As shown in Figure S3B, Polb deficiency significantly decreased the cell proliferation rate. These results were confirmed by using an EdU incorporation assay (Figure S3C, D). As is known, cell proliferation is tightly related to the cell cycle re-entry. Coincided with above findings, Polb deficiency arrested more cells at the G0-G1 phase and blocked the S phase entry (Figure S3E). Moreover, a subcutaneous xenograft tumor model established by POLB KO HepG2 cells exhibited reduced tumor volumes and weights (Figure S3F-H). Therefore, Polb is a \u003cem\u003ebona fide\u003c/em\u003e oncogene involved in the pathogenesis of liver cancer.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePolb activates\u003c/b\u003e \u003cb\u003ePer1\u003c/b\u003e \u003cb\u003emRNA expression by inducing epigenetic CpG demethylation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSince Polb is rhythmically expressed in the liver and it is reciprocally required for clock homeostasis, we performed venn analysis to investigate downstream circadian effectors. Seven genes were identified to be consistently regulated in the liver of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e HCC and non-tumor mice. An independent RT-qPCR analysis confirmed the mRNA expression patterns of \u003cem\u003eBmal1\u003c/em\u003e, \u003cem\u003eCry1\u003c/em\u003e and \u003cem\u003ePer1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). It should be noted that Polb is involved in the DNA demethylation process to activate genetic transcription(Wang et al, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), therefore we hypothesize that Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mutant may reasonably repress downstream gene expression. Given that \u003cem\u003ePer1\u003c/em\u003e was the only downregulated gene, it may serve as the authentic target in the Polb-driven cascade flux. In this sense, we analyzed the CpG islands on the proximal promoter and 5'UTR, which were closed to the transcriptional start site of \u003cem\u003ePer1.\u003c/em\u003e As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, eight CpG islands were predicted by Ensembl and MethPrimer. MedIP analysis revealed that the 4th CpG island presented on the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e was hypermethylated in the liver tissues of Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mice at ZT13 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Such a hypermethylation was further confirmed by bisulfite sequencing PCR (BSP) analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Coincidence with these results, ChIP assays indicated that Polb was located near the 4th CpG island on the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e, while Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e significantly reduced such recruitment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition to the epigenetic modification of CpG islands, it has been documented that an E-box motif residing in the 5'UTR also regulates the gene transcriptional activity(Kim et al, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). We found that three E-box motifs were present in this region (-79\u0026thinsp;~\u0026thinsp;+\u0026thinsp;983 bp). To clarify Polb\u0026rsquo;s demethylation function, we constructed a \u003cem\u003ePer1\u003c/em\u003e luciferase reporter containing both the 4th CpG island and the mutated E-box motifs. Reporter gene assays demonstrated that as expected, Bmal1 robustly activated \u003cem\u003ePer1\u003c/em\u003e transcription. Similarly, overexpression of Polb also promoted \u003cem\u003ePer1\u003c/em\u003e transcription even when the E-boxes were mutated, suggesting an E-box independent regulation in \u003cem\u003ePer1\u003c/em\u003e gene transcription by Polb (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eTo dissect the role of Per1 in mediating Polb\u0026rsquo;s function, we recapitulated Per1 expression in POLB KO HepG2 cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-H, overexpression of Per1 partially relieved the inhibition of cell proliferation triggered by Polb deficiency. Similar results were observed in cell cycle analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). All these findings suggest that Polb/Per1 axis positively contributes to the HCC progression. To further confirm this hypothesis, we knocked out PER1 in HepG2 cells (PER1 KO efficiency was presented in Figure S4A) and found that Per1 deficiency led to a reduced cell proliferation rate (Figure S4B-D). \u003cem\u003eIn vivo\u003c/em\u003e xenograft tumor assays revealed that PER1 KO reduced tumor volumes and weights in HCC-bearing mice (Figure S4E-G).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eThe expression of POLB is increased in HCC specimens\u003c/h2\u003e \u003cp\u003eThe TCGA analysis revealed that mRNA expression levels of \u003cem\u003ePOLB\u003c/em\u003e were increased in liver hepatocellular carcinoma (LIHC) samples (374 cases) compared to their adjacent normal tissue samples (50 cases) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Although low expression levels of \u003cem\u003ePOLB\u003c/em\u003e did not affected the overall survival of HCC patients, they were positively correlated with disease-free survival, as evidenced using the public database KM plotter (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). To validate the database results, we examined \u003cem\u003ePOLB\u003c/em\u003e mRNA expression in a cohort of 21 paired HCC and matched adjacent normal tissue samples. Patients\u0026rsquo; detailed clinical and pathological information were presented in Table S9. Our results revealed that the mRNA and protein expression of POLB was significantly increased in HCC tissues compared to their adjacent normal controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePolb is post-translationally regulated by Calr\u003c/h2\u003e \u003cp\u003eAlthough the Polb/Per1 axis has been successfully established and its function in HCC progression has been clarified in the above studies, how the rhythmicity of Polb is achieved remains unknown. To answer this question, we performed Co-immunoprecipitation (Co-IP, IP: anti-Polb) and label-free proteomics analyses by using mouse liver samples obtained at ZT1 and ZT13. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, a total of 50 genes was changed according to the circadian time. We next clustered them with our previous RNA-seq database (GSE133342), which is a collection of hepatic gene profiles in response to the constant darkness and fasting/refeeding cycles (Chen et al, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Using Metacycle analysis, we identified four genes (Got1, Rpl23a, Rack1 and Calr) as potential candidates with a robust rhythmic expression pattern (Table S10). Among which, only Got1 and Calr were found to be responsive to the refeeding signals (Table S2). Reactome analysis (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://reactome.org\u003c/span\u003e\u003cspan address=\"https://reactome.