DistinguishingPEXgene variant severity for mild, severe, and atypical peroxisome biogenesis disorders inDrosophila

Distinguishing PEX gene variant severity for mild, severe, and atypical peroxisome biogenesis disorders in Drosophila | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Distinguishing PEX gene variant severity for mild, severe, and atypical peroxisome biogenesis disorders in Drosophila View ORCID Profile Vanessa A. Gomez , Oguz Kanca , View ORCID Profile Sharayu V. Jangam , Saurabh Srivastav , View ORCID Profile Jonathan C. Andrews , View ORCID Profile Michael F. Wangler doi: https://doi.org/10.1101/2024.11.14.623590 Vanessa A. Gomez 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Vanessa A. Gomez Oguz Kanca 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sharayu V. Jangam 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Sharayu V. Jangam Saurabh Srivastav 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jonathan C. Andrews 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jonathan C. Andrews Michael F. Wangler 1 Department of Molecular and Human Genetics, Baylor College of Medicine , Houston, 2 Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital , Houston, TX 77030 Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Michael F. Wangler For correspondence: Michael.Wangler{at}bcm.edu Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Peroxisomal biogenesis disorders (PBD) are autosomal recessive disorders caused by loss-of-function mutations of one of the PEX genes responsible for peroxisomal formation. Impaired peroxisome assembly causes severe multisystemic failure with patient phenotypes ranging from epilepsy, liver disease, feeding issues, biochemical abnormalities, and neurodegeneration. Variants in the same PEX gene can produce wide differences in severity, ranging from individuals with death in the first year of life to adults with milder complications. To study this strong genotype-phenotype correlation, we selected specific human PEX gene mutations and utilized Drosophila as a model organism. We generated flies replacing the coding sequence of our Pex gene of interest with a KozakGAL4 (KZ) promoter trap sequence. These cassettes simultaneously knock-out of the Pex gene and knock-in a GAL4 driver, ideal for making “humanized” flies in which the human PEX gene can replace the fly loss. We assessed Pex2 KZ and Pex16 KZ lines in lifespan, bang sensitivity, and climbing assays and confirmed that these are strong loss-of-function alleles. In parallel, we generated human reference and variant UAS-cDNA lines of PEX2 and PEX16 variants in Drosophila . We observed nearly complete phenotypic rescue of Drosophila Pex2 and Pex16 loss when human PEX2 Ref or PEX16 Ref , respectively, were expressed. We also provide evidence for an allele severity spectrum in PEX2 and PEX16 in which some missense alleles, such as PEX2 C247R , are equally severe as early truncations, such as PEX2 R119* . We also observed that alleles associated with mild PBD, such as PEX2 E55K , show variability depending on the assay but do not fully rescue. Finally, alleles associated with atypical ataxia phenotypes, such as PEX16 F332Del , can perform as well as PEX16 Ref , depending on the assay. Altogether, these Drosophila lines effectively model the range of severity of peroxisomal biogenesis disorders. Introduction Peroxisomes are ubiquitous organelles that play an important role in cellular metabolism and perform specific biochemical functions in the cell, primarily involving complex lipids in eukaryotic cells 1 , 2 . Important biochemical functions performed by peroxisomes include fatty acid β-oxidation of very-long-chain fatty acids (VLCFA) 3 , α-oxidation of branched-chain fatty acids 4 , 5 , plasmalogen biosynthesis 6 , 7 , and catabolism of reactive oxygen species 8 and glyoxylate 9 , 10 . There are two main disorders associated with peroxisomes in humans: Peroxisomal biogenesis disorders (PBD) and single enzyme/protein deficiency disorders (SEPD) 11 . Peroxisomal biogenesis disorders are a group of autosomal recessive disorders caused by loss-of-function mutations in one of the peroxisomal matrix genes responsible for peroxisomal assembly and function 2 , 12 . Patients with PBD Zellweger spectrum disorders (ZSD) experience a wide range of multisystemic symptoms often within the first year of life, involving brain, bone, kidney, and liver, which can lead to death 13 , 14 . PBD consists of a spectrum of disorders with varying severity, ranging from mild to moderate to severe phenotypes 11 . Historically, severe PBD-ZSD (a.k.a. Zellweger syndrome) is the most dramatic and rapidly progressive disorder with a high mortality rate 11 . Intermediate PBD-ZSD (a.k.a. Neonatal adrenoleukodystrophy) has an infantile presentation with feeding problems and brain white matter changes, while mild PBD-ZSD (a.k.a. Infantile Refsum disease) is marked by hearing loss and retinal degeneration with a much milder cognitive impact 11 , 15 . The peroxisomal biogenesis machinery is a conserved process, which is highly dependent on the action of 14 peroxins encoded by PEX genes that are required for matrix protein import, peroxisome membrane assembly, and peroxisome proliferation 16 , 17 . Early peroxisomal proteins including PEX3 , PEX19 , and PEX16 aid in the designation of an ER-derived lipid bilayer and its maturation to a pre-peroxisomal vesicle 17 . Membrane proteins are then incorporated to allow enzyme import into the maturing peroxisome with the help of PEX2 and the importer complex 18 . Mature peroxisomes can then perform a wide range of biochemical functions important for cell function and proper metabolism 1 , 2 . Therefore, it is critical to study PEX genes involved in different aspects of biogenesis, such as PEX2 and PEX16 , when characterizing peroxisomal biogenesis disorders. The severity spectrum of PBD-ZSD correlates to the allele severity of the PEX gene mutations. In general, clinical severity correlates to lower levels of residual PEX gene activity and much less to which PEX gene is involved (e.g. PEX16 vs. PEX2 vs. PEX3 ) 19 , 20 . Patients with biallelic loss of function ‘null’ PEX alleles are more likely to exhibit drastic biochemical defects and severe cases of PBD-ZSD than patients harboring one of the hypomorphic alleles that retain partial PEX protein functions. For instance, milder alleles of PEX2 such as PEX2 E55K in compound heterozygotes (PEX2 Null /PEX2 E55K ) are associated with mild PBD-ZSD, where the phenotypes are mild or intermediate due to residual PEX2 function 21 , 22 . Likewise, we also observed a case with a single amino acid deletion of PEX16 with normal plasma VLCFA and an atypical ataxia phenotype 23 , 24 . In summary, PBD-ZSD exhibits a clinical spectrum that correlates with specific alleles. Peroxisomal biology is highly conserved across eukaryotes, and recent studies have demonstrated the evolutionary conservation of peroxisomal biogenesis in Drosophila 25 – 30 . Previous studies have found that Pex mutations in Drosophila alter lipid metabolism, muscle function, and spermatogenesis 25 – 27 . Our research has focused on Pex2 and Pex16 mutant flies, which has allowed us to compare different biogenesis defects. We previously documented a detailed phenotypic characterization in flies on two alleles for both Pex2 and Pex16 , studying the mutants in trans with genomic deficiencies, and creating genomic rescue strains for each mutation 30 . We also showed that the peroxisomes were similarly functionally and morphologically defective in Pex2 or Pex16 mutants, and mutant flies had short lifespans, increased bang sensitivity, lacked flight ability, and showed reduced activity 30 . Additionally, functional analysis of peroxisomal lipids allowed for a comprehensive study of VLCFA metabolites in different stages of development, as well as findings