Transcription factor SmMYC2 regulates secondary cell wall thickening to enhance drought resilience in eggplant

Transcription factor SmMYC2 regulates secondary cell wall thickening to enhance drought resilience in eggplant | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 26 February 2025 V1 Latest version Share on Transcription factor SmMYC2 regulates secondary cell wall thickening to enhance drought resilience in eggplant Authors : Sirui Li , Yao Hu , Dayong Wei , Qinglin Tang , Yang Yang , and Zhimin Wang 0000-0001-8548-2552 [email protected] Authors Info & Affiliations https://doi.org/10.22541/au.174055213.39024882/v1 Published Plant Cell Reports Version of record Peer review timeline 161 views 109 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Drought stress poses a serious threat to agricultural growth and productivity worldwide as climate change worsens. bHLH transcription factors play a significant and diverse role in plant stress response, yet the regulatory network of bHLH transcription factors in eggplant ( Solanum melongena L.) under drought stress remains unclear. Here, we cloned SmMYC2 gene from “March eggplant” leaves, which belongs to the bHLH transcription factor (TF) family and located in the nucleus. Through quantitative real-time PCR (qRT-PCR), we demonstrated that SmMYC2 expression was substantially higher in leaves, with tender leaves expressing the most and fruits expressing the least. Compared with the wild type (WT), the SmMYC2 overexpression eggplants plants ( SmMYC2- OE) showed enhanced drought resilience, lower MDA conten, higher SOD content in the leaves, but no significant difference in POD enzyme activity after drought treatment. Meanwhile, SmMYC2- OE plants exhibited a considerable increase in stem thickness and we found that the SmMYC2 gene can bind to the SmNST1 promoter to participate in the regulation of secondary cell wall (SCW) thickening. Furthermore, double molecule fluorescence (BiFC) assay and luciferase complementation (LCI) analysis showed that SmMYC2 can interacts with SmJAZ1, SmJAZ3, and SmMYB21 in vivo. Through the yeast one-hybrid (Y1H) assay and the luciferase reporter system (LUC) assay, we revealed that SmMYC2 engaged in negative feedback regulation by binding to its own promoter and inhibited its transcription in eggplant. Additionally, we found that SmMYC2 can also bind to SmMYB108 promoters and decrease its expression but act as an activator and interact with SmNST1 promoter in vivo. Together, the results of this study may reveal that SCW thickening is related to enhanced drought resistance in eggplants, and further provide insights into its regulatory network, which may greatly improve agricultural productivity. 1 Introduction Eggplant ( Solanum melongena L.) is an economically significant horticultural crop and one of the most prevalent crops in the Solanaceae family. As an annual herbaceous plant originating from tropical Asia, it has certain growth traits such as a preference for high temperatures, a high fertilizer requirement. On top of that, Eggplants are subject to water requirements throughout their growth cycle, particularly in the germination and seedling stages, drought stress can directly lead to a decrease in germination and emergence rates, as well as plant mortality. Plants can demonstrate their drought resistance through three mechanisms: escape, avoidance, and tolerance. At the same time, the survival of rehydration after drought can also reflect the strength of drought resistance (Basu et al., 2016). Transcription factors (TFs) are key stress tolerance mediators that can respond to environmental and hormonal changes, and participate in regulating plant drought resistance by binding to specific DNA sequences. The transcription factor families such as bHLH (Basic helix-loop-helix), R2R23-MYB, and NAC have been identified to be involved in responding to plant drought stress (Baldoni et al., 2015, Basu et al., 2016, Diao et al., 2020, Sun et al., 2018). Among them, MYC2 in the bHLH family, as a core transcription factor in the jasmonic acid (JA) signaling pathway, can participate in various hormone signaling pathways by forming MYC-MYB complex proteins or COI1/JAZs/MYC2 complexes (Chini et al., 2009), or regulate the expression of downstream drought resistant genes to regulate plant drought stress responses (Shamloo-Dashtpagerdi et al., 2023, Xia et al., 2024). In addition, MYC TFs can regulate the expression of JAZ in the JA signaling pathway (Chini et al., 2009). In rice, OsJAZ1 overexpressing plants are insensitive to Methyl Jasmonate (MeJA) and Abscisic Acid (ABA), and JAZs can partially regulate rice drought resistance through the JA pathway (Fu et al., 2017), MYC TFs may indirectly improve rice drought tolerance by directly inhibiting the expression of JAZ protein. Currently, ABA, as one of the most classic molecular pathways for plants to respond to drought stress, has been extensively studied in Arabidopsis. Most drought-induced genes studied so far are induced by ABA, and many of them contain a conserved ABRE cis-acting element in promoter sequences. MYC2-like proteins can bind to ABRE elements, and under drought conditions, MYC2 can bind to the promoters of ABA induced-genes rd22 and ADH , activating the ABA signaling pathway (Abe et al., 2003). Among the conserved motifs of drought