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) further narrowed down these two factors and indicated that only Calr was involved in the post-translational protein modification pathway. In addition, we found that the mRNA and protein expression levels of hepatic Calr exhibited robust diurnal fluctuations, and that Calr was sensitive to both fasting/refeeding and time-restricted feeding signals and exhibited opposite expression patterns compared to the Polb protein (Figure S5A-C). Therefore, we selected Calr as the target mediator of the synergy between food and peripheral clock signals on the Polb protein expression. To confirm this, we performed an independent Co-IP analysis, which showed that Calr abundantly bound with Polb in the mouse liver and PHs. Note that their binding was decreased at ZT13, when compared to ZT1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-D and Figure S5D, E). Moreover, overexpression of Calr in mouse PHs led to a dose-dependent decrease in the Polb protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE and Figure S5F). To further investigate the mechanism by which Calr regulates Polb protein levels, we performed a cycloheximide (CHX) chase experiment, which showed that overexpression of Calr accelerated the protein degradation of Polb, while knockdown of Calr using shRNA blocked such a degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Accordingly, the ubiquitination of Polb was found to be dramatically increased in mouse primary hepatocytes (PHs) transfected with Calr-expressing plasmids (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn conclusion, Calr is finely orchestrated by both food and peripheral clock signals, and consequently triggers protein ubiquitination of Polb, culminating in the circadian fluctuation of Polb protein.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe circadian clock is implicated in various cellular functions, including DNA repair, through a transcription-translation feedback loop. A decade ago, researchers already found that the expression levels of XPA, one of the key components in the nucleotide excision repair system, exhibited robust diurnal oscillation, providing the first piece of evidence that DNA repair is controlled by the circadian clock (Kang, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the circadian oscillation of BER is still unclear. In our present study, we analyzed the expression pattern of core components in the BER system throughout a day, and found that while the expression levels of Xrcc1, Fen1 and Apex1 were roughly stable, Polb possessed a precise circadian expression pattern and was responsive to food signals, especially at its protein level. Moreover, the pathophysiological activities of both Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e mutant mice and POLB KO HepG2 cells exhibited a dampened circadian pattern, and more importantly, Polb dysfunction retarded HCC progression in a circadian-dependent manner. Coincided with these findings, Polb expression was upregulated in human HCC samples and was positively correlated with poor prognosis. At the molecular level, Polb demethylated the 4th CpG island on the 5'UTR of core clock gene \u003cem\u003ePer1\u003c/em\u003e and activated its transcription, leading to enhanced tumorigenicity. Besides, considering the nadir and peak times of hepatic Polb protein expression at ZT1 and ZT13, we later performed proteomics and bioinformatics clustering analysis with our previous database and screened out Calr as an important regulator that triggered Polb protein ubiquitination in response to both clock and food signals. Hence, our findings provide important insights into the molecular mechanism underlying the synergy between clock and food signals on the Polb-driven BER system and new clock-dependent carcinogenetic effects of Polb (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Chronobiological modulation of Polb may help to promote precise interventions for HCC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEpidemiologic studies indicate that circadian dysfunction among night-shift workers and individuals suffering from sleep dyspnea is a significant risk factor for the development of cancers, including HCC (Bass \u0026amp; Takahashi, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Fu \u0026amp; Kettner, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Kettner et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Consistently, chronic circadian misalignment is sufficient to induce spontaneous hepatocarcinogenesis in mice (Kettner et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Furthermore, mice exposed to the UV carcinogen at 4:00 a.m. exhibit a decreased latency and an approximately 5-fold increased multiplicity of skin cancer compared to mice exposed to UV at 4:00 p.m. (Gaddameedhi et al, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). All these phenomena indicates that the circadian clock plays a vital role in carcinogenesis. However, studies are lacking to identify direct molecule targets that relay the clock signals to tumorigenicity. To filling in this missing piece of the puzzle, we established a mouse HCC model by injection of DEN and CCl\u003csub\u003e4\u003c/sub\u003e according to the peak and nadir time points of Polb protein expression, and revealed a time-dependent on the chemical-induced hepatocarcinogenesis at ZT1 and ZT13. In particular, HCC mice established by chemical injection at ZT13 exhibited more severe tumorigenesis phenotypes, when compared to HCC mice established at ZT1. More importantly, Polb dysfunction with R137Q mutant significantly alleviated the HCC progression, and its anti-tumor effects were more profound at ZT13, indicating the circadian clock is potentially involved in relaying the oncogenic signal of Polb. Indeed, the transcriptome data from the liver of normal and tumor-baring mice were clustered, and the circadian rhythm was identified as the most responsive pathway to Polb signals. These results implied that disrupted clocks contributed to the circadian discrepancy of anti-tumor properties observed in the Polb-deficiency background on HCC progression. Currently, the roles of Polb in the tumorigenesis are still in debate. On one hand, the expression levels of Polb have been found to be elevated in certain tumors, including lung cancer, breast cancer, and colon cancer (Iwatsuki et al, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). On the other hand, Polb variants with low catalytic activity are also linked to an increased risk of cellular transformation and cancer susceptibility (Bergoglio et al, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Guo et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Zhou \u003cem\u003eet al\u003c/em\u003e, 2016). Overexpression of Polb decreases the metastasis and invasion of lung and breast cancers (Wang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Of note, Polb is a core component in BER system, and inhibition of BER pathway has been proven to decrease the prostate cancer cell proliferation and is a potential therapeutic strategy for prostate cancer treatment (Vasquez et al, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Consistently, we found that genetic mutation of Polb (reduced enzymatic activity) reduced the liver tumorigenesis, and \u003cem\u003ein vitro\u003c/em\u003e studies further confirmed the anti-tumor properties of Polb dysfunction. Therefore, at least in our study, Polb\u0026rsquo;s role in HCC progression is positive and it serves as a promising integrator linking the circadian clock signals to liver cancer development.