of a dramatic loss of plasmalogen synthesis in both Pex2 and Pex16 mutant flies 30 . Altogether, previous studies of peroxisomes in Drosophila support the high conservation of the peroxisomal biogenesis machinery in flies and humans. A key question that has not been addressed previously is whether human transgenes could rescue deleterious Pex mutant phenotypes in flies. While comprehensive studies have functionally characterized the conservation of the peroxisomal biogenesis machinery in flies and phenotypes of Pex mutants, functional studies on known human proband variants involved in PBD in the context of the human protein have not yet been done. Here, we utilize KozakGAL4 cassettes to knock-out Pex genes of interest, creating an effective null background that allowed us to express human reference and variant UAS-cDNAs of the targeted gene to assess the rescue of the Pex mutants. We assayed the flies for phenotypes that allowed us to study disease progression resulting from the expression of the human variants that could be classified as pathogenic or likely pathogenic. We also studied whether the human protein can functionally replace the loss of the endogenous fly Pex protein. With these findings, we have found a method to functionally characterize individual human PEX mutations in Drosophila and create an allelic series. Results Generation of the KozakGAL4 lines resulting in a GAL4 gene trap allele and examination of the spatiotemporal expression pattern To study the neurodevelopmental and neurodegenerative phenotypes seen in PBD patients, we generated novel alleles for our genes of interest with KozakGAL4 cassettes in Drosophila. This strategy replaces the coding sequence of genes with the KozakGAL4 cassette using CRISPR induced homologous recombination using sgRNAs targeting the 5’ and 3’ UTR 31 . These alleles are useful for determining the gene’s expression pattern, studying the effect of loss-of-function of the gene product, assessing protein subcellular localization with the help of a GFP protein trap, and expression of UAS-cDNAs of the targeted gene and variants to assess rescue of the mutant phenotypes 31 . We have generated fly lines in which the coding sequence of Pex2 and Pex16 respectively were replaced by the KozakGAL4 gene trap sequence ( Figure 1A-B ). We confirmed the insertions by PCR. This technology leads to a null allele ( Pex2 KZ and Pex16 KZ ) with expression of GAL4 in a similar spatial and temporal pattern as the protein encoded by the targeted gene 31 . This method has been successfully employed to study expression patterns and to “humanize” the gene by driving the human cDNA to effectively replace the fly loss 32 , 33 . Download figure Open in new tab Figure 1 The KozakGAL4 knock-in/knock-out strategy, which replaces the coding region of the Pex gene of interest by identifying sgRNA target sites in the 5’ UTR and 3’ UTR. Gray boxes, UTRs; blue boxes, Pex -coding region. (A) Schematics of Pex2 locus and targeting strategy. (B) Schematics of Pex16 locus and targeting strategy. (C) Expression pattern of Pex2 KZ in 3rd instar larval brain. (C’) Repo expression. (C’’) Elav expression. (C’’’) Merged image with co-localization within the ventral nerve cord, indicating Pex2 KZ expression in both neurons (Elav) and nuclear glia (Elav) in the larval brain. (D) Expression of Pex16 KZ expression pattern in the third instar Drosophila larval brain. (D’) Repo expression. (D’’) Elav expression. (D’’’) Merged image with co-localization within the ventral nerve cord, indicating Pex16 KZ expression in both neurons (Elav) and nuclear glia (Elav) in the larval brain. We examined the expression using third instar larval Drosophila brain ( Figure 1C-D ) and assessed whether the Pex2 and Pex16 genes were expressed in neurons, glia, or both by co-staining with Repo and Elav. Within the ventral nerve cord (VNC), we observed co-staining of cells expressing Pex2 or Pex16 with both Repo and Elav ( Figure 1C-D ). We noted that Pex2 expression was generally sparser in the larval third instar brain. Altogether, Pex2 and Pex16 appear to be expressed in both neurons and glia in the larval brain. The novel alleles Pex2 KZ and Pex16 KZ behave similar to known Pex2 and Pex16 null alleles Having generated these unique KozakGAL4 cassettes, we wanted to study the strength of these loss-of-function alleles of Pex2 and Pex16 using behavior assays. We crossed Pex2 KZ to known Pex2 null alleles, including a transposable element, a deletion allele, and 2 frameshift alleles Pex2 1 and Pex2 2 ( Figure 2A ). Similarly, we crossed Pex16 KZ to a known Pex16 null allele, Pex16 1 ( Figure S1A ). Download figure Open in new tab Figure 2 Drosophila Pex2 mutants have shortened lifespan, are bang-sensitive, and have a climbing defect. (A) Schematic representation of fly Pex2 gene along with four alleles, including a coding P-element insertion ( Pex2 EPg ), 2 deletion alleles ( Pex2 1 , Pex2 2 ), and Pex2 - KozakGAL4 (Pex2 KZ ). (B) Pex2 female lifespan assay shows that the Pex2 mutants have a shorter lifespan compared to control lines (pink and purple). (C) Pex2 male lifespan assay shows that the Pex2 mutants have a shorter lifespan compared to control lines, worse than female mutant flies. (D) Pex2 null flies have a significant bang-sensitive phenotype (red) compared to controls (pink and purple) observed at 10 days after eclosion (DAE). (E) Pex2 null flies have a significant climbing deficiency (red) compared to controls (pink and purple) observed at 10 days after eclosion. [* = p -value is less than 0.05. ** = p -value is less than 0.01. *** = p -value is less than 0.001. **** = p -value is less than 0.0001] We first analyzed the lifespan of the F1 progeny of the flies crossed from Pex2 KZ to the 4 known Pex2 null alleles. Lifespan analysis showed a significant difference between experimental flies and controls in females ( Figure 2B ). While both control genotypes had an average lifespan of 55.5 days, female flies Pex2 KZ /Pex2 Df lived an average of 27.2 days, Pex2 KZ /Pex2 1 lived 35.7 days, Pex2 KZ /Pex2 2 lived 29.5 days, and Pex2 KZ /Pex2 EPg lived an average of 26.6 days. This effect was even more dramatic in males ( Figure 2C ). Control male flies Pex2 Df /+ and Pex2 KZ /+ lived an average of 49.3 days and 55.9 days, respectively. Meanwhile, male flies Pex2 KZ /Pex2 Df lived an average of 12.8 days, Pex2 KZ /Pex2 1 lived 16.4 days, Pex2 KZ /Pex2 2 lived 17.4 days, and Pex2 KZ /Pex2 EPg lived an average of 16.5 days. We also assessed bang sensitivity and climbing, focusing on the Pex2 KZ /Pex2 2 null flies compared to controls. Bang sensitivity is an assay used to test for seizure-like behavior and paralysis following mechanical stimulation 34 . 