responsive genes, protein kinases and MYB domain proteins are the most conserved (Chakraborty et al., 2022). MYB can improve the drought resistance of transgenic plants by regulating flavonoid, stratum corneum synthesis, and stomatal movement (Zhu et al., 2022, Baldoni et al., 2015, Song et al., 2023). And MYC TFs may respond to drought stress by forming MYB-bHLH complexes (Min et al., 2018). At the same time, SlMYB21 positively regulates JA biosynthesis in tomato (Schubert et al., 2019), the MYB21 gene can participates in the regulatory cascade of plant reproductive response and adaptation under drought stress (Su et al., 2013). On the other hand, secondary cell wall (SCW) lignification is a key component of plant stress response (Barros et al., 2015). SCW supports tubular cells and fiber cells in the xylem, allowing these cells to perform specialized roles while also improving plant stress resistance and cell wall mechanical strength. Previous studies have reported that TFs MYC2 and MYC4 can directly bind to the NST1 gene promoter of the NAC family under blue light, activating the NST1 directed transcription network and promoting SCW thickening in Arabidopsis (Zhang et al., 2018). In addition to serving as a direct transcription target for MYB103 and regulating secondary wall biosynthesis in Arabidopsis (Zhong et al., 2008), NST1 , a homologous gene SND1 , can also enhance salt stress tolerance and promote anthocyanin accumulation in Arabidopsis seedlings (Jeong et al., 2018). MYB108 , as an important factor regulating stamen development in MYB family (Mandaokar and Browse, 2009, Xu et al., 2019), also participates in JA signaling pathway and drought response signaling pathway, which may affect plant stress tolerance through JA and ABA signaling, and regulating the expression of antioxidant related genes (Dong et al., 2021). GhMYB108-like plays an important role in response to drought and salt stress in cotton (Ullah et al., 2020), and we confirmed that SmNST1 inhibited the expression of ProSmMYB108 in eggplant (Wang et al., 2024a). Additionally, MYC2 also forms an automatic regulatory negative feedback loop with MTB (MYC2-TARGETED BHLH) protein, terminating JA signaling in a highly ordered manner (Liu et al., 2019). Previous studies have found that overexpression of AtMYC2 in Arabidopsis significantly reduces its own transcription levels (Dombrecht et al., 2007), suggesting that MYC2 may be used to fine tune JA signaling transduction by negatively regulating its own expression. Previous studies have implicated the MYC2 in plant responses to drought stress and SCW thickening. However, the molecular mechanisms linking these two processes remain unclear. Here, we investigate the role of MYC2 in drought stress resistance in eggplant. Our findings elucidate interactions between MYC2 and the MYB family of TFs, the JAZ proteins, and NST1, a TF known to regulate SCW thickening, and these interactions can confirm its position in the SCW thickening regulatory network. Furthermore, our results suggest that enhanced SCW thickening, mediated by SmMYC2 , contributes to improved drought tolerance in eggplants. 2. Materials and methods 2.1. Plant materials The plant material used in this study is “March eggplant” which provided by the Institute of Vegetables and Flowers, Chongqing Academy of Agricultural Sciences. Eggplant is cultured in a greenhouse (16 hours under 28 ℃ light conditions, 8 hours under 22 ℃ dark conditions, relative humidity 60%~65%). 2.2. Phylogenetic analysis The coding sequence of the tomato SlMYC2 gene was retrieved from the Sol Genomics Network database (https://solgenomics.sgn.cornell.edu/). Subsequently, a BLAST search was conducted on the eggplant genome database (http://www.eggplant-hq.cn/Eggplant/home/index) to identify the corresponding SmMYC2 sequence of Solanum melongena . Further homologous protein sequences were obtained by performing BLAST searches on the NCBI online platform (http://www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence alignment was executed using MEGA 11.0 software to construct a phylogenetic tree for comparative analysis. 2.3. RNA extraction and reverse transcription Samples comprising roots, stems, leaves, flowers, and fruits of the ”March eggplant” cultivar were collected and promptly cryopreserved in liquid nitrogen. Total RNA was subsequently extracted from these tissues using the Biospin Plant Total RNA Extraction Kit (BioFlux), adhering strictly to the manufacturer’s guidelines. To eliminate genomic DNA contamination, a digestion step was incorporated, wherein a 15 μL reaction mixture was prepared containing 3 μL of 5× gDNA Digester Mix, 6 μL of the extracted total RNA, and 6 μL of RNase-free water, followed by incubation at 42°C for 2 minutes. The RNA samples were then subjected to reverse transcription using the Hifair III 1st Strand cDNA Synthesis SuperMix Kit (YEASEN), strictly following the manufacturer’s protocol. The thermal cycling conditions for reverse transcription were set as follows: 25°C for 5 minutes, 55°C for 15 minutes, and a final denaturation step at 85°C for 5 minutes. The resulting cDNA was diluted with double-distilled water (ddH 2 O) at a ratio of 1: 4 (v/v). This diluted cDNA was subsequently employed as a template for PCR amplification. 