\u003c/p\u003e \u003cp\u003eAccumulating evidence have demonstrated that epigenetic modification, such as DNA methylation, play an important role in cancer progression (Barcena-Varela et al, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Sun et al, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Moreover, DNA methylation on the promoter of core circadian genes controls their mRNA expression levels, thus maintaining the circadian clock homeostasis (Satou et al, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Inhibition of DNA methylation can modify chromatin structure and affect gene expression, influencing cell fate decision (Raggi et al, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Notably, the BER system is essential for the AP-site repair generated by TDG, potentially involving in the TET1-TDG-BER-mediated DNA demethylation (Chen \u0026amp; Riggs, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Active global DNA demethylation was \u003cem\u003ede facto\u003c/em\u003e found to be associated with the activity of BER, while BER proteins participate in the process of DNA demethylation (Hajkova et al, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Weber et al, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Polb, as a core component of BER system, has been shown to exert demethylation abilities closely associated with lung and breast cancer metastasis (Wang et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In addition to the classic DNA methylation region existed on the gene promoter, the 5'UTR is another important region for DNA methylation modification (Beltran et al, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Lim et al, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Our results revealed that Polb demethylates the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e, further activating its mRNA expression. Functionally, overexpression of Per1 partially abolished the Polb deficiency-induced cell proliferation and G0/G1 phase cell cycle arrest of HepG2. Since the amount of endogenous Polb protein was rhythmically enriched, the demethylation function of Polb was different at each time point, producing a time discrepancy of chemical-induced HCC progression. For instance, when the hepatic Polb protein level reached its peak time at ZT13, the abundant Polb executed its demethylation function on the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e, further aggravating HCC progression. More importantly, such a demethylation-triggered \u003cem\u003ePer1\u003c/em\u003e transcription was persistent even when the E-box were mutated, indicating that Polb-mediated 5'UTR demethylation is a non-classical pathway that activates \u003cem\u003ePer1\u003c/em\u003e transcription independent of the Bmal1/Clock heterodimer. This non-classical pathway may explain the inconsistent results of cancer chronochemotherapy based on the circadian pattern of key clock genes, including Bmal1 and Clock.\u003c/p\u003e \u003cp\u003eProtein posttranslational modification is a critical process that determines protein function, localization, stability, and interaction with other molecules (Lin et al, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the present study, a significant circadian misalignment of Polb was observed at its transcriptional and translational levels. Hence, we speculated that such an uncoupling is potentially caused by protein posttranslational ubiquitination, which is orchestrated by the reciprocal synergy between food and clock signals. Taking advantages of proteomics and bioinformatics analyses, we identified that Calr is responsible for triggering Polb protein ubiquitination. Calr is a calcium-binding endoplasmic reticulum protein that plays multiple roles in the government of protein folding, and facilitation of their secretion and insertion in the plasma membrane, thus contributing to the maintenance of cellular homeostasis when unfolded proteins accumulate within the endoplasmic reticulum (Fucikova et al, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Given that excessive unfolded protein accumulation disrupts the circadian oscillation in the mouse liver and inhibits fasting-induced gluconeogenesis, we hypothesized that Calr is potentially regulated by clock and nutritional signals. Indeed, the expression levels of hepatic Calr exhibited robust circadian rhythmicity and were actively responsive to fasting/refeeding cycles. Hence, Calr may serve as an integrator linking the peripheral clock and food signals to regulate Polb in a circadian-dependent manner. On the other hand, Calr exhibited an anti-phase expression pattern compared to that of Polb in healthy liver cells, contradictory to the facts that Calr actually is an oncogene during HCC progression and both Calr and Polb are consistently up-regulated in human HCC condition. Such a paradox can be explained by the different cellular location and functions of Calr in the normal and tumor settings. It has been revealed that cancer cells succumb to immunogenic cell death and then expose intracellular Calr to the surface of their cell membranes (Fucikova et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This process facilitates the uptake of cell corpses by specialized phagocytes and ultimately triggers the onset of anti-cancer immunity (Fucikova et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Such a translocation of Calr and its dissociation from Polb exhibit some degree of heterogeneity that is linked to cell type and initiating trigger, resulting in varying expression and functions of Calr in different types of normal and cancer settings.\u003c/p\u003e \u003cp\u003eIn conclusion, our study focused on the role of Polb in the regulating the circadian clock and HCC progression. Our findings shed some light on the mechanism by which Polb maintains circadian homeostasis, and triggers the HCC progression in a circadian-dependent manner via demethylation on the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e. Because Polb is clinically upregulated in human HCC samples and positively correlated with patient poor prognosis, targeting Polb from a chronobiological perspective could be an attractive strategy for the precise intervention in HCC.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e All animal procedures in this investigation conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication No. 85\u0026thinsp;\u0026minus;\u0026thinsp;23, revised 1996) and the approved regulations set by the Laboratory Animal Care Committee at China Pharmaceutical University (Permit number SYXK-2021-0011). All mice were maintained in a 12 h light/dark cycle and in a temperature- and humidity-controlled environment. Zeitgeber time zero (ZT0) referred to lights on. To establish the circadian mouse model, as well as the starvation and re-feeding mouse model and time-restricted feeding mouse model, 8-week-old male mice in the C57BL6/J background were used, as previously reported (Chen et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). To investigate the role of Polb in HCC progression, we constructed HCC mouse models using Polb R137Q male mice and their wild-type (WT) littermate in the 129S1 background. We selected the Polb\u003csup\u003e\u003cem\u003eR137Q\u003c/em\u003e\u003c/sup\u003e variant as it had only 30% primer extension activity compared to the WT enzyme, whereas global Polb knockout (KO) causes mouse embryonic death (Pan et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These mice were generously provided by Professor Zhigang Guo\u0026rsquo;s lab (Nanjing Normal University, Nanjing, Jiangsu, China). To create the HCC mouse model, 14-day-old male male mice were given a single injection (\u003cem\u003ei.p.