10 days after eclosion (DAE), the Pex2 KZ /Pex2 2 null flies were found to have a significant bang-sensitive phenotype compared to heterozygous controls ( Figure 2D ). The climbing assay evaluates the flies’ natural tendency to climb, which is known as negative geotaxis 35 . In Drosophila , negative geotaxis relies on the presence of intact sensory and motor systems, and a defect in climbing may be an effective readout for peroxisomal disease progression in the fly 35 . When observing the climbing behavior of the Pex2 KZ /Pex2 2 flies compared to heterozygous controls at 10 days after eclosion, we observed only 18% of Pex2 null flies had the ability to climb a full 8 cm within 60 seconds, demonstrating a clear lack of climbing ability and putative disease progression ( Figure 2E ). In parallel, we performed lifespan analysis on the F1 progeny of the flies crossed from Pex16 KZ to the Pex16 1 null allele. Lifespan analysis showed a significant difference between the Pex16 KZ /Pex16 1 and controls in both females and males ( Figure S1B-C ). Control female flies Pex16 1 /+ and Pex16 KZ /+ lived an average of 49 and 50.5 days, respectively. Meanwhile, Pex16 KZ /Pex16 1 null female flies lived an average of 13.2 days. Control male flies Pex16 1 /+ and Pex16 KZ /+ lived an average of 40 and 51.2 days, respectively. Meanwhile, Pex16 KZ /Pex16 1 null male flies lived an average of 8.5 days. When performing the bang sensitivity assay on Pex16 KZ /Pex16 1 null flies, we found a significant seizure-like phenotype that was not seen in the heterozygous control flies ( Figure S1D ). When assessing climbing ability 10 days after eclosion, only 3% of the Pex16 KZ /Pex16 1 flies were able to climb the full 8 cm within 60 seconds ( Figure S1E ). In summary, the KozakGAL4 cassette alleles Pex2 KZ and Pex16 KZ behave as genetic null alleles similar to previously documented deletions of Pex2 2 and Pex16 1 in flies. Rescue-based humanization of Drosophila Pex genes to study rare PEX variants Having established that the Pex2 KZ and Pex16 KZ are strong loss-of-function alleles and express transgene under GAL4 , we chose to further study rare human variants involved in PBD. The rescue-based humanization experiments of Pex2 and Pex16 involve the generation of transgenic Drosophila lines containing human reference and variant PEX2 and PEX16 under the control of the UAS 36 , 37 . “Humanization” was performed by expressing the reference or variant UAS-human cDNA in either the Pex2 KZ /Pex2 2 or Pex16 KZ /Pex16 1 mutant background, as appropriate, and observing for differences in phenotype that could suggest a Pex -specific effect 36 , 37 . PEX2 is found on chromosome 8 ( Figure 3A ) and contains 5 transmembrane domains and a Zinc finger binding domain ( Figure 3B ). Autosomal recessive mutations in PEX2 have been associated with a range of mild to intermediate to severe cases of PBD-ZSD. We selected four variants that span the range of clinical severity to test in Drosophila 21 , 22 , 38 – 42 . We generated transgenic Drosophila lines with the four selected human variants, as well as a human reference line, designed to express the human protein (codon optimized) in Drosophila ( Figure 3C ). Our first variant, PEX2 E55K , was classified on ClinVar (Variation ID:13705) as a likely pathogenic variant in an individual with mild PBD-ZSD who was compound heterozygous with a pathogenic missense variant in PEX2 R1 19 * 21 , 22 . Experimental evidence from cells from patients with this particular PEX2 variant demonstrates that the PEX2 E55K variant displays residual enzymatic activity and is competent to import target proteins into peroxisomes 22 , 38 . The PEX2 E55K cells also demonstrate “peroxisomal mosaicism” in cell culture, where some cells within the culture do not contain peroxisomes 22 , 38 . This feature is thought to be related to the mild temperature sensitivity of the PEX allele and presumed stochastic factors within the cell culture 22 , 38 . PEX2 R119* is noted on ClinVar (Variation ID: 13704) as a pathogenic variant in several PBD-ZSD cases and is known to alter peroxisome assembly 39 . When homozygous, the PEX2 R119* variant has been shown to cause a severe PBD-ZSD (Zellweger syndrome) phenotype and death in early infancy 40 . When seen in cases with other PBD-ZSD variants, the clinical severity of the PEX2 R119* variant varies based on the other allele, with findings of mild PBD-ZSD with PEX2 R119* / PEX2 E55K and findings of mild PBD-ZSD manifesting as childhood-onset cerebellar ataxia and an axonal sensorimotor polyneuropathy with PEX2 R119* and a 1-bp insertion (c.865_866insA;170993.0006) in the PEX2 gene 22 , 41 . The PEX2 W223* variant is also noted on ClinVar (Variation ID: 139590) as a pathogenic variant. The proband, who was homozygous for the PEX2 W223* variant, displayed mild PBD-ZSD and had normal infancy, but by the age of 22 months, he had hypotonia, cerebellar and vermian atrophy, and continued to deteriorate until he died at age 13 40 , 42 . The last PEX2 variant generated was PEX2 C247R mutation, which is also noted on ClinVar (Variation ID: 139589) as a pathogenic variant. This variant was seen in a newborn patient with severe PBD-ZSD (Zellweger syndrome), with a low birth weight, severe hypotonia, seizures, absent corpus callosum, severe icterus, and absent peroxisomes leading to death at 3 months of age 40 . Download figure Open in new tab Figure 3 Human UAS cDNA PEX2 reference and variant lines. (A) Schematic representation of human PEX2 gene. (B) Schematic representation of human PEX2 protein and variant locations. (C) PEX2 variant table indicates the consequence of the change, pathogenicity prediction, clinical significance, clinical severity in homozygosity and heterozygosity, and conservation in Drosophila. (D) Indicates the observed/expected Mendelian ratio of the F1 generation of human PEX2 variants, in a fly null background. (E) Assessment of the phenotype of indicated genotypes as lethal, viable, or semi-lethal. Once we generated the reference and variant lines, we then crossed these lines to the Pex2 2 null background and generated flies that were compound heterozygous Pex2 KZ /Pex2 2 expressing the human transgenes. We had previously observed that Pex2 KZ /Pex2 2 without transgenes were semi-lethal leading to approximately 50% of the expected progeny by Mendelian ratios ( Figure 3D ). The PEX2 Ref human transgene was able to fully rescue this semi-lethality. Interestingly, the PEX2 E55K also fully rescued but the PEX2 C247R , PEX2 W223* and PEX2 R119* did not appear to rescue the semi-lethality, although PEX2 W223* was above 80% observed/expected ( Figure 3D-E ). We also followed a similar strategy to study human variants for PEX16 (Figure S2) . PEX16 is found on chromosome 11 ( Figure S2A ) and contains 2 transmembrane domains, a peroxisomal location domain, and a PEX19 interaction domain ( Figure S2B ). We have generated 2 transgenic Drosophila lines with human variants of varying clinical severity, as well as a PEX16 human reference line ( Figure S2C ). Our variant PEX16 R176* is interpreted as a pathogenic variant on ClinVar (Variation ID: 6466) and is expected to result in an absent or disrupted protein. This variant has been observed as homozygous or in trans with another pathogenic variant in patients with the hallmark clinical features of Zellweger syndrome 43 , 44 . We also generated a transgene for a unique case that we have previously reported. The patient was homozygous for a PEX16 F332del variant that is currently interpreted as likely pathogenic on ClinVar (Variation ID: 209181) 23 , 24 , 45 . Our proband had no symptoms until the age of 7 and then displayed a progressive ataxia phenotype that was undiagnosed for 18 years as the patient had multiple plasma studies including peroxisomal biochemical assays that had normal findings 23 , 24 . Utilizing both variants along with the reference line in PEX16 we documented rescue of semi-lethality of Pex16 KZ /Pex16 1 , and complete rescue by PEX16 Ref ( Figure S2D ). For the two PEX16 alleles, we saw no rescue of semi-lethality for the PEX16 R176* but the PEX16 F332del fully rescued ( Figure S2D-E ). Human PEX reference gene rescues fly peroxisome morphology Next, we wanted to test the impact of the human proteins on rescue to peroxisomal morphology defects ( Figure 4 ). We utilized anti-Pex3 staining in the 3 rd instar larval body wall muscle. The Pex3 antibody stains the early pre-peroxisomal vesicles, and we have previously observed that, in Pex2 null and Pex16 null mutants, Pex3 puncta are present but are significantly reduced with a more severe reduction in Pex16 mutants 25 , 30 . Download figure Open in new tab Figure 4 Human PEX2 expression in Pex2 null background larvae significantly rescues peroxisomes in 3 rd instar larva body wall 6 muscle. (A, A’& A’’) represents control group; (B, B’, & B’’) represents Pex2 null flies & (C, C’ & C’’) represents human rescue group. Quantification of Pex3 positive puncta between the three