2.4. Gene cloning The nucleotide sequences of SmMYC2 , SmJAZ1 , SmJAZ3 , and SmMYB21 genes were downloaded from Eggplant Genome Database (http://www.eggplant-hq.cn/Eggplant/home/index), and design specific primers for these genes using Oligo 7.0 software (Table 1). Then, the genes were amplified by PCR in a 25-μL reaction containing 12.5 μL PrimeSTAR Max Premix (2X), 1 μL each of sequence specific forward and reverse primers, 1 μL of March eggplant leaf cDNA (template), and 9.5 μL of ddH 2 O. The PCR conditions were as follows: 2 minutes at 98 ℃, followed by 34 cycles, 30 seconds at 98 ℃, 30 seconds at 56 ℃, 90 seconds at 72 ℃, and finally 10 minutes at 72 ℃. PCR products were detected by 1.5% agarose gel electrophoresis. Using TSINKE TSP602-200 Trelief® DNA gel extraction kit (TSINGKE Biotech, Beijing, China) recovered the target DNA fragment and cloned it into pEASY®- In the Blunt cloning vector (TransGen Biotech, China). The final construction was sequenced by Shenzhen BGI Co., Ltd. TABLE 1 Experimental primer list SmMYC2-For GAATTCCAATCTGAACCCAAAACCA Gene cloning SmMYC2-Rev GATGCAATATTACAGACTAGACGGA SmMYB21-For ATGGGAAGAATTCCATGTTG SmMYB21-Rev TCAAACCATGGGATTCATC SmJAZ1-For ATGGGGTCATCGGAAAATGTGG SmJAZ1-Rev CTAGAAGTATTGCTCCGTTTTAAC SmJAZ3-For ATGGAGAGGGACTTTATGGGA SmJAZ3-Rev CTAGGCCTCCTTACCGGCTAAC qRT-SmMYC2-For TGCTTCCAAATCCATGCCCT qRT-PCR qRT-SmMYC2-Rev CTCGTGAAGTCAACCACCGA 1300-SmMYC2-For GCTCTAGA ATGACTGATTACAGCTTACC Subcellular localization 1300-SmMYC2-Rev GGGGTACC AGACGCTTCAGCGATTCTTG SmMYC2-2301G-For GCTCTAGA ATGACTGATTACAGCTTACC Overexpression vector SmMYC2-2301G-Rev CGAGCTCG CTAAGACGCTTCAGCGATTC PrSmMYC2-For CCATCCTAAAAGTACACCAAA Promoter cloning PrSmMYC2-Rev CAGTCATTCCATAAACACAAG 2.5. Gene expression analysis The qRT-PCR primers for SmMYC2 gene (Table 1) were designed by Primer3 online software (https://www.primer3plus.com/index.html). Next, we used SYBR Green based PCR detection method (Takara) and CFX96 Touch RealTime PCR detection system (Bio Rad Laboratories) to conduct qRT-PCR, 1 μL of synthesized cDNA was used as a template for 20 μ L qRT-PCR amplification. The reaction was carried out under the following conditions: 94 ℃ for 30 seconds, 94 ℃ for 5 seconds for 38 cycles, 56 ℃ for 30 seconds, and 72 ℃ for 30 seconds. Three biological replicates were performed and the GAPDH gene was used as an internal control to normalize transcription levels. We calculated the relative expression level of target genes using the 2 -△△CT method. 2.6. Subcellular localization The full-length coding sequence of the SmMYC2 gene was subcloned into the pCAMBIA1300-GFP binary vector, resulting in a fusion with the green fluorescent protein (GFP) under the regulation of the CaMV35S promoter. The constructs were then introduced into the Agrobacterium tumefaciens strain GV3101, which was subsequently used for infiltration into Nicotiana tabacum leaf. Post-transformation, the plants were subjected to a 24-hour dark incubation period, followed by a 36-hour exposure to standard light conditions. Fluorescence was visualized using a confocal laser scanning microscope (Fv1000, Olympus, Japan). The primers employed for vector construction are detailed in Table 1. 2.7. Overexpression vector construction and eggplant transformation The SmMYC2 gene was subcloned into the pCAMBIA-2301G vector, which harbors the kanamycin resistance gene under the control of the CaMV35S promoter. Segments of approximately 0.5 cm from eggplant hypocotyls were excised and placed on a MS pre-culture medium supplemented with 1.75 mg/L zeatin (ZT) and 0.75 mg/L indole-3-acetic acid (IAA), and incubated in darkness at 25°C for 48 hours. Subsequently, the recombinant plasmid was transformed into Agrobacterium tumefaciens strain LBA4404 via the freeze-thaw method. Transformed cells were selected on yeast extract broth (YEB) liquid medium supplemented with 50 μg/mL rifampicin and 50 μg/mL kanamycin, and incubated at 28°C with shaking at 225 r/min overnight. A 2 mL aliquot of the bacterial suspension was then transferred to YEB liquid medium containing the same antibiotic concentrations and grown to an optical density at 600 nm (OD 600 ) of 0.5-0.8 at 28°C with shaking at 225 r/min. The culture was centrifuged at 4000 r/min for 10 min at 4°C, the supernatant was removed, and the pellet was resuspended in 25 mL of pre-cooled MS liquid medium. The resuspended solution was used to infuse eggplant hypocotyls for 15 min. Excess solution on the tissue surface was absorbed using sterile filter paper, and the tissues were incubated. After 48 hours of culture, the explants were transferred to a differentiation medium (MS solid medium supplemented with 1.75 mg/L ZT, 0.75 mg/L IAA, 35 mg/L kan, and 400 mg/L Cb) to induce adventitious shoot differentiation. The adventitious buds were then transferred to a rooting medium (MS solid medium supplemented with 35 mg/L kan, 0.2 mg/L IAA, and 200 mg/L Cb) to promote root formation. We extracted DNA from transgenic eggplant leaves, using recombinant plasmid pCAMBIA-2301G-SmMYC2 as a positive control, the WT “March Eggplant” DNA and water as negative controls. The primers SmMYC2 -2301G-F and pCAMBIA-2301G-R (Table 1) were used for PCR amplification, and the reaction results were detected by agarose gel electrophoresis to screen positive transgenic plants. Domesticated, transplanted, and stored the cultured seedlings in the nursery room of the Biotechnology Building at Southwest University. 