\u003c/em\u003e) of 30 mg/kg diethylnitrosamine (DEN) at either ZT1 or ZT13. 6-week later, these mice received CCl\u003csub\u003e4\u003c/sub\u003e (0.5mL/kg) injection (\u003cem\u003ei.p.\u003c/em\u003e) twice a week at either ZT1 or ZT13 (Chuang et al, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). To investigate the effect of Polb on xenograft tumor growth \u003cem\u003ein vivo\u003c/em\u003e, \u003cem\u003ePOLB\u003c/em\u003e-deficient (POLB KO) HepG2 cells (5\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells per mouse) were injected subcutaneously into the right flanks of male BALB/C nude mice (GenePharmatech, Nanjing, Jiangsu, China). Tumor volumes (V\u0026thinsp;=\u0026thinsp;length \u0026times; width \u0026times; width/2) were measured every three days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR and Western blot analyses\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA), reverse transcribed, and analyzed by qPCR using SYBR Green (Vazyme, Nanjing, Jiangsu, China) and the LightCycler\u0026reg; 480 System (Roche, Basal, Switzerland). The primers for human β-ACTIN and mouse 36B4 were included for normalization when indicated. A complete list of PCR primers is shown in Table S11. For protein expression analysis, liver tissues were homogenized, and the cells were lysed in RIPA buffer. Equal amounts of protein were loaded and separated by 10% SDS-PAGE, then transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were incubated overnight with appropriate primary antibodies and bound antibodies were then visualized using HRP-conjugated secondary antibodies. A quantitative analysis was performed by using AlphaEaseFC software (AlphaInnotech, San Leando, CA, USA). The antibodies against Polb (Cat. No. ab26343; 1:1000 dilution) and Calr (Cat. No. ab2907; 1:1000 dilution) were purchased from Abcam (Cambridge, MA, USA). Antibodies against Xrcc1 (Cat. No. 21468-1-AP; 1:1000 dilution), Apex1 (Cat. No. 10203-1-AP; 1:1000 dilution), Fen1 (Cat. No. 14768-1-AP; 1:1000 dilution), and GAPDH (Cat. No. 60004-1-AP; 1:5000 dilution) were purchased from Proteintech (Chicago, IL, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eMouse primary hepatocytes were isolated from mice by using the collagenase IV (Gibco, Grand Island, NY, USA) perfusion method as described previously and cultured in a humidified atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C (Chen et al, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Both POLB KO, PER1 KO HepG2 cells and POLB KO human \u003cem\u003eBmal1\u003c/em\u003e::\u003cem\u003eLuc\u003c/em\u003e U2OS cells were established using a CRISPR/Cas9 system according to the standard protocol provided by Zhang\u0026rsquo;s lab (Konermann et al, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Briefly, we designed the single guide RNA (sgRNA) using the online CRISPR design Tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://crispr.mit.edu/\u003c/span\u003e\u003cspan address=\"http://crispr.mit.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and cloned them into SpCas9-2A-puro vector (PX459). After confirming the cutting efficiency of the sgRNA, we transfected the SpCas9 vectors into cells. Puromycin-resistant cells were sorted and seeded onto 96-well plates for monoclonal colonization. After four weeks, cell clones derived from single cells were screened for gene expression by DNA sequencing. The following sgRNA sequences targeting human \u003cem\u003ePOLB\u003c/em\u003e and \u003cem\u003ePER1\u003c/em\u003e were used. sgRNA for \u003cem\u003ePOLB\u003c/em\u003e knockout were: GAGTCTAGAGGCGCATCTCAG; sgRNA for \u003cem\u003ePER1\u003c/em\u003e knockout were: GTGCTAACCTGTGAGCATGT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRhythmicity of gene expression\u003c/h2\u003e \u003cp\u003eThe rhythmicity of gene expression was assessed using the \u0026ldquo;meta2d\u0026rdquo; function in the \u0026ldquo;Metacycle\u0026rdquo; R package (Wu et al, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). \u0026ldquo;Metacycle\u0026rdquo; is designed to detect periodic signals and integrate the results from the ARSER, JKT-CYCLE, and Lomb-Scargle methods. In this study, genes were considered rhythmically expressed when the meta2d_pvalue was \u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWheel-running activity\u003c/h2\u003e \u003cp\u003eTen-week-old mice were housed in standard mouse cages equipped with infrared sensors to detect locomotor activity. After being synchronized to a 12-h light/dark cycle for at least 7 days, the mice were transferred into light/dark for 15 days, followed by constant dark for another 15 days. Wheel revolutions were recorded in 6-min intervals by using ClockLab system (Actimetrics, Wilmette, IL, USA). The circadian period and phase shift in DD were determined using ClockLab analysis software (Actimetrics, Wilmette, IL, USA) (Xu et al, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Xu et al, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2007\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eReal-time monitoring assay\u003c/h2\u003e \u003cp\u003eFor the real-time monitoring assay, human \u003cem\u003eBmal1\u003c/em\u003e::\u003cem\u003eLuc\u003c/em\u003e U2OS cells (a gift from Zhang Eric Erquan (Zhang et al, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), National Institute of Biological Sciences, Beijing, China) were plated onto 35-mm dishes (6 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/dish) were cultured at 37℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e -95% air in high-glucose DMEM supplemented with 10% FBS for 5 days, and then the culture medium was then changed into serum-free DMEM for an additional 24 h, followed by a 2-h dexamethasone shock. To achieve real-time circadian variation, the medium was replaced with recording medium and raw data were analyzed as previously described (Izumo et al, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). The period length and amplitude were calculated from the raw data derived from 24 to 120 h after synchronization using MATLAB software (9.0 Version R2016a, MathWorks Inc., MA, USA) (Chen et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDexamethasone shock\u003c/h2\u003e \u003cp\u003eTo perform the dexamethasone shock, HepG2 cells were cultured with DMEM plus 100 nM dexamethasone for 2 h. Following this, the HepG2 cells were washed once with PBS and incubated with serum-free DMEM (Time point\u0026thinsp;=\u0026thinsp;0 h). Cell samples were collected at 4-h intervals, and total RNA was extracted and processed for RT-qPCR analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHigh-throughput RNA sequencing\u003c/h2\u003e \u003cp\u003eLiver samples were collected to screen out candidate genes that mediate the role of Polb in regulating the liver clock and HCC. Total RNA was isolated from the liver samples for construction of RNA-seq libraries. The RNA libraries were sequenced using a HiSeq 3000 sequencing platform (Illumina Company, USA) by RiboBio (Guangzhou, Guang Dong, China). For additional statistics, Fragments Per Kilobase of transcript per Million mapped reads (FPKM) were calculated. All reads were mapped to the mouse genome (GRCm38/mm10). The DAVID tool was used for pathway enrichment and gene cluster analysis (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://david.ncifcrf.gov/\u003c/span\u003e\u003cspan address=\"https://david.ncifcrf.