genotypes. [*p<0.05; ****p<0.0001] In the Pex2 control line, we see Pex3 staining in a puncta pattern throughout the body wall ( Figure 4A ). For Pex2 KZ /Pex2 2 mutants, we observed a dramatic reduction in the Pex3 puncta compared to control ( Pex2 KZ /+ ) ( Figure 4B, 4D ). This peroxisomal morphology phenotype is partially rescued by the human PEX2 expression ( Figure 4C ). The Pex3 reduction in the Pex2 KZ /Pex2 2 mutant is dramatic and statistically significant ( p <0.0001) providing further evidence that the Pex2 KZ is a strong loss-of-function allele ( Figure 4D ). The human reference PEX2 transgene expression leads to a robust increase in the Pex3 puncta compared to the Pex2 KZ /Pex2 2 mutant, but it is also significantly less than the control indicating a partial rescue ( Figure 4D ). In the Pex16 lines, we also saw a dramatic loss of Pex3 puncta in the mutant compared to the control, and this phenotype was also partially rescued by the human PEX16 transgene ( Figure S3 ). In summary, both human PEX2 and PEX16 human genes can function in Drosophila and partially rescue Pex3 staining, indicating that the human genes can successfully restore peroxisomes in a fly mutant. Therefore, we have generated humanized flies for PEX2 and PEX16 in which disease-causing variants and other phenotypes can be tested. Human PEX reference partially rescues fly Pex null behavior phenotypes, but the variants fail to do so To further study the effects of rescue-based humanization of Pex genes, we moved to three behavior assays (lifespan, bang sensitivity, and climbing) to observe and compare the behavior of the PEX variants and reference lines. We performed a lifespan analysis of our humanized PEX2 variants and reference flies ( FIGURE 5A-B ). We noted that the human PEX2 Ref partially rescues the shortened lifespan of Pex2 KZ /Pex2 2 in females and there is some degree of rescue with the PEX2 E55K ( FIGURE 5A ). The severe loss-of-function variants ( PEX2 R119* , PEX2 C247R , PEX2 W223* ) have a similar lifespan to the Pex2 KZ /Pex2 2 mutant and fail to rescue ( FIGURE 5A ). Female control flies Pex2 KZ /+ lived an average of 55.5 days and Pex2 2 /+ lived an average of 40.7 days. Female mutant flies Pex2 KZ /Pex2 2 lived an average of 29 days, PEX2 Ref ; Pex2 KZ /Pex2 2 lived an average of 33.1 days, PEX2 E55K ;Pex2 KZ /Pex2 2 lived an average of 25.9 days, PEX2 C247R ;Pex2 KZ /Pex2 2 lived an average of 17.2 days, PEX2 W223* ;Pex2 KZ /Pex2 2 lived an average of 21.2 days, and PEX2 R119* ;Pex2 KZ /Pex2 2 lived an average of 19.3 days. In males, the lifespan for Pex2 KZ /Pex2 2 is even shorter and is not rescued by the severe loss-of-function variants, but the PEX2 Ref appears to rescue. Interestingly, the mild allele PEX2 E55K is indistinguishable from null in the male lifespan assay ( FIGURE 5B ). Download figure Open in new tab Figure 5 Rescue-based humanization of Pex2 : Behavior Assays. (A) Lifespan analysis of PEX2 Ref and Variant female flies, along with our Pex2 null and control lines. (B) Lifespan analysis of PEX2 Ref and Variant male flies, along with our Pex2 null and control lines. (C) Bang sensitivity assay of PEX2 Ref and Variant female flies, along with our Pex2 null and control lines, at 10 days after eclosion (DAE). (D) Bang sensitivity assay of PEX2 Ref and Variant female flies, along with our Pex2 null and control lines, at 15 days after eclosion. (E-G) Climbing assay of PEX2 Ref and Variant female flies, along with our Pex2 null and control lines, at 5 days, 10 days, and 15 days after eclosion. [* = p -value is less than 0.05. ** = p -value is less than 0.01. *** = p -value is less than 0.001. **** = p -value is less than 0.0001] Additionally, the male reference flies have a much more significant rescue, especially noting that Pex2 male null flies tend to have a shorter lifespan than female nulls. Male control flies Pex2 KZ /+ lived an average of 55.9 days and Pex2 2 /+ lived an average of 43.9 days. Male mutant flies Pex2 KZ /Pex2 2 lived an average of 16.2 days, PEX2 Ref ; Pex2 KZ /Pex2 2 lived an average of 38.4 days, PEX2 E55K ;Pex2 KZ /Pex2 2 lived an average of 13.8 days, PEX2 C247R ;Pex2 KZ /Pex2 2 lived an average of 13 days, PEX2 W223* ;Pex2 KZ /Pex2 2 lived an average of 12.4 days, and PEX2 R119* ;Pex2 KZ /Pex2 2 lived an average of 13.2 days. Next, we observed the PEX2 variants and reference flies’ behavior in response to the bang sensitivity assay at 10 and 15 days after eclosion ( FIGURE 5C-D ). On day 10, we found that PEX2 Ref can partially rescue the Pex2 null phenotype. However, the variants PEX2 R119* and PEX2 C247R fail to rescue, and PEX2 E55K and PEX2 W223* did not differ significantly from the reference ( FIGURE 5C ). At day 15, the flies become slightly more bang-sensitive, showing that there is progressive neuronal dysfunction ( FIGURE 5D ). Interestingly, PEX2 E55K continued to behave not significantly different to PEX2 Ref at day 15 ( FIGURE 5D ). We also noted age-dependent worsening of phenotype when observing the flies’ ability to climb at 5 days, 10 days, and 15 days after eclosion ( FIGURE 5E-G ). We found, again, that the PEX2 Ref flies were able to partially rescue the fly null phenotype, and we found that the variants behave similarly to the Pex2 null flies. PEX2 R119* , PEX2 C247R , and PEX2 W223* expressed in flies all behave as null alleles in each of the three assays. However, we show that the PEX2 E55K variant, associated with mild PBD-ZSD rescues lifespan for females but not males, rescues bang sensitivity, and has an intermediate rescue of climbing at different ages. Altogether, the PEX2 E55K allele is likely a hypomorphic allele. We conducted the same three behavior assays for the PEX16 variants and reference lines. We first performed a lifespan analysis of our humanized PEX16 variants and reference flies ( FIGURE S4A-B ). We noted that the human PEX16 Ref partially rescues the shortened lifespan of Pex16 KZ /Pex16 1 in both females and males, and there is also partial rescue with PEX16 F332del ( FIGURE S4A-B ). The severe loss-of-function PEX16 R176* variant has a similar lifespan to Pex16 KZ /Pex16 1 and fails to rescue in both females and males ( FIGURE S4A-B ). Female control flies Pex16 KZ /+ lived an average of 50.5 days and Pex16 1 /+ lived an average of 49 days. Female mutant flies Pex16 KZ /Pex16 1 lived an average of 13.2 days, PEX16 Ref ; Pex16 KZ /Pex16 1 lived an average of 26.2 days, PEX16 F332del ;Pex16 KZ /Pex16 1 lived an average of 26.3 days, and PEX16 R176* ;Pex16 KZ /Pex16 1 lived an average of 11 days. Male control flies Pex16 KZ /+ lived an average of 51.2 days and Pex16 1 /+ lived an average of 40 days. Male mutant flies Pex16 KZ /Pex16 1 lived an average of 8.5 days, PEX16 Ref ; Pex16 KZ /Pex16 1 lived an average of 23 days, PEX16 F332del ;Pex16 KZ /Pex16 1 lived an average of 26.2 days, and PEX16 R176* ;Pex16 KZ /Pex16 1 lived an average of 12 days. Next, we performed the bang sensitivity assay on our PEX16 variant and reference flies at 10 and 15 days after eclosion ( FIGURE S4C-D ). We found that our human reference flies could rescue the Pex16 null bang sensitivity. Interestingly, the PEX16 R176* variant flies could not rescue the bang-sensitive phenotype, but the PEX16 F332del variant flies had no significant difference with the reference flies at day 10 or day 15 and could also rescue the phenotype. We also observed PEX16 Ref and variant flies’ ability to climb at 5 days, 10 days, and 15 days ( FIGURE S4E-G ). We found that the PEX16 R176* variant behaved similarly to the Pex16 null flies and could not rescue the phenotype. However, the reference and PEX16 F332del flies could partially rescue the climbing defect. Interestingly, the PEX16 F332del flies were similar to PEX16 Ref at 5 and 10 days and actually behaved better than PEX16 Ref at day 15 ( Figure S4G ). In summary, the PEX16 F332del allele which is