2.8. DNA extraction and promoter cloning The gDNA used for cloning of promoters was extracted using the Plant Genomic DNA Kit (TIANGEN) from young leaves of ‘March eggplant’ following the manufacturer’s instructions. We designed primers for PCR amplification of the promoter region to obtain the full-length 2094 bp promoter ProSmMYC2 . Primers used are listed in Table 1. In addition, our laboratory also provided ProSmMYB108 (pAbAi- ProSmMYB108 vector) and ProSmNST1 (pAbAi- ProSmNST1 vector). 2.9. Bimolecular fluorescen complimentary (BiFC) assays The coding sequence of SmMYC2 was subcloned into the pVYNE vector, and the coding sequences of SmJAZ1 , SmJAZ3 , and SmMYB21 were subcloned into the pVYCE vectors with the specific primers, respectively. Agrobacterium solutions containing pVYNE and pVYNE-SmMYC2 were respectively mixed with the same volumes of Agrobacterium solutions containing pVYCE-SmJAZ1, pVYCE-SmJAZ3, and pVYCE-SmMYB21 to detect the interactions. The following procedures were similar to those used in the above subcellular localization experiment, and the fluorescent was detected by LSCM. 2.10. Luciferase complementation (LCI) assay The SmMYC2 was cloned into the pCAMBIA1300-NLuc (pC-N) and SmJAZ1 , SmJAZ3 , and SmMYB21 were subcloned into the pCAMBIA1300-CLuc (pC-C) vectors, respectively (Zhou et al., 2018). Agrobacterium suspensions harboring pC-N and pC-N-SmMYC2 were respectively mixed with the same volumes of Agrobacterium suspensions harboring pC-C-SmJAZ1, pC-C-SmJAZ3. And pC-C-SmMYB21. The negative controls and tested protein pairs were infiltrated into the same leaf to avoid false positives and negatives caused by differences in physiological conditions between leaves. The infiltrated plants were incubated in a greenhouse for 48 h before measurement of luminescence. Then, a 1 mM D-luciferin solution was sprayed onto the leaves of Nicotiana tabacum , ensuring that the leaves were completely wet, and then the plants were placed in the dark for 5-8 min to allow the chlorophyll luminescence to decay. Luminescence images were captured using IVIS Imaging System. 2.11. Yeast one-hybrid (Y1H) assay The full-length coding sequence SmMYC2 were cloned into pGADT7 vector to generate prey AD-SmMYC2. The promoters of SmMYC2 , SmNST1 and SmMYB108 were cloned and then recombined separately into the pAbAi vector. Using the Matchmaker Gold Yeast One-Hybrid Library Screening System (TaKaRa), the linearized plasmids pAbAi- ProSmMYC2, pAbAi- ProSmNST1 , pAbAi- ProSmMYB108 were introduced into the yeast strain Y1H Gold and cultured on SD/-Ura agar plates. The minimum concentration of AbA (0-600 ng/mL) that inhibited yeast growth was screened on SD/-Ura/AbA plates. Subsequently, the pGADT7-SmMYC2 plasmid was transformed into yeast strain Y1H Gold harboring pAbAi- ProSmMYC2, pAbAi- ProSmNST1 and pAbAi- ProSmMYB108 . The yeast strains were successively plated on SD/-Leu and SD/-Leu/AbA media. The growth of the yeast strains at 30 °C was assessed for testing the protein-DNA interactions. 2.12. Dual-luciferase reporter (LUC) system The promoters ProSmMYC2 , ProSmNST1 , and ProSmMYB108 were amplified and subsequently recombined into the pGreenII0800-LUC vector to generate reporter constructs (Hellen et al., 2005). Concurrently, the SmMYC2 gene was cloned into the pGreenII62-SK vector to create an effector construct. Utilizing the freeze-thaw method, these recombinant plasmids—pGreenII62-0800- ProSmMYC2 , pGreenII62-0800- ProSmNST1 , pGreenII62-0800- ProSmMYB108 , and pGreenII62-SK-SmMYC2 were introduced into the Agrobacterium tumefaciens strain LBA4404. The bacteria were cultured at 28°C in 50 mL of YEB medium supplemented with 50 mg/mL kan and 25 mg/mL rifampicin until reaching an optical density at 600 nm (OD 600 ) of 0.8-1.5. The cells were then harvested and resuspended in an induction medium comprising 10 mM MgCl 2 , 100 μM acetosyringone, and 100 mM MES, followed by incubation in the dark for 2-3 hours to induce virulence genes. The Agrobacterium suspension was infiltrated into Nicotiana tabacum leaves, and the infiltrated plants were kept in darkness for 24 hours before being transferred to a light regime for an additional 36 hours. Finally, the leaves were imaged using a live imager (FX7 IR SPECTRA11000, VILBER LOURMAT, France) to assess the reporter gene expression. 2.13. Determination of physiological indicators after drought treatment The steps for determining the content of malondialdehyde refer to the instructions for the malondialdehyde (MDA) kit of Chongqing Bonoheng Biotechnology Co., Ltd. The steps for determining the activity of antioxidant-related enzymes SOD and POD mainly refer to the instructions for the peroxidase (POD) kit and the superoxide dismutase (SOD)-WST-8 activity assay kit of Suzhou Grace Biotechnology Co., Ltd. 2.14. Stem section analysis Stem segments exhibiting the greatest girth, located between the first and second true leaves, were harvested from both wild-type (WT) and transgenic eggplant plants overexpressing SmMYC2 . These plants, measuring approximately 14 cm in height and exhibiting robust growth, were selected for tissue sampling. The excised stem tissues were fixed in a formalin-aceto-alcohol (FAA) solution, stored at 4°C overnight, and subsequently forwarded to Chongqing Amida Biological Co., Ltd. for histological examination via paraffin sectioning and toluidine blue staining. 