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSerological analysis\u003c/h2\u003e \u003cp\u003eBlood samples were collected in non-heparinized tubes and centrifuged at 4000 rpm for 10 min at 4\u0026deg;C. The serum levels of ALT and AST were determined spectrophotometrically using commercial kits (Jiancheng Institute of Biotechnology, Nanjing, Jiangsu, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eH\u0026amp;E and Sirius red staining\u003c/h2\u003e \u003cp\u003eLiver samples from both human and mouse HCC were isolated, fixed in 4% paraformaldehyde solution for 24 h \u003cem\u003ein situ\u003c/em\u003e, processed for paraffin embedding, and cut into 4 \u0026micro;m transverse sections. H\u0026amp;E and Sirius red staining were performed on the sections. The slides were scanned using a Pannoramic Flash 250 scanner (Perkin Elmer, Waltham, MA, USA) and viewed using the Pannoramic viewer software program (3D Histech, Waltham, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eProliferation assay\u003c/h2\u003e \u003cp\u003eTo analyze cell proliferation, CCK-8 and EdU assays were performed. For the CCK-8 assay, cells were seeded in 96-well plates at a density of 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well. Subsequently, 10 \u0026micro;L CCK-8 reagent (Beyotime Biotechnology, Nantong, Jiangsu, China) was added to each well and incubated for 2 h. Cell proliferation was assessed by measuring the absorbance at 450 nm using a microplate reader. For EdU incorporation, HepG2 cells were seeded in 12-well plates at a density of 5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per well for the indicated times. Then, the cells were incubated with 10 \u0026micro;M EdU (RiboBio, Guangzhou, Guangdong, China) for 2 h. Afterward, the cells were fixed with 4% paraformaldehyde and were double stained with DAPI (Sigma-Aldrich, St. Louis, MO, USA). Signals were visualized using a fluorescence microscope, and the average ratios between EdU-positive (red) and total DAPI-stained nuclei (blue) were calculated for statistical analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eTo analyze the cell cycle of HepG2 cells, the following steps were performed. The cells were fixed with 70% ethanol overnight, washed twice with PBS, and stained with 500 \u0026micro;L of propidium iodide (PI) (50 \u0026micro;g/mL PI in the sample buffer containing 0.1% Triton X-100, 0.1 mmol/L EDTA, and 100 \u0026micro;g/ml RNase A). After 1 h, the fluorescence of the PI-DNA complex in each nucleus was measured using a FACSCalibur instrument (Becton-Dickinson, Sunnyvale, CA, USA). The rates of the G\u003csub\u003e0\u003c/sub\u003e/G\u003csub\u003e1\u003c/sub\u003e, S, and G\u003csub\u003e2\u003c/sub\u003e/M phases of the cell cycle were determined using the Modfit LT software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eCpG island analysis\u003c/h2\u003e \u003cp\u003eThe CpG sites in the promoter (-2000bp\u0026thinsp;~\u0026thinsp;+\u0026thinsp;1bp) and 5'UTR of mouse \u003cem\u003ePer1\u003c/em\u003e were predicted by Ensembl (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ensembl.org/index.html\u003c/span\u003e\u003cspan address=\"http://www.ensembl.org/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and MethPrimer (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.urogene.org/cgi-bin/methprimer/methprimer.cgi\u003c/span\u003e\u003cspan address=\"http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). DNA methylation were detected by MedIP and BSP. For MedIP, 10 \u0026micro;g liver genomic DNA was sonicated and then heat denatured. 5% of the DNA was reserved as the input, while the remaining portion was divided equally. To each portion, 2 \u0026micro;g of IgG or 5-mC antibody was added and incubated at 4\u0026deg;C overnight. Protein G beads were added to capture the complexes, and the eluted DNA was subsequently used for PCR analysis. The primer sequences were presented in the Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. For BSP analysis, 2 \u0026micro;g of genomic DNA was denatured using 0.3 M NaOH for 10 min at 37\u0026deg;C. After adding hydroquinone and sodium bisulfate, the samples were incubated at 50\u0026deg;C for 16 h. The modified DNA was then purified and amplified by PCR. The PCR products were further purified and cloned into the pTG19-T cloning vector (Generay, Shanghai, China). At least ten positive clones from each product were selected for sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eChIP assay\u003c/h2\u003e \u003cp\u003eChIP assays were performed in mouse livers essentially as described previously. Briefly, chromatin lysates were prepared, pre-cleared with Protein-A/G agarose beads, and immunoprecipitated with antibodies against Polb or normal mouse IgG (Cat. No. SC-2025, Santa Cruz, Dallas, TX, USA) in the presence of BSA and salmon sperm DNA. The beads were extensively washed before reverse cross-linking. The DNA was purified using a PCR purification kit (Qiagen, Valencia, CA, USA) and subsequently analyzed by PCR using primers flanking the 4th CpG island on the 5'UTR of \u003cem\u003ePer1\u003c/em\u003e. The primer sequences were the same to the primers used in MedIP analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eTransfection and reporter gene assays\u003c/h2\u003e \u003cp\u003eThe E-box binding sites that were proximal to the key CpG island on the 5'UTR of mouse \u003cem\u003ePer1\u003c/em\u003e were mutated and synthesized by Tsingke (Beijing, China). All transient transfections were conducted using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer\u0026rsquo;s instructions. For Calr knockdown, shRNA targeting mouse Calr were designed, validated, and synthesized by GenePharma (Shanghai, China). Detailed shRNA sequences were: 5'- GCAAGAATGTGCTGATCAATTCAAGAGATTGATCAGCACATTCTTGCTTTTTT-3' for Calr; 5'- GTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTT-3' for scramble. For the luciferase reporter assays, 200 ng of reporter plasmids were mixed with 500 ng of expression constructs for either Bmal1 or Polb. Equal amounts of DNA were used for all transfection combinations by adding the appropriate vector DNA. Relative luciferase activities were determined 48 h following transfection using the Luciferase System (Promega, Madison, WI, USA). The data were representative of at least four independent experiments.