associated with an atypical ataxia clinical presentation exhibits a complete rescue of shortened lifespan, a complete rescue of bang sensitivity at day 10 and day 15, a near complete rescue of bang sensitivity and Day 15, and overall better rescue than reference for climbing. Loss of Pex genes leads to phenotypes in the direct flight muscle, but the human PEX reference is able to rescue In our previous characterization of Pex2 and Pex16 deletion alleles, we observed climbing, lifespan, and flight defects 30 . Given that we saw locomotor and lifespan rescue with the human transgenes, we decided to assess the morphology of indirect flight muscles. In control flies ( Pex2 KZ /+ ), we observe Pex3 puncta intercalating the muscle fibers and stained HRP to examine the innervating nerve fiber in 0-day-old flies ( Figure 6A ). In the mutant, we observed a reduction in Pex3 staining and an apparent thickening of the surrounding nerve fiber, an intriguing observation as the 0-day-old flies exhibit locomotor defects in our bang sensitivity and climbing assay ( Figure 6B ). The human PEX2 transgene expression partially rescued peroxisomes (Pex3 staining) and appears to rescue the nerve fiber thickening observed in the mutant ( Figure 6C ). The differences were statistically significant, indicating a partial peroxisome rescue ( Figure 6D ). Download figure Open in new tab Figure 6 Human PEX2 expression in Pex2 null background significantly rescues peroxisome number in direct flight muscle (DFM49) in adult flies. (A, A’, A’’ & A’’’) represents control group; (B, B’, B’’ & B’’’) represents Pex2 null flies & (C, C’, C’’ & C’’’) represents human rescue group. (A’’’’, B’’’ & C’’’’) illustrates the closure look at Pex3 puncta within the square box selected ROI for each respective group i.e., control, knockdown & rescue. Scale bar corresponds to 10 µm & 5 µm respectively. DFM49 marked with long dashed line. (D) Quantification of Pex3 puncta between the three genotypes. [**p<0.01; ****p<0.0001] Similarly, we assessed the morphology of the indirect light muscle in Pex16 flies. In our control flies, we observe Pex3 puncta intercalating the muscle fiber and HRP innervating the nerve fiber in 0-day-old flies ( Figure S5A ). In our Pex16 mutant, we observed a dramatic reduction in Pex3 staining and thickening of the innervating nerve fiber ( Figure S5B ). However, the human PEX16 transgene expression is able to rescue Pex3 staining and the nerve fiber thickening seen in the Pex16 mutant ( Figure S5D ). Discussion In this study, we generated “humanized” Drosophila Pex2 and Pex16 to the study the evolutionary conservation of the PEX genes across species and to assay the effect of human mutations 36 , 37 . In our study, we generated KozakGAL4 alleles where we replaced the coding sequence of the fly gene with GAL4 , generating a driver that allows expression of the human gene in its place 31 . Upon finding that these unique alleles effectively serve as nulls, we used the KozakGAL4 lines to express human UAS-cDNAs of our targeted PEX2 and PEX16 gene and variants to assess rescue of the fly null phenotype. We began testing the impact of human proteins and their ability to rescue peroxisomal morphology defects. We found that Pex2 and Pex16 null mutants have a significantly reduced number of Pex3 puncta, but PEX2 Ref and PEX16 Ref can partially rescue the number of Pex3 puncta, demonstrating that the human protein can partially function in place of the fly protein in vivo . With these findings, PEX2 and PEX16 human reference constructs successfully restore peroxisomes, confirming the generation of humanized flies for PEX2 and PEX16 . It is remarkable to note that, for these two Pex genes, the human protein can participate in fly peroxisome biogenesis in distinct steps of the process, despite over 500 million years of evolution separating the fly and human genome. In addition to humanization, another benefit of the KozakGAL4 lines for Pex2 and Pex16 is that we could see the endogenous expression pattern of these genes in the fly. While we would expect peroxisome biogenesis to be a general process, in this study we did not observe ubiquitous expression of either Pex2 or Pex16 . Moreover, there were differences in Pex16 and Pex2 expression patterns. We are relatively confident that our experiments mark the true expression of these genes because we find that human rescue is an independent confirmation for the respective Pex gene expression patterns. This is because the UAS human cDNA rescues the mutant phenotype while being expressed in a subset of cells. Since human rescue argues against the possibility that we do not see the full expression, we confirm that the expression patterns of Pex2 and Pex16 differ. This is somewhat surprising since peroxisome biogenesis requires both factors, as well as the other Pex genes. Performing various behavior assays, we found that PEX2 Ref and PEX16 Ref were able to partially rescue Pex2 and Pex16 shortened lifespan, bang sensitivity, and defective climbing behavior. Interestingly, in addition to confirming human rescue, we also found that previously characterized “mild” or “atypical” PBD variants also produced a mild phenotype in the various assays. After utilizing rescue-based humanization of Pex genes, we found that our PEX2 E55K and PEX16 F332del variants display milder behavior phenotypes, compared to the other pathogenic variants. This finding corresponds to previous studies on mild PBD variants 21 – 24 , 38 , suggesting an allelic spectrum for PEX2 and PEX16 . Based on previous studies, the four PEX2 variants chosen range in clinical severity for classic PBD-ZSD 21 , 22 , 38 – 42 . The PEX2 E55K variant has been identified in patients with mild PBD-ZSD in compound heterozygosity with the PEX2 R1 19 * variant 21 , 22 , 38 . In our assays, we found that the PEX2 E55K variant has a less severe phenotype compared to the other PEX2 variants, having the best performance in lifespan analysis in females, the least severe bang-sensitive phenotype among the variants, and a slight decrease in climbing ability that is significantly better than the other variants. PEX2 E55K never fully rescued the phenotypes, but except for male lifespan, it was consistently a hypomorph. Our other three PEX2 variants have been characterized as pathogenic, but the clinical significance varies among patients. The homozygous PEX2 W223* variant was identified in a patient with mild-PBD-ZSD 40 , 42 . While the PEX2 W2 23 * flies did not perform as well in the various assays, it had a slightly better performance in viability assay and bang sensitivity than the PEX2 R119* and PEX2 C247R variants. The PEX2 R119* variant has been identified in patients with severe and more mild cases of PBD-ZSD, where homozygous probands trend towards a more severe expression of the disease and patients with compound heterozygous genotype show milder or atypical presentations 22 , 39 – 41 . In flies, PEX2 R119* had a more severe phenotype in behavior assays than the other two variants previously mentioned. Lastly, the presence of the homozygous PEX2 C247R variant is also associated with a severe PBD-ZSD phenotype 40 . In flies, PEX2 C247R also displayed the most severe phenotype in the behavior assays overall. With these findings, we propose an allelic severity spectrum with PEX2 E55K being the least severe and PEX2 C247R being the most severe ( PEX2 E55K < PEX2 W223* < PEX2 R119* < PEX2 C247R ) ( Table 1 ). View this table: View inline View popup Table 1 Clinical and Functional Severity of PEX2 and PEX16 gene mutations Pex2 and Pex16 variant severity, considering clinical significance and severity, as well as outcomes observed from the study. Additionally, we also found an allelic spectrum with our two PEX16 variants. The PEX16 F332del variant was reported by our group in a patient homozygous for the variant and with an atypical