3 Results 3.1. Cloning and Bioinformatics Analysis of SmMYC2 Used the primers listed in Table 1 and the “March Eggplant” leaf cDNA as a template to amplify SmMYC2 gene. The open reading frame (ORF) of SmMYC2 was 2076 bp, located on chromosome 8. The SmMYC2 protein contained a conserved MYB/MYC domain at the N-terminus (Figure 1A), predicted to interact with the JAZ family domain at the N-terminus, and encoded a typical bHLH (basic Helix-Loop-Helix) conserved DNA binding site at the C-terminus (Li et al., 2023), indicating that it was a typical bHLH family protein (Figure 1B). The conserved ACT-like domain contained in the C-terminus was necessary and essential for the homodimerization and heterodimerization of the relevant bHLH protein GLABRA3 (GL3; At5g41315) and GL3 enhancer (EGL3; At1g63650) (Zhang et al., 2003). Aligned the amino acid sequence of SmMYC2 gene on NCBI website to obtain the amino acid sequence of homologous gene. We used MEGA-11 software for neighbor-joining method (NJ) calculation to construct a phylogenetic tree (Figure 1B). The evolutionary tree results indicated that SmMYC2 is closely related to Solanum dulcamara SdMYC2 and Datura stramonium DsMYC2 . FIGURE 1 Bioinformation analyses of SmMYC2. A: Prediction of basic structure of the SmMYC2 protein. B: Phylogenetic tree analysis . 3.2. Analysis of the expression pattern of SmMYC2 gene In order to analyze the expression pattern of SmMYC2 gene in different tissues and leaves at different stages, six different tissue parts including roots, stems, leaves, flower buds, flowers, and fruits of “March eggplant” were selected, as well as three leaf stages, namely tender leaves, mature leaves, and old leaves. RNA was extracted and reverse transcribed into cDNA, and the expression level of SmMYC2 gene was determined by qRT-PCR. The qRT-PCR analysis showed (Figure 2) that the expression level of SmMYC2 gene in leaves, roots, and stems was significantly higher than that in flowers and fruits, with the highest expression level in tender leaves and the lowest expression level in fruits. FIGURE 2 Relative expression of SmMYC2 in different tissues of eggplant. 3.3. SmMYC2 protein is a nuclear localization transcription factor Transient expression assay was conducted on tobacco leaf epidermal cells, and the subcellular localization of SmMYC2 was observed under a fluorescence microscope. The pCAMBIA1300-SmMYC2-GFP recombinant protein only detected green fluorescence in the nucleus (Figure 3), indicating that SmMYC2 protein is localized on the nucleus and its specific site of action is in the nucleus. FIGURE 3 Subcellular localization of SmMYC2. 3.4. Overexpression of SmMYC2 gene affects the thickening of eggplant SCW In order to investigate the role of SmMYC2 in eggplant drought resistance, we obtained 9 transgenic eggplant plants (Figure 4A). Total RNA was extracted from 6 transgenic eggplant plants, and reverse transcribed into cDNA. qRT-PCR analysis revealed a marked disparity in SmMYC2 transcript abundance between the SmMYC2-OE-3 line and the wild-type (WT) control, with the transgenic line exhibiting a 3.6-fold increase in expression relative to the WT (Figure 4B). The plant stem, as an important organ for transporting water and nutrients, can provide mechanical support for plants and is closely related to their drought resistance. Under the same growth conditions, WT and SmMYC2 overexpressing transgenic eggplant plants were cultivated, and a comparison revealed that the stem of SmMYC2 overexpressing eggplant lines was thicker than that of the wild-type (Figure 4C). We selected SmMYC2- OE-1 and SmMYC2- OE-3 lines with SmMYC2 overexpression levels of approximately 1.8 and 3.6, respectively. OE-1 and OE-3 plants were selected to observe the effect of SmMYC2 expression on plant phenotypes under the background of multiples. Ultimately, we found that when the eggplant plants grew to a height of 12 cm, the stem thickness of transgenic eggplant plants was larger than that of the WT (Figure 4D). FIGURE 4 Identification and phenotypic analysis of transgenic SmMYC2-OE lines. A: Identification of transgenic plants by PCR. Lines 1-9 were identified as transgenic lines; NC and PC represented the negative control and positive control, respectively. B: Expression levels of SmMYC2 in wild-type (WT) plants and SmMYC2 -OE transgenic lines (OE). *P<0.05,**P<0.01. C: Stem phenotype observation of SmMYC2 transgenic eggplant and WT eggplant. D: Stem diameter of WT and SmMYC2 transgenic eggplant at different growth heights *P<0.05，**P<0.01. Next, we selected WT and SmMYC2-OE -3 line plants that had consistent growth days, growth condition, and plant height. And we took the thickest stem segment between the first and second true leaves for paraffin embedding and sectioning, and observed the development of secondary wall cells using toluidine blue staining (Figure 5). The slicing results indicated that the average thickness of the SCW of “March eggplant” was 2.25 µm, as measured in Figure 5a. The SCW thickness of overexpressed eggplant was measured (Figure 5b), with an average thickness of 3.35 µm. The SCW thickness of the SmMYC2 -overexpressing transgenic lines was higher. FIGURE 5 Paraffin sections of stems of wild-type eggplant and transgenic eggplant with SmMYC2 gene and the statistical analysis of secondary cell wall thickness. A-C: Observation of paraffin sections on cross section of stem of WT eggplant. D-F: Paraffin section observation of cross section of stem of SmMYC2 transgenic eggplants. a, b: indicates part of the measurement area; G: Statistical analysis of secondary cell wall thickness *P<0.05，**P<0.01. 