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eClinical samples from public database/TCGA database analysis\u003c/h2\u003e \u003cp\u003eHCC samples (374 cases) and adjacent normal tissue samples (50 cases) were downloaded from the TCGA-Liver hepatocellular carcinoma (LIHC) database and Polb expression was assessed. To compare the percentage survival between different Polb expression groups, Kaplan-Meier survival curves were generated. Additionally, we also assessed the impact of Polb on survival using the public database KMplotter (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://kmplot.com\u003c/span\u003e\u003cspan address=\"https://kmplot.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eHuman subjects and IHC analysis\u003c/h2\u003e \u003cp\u003eHCC tissue samples and the paired adjacent non-tumor tissues used in RT-qPCR and IHC analysis were surgically dissected from patients at First Affiliated Hospital of Nanjing Medical University. The study was approved by the Institutional Ethics Committee of the First Affiliated Hospital of Nanjing Medical University. Informed consent for tissue analysis was obtained before the liver biopsy or surgery.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eCo-IP analysis\u003c/h2\u003e \u003cp\u003eThe liver tissues were homogenized, and the cells were lysed in the IP lysis buffer. After centrifugation, 40 \u0026micro;g of protein lysate was incubated with 20 \u0026micro;L of Protein-A/G agarose beads (Roche, Basal, Switzerland) and 1 \u0026micro;g of anti-Polb antibody. Following a 12-h incubation, the immune complexes were centrifuged and washed four times with ice-cold IP wash buffer. The immunoprecipitated protein was then analyzed by using a western blot assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eLabel-free quantification and protein identification\u003c/h2\u003e \u003cp\u003eTo identify the candidate gene that mediates the clock-dependent ubiquitination of hepatic Polb, we conducted label-free proteomics analysis using Co-IP samples (immunoprecipitated with the anti-Polb antibody) from the livers of mice sacrificed at ZT1 and ZT13. Detailed proteomics analysis was performed according to standard protein digestion and LC-MS/MS analyses by Shanghai Applied Protein Technology Co (Shanghai, China). The resulting MS raw data for each sample were consolidated and analyzed for identification and quantitation using the MaxQuant (Version 1.6.14) software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eProtein half-life and ubiquitination analyses\u003c/h2\u003e \u003cp\u003eThe half-life of Polb protein was determined using the cycloheximide (CHX) chase assay. Mouse primary hepatocytes (PHs) were transfected with the indicated plasmids. After 36 h, DMEM medium containing 10 \u0026micro;g/mL CHX (Sigma-Aldrich, St. Louis, MO, USA) were added. Cells were harvested at the specified time-points and subjected to western blot analysis. The ubiquitination of Polb protein was measured by a Co-IP assay. Mouse PHs were similarly transfected with indicated plasmids for 36 h, followed by the treatment with 10 \u0026micro;M MG132 (Sigma-Aldrich, St. Louis, MO, USA) for 6 h. Cells were lysed and lysates were precipitated with anti-Polb antibody and pre-cleared protein A/G PLUS-Agarose beads (Roche, Basal, Switzerland). Ubiquitinated proteins within the IP were detected by western blot using a monoclonal anti-ubiquitin antibody (Cat. No. sc-8017; 1:200 dilution, Santa Cruz, Dallas, TX, USA).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was conducted using Graphpad (version 9.5, San Diego, CA, USA). The data were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD (standard deviation) for each group. One-way or two-way ANOVA followed by Bonferroni\u0026rsquo;s \u003cem\u003eposthoc\u003c/em\u003e test was used to analyze time series data. A \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. When comparing only two groups, Student's \u003cem\u003et\u003c/em\u003e-test was used unless otherwise specified.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from the National Natural Science Foundation of China (92057112), National Key R\u0026amp;D Program of China (2021YFF0702000, 2022YFA0807200), the Natural Science Foundation of Jiangsu Province (BK20220151), the Project of State Key Laboratory of Natural Medicines, China Pharmaceutical University (SKLNMZZ202214), the \u0026ldquo;Double First-Class\u0026rdquo; University Project (CPU2022QZ30), the Fundamental Research Funds for the Central Universities (2632022ZD08).\u0026nbsp;The authors thank Professor Guo Zhigang for providing\u0026nbsp;Polb\u003cem\u003e\u003csup\u003eR137Q\u003c/sup\u003e\u003c/em\u003e mice and Zhang Eric Erquan for providing human \u003cem\u003eBmal1\u003c/em\u003e::\u003cem\u003eLuc\u003c/em\u003e U2OS cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSYC, WXZ and CL designed the experiments and conceived the project. SYC, WXZ and XL performed the experiments and prepared the figures. XL provided the clinical samples. SYC, WXZ and CL wrote the manuscript, and was responsible for data compilation and integration. All authors have reviewed to the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure and competing interests statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support this study are available within the article and its supplementary data files or available from the authors upon request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAntoniali G, Malfatti MC, Tell G (2017) Unveiling the non-repair face of the Base Excision Repair pathway in RNA processing: A missing link between DNA repair and gene expression? \u003cem\u003eDNA Repair (Amst)\u003c/em\u003e 56: 65-74\u003c/li\u003e\n\u003cli\u003eAsher G, Schibler U (2011) Crosstalk between components of circadian and metabolic cycles in mammals. \u003cem\u003eCell Metab\u003c/em\u003e 13: 125-137\u003c/li\u003e\n\u003cli\u003eBarakat KH, Gajewski MM, Tuszynski JA (2012) DNA polymerase beta (pol beta) inhibitors: a comprehensive overview. \u003cem\u003eDrug Discov Today\u003c/em\u003e 17: 913-920\u003c/li\u003e\n\u003cli\u003eBarcena-Varela M, Caruso S, Llerena S, Alvarez-Sola G, Uriarte I, Latasa MU, Urtasun R, Rebouissou S, Alvarez L, Jimenez M\u003cem\u003e et al\u003c/em\u003e (2019) Dual Targeting of Histone Methyltransferase G9a and DNA-Methyltransferase 1 for the Treatment of Experimental Hepatocellular Carcinoma. \u003cem\u003eHepatology\u003c/em\u003e 69: 587-603\u003c/li\u003e\n\u003cli\u003eBass J, Takahashi JS (2010) Circadian integration of metabolism and energetics. \u003cem\u003eScience\u003c/em\u003e 330: 1349-1354\u003c/li\u003e\n\u003cli\u003eBeltran M, Puig I, Pena C, Garcia JM, Alvarez AB, Pena R, Bonilla F, de Herreros AG (2008) A natural antisense transcript regulates Zeb2/Sip1 gene expression during Snail1-induced epithelial-mesenchymal transition. \u003cem\u003eGenes Dev\u003c/em\u003e 22: 756-769\u003c/li\u003e\n\u003cli\u003eBergoglio V, Pillaire MJ, Lacroix-Triki M, Raynaud-Messina B, Canitrot Y, Bieth A, Gares M, Wright M, Delsol G, Loeb LA\u003cem\u003e et al\u003c/em\u003e (2002) Deregulated DNA polymerase beta induces chromosome instability and tumorigenesis. \u003cem\u003eCancer Res\u003c/em\u003e 62: 3511-3514\u003c/li\u003e\n\u003cli\u003eChen J, Liu A, Lin Z, Wang B, Chai X, Chen S, Lu W, Zheng M, Cao T, Zhong M\u003cem\u003e et al\u003c/em\u003e (2020) Downregulation of the circadian