presentation of PBD-ZSD, having ataxia but normal peroxisomal biochemical testing in plasma 23 , 24 . In flies, we found that the PEX16 F332del had completely viable F1 progeny, a lifespan similar to PEX16 Ref , could rescue bang-sensitive, and even outperformed the human reference in the climbing assay at day 15. Alternatively, the homozygous PEX16 R176* variant was seen in a patient who presented with a severe PBD-ZSD phenotype 43 , 44 . In flies, PEX16 R176* was observed to have much more severe behavior phenotypes consistent with a null allele. PEX16 R176* flies have semi-lethality in their F1 progeny, a decreased lifespan, severe bang sensitivity, and a severe climbing defect. With these findings, we propose an allelic severity spectrum with PEX16 F332del being a mild variant and PEX16 R176* being a severe variant ( PEX16 F332del < PEX16 R176* ) ( Table 1 ). Our data is informative for understanding the difference between mild PBD-ZSD with classic involvement of the retina and hearing versus the atypical ataxia phenotypes. The PEX16 F332del variant has been associated with atypical ataxia with normal retinal and hearing findings. This atypical ataxia phenotype for PEX16 has been characterized by other groups but lacks the classic features of PBD-ZSD, and its relationship to the classic spectrum has been unclear 46 , 47 . Our data shows that the ataxia allele behaves as a very weak hypomorphic allele in some contexts and is normal or even better than reference in others. This suggests that a certain level of very mild PEX16 alleles can produce unique phenotypes that are not clinically recognizable as PBD-ZSD. Severe alleles in PEX genes lead to severe clinical presentations, but in recent years, the mild presentations due to PEX mutations have expanded from phenotypes labeled as “infantile Refsum disease” to include atypical ataxia in PEX16 and Heimler syndrome in PEX1 and PEX6 . How these mild conditions can differ so drastically is not yet understood. Using humanized flies to continue building an allelic spectrum as additional variants emerge has the great potential to fully distinguish the differences between these alleles. In the future, it will be interesting to determine how severe Heimler syndrome alleles alter the behavior and peroxisomal morphology in Drosophila compared to those studied here. Drosophila allows multiple in vivo assays for these variants to probe the pleiotropic effects of PEX genes on the neurological system. Methods Fly strains and maintenance All flies were maintained at room temperature (21C), except when otherwise noted. Experiments were conducted at room temperature, as well. Pex2 lines TI{KozakGAL4} Pex2 [CR70193-KO-kG4] (labeled as Pex2 KZ ) (BDSC# 94997) were generated as described 31 . sgRNA target sites in Pex2 UTRs are as follows: (TTTGTTTATATTCTTGCCTTTGG and GGTTCTGCGTGTCCTGAGTCGGG). Information about homology arms and the primers used to verify the insertions can be found at https://flypush.research.bcm.edu/pscreen/crimic/crimic.php . The Pex2 1 and Pex2 2 lines were derived from imprecise excision of (w[1118]; P{w[+mC] = E[g}pex2[HP35039]/TM3Sb[1] . These were then backcrossed with 5 generations with yw:FRT80B and studied as: yw ; FRT80B-Pex2 1 (labeled as Pex2 1 ) yw ; FRT80B-Pex2 2 (labeled as Pex2 2 ) Additionally, a genomic deficiency line uncovering the Pex2 locus was used as w118;Df(3L)BSC376/TM6C,Sb1 (labeled as Pex2 Df ) For the generation of the human UAS- PEX2 lines for Reference, E55K, R119X, W223X, C247R we obtained constructs which were codon-optimized for Drosophila and encoded the human protein from GeneART TM (Thermo Fisher Scientific) (See Supplemental Text ). These constructs were subcloned into the pUAST-attB vector using NotI and XhoI restriction sites. The UAS-constructs were then injected and inserted into the same genomic locus on the second chromosome (VK37 docking site) via φC31-mediated transgenesis 48 . Pex16 lines TI{KozakGAL4} Pex16 [CR70194-KO-kG4] (labeled as Pex16 KZ ) (BDSC# 94998) were generated as described 31 . sgRNA target sites in Pex16 UTRs are as follows: ATAAAAATAATGAGGTGTTTCGG and TAGAGCGTTAGTATTCCCCTAGG). Information about homology arms and the primers used to verify the insertions can be found at https://flypush.research.bcm.edu/pscreen/crimic/crimic.php . The yw:Pex16 1 line was obtained from Kenji Matsuno, derived from y 1 w 67c23 ; P{w[+mC]y[+mDint2] = EPgy2}Pex16[EY05323]. yw ; Pex16 1 (labeled as Pex16 1 ) For the generation of the human UAS- PEX16 lines for Reference, R176X and del955TCT (F332del), we obtained constructs which were codon-optimized for Drosophila and encoded the human protein from GeneART TM (Thermo Fisher Scientific) (See Supplemental Text ). These constructs were subcloned into the pUAST-attB vector using NotI and XhoI restriction sites. The UAS-constructs were then injected and inserted into the same genomic locus on the second chromosome (VK37 docking site) via φC31-mediated transgenesis 48 . Lifespan determination Flies were collected under CO2 between 1 and 24 hours after eclosion. Male and female flies were separated and kept with 10 flies per vial at 25C. 100 flies of each line were collected, 50 females and 50 males. Fly food was changed every 3 days. The number of live flies was checked every 3 days until the last fly had died. A tally of the number of flies and their lifespan was kept, and the data was analyzed with a Kaplan-Meier survival curve. Bang sensitivity assay Flies were kept without exposure to CO2 for at least 48 hours prior to the assay. Flies were vortexed for 10 seconds in an empty vial and the time it took to recover to normal behavior was recorded. Bang sensitivity was done for flies at 5 days, 10 days, and 15 days after eclosion. Climbing assay Flies were kept without exposure to CO2 for at least 48 hours prior to the assay. Climbing assay was performed on flies at 5 days, 10 days, and 15 days after eclosion. Flies were dropped into an empty vial and timed to see how long it took to climb to the 8 cm mark within 60 seconds. Immunocytochemistry Tissue samples were collected from wandering third instar larvae for body wall muscle and from the adult thorax for Direct flight muscle 49 (DFM49). Dissections were performed on Sylgard plates using 1x PBST (1% Tween 20 in 1x phosphate-buffered saline). The dissected larvae were fixed in 4% paraformaldehyde for 10 minutes at room temperature. After fixation, they were washed three times with PBST for 10 minutes each and then blocked with goat serum for 30 minutes. The samples were incubated overnight at 4°C with primary antibodies, followed by three additional washes with PBST. Next, they were incubated overnight at 4°C with secondary antibodies and washed again three times with PBST. Finally, the samples were mounted on slides using Vectashield containing DAPI. The primary antibody used was rabbit anti-Pex3 at a dilution of 1:500, (from the McNew lab at Rice University). The secondary antibody was donkey anti-rabbit IgG conjugated to Cy3 at a dilution of 1:1000. For immunostaining neuromuscular junctions in adult DFM49, we used Alexa Fluor 488 conjugated rabbit anti-horseradish peroxidase (HRP) at a dilution of 1:1000, which specifically recognizes the HRP epitope present on the surface of all Drosophila neurons. Fluorescence microscopy imaging Imaging was performed using a Zeiss LSM800 Airyscan confocal microscope. Images were acquired with a Plan-Apochromat 40x/1.2 NA water immersion objective, using a frame size of 1024x1024 pixels. The excitation and emission wavelengths were as follows: ex405/em410-480 nm for DAPI, ex488/em493-570 nm for AF488, and ex561/em576-700 nm. The raw images were processed using the Airyscan Processing module in Zen 2.6 – Blue edition (Carl Zeiss Microscopy GmbH, Germany), applying the 2D SR processing option. The Airyscan filtering, utilizing a Wiener filter for