3.5. SmMYC2 overexpression enhances drought resilience in transgenic eggplant We transplanted the SmMYC2 -OE-1, OE-3 and WT eggplants into a solar greenhouse to verify the function of the SmMYC2 gene, and chose eggplants that grew well and had consistent growth condition for drought stress treatment (Figure 6A). It can be seen that after 12 days of water control, both the WT and OE-1 plants showed severe wilting and withering of leaves, as well as lodging of plants, while the OE-3 line showed relatively mild wilting; Subsequently, all plants were subjected to rehydration treatment. After 3 days, the WT plants still wilted and withered after rehydration and the phenotype was not restored. However, both OE-1 and OE-3 lines showed significant recovery, mainly manifested in the upper leaves absorbing water and spreading out, and the plants partially recovering upright growth. It can be seen that compared with the wild-type eggplant, overexpression of SmMYC2 gene in transgenic plants can enhance the plant’s drought resistance to a certain extent. By measuring the MDA content of SmMYC2 overexpressing transgenic eggplant and WT plants (Figure 6B), it was found that under normal growth conditions, there was no significant difference in MDA content between SmMYC2 transgenic and WT plants. After drought stress treatment, the MDA content of WT eggplant increased significantly, and was higher than that of SmMYC2 -overexpressing plants, indicating that drought stress accelerated the degree of lipid peroxidation in leaf cell membranes, while overexpression of SmMYC2 alleviated the degree of cell membrane oxidation. As shown in Figure 6C, under normal growth conditions, there was no significant difference in POD enzyme activity between SmMYC2 transgenic lines and WT eggplant plants; After drought treatment, there was an increase in POD enzyme activity between WT plants and overexpressing transgenic eggplant lines, but no significant difference was observed between them. The SOD enzyme activity of OE-3 line was significantly higher than that of wild type after drought treatment. FIGURE 6 Phenotypic observation and physiological indicators changes in WT and SmMYC2 transgenic plants under normal growth and drought stress A: Phenotypic changes after drought treatment. B: SOD activity; C: MDA content. D: POD activity. *P<0.05，**P<0.01. 3.6. SmMYC2 interacts with SmJAZ1, SmJAZ3, and SmMYB21 in vivo Here, we conducted BiFC assays and LCI assays to validate the in vivo interactions between SmMYC2 and SmJAZ1, SmJAZ3, SmMYB21. And the results demonstrated that SmMYC2 can interacts with SmJAZ1, SmJAZ3, and SmMYB21 proteins in vivo to jointly regulate the response of eggplant plants to drought stress (Figure 7). FIGURE 7 Interaction analysis between SmMYC2 and SmJAZ1, SmJAZ3, SmMYB21. A: BiFC verify protein interactions. B: LCI verify protein interactions. 3.6. SmMYC2 can promote the expression of SmNST1 in vivo, but inhibit the expression of SmMYB108 and SmMYC2 itself Our previous research found that SmNST1 can promote SCW thickening and lignin synthesis in tobacco (Wang et al., 2024a), but whether SmMYC2 can guide SCW thickening by binding to the SmNST1 gene promoter remained to be further verified. The regulatory relationship between MYC2 and MYB108 , as well as its own negative feedback regulatory mechanisms, also need further confirmation. To investigate the above issues, we cloned a 2094 bp SmMYC2 promoter and analyzed its core regulatory components. We found multiple transcription factor binding sites, including MYB and MYC, as well as core response elements related to plant stress such as light response, SA and JA. Here, we conducted luciferase reporter system assay to validate the interaction between SmMYC2 and ProSmMYC2 , ProSmNST1 , ProSmMYB108 in vivo. The chemiluminescence results of the luciferase reporter system demonstrated that the SmMYC2 TF can promote the expression of SmNST1 in vivo, but inhibited the expression of SmMYC2 itself and SmMYB108 (Fig. 8). FIGURE 8 DNA-protein interactions identified by LUC assay . A: Schematic illustration of the effector vector and the reporter vectors in LUC assays. B: LUC assays show that SmMYC2 directly enhance the expression of SmNST1 but inhibit the expression of SmMYC2 and SmMYB108. 3.7. SmMYC2 transcription factor can interact with ProSmMYC2 and ProSmMYB108 in vitro, but has no interaction with ProSmNST1 in vitro We transformed the recombinant plasmid pAbAi- ProSmMYC2 into yeast competent cells of Y1H Gold, and performed spot screening on SD/-Ura+AbA solid culture medium at different concentrations. The results showed that the recombinant yeast strain Y1H Gold (pAbAi- ProSmMYC2 ) could not grow on solid defect medium with AbA concentration of 300 ng/mL after 10 fold dilution (Supplementary Figure 1). Previously, our research confirmed that the optimal concentration of AbA for recombinant yeast strains Y1H Gold (pAbAi- ProSmNST1 ) and Y1H Gold (pAbAi- ProSmMYB108 ) was 600 ng/mL (Hu et al., 2023, Wang et al., 2024a). The Y1H results showed that SmMYC2 interacts with the promoters of SmMYB108 and SmMYC2 in vitro, but not with the ProSmNST1 in vitro (Fig. 9). FIGURE 9 DNA-protein interactions identified by Y1H assay. A: Schematic illustration of the effector vector and the reporter vectors in Y1H assays. B: Y1H assays show that SmMYC2 directly binds to the promoter of SmMYC2 and SmMYB108 , but not to the ProSmNST1 in vitro. 