rhythm regulator HLF promotes multiple-organ distant metastases in non-small cell lung cancer through PPAR/NF-kappab signaling. \u003cem\u003eCancer Lett\u003c/em\u003e 482: 56-71\u003c/li\u003e\n\u003cli\u003eChen S, Feng M, Zhang S, Dong Z, Wang Y, Zhang W, Liu C (2019) Angptl8 mediates food-driven resetting of hepatic circadian clock in mice. \u003cem\u003eNat Commun\u003c/em\u003e 10: 3518\u003c/li\u003e\n\u003cli\u003eChen S, Zhang W, Tang C, Tang X, Liu L, Liu C (2014) Vanin-1 is a key activator for hepatic gluconeogenesis. \u003cem\u003eDiabetes\u003c/em\u003e 63: 2073-2085\u003c/li\u003e\n\u003cli\u003eChen ZX, Riggs AD (2011) DNA methylation and demethylation in mammals. \u003cem\u003eJ Biol Chem\u003c/em\u003e 286: 18347-18353\u003c/li\u003e\n\u003cli\u003eChuang SE, Kuo ML, Hsu CH, Chen CR, Lin JK, Lai GM, Hsieh CY, Cheng AL (2000) Curcumin-containing diet inhibits diethylnitrosamine-induced murine hepatocarcinogenesis. \u003cem\u003eCarcinogenesis\u003c/em\u003e 21: 331-335\u003c/li\u003e\n\u003cli\u003eCiccia A, Elledge SJ (2010) The DNA damage response: making it safe to play with knives. \u003cem\u003eMol Cell\u003c/em\u003e 40: 179-204\u003c/li\u003e\n\u003cli\u003eFan J, Wilson DM, 3rd (2005) Protein-protein interactions and posttranslational modifications in mammalian base excision repair. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e 38: 1121-1138\u003c/li\u003e\n\u003cli\u003eFu L, Kettner NM (2013) The circadian clock in cancer development and therapy. \u003cem\u003eProg Mol Biol Transl Sci\u003c/em\u003e 119: 221-282\u003c/li\u003e\n\u003cli\u003eFucikova J, Spisek R, Kroemer G, Galluzzi L (2021) Calreticulin and cancer. \u003cem\u003eCell Res\u003c/em\u003e 31: 5-16\u003c/li\u003e\n\u003cli\u003eGaddameedhi S, Selby CP, Kaufmann WK, Smart RC, Sancar A (2011) Control of skin cancer by the circadian rhythm. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 108: 18790-18795\u003c/li\u003e\n\u003cli\u003eGhaderi-Zefrehi H, Rezaei M, Sadeghi F, Heiat M (2021) Genetic polymorphisms in DNA repair genes and hepatocellular carcinoma risk. \u003cem\u003eDNA Repair (Amst)\u003c/em\u003e 107: 103196\u003c/li\u003e\n\u003cli\u003eGuo Z, Zheng L, Dai H, Zhou M, Xu H, Shen B (2009) Human DNA polymerase beta polymorphism, Arg137Gln, impairs its polymerase activity and interaction with PCNA and the cellular base excision repair capacity. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 37: 3431-3441\u003c/li\u003e\n\u003cli\u003eHajkova P, Jeffries SJ, Lee C, Miller N, Jackson SP, Surani MA (2010) Genome-wide reprogramming in the mouse germ line entails the base excision repair pathway. \u003cem\u003eScience\u003c/em\u003e 329: 78-82\u003c/li\u003e\n\u003cli\u003eHarmer SL, Panda S, Kay SA (2001) Molecular bases of circadian rhythms. \u003cem\u003eAnnu Rev Cell Dev Biol\u003c/em\u003e 17: 215-253\u003c/li\u003e\n\u003cli\u003eHu L, Harper A, Heer E, McNeil J, Cao C, Park Y, Martell K, Gotto G, Shen-Tu G, Peters C\u003cem\u003e et al\u003c/em\u003e (2020) Social Jetlag and Prostate Cancer Incidence in Alberta\u0026apos;s Tomorrow Project: A Prospective Cohort Study. \u003cem\u003eCancers (Basel)\u003c/em\u003e 12\u003c/li\u003e\n\u003cli\u003eIwatsuki M, Mimori K, Yokobori T, Tanaka F, Tahara K, Inoue H, Baba H, Mori M (2009) A platinum agent resistance gene, POLB, is a prognostic indicator in colorectal cancer. \u003cem\u003eJ Surg Oncol\u003c/em\u003e 100: 261-266\u003c/li\u003e\n\u003cli\u003eIzumo M, Johnson CH, Yamazaki S (2003) Circadian gene expression in mammalian fibroblasts revealed by real-time luminescence reporting: temperature compensation and damping. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 100: 16089-16094\u003c/li\u003e\n\u003cli\u003eJackson SP, Bartek J (2009) The DNA-damage response in human biology and disease. \u003cem\u003eNature\u003c/em\u003e 461: 1071-1078\u003c/li\u003e\n\u003cli\u003eKang TH (2021) Circadian Rhythm of NER and ATR Pathways. \u003cem\u003eBiomolecules\u003c/em\u003e 11\u003c/li\u003e\n\u003cli\u003eKaufman BA, Van Houten B (2017) POLB: A new role of DNA polymerase beta in mitochondrial base excision repair. \u003cem\u003eDNA Repair (Amst)\u003c/em\u003e 60: A1-A5\u003c/li\u003e\n\u003cli\u003eKettner NM, Voicu H, Finegold MJ, Coarfa C, Sreekumar A, Putluri N, Katchy CA, Lee C, Moore DD, Fu L (2016) Circadian Homeostasis of Liver Metabolism Suppresses Hepatocarcinogenesis. \u003cem\u003eCancer Cell\u003c/em\u003e 30: 909-924\u003c/li\u003e\n\u003cli\u003eKim CH, Ardayfio P, Kim KS (2001) An E-box motif residing in the exon/intron 1 junction regulates both transcriptional activation and splicing of the human norepinephrine transporter gene. \u003cem\u003eJ Biol Chem\u003c/em\u003e 276: 24797-24805\u003c/li\u003e\n\u003cli\u003eKonermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H\u003cem\u003e et al\u003c/em\u003e (2015) Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. \u003cem\u003eNature\u003c/em\u003e 517: 583-588\u003c/li\u003e\n\u003cli\u003eLim KH, Park ES, Kim DH, Cho KC, Kim KP, Park YK, Ahn SH, Park SH, Kim KH, Kim CW\u003cem\u003e et al\u003c/em\u003e (2018) Suppression of interferon-mediated anti-HBV response by single CpG methylation in the 5\u0026apos;-UTR of TRIM22. \u003cem\u003eGut\u003c/em\u003e 67: 166-178\u003c/li\u003e\n\u003cli\u003eLin J, Bao X, Li XD (2021) A tri-functional amino acid enables mapping of binding sites for posttranslational-modification-mediated protein-protein interactions. \u003cem\u003eMol Cell\u003c/em\u003e 81: 2669-2681 e2669\u003c/li\u003e\n\u003cli\u003eMarcheva B, Ramsey KM, Peek CB, Affinati A, Maury E, Bass J (2013) Circadian clocks and metabolism. \u003cem\u003eHandb Exp Pharmacol\u003c/em\u003e: 127-155\u003c/li\u003e\n\u003cli\u003eMullins EA, Rodriguez AA, Bradley NP, Eichman BF (2019) Emerging Roles of DNA Glycosylases and the Base Excision Repair Pathway. \u003cem\u003eTrends Biochem Sci\u003c/em\u003e 44: 765-781\u003c/li\u003e\n\u003cli\u003ePan F, Zhao J, Zhou T, Kuang Z, Dai H, Wu H, Sun H, Zhou X, Wu X, Hu Z\u003cem\u003e et al\u003c/em\u003e (2016) Mutation of DNA Polymerase beta R137Q Results in Retarded Embryo Development Due to Impaired DNA Base Excision Repair in Mice. \u003cem\u003eSci Rep\u003c/em\u003e 6: 28614\u003c/li\u003e\n\u003cli\u003ePanda S (2016) Circadian physiology of metabolism. \u003cem\u003eScience\u003c/em\u003e 354: 1008-1015\u003c/li\u003e\n\u003cli\u003eParsons JL, Dianova, II, Allinson SL, Dianov GL (2005) DNA polymerase beta promotes recruitment of DNA ligase III alpha-XRCC1 to sites of base excision repair. \u003cem\u003eBiochemistry\u003c/em\u003e 44: 10613-10619\u003c/li\u003e\n\u003cli\u003eQu M, Zhang G, Qu H, Vu A, Wu R, Tsukamoto H, Jia Z, Huang W, Lenz HJ, Rich JN\u003cem\u003e et al\u003c/em\u003e (2023) Circadian regulator BMAL1::CLOCK promotes cell proliferation in hepatocellular carcinoma by controlling apoptosis and cell cycle. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 120: e2214829120\u003c/li\u003e\n\u003cli\u003eRaggi C, Factor VM, Seo D, Holczbauer A, Gillen MC, Marquardt JU, Andersen JB, Durkin M, Thorgeirsson SS (2014) Epigenetic reprogramming modulates malignant properties of human liver cancer. \u003cem\u003eHepatology\u003c/em\u003e 59: 2251-2262\u003c/li\u003e\n\u003cli\u003eRay S, Menezes MR, Senejani A, Sweasy JB (2013) Cellular roles of DNA polymerase beta. \u003cem\u003eYale J Biol Med\u003c/em\u003e 86: 463-469\u003c/li\u003e\n\u003cli\u003eRipperger JA, Schibler U (2006) Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions. \u003cem\u003eNat Genet\u003c/em\u003e 38: 369-374\u003c/li\u003e\n\u003cli\u003eSancar A, Lindsey-Boltz LA, Gaddameedhi S, Selby CP, Ye R, Chiou YY, Kemp MG, Hu J, Lee JH, Ozturk N (2015) Circadian clock, cancer, and chemotherapy. \u003cem\u003eBiochemistry\u003c/em\u003e 54: 110-123\u003c/li\u003e\n\u003cli\u003eSatou R, Sugihara N, Ishizuka Y, Matsukubo T, Onishi Y (2013) DNA methylation of the BMAL1 promoter. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e 440: 449-453\u003c/li\u003e\n\u003cli\u003eShi Y, Liu L, Hamada T, Nowak JA, Giannakis M, Ma Y, Song M, Nevo D, Kosumi K, Gu M\u003cem\u003e et al\u003c/em\u003e (2020) Night-Shift Work Duration and Risk of Colorectal Cancer According to IRS1 and IRS2 Expression. \u003cem\u003eCancer Epidemiol Biomarkers Prev\u003c/em\u003e 29: 133-140\u003c/li\u003e\n\u003cli\u003eSun L, Zhang H, Gao P (2022) Metabolic reprogramming and epigenetic modifications on the path to cancer. \u003cem\u003eProtein Cell\u003c/em\u003e 13: 877-919\u003c/li\u003e\n\u003cli\u003eVasquez JL, Lai Y, Annamalai T, Jiang Z, Zhang M, Lei R, Zhang Z, Liu Y, Tse-Dinh YC, Agoulnik IU (2020) Inhibition of base excision repair by natamycin suppresses prostate cancer cell proliferation. \u003cem\u003eBiochimie\u003c/em\u003e 168: 241-250\u003c/li\u003e\n\u003cli\u003eWallace SS, Murphy DL, Sweasy JB (2012) Base excision repair and cancer. \u003cem\u003eCancer Lett\u003c/em\u003e 327: 73-89\u003c/li\u003e\n\u003cli\u003eWang M, Long K, Li E, Li L, Li B, Ci S, He L, Pan F, Hu Z, Guo Z (2020) DNA polymerase beta modulates cancer progression via enhancing CDH13 expression by promoter demethylation. \u003cem\u003eOncogene\u003c/em\u003e 39: 5507-5519\u003c/li\u003e\n\u003cli\u003eWeber AR, Krawczyk C, Robertson AB, Kusnierczyk A, Vagbo CB, Schuermann D, Klungland A, Schar P (2016) Biochemical reconstitution of TET1-TDG-BER-dependent active DNA demethylation reveals a highly coordinated mechanism. \u003cem\u003eNat Commun\u003c/em\u003e 7: 10806\u003c/li\u003e\n\u003cli\u003eWu G, Anafi RC, Hughes ME, Kornacker K, Hogenesch JB (2016) MetaCycle: an integrated R package to evaluate periodicity in large scale data. \u003cem\u003eBioinformatics\u003c/em\u003e 32: 3351-3353\u003c/li\u003e\n\u003cli\u003eXu Y, Padiath QS, Shapiro RE, Jones CR, Wu SC, Saigoh N, Saigoh K, Ptacek LJ, Fu YH (2005) Functional consequences of a CKIdelta mutation causing familial advanced sleep phase syndrome. \u003cem\u003eNature\u003c/em\u003e 434: 640-644\u003c/li\u003e\n\u003cli\u003eXu Y, Toh KL, Jones CR, Shin JY, Fu YH, Ptacek LJ (2007) Modeling of a human circadian mutation yields insights into clock regulation by PER2. \u003cem\u003eCell\u003c/em\u003e 128: 59-70\u003c/li\u003e\n\u003cli\u003eXuan W, Khan F, James CD, Heimberger AB, Lesniak MS, Chen P (2021) Circadian regulation of cancer cell and tumor microenvironment crosstalk. \u003cem\u003eTrends Cell Biol\u003c/em\u003e 31: 940-950\u003c/li\u003e\n\u003cli\u003eZhang EE, Liu AC, Hirota T, Miraglia LJ, Welch G, Pongsawakul PY, Liu X, Atwood A, Huss JW, 3rd, Janes J\u003cem\u003e et al\u003c/em\u003e (2009) A genome-wide RNAi screen for modifiers of the circadian clock in human cells. \u003cem\u003eCell\u003c/em\u003e 139: 199-210\u003c/li\u003e\n\u003cli\u003eZhou T, Pan F, Cao Y, Han Y, Zhao J, Sun H, Zhou X, Wu X, He L, Hu Z\u003cem\u003e et al\u003c/em\u003e (2016) R152C DNA Pol beta mutation impairs base excision repair and induces cellular transformation. \u003cem\u003eOncotarget\u003c/em\u003e 7: 6902-6915\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"DNA base excision repair, Circadian homeostasis, Hepatocellular carcinoma, Epigenetic modification, Core clock components","lastPublishedDoi":"10.21203/rs.3.rs-3350322/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3350322/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe circadian-controlled DNA repair exhibits a strong diurnal rhythm. Disruption in circadian clock and DNA repair is closely linked with hepatocellular carcinoma (HCC) progression, but the mechanism remains unknown. Here, we show that polymerase beta (Polb), a critical enzyme in the DNA base excision repair pathway, is rhythmically expressed at the translational level in mouse livers. Hepatic Polb dysfunction dampens clock homeostasis, whereas retards HCC progression, through methylation of the 4\u003csup\u003eth\u003c/sup\u003e CpG island on the 5'UTR of clock gene \u003cem\u003ePer1\u003c/em\u003e. Clinically, POLB is overexpressed in human PolbHCC samples and positively associated with poor prognosis. Furthermore, the hepatic rhythmicity of Polb protein expression is orchestrated by Calreticulin (Calr).\u003cstrong\u003e \u003c/strong\u003eOur findings provide important insights into the molecular mechanism underlying the synergy between clock and food signals on the Polb-driven BER system and reveal new clock-dependent carcinogenetic effects of Polb. Therefore, chronobiological modulation of Polb may help to promote precise interventions for HCC.\u003c/p\u003e","manuscriptTitle":"DNA polymerase beta connects tumorigenicity with the circadian clock in liver cancer through the epigenetic demethylation of Per1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-10-06 21:17:02","doi":"10.21203/rs.3.rs-3350322/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2023-11-07T12:08:50+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2023-10-17T05:52:52+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2023-10-16T04:54:34+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2023-10-04T09:22:19+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2023-10-03T18:28:56+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2023-10-02T14:19:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-09-14T09:23:57+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2023-09-14T02:03:12+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2023-09-13T09:28:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-09-13T03:18:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aee8205b-2708-4621-9078-3975f94677a5","owner":[],"postedDate":"October 6th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":25124749,"name":"Biological sciences/Molecular biology/Epigenetics/DNA methylation"},{"id":25124750,"name":"Health sciences/Diseases/Cancer/Gastrointestinal cancer/Liver cancer"}],"tags":[],"updatedAt":"2024-01-21T08:11:53+00:00","versionOfRecord":{"articleIdentity":"rs-3350322","link":"https://doi.org/10.1038/s41419-024-06462-7","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2024-01-20 05:00:00","publishedOnDateReadable":"January 20th, 2024"},"versionCreatedAt":"2023-10-06 21:17:02","video":"","vorDoi":"10.1038/s41419-024-06462-7","vorDoiUrl":"https://doi.org/10.1038/s41419-024-06462-7","workflowStages":[]},"version":"v1","identity":"rs-3350322","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3350322","identity":"rs-3350322","version":["v1"]},"buildId":"WrCJVZZCHTDjtuVLN7oU0","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00