deconvolution, was set to Standard. Image quantitative analysis All fluorescence images were quantified and analyzed using the Surface module of Imaris v9.8.2 (Bitplane, Zurich, Switzerland). In this module, surfaces were generated for the fluorophore signal of interest, employing the background subtraction option and setting a lower area limit of 0.5 µm². This threshold was established to reduce background noise and minimize false positives during surface creation. Voxels outside the surface were masked and assigned a zero value. The number of surface puncta was then obtained from the statistical data generated for the created surface. Statistical analysis Statistical analysis is completed using GraphPad Prism (Version 10.1.1). Continuous analysis is completed by Ordinary one-way ANOVA with multiple comparisons test, where differences between groups are quantified and a p -value less than 0.05 is considered significant. Funding This work was supported by the National Institute for Neurological Disorders and Stroke 671 5R01NS107733 to MFW and support from the Global Foundation for Peroxisomal Disorders (GFPD), the Wynne Mateffy Research Foundation and RhizoKids International. OK is supported by Office of Infrastructure Programs of National Institutes of Health R24OD031447 and Southern Star Medical Research Institute. Supplementary Figure Legend Figure S1 Drosophila Pex16 mutants have shortened lifespan, are bang-sensitive, and have a climbing defect. (A) Schematic representation of fly Pex16 gene along with one frameshift alleles ( Pex16 1 ) and Pex16 - KozakGAL4 (Pex16 KZ ). (B) Pex16 female lifespan assay shows that the Pex16 mutants have a shorter lifespan compared to control lines (pink and purple). (C) Pex16 male lifespan assay shows that the Pex16 mutants have a shorter lifespan compared to control lines. D) Pex16 null flies have a significant bang- sensitive phenotype (red) compared to controls (pink and purple) observed at 10 days after eclosion (DAE). (E) Pex16 null flies have a significant climbing deficiency (red) compared to controls (pink and purple) observed at 10 days after eclosion. [* = p -value is less than 0.05. ** = p -value is less than 0.01. *** = p -value is less than 0.001. **** = p - value is less than 0.0001] Figure S2 Human UAS cDNA PEX16 reference and variant lines. (A) Schematic representation of human PEX16 gene. (B) Schematic representation of human PEX16 protein and variant locations. (C) PEX16 variant table indicates the consequence of the change, pathogenicity prediction, clinical significance, clinical severity in homozygosity and heterozygosity, and conservation in Drosophila. (D) Indicates the observed/expected Mendelian ratio of the F1 generation of human PEX16 variants, in a fly null background. (E) Assessment of the phenotype of indicated genotypes as lethal, viable, or semi-lethal. Figure S3 Human PEX16 expression in Pex16 null background larvae significantly rescues peroxisomes in 3 rd instar larva body wall 6 muscle. (A, A’ & A’’) represents control group; (B, B’, & B’’) represents Pex16 null flies & (C, C’ & C’’) represents human rescue group. (D) Quantification of Pex3 positive puncta between the three genotypes. [**p=0.0011; ***p=0.001; ****p<0.0001] Figure S4 Rescue-based humanization of Pex16 : Behavior Assays. (A) Lifespan analysis of PEX16 Ref and Variant female flies, along with our Pex16 null and control lines. (B) Lifespan analysis of PEX16 Ref and Variant male flies, along with our Pex16 null and control lines. (C) Bang sensitivity assay of PEX16 Ref and Variant female flies, along with our Pex16 null and control lines, at 10 days after eclosion (DAE). (D) Bang sensitivity assay of PEX16 Ref and Variant female flies, along with our Pex16 null and control lines, at 15 days after eclosion. (E-G) Climbing assay of PEX16 Ref and Variant female flies, along with our Pex16 null and control lines, at 5 days, 10 days, and 15 days after eclosion. [* = p -value is less than 0.05. ** = p -value is less than 0.01. *** = p -value is less than 0.001. **** = p - value is less than 0.0001] Figure S5 Human PEX16 expression in Pex16 null background significantly rescues peroxisome number in direct flight muscle (DFM49) in adult flies. (A, A’, A’’ & A’’’) represents control group; (B, B’, B’’ & B’’’) represents Pex16 null flies & (C, C’, C’’ & C’’’) represents rescue group. (A’’’’, B’’’’ & C’’’’) illustrates the closure look at Pex3 puncta within the square box selected ROI for each respective group i.e., control, knockdown & rescue. Scale bar corresponds to 10 µm & 5 µm respectively. DFM49 marked with long dashed line. Acknowledgments We acknowledge Carlos Bacino for introducing us to PEX16 related ataxia. We also acknowledge the families affected by Peroxisomal disorders. Footnotes Emails of co-authors: Oguz Kanca: Oguz.Kanca{at}bcm.edu , Sharayu V. Jangam: Sharayu.Jangam{at}bcm.edu , Saurabh Srivastav: Saurabh.Srivastav{at}bcm.edu , Jonathan C. Andrews: Jonathan.Andrews{at}bcm.edu We added the supplemental figures and supplemental text Bibliography 1. ↵ Delille , H. K. , Bonekamp , N. A. & Schrader , M . Peroxisomes and Disease - An Overview . Int. J. Biomed. Sci. IJBS 2 , 308 – 314 ( 2006 ). OpenUrl CrossRef PubMed 2. ↵ Wanders , R. J. A . Metabolic and molecular basis of peroxisomal disorders: a review . Am. J. Med. Genet. A . 126A , 355 – 375 ( 2004 ). 3. ↵ Moser , A. E. et al. The cerebrohepatorenal (Zellweger) syndrome. Increased levels and impaired degradation of very-long-chain fatty acids and their use in prenatal diagnosis . N. Engl. J. Med . 310 , 1141 – 1146 ( 1984 ). OpenUrl CrossRef PubMed Web of Science 4. ↵ Poulos , A. , Sharp , P. , Fellenberg , A. J. & Johnson , D. W . Accumulation of pristanic acid (2, 6, 10, 14 tetramethylpentadecanoic acid) in the plasma of patients with generalised peroxisomal dysfunction . Eur. J. Pediatr . 147 , 143 – 147 ( 1988 ). 5. ↵ Van Veldhoven , P. P . Biochemistry and genetics of inherited disorders of peroxisomal fatty acid metabolism . J. Lipid Res . 51 , 2863 – 2895 ( 2010 ). OpenUrl Abstract / FREE Full Text 6. ↵ Heymans , H. S. , Schutgens , R. B. , Tan , R. , van den Bosch , H. & Borst , P. Severe plasmalogen deficiency in tissues of infants without peroxisomes (Zellweger syndrome) . Nature 306 , 69 – 70 ( 1983 ). OpenUrl CrossRef PubMed 7. ↵ Braverman , N. E. & Moser , A. B . Functions of plasmalogen lipids in health and disease . Biochim. Biophys. Acta 1822, 1442 – 1452 ( 2012 ). 8. ↵ Fransen , M. , Nordgren , M. , Wang , B. & Apanasets , O . Role of peroxisomes in ROS/RNS-metabolism: implications for human disease . Biochim. Biophys. Acta 1822, 1363 – 1373 ( 2012 ). 9. ↵ Vandor , S. L. & Tolbert , N. E . Glyoxylate metabolism by isolated rat liver peroxisomes . Biochim. Biophys. Acta 215 , 449 – 455 ( 1970 ). OpenUrl PubMed 10. ↵ Wanders , R. J. A. & Waterham , H. R . Biochemistry of mammalian peroxisomes revisited . Annu. Rev. Biochem . 75 , 295 – 332 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 11. ↵ 11. Peroxisomal Disorders - The Global Foundation for Peroxisomal Disorders. https://thegfpd.org/peroxisomal-disorders/ ( 2021 ). 12. ↵ Wanders , R. & Waterham , H . Peroxisomal disorders I: biochemistry and genetics of peroxisome biogenesis disorders . Clin. Genet . 67 , 107 – 133 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 13. ↵ Baumgartner , M. R. & Saudubray , J. M. Peroxisomal disorders . Semin. Neonatol . SN 7 , 85 – 94 ( 2002 ). 14. ↵ Gould , S. J. & Valle , D . Peroxisome biogenesis disorders: genetics and cell biology . Trends Genet. TIG 16 , 340 – 345 ( 2000 ). OpenUrl CrossRef PubMed 15. ↵ Bose , M. et al. Characterization of Severity in Zellweger Spectrum Disorder by Clinical Findings: A Scoping Review, Meta-Analysis and Medical Chart Review . Cells 11 , 1891 ( 2022 ). 16. ↵ Fujiki , Y. , Okumoto , K. , Mukai , S. , Honsho , M. & Tamura , S . Peroxisome biogenesis in mammalian cells . Front. Physiol . 5 , ( 2014 ). 17. ↵ Subramani , S . Components involved in peroxisome import, biogenesis, proliferation, turnover, and movement . Physiol. Rev . 78 , 171 – 188 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 18. ↵ Platta , H. W. et al. Pex2 and pex12 function as protein-ubiquitin ligases in peroxisomal protein import . Mol. Cell. Biol . 29 , 5505 – 5516 ( 2009 ). OpenUrl Abstract / FREE Full Text 19. ↵ Waterham , H. R. & Ebberink , M. S . Genetics and molecular basis of human peroxisome biogenesis disorders . Biochim. Biophys. Acta 1822, 1430 – 1441 ( 2012 ). 20. ↵ Rosewich , H. , Ohlenbusch , A. & Gärtner , J . Genetic and clinical aspects of Zellweger spectrum patients with PEX1 mutations . J. Med. Genet . 42 , e58 ( 2005 ). OpenUrl Abstract / FREE Full Text 21. ↵ Imamura , A. et al. Temperature-sensitive phenotypes of peroxisome-assembly processes represent the milder forms of human peroxisome-biogenesis disorders . Am. J. Hum. Genet . 62 , 1539 – 1543 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 22. ↵ Shimozawa , N. et al. Defective PEX gene products correlate with the protein import, biochemical abnormalities, and phenotypic heterogeneity in peroxisome biogenesis disorders . J. Med. Genet . 36 , 779 – 781 ( 1999 ). OpenUrl Abstract / FREE Full Text 23. ↵ Bacino , C. A. et al. A homozygous mutation in PEX16 identified by whole-exome sequencing ending a diagnostic odyssey . Mol. Genet. Metab. Rep . 5 , 15 – 18 ( 2015 ). OpenUrl CrossRef PubMed 24. ↵ Bacino , C. et al. Dataset for a case report of a homozygous PEX16 F332del mutation . Data Brief 6 , 722 – 727 ( 2015 ). OpenUrl PubMed 25. ↵ Faust , J. E. et al. Peroxisomes are required for lipid metabolism and muscle function in Drosophila melanogaster . PloS One 9 , e100213 ( 2014 ). OpenUrl CrossRef PubMed 26. Chen , H. , Liu , Z. & Huang , X . Drosophila models of peroxisomal biogenesis disorder: peroxins are required for spermatogenesis and very-long-chain fatty acid metabolism . Hum. Mol. Genet . 19 , 494 – 505 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 27. ↵ Faust , J. E. , Verma , A. , Peng , C. & McNew , J. A . An inventory of peroxisomal proteins and pathways in Drosophila melanogaster . Traffic Cph. Den . 13 , 1378 – 1392 ( 2012 ). OpenUrl CrossRef 28. Mast , F. D. et al. A Drosophila model for the Zellweger spectrum of peroxisome biogenesis disorders . Dis. Model. Mech . 4 , 659 – 672 ( 2011 ). OpenUrl Abstract / FREE Full Text 29. Nakayama , M. et al. Drosophila Carrying Pex3 or Pex16 Mutations Are Models of Zellweger Syndrome That Reflect Its Symptoms Associated with the Absence of Peroxisomes . PLoS ONE 6 , e22984 ( 2011 ). OpenUrl CrossRef PubMed 30. ↵ Wangler , M. F. et al. Peroxisomal biogenesis is genetically and biochemically linked to carbohydrate metabolism in Drosophila and mouse . PLOS Genet . 13 , e1006825 ( 2017 ). OpenUrl CrossRef PubMed 31. ↵ Kanca , O. et al. An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombination . eLife 11 , e76077 . 32. ↵ Dutta , D. et al. Loss of the endoplasmic reticulum protein Tmem208 affects cell polarity, development, and viability . Proc. Natl. Acad. Sci. U. S. A . 121 , e2322582121 ( 2024 ). OpenUrl CrossRef PubMed 33. ↵ Yamamoto , S. , Kanca , O. , Wangler , M. F. & Bellen , H. J . Integrating non- mammalian model organisms in the diagnosis of rare genetic diseases in humans . Nat. Rev. Genet . 25 , 46 – 60 ( 2024 ). OpenUrl CrossRef PubMed 34. ↵ Fergestad , T. , Bostwick , B. & Ganetzky , B . Metabolic Disruption in Drosophila Bang-Sensitive Seizure Mutants . Genetics 173 , 1357 – 1364 ( 2006 ). OpenUrl Abstract / FREE Full Text 35. ↵ Madabattula , S. T. et al. Quantitative Analysis of Climbing Defects in a Drosophila Model of Neurodegenerative Disorders . J. Vis. Exp. JoVE 52741 ( 2015 ) doi: 10.3791/52741 . OpenUrl CrossRef 36. ↵ Harnish , J. M. et al. In Vivo Functional Study of Disease-Associated Rare Human Variants using Drosophila . J. Vis. Exp. JoVE ( 2019 ) doi: 10.3791/59658 . OpenUrl CrossRef 37. ↵ Bellen , H. J. & Yamamoto , S . Morgan’s legacy: fruit flies and the functional annotation of conserved genes . Cell 163 , 12 – 14 ( 2015 ). OpenUrl CrossRef PubMed 38. ↵ Fujiwara , C. et al. Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesis disorder . J. Biol. Chem . 275 , 37271 – 37277 ( 2000 ). OpenUrl Abstract / FREE Full Text 39. ↵ Shimozawa , N. et al. A human gene responsible for Zellweger syndrome that affects peroxisome assembly . Science 255 , 1132 – 1134 ( 1992 ). OpenUrl Abstract / FREE Full Text 40. ↵ Gootjes , J. et al. Novel Mutations in the PEX2 Gene of Four Unrelated Patients with a Peroxisome Biogenesis Disorder . Pediatr. Res . 55 , 431 – 436 ( 2004 ). OpenUrl CrossRef PubMed 41. ↵ Mignarri , A. et al. Zellweger Spectrum Disorder with Mild Phenotype Caused by PEX2 Gene Mutations . JIMD Rep . 6 , 43 – 46 ( 2012 ). OpenUrl CrossRef PubMed 42. ↵ Mandel , H. et al. A new type of peroxisomal disorder with variable expression in liver and fibroblasts . J. Pediatr . 125 , 549 – 555 ( 1994 ). OpenUrl CrossRef PubMed Web of Science 43. ↵ Honsho , M. et al. Mutation in PEX16 is causal in the peroxisome-deficient Zellweger syndrome of complementation group D . Am. J. Hum. Genet . 63 , 1622 – 1630 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 44. ↵ Ohba , C. et al. Diagnostic utility of whole exome sequencing in patients showing cerebellar and/or vermis atrophy in childhood . Neurogenetics 14 , 225 – 232 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 45. ↵ Posey , J. E. et al. Molecular Diagnostic Experience of Whole-Exome Sequencing in Adult Patients . Genet. Med. Off. J. Am. Coll. Med. Genet . 18 , 678 ( 2016 ). 46. ↵ Cheung , A. et al. Clinical, neuroradiological, and molecular characterization of patients with atypical Zellweger spectrum disorder caused by PEX16 mutations: a case series . neurogenetics 23 , 115 – 127 ( 2022 ). OpenUrl CrossRef PubMed 47. ↵ Ebberink , M. S. et al. Identification of an unusual variant peroxisome biogenesis disorder caused by mutations in the PEX16 gene . J. Med. Genet . 47 , 608 – 615 ( 2010 ). OpenUrl Abstract / FREE Full Text 48. ↵ Venken , K. J. T. , He , Y. , Hoskins , R. A. & Bellen , H. J . P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster . Science 314 , 1747 – 1751 ( 2006 ). OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted November 19, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Distinguishing PEX gene variant severity for mild, severe, and atypical peroxisome biogenesis disorders in Drosophila Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Distinguishing PEX gene variant severity for mild, severe, and atypical peroxisome biogenesis disorders in Drosophila Vanessa A. Gomez , Oguz Kanca , Sharayu V. Jangam , Saurabh Srivastav , Jonathan C. Andrews , Michael F. Wangler bioRxiv 2024.11.14.623590; doi: https://doi.org/10.1101/2024.11.14.623590 Share This Article: Copy Citation Tools Distinguishing PEX gene variant severity for mild, severe, and atypical peroxisome biogenesis disorders in Drosophila Vanessa A. Gomez , Oguz Kanca , Sharayu V. Jangam , Saurabh Srivastav , Jonathan C. Andrews , Michael F. Wangler bioRxiv 2024.11.14.623590; doi: https://doi.org/10.1101/2024.11.14.623590 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7651) Biochemistry (17746) Bioengineering (13928) Bioinformatics (42066) Biophysics (21499) Cancer Biology (18650) Cell Biology (25579) Clinical Trials (138) Developmental Biology (13409) Ecology (19947) Epidemiology (2067) Evolutionary Biology (24374) Genetics (15633) Genomics (22557) Immunology (17775) Microbiology (40505) Molecular Biology (17217) Neuroscience (88796) Paleontology (667) Pathology (2845) Pharmacology and Toxicology (4836) Physiology (7664) Plant Biology (15179) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9839) Zoology (2272)