4 Discussion As a standalone protein, MYC2 has been shown to integrate different signals and help regulate multiple pathways leading to different phenotypic outputs (Pireyre and Burow, 2015), and plays an important regulatory role in stress response processes. SmMYC2 predicted structure contains a typical bHLH conserved domain at the C-terminus, which can specifically bind to the G-box (5 ’- CACGTG-3’ and 5 ’- CACATG-3’) and E-box (CANNTG) in the promoter of the target gene (Li et al., 2023). At the same time, subcellular localization shows that the SmMYC2 protein is located in the nucleus, indicating that this gene possesses the basic characteristics of encoding transcription factors. Additionally, the tissue expression pattern of SmMYC2 demonstrated that its expression levels in plant roots, stems, and leaves were significantly higher than those in flowers and fruits, suggesting that SmMYC2 can play a critical role in plant growth stages, leaf development, maturation, and aging processes (Kazan and Manners, 2013, Qi et al., 2015). In horticultural crops, tomato SlMYC2 can directly regulate the expression of SlRR26 to improve osmotic stress response, thereby improving the drought tolerance of tomato plants (Zhao et al., 2023). In addition, SlMYC2 can induce the expression of SlWRKY50 through the MYC2-WRKY50 pathway, promoting JA accumulation to activate antioxidant enzyme activity, and enhancing the ability to clear reactive oxygen species to enhance tomato cold tolerance (Wang et al., 2024b). In cantaloupe, drought induced expression of JA biosynthesis gene lipoxygenase 10 ( CmLOX10 ) and JA signaling gene CmMYC2 (Xing et al., 2020). Moreover, MYC2 silencing can cause stomata close in plant leaves, leading to accelerated water loss and reduced drought tolerance in Brassica napus (Wang et al., 2020). Here, we obtained positive transgenic eggplant plants by constructing an overexpression vector of SmMYC2 and found that compared with the WT, SmMYC2 -OE eggplant plants showed enhanced drought resistance. There was no significant difference in POD enzyme activity between the WT and transgenic eggplant lines, but the MDA content was lower in the overexpressing lines and the SOD enzyme activity of OE-3 line was significantly higher than that of WT after drought treatment, indicating that SmMYC2 -OE plants have an improved drought tolerance. On the other hand, plant SCW plays an essential role in improving stem strength and environmental stress. The NST1 protein is a member of the transcription factor NAC family and is known to serve as an important switch in regulating SCW formation in many species, such as model plants Arabidopsis and tobacco (Fang et al., 2020, Zhong et al., 2008). We previously identified that heterologous overexpression of SmNST1 in tobacco resulted in increased SCW thickness in tobacco stems and increased expression of hemicellulose and lignin in cell wall components (Wang et al., 2024a). On top of that, previous studies have demonstrated that thickening of plant secondary cell walls can enhance plant drought resistance. Niu et al. (Niu et al., 2021) demonstrated that overexpression of the PeuLAC2 gene can promote the increase in the thickness of SCW of xylem, while affecting the number and area of xylem vessels and cell wall components, resulting in a significant increase in the tensile strength of plant stems; thereby improving the drought resistance of plants. Some researchers have also found that the expression of MdMYB88 and MdMYB124 genes in apples can promote lignin deposition and vessel development, and increase the ability of roots to transport water. This process also enhanced the drought resistance of apples (Geng et al., 2018), showing the importance of SCW thickening in improving plant drought resistance. In this study, we found that SmMYC2 overexpressing eggplant lines exhibited stem thickening and SCW thickening phenotypes compared to the WT, this suggests that SmMYC2 may enhance the drought resistance of eggplant by promoting the thickening of SCWs. Based on previous research reports, the TF MYC2 can directly bind to the NST1 gene promoter of the NAC family under blue light, thereby promoting secondary cell wall thickening in Arabidopsis (Zhang et al., 2018). And JA can also activate secondary cell wall biosynthesis through the MYC2-MYB46 module (Im et al., 2024). Here, we further validated the interaction relationship between SmMYC2 and ProSmNST1 , ProSmMYB108 in vitro and in vivo. The results showed that SmMYC2 could not interact with the SmNST1 promoter in vitro but could directly bind to the SmMYB108 promoter; The LUC assay showed that SmMYC2 can promote SmNST1 expression and inhibit SmMYB108 expression in vivo. By analyzing the core components of ProSmMYC2 , we found that it contains multiple binding sites for MYB and MYC transcription factors. Our experiment further confirmed that SmMYC2 had a negative regulatory mechanism, which can bind to its own promoter and inhibit its expression both in vivo and in vitro, which was consistent with previous experimental results (Dombrecht et al., 2007). Meanwhile, we further confirmed that SmMYC2 can interact with the core repressors JAZ1 and JAZ3 proteins in JA signaling and form MYC2-MYB21 complexes in eggplants. Consistent with previous studies, it suggests that bHLH, JAZ, and MYB transcription factor family proteins may play a role in the JA signaling pathway in the form of TF complexes. However, it is still unclear whether they regulate the drought tolerance of eggplant through the network of interactions, and further experiments are needed to explore. Based on these results, we described a model of SmMYC2 regulated drought tolerance by SCW thickening in eggplant seedlings (Fig. 10). These results provided a theoretical basis for breeding eggplant varieties with lodging resistance and drought tolerance. Nevertheless, further verification is needed on how SmMYC2 participates in plant drought resistance and SCW development by linking other factors in the JA and ABA signaling pathways. And certain hypotheses require additional experimental study to test and investigate in depth. FIGURE 10 The model of SmMYC2 regulating drought resistance by SCW thickening in eggplant seedlings ‘ ’indicate direct promotion of regulation, ‘ ’ indicate direct inhibitory effect, ‘ ’indicating a need for further verification Data availability statement The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. Author contributions S-RL, Z-MW, and YY designed the research; S-RL and HY performed the molecular biology experiments; Q-LT and D-YW carried out the bioinformatics analysis; S-RL and Z-MW analyzed the data and wrote the manuscript. Funding This work was supported by the Chongqing Natural Science Foundation Project [CSTB2024NSCQ-MSX1020], the China Agriculture Research System [CARS-23-A08], and the Major Core Technology Research of Chongqing Academy of Agricultural Sciences Supported by Municipal Finance Project [cqaas2023sjczhx002]. Conflict of interest The authors declare that they have no competing interests or personal relationships that could have appeared to influence the work reported in this paper. References ABE, H., URAO, T., ITO, T., SEKI, M., SHINOZAKI, K. & YAMAGUCHI-SHINOZAKI, K. 2003. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell, 15 , 63-78.BALDONI, E., GENGA, A. & COMINELLI, E. 2015. Plant MYB Transcription Factors: Their Role in Drought Response Mechanisms. Int J Mol Sci, 16 , 15811-51.BARROS, J., SERK, H., GRANLUND, I. & PESQUET, E. 2015. The cell biology of lignification in higher plants. Ann Bot, 115 , 1053-74.BASU, S., RAMEGOWDA, V., KUMAR, A. & PEREIRA, A. 2016. Plant adaptation to drought stress. F1000Res, 5.CHAKRABORTY, A., VISWANATH, A., MALIPATIL, R., SEMALAIYAPPAN, J., SHAH, P., RONANKI, S., RATHORE, A., SINGH, S. P., GOVINDARAJ, M., TONAPI, V. A. & THIRUNAVUKKARASU, N. 2022. Identification of Candidate Genes Regulating Drought Tolerance in Pearl Millet. Int J Mol Sci, 23.CHINI, A., BOTER, M. & SOLANO, R. 2009. Plant oxylipins: COI1/JAZs/MYC2 as the core jasmonic acid-signalling module. Febs j, 276 , 4682-92.DIAO, P., CHEN, C., ZHANG, Y., MENG, Q., LV, W. & MA, N. 2020. The role of NAC transcription factor in plant cold response. Plant Signal Behav, 15 , 1785668.DOMBRECHT, B., XUE, G. P., SPRAGUE, S. J., KIRKEGAARD, J. A., ROSS, J. J., REID, J. B., FITT, G. P., SEWELAM, N., SCHENK, P. M., MANNERS, J. M. & KAZAN, K. 2007. MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. Plant Cell, 19 , 2225-45.DONG, J., CAO, L., ZHANG, X., ZHANG, W., YANG, T., ZHANG, J. & CHE, D. 2021. An R2R3-MYB Transcription Factor RmMYB108 Responds to Chilling Stress of Rosa multiflora and Conferred Cold Tolerance of Arabidopsis. Front Plant Sci, 12 , 696919.FANG, S., SHANG, X., YAO, Y., LI, W. & GUO, W. 2020. NST- and SND-subgroup NAC proteins coordinately act to regulate secondary cell wall formation in cotton. Plant Sci, 301 , 110657.FU, J., WU, H., MA, S., XIANG, D., LIU, R. & XIONG, L. 2017. OsJAZ1 Attenuates Drought Resistance by Regulating JA and ABA Signaling in Rice. Front Plant Sci, 8 , 2108.GENG, D., CHEN, P., SHEN, X., ZHANG, Y., LI, X., JIANG, L., XIE, Y., NIU, C., ZHANG, J., HUANG, X., MA, F. & GUAN, Q. 2018. MdMYB88 and MdMYB124 Enhance Drought Tolerance by Modulating Root Vessels and Cell Walls in Apple. Plant Physiol, 178 , 1296-1309.HU, R., WANG, J., YANG, H., WEI, D., TANG, Q., YANG, Y., TIAN, S. & WANG, Z. 2023. Comparative transcriptome analysis reveals the involvement of an MYB transcriptional activator, SmMYB108, in anther dehiscence in eggplant. Front Plant Sci, 14 , 1164467.IM, J. H., SON, S., KIM, W. C., KIM, K., MITSUDA, N., KO, J. H. & HAN, K. H. 2024. Jasmonate activates secondary cell wall biosynthesis through MYC2-MYB46 module. Plant J, 117 , 1099-1114.JEONG, C. Y., LEE, W. J., TRUONG, H. A., TRỊNH, C. S., JIN, J. Y., KIM, S., HWANG, K. Y., KANG, C. S., MOON, J. K., HONG, S. W. & LEE, H. 2018. Dual role of SND1 facilitates efficient communication between abiotic stress signalling and normal growth in Arabidopsis. Sci Rep, 8 , 10114.KAZAN, K. & MANNERS, J. M. 2013. MYC2: the master in action. Mol Plant, 6 , 686-703.LI, S., HU, Y., YANG, H., TIAN, S., WEI, D., TANG, Q., YANG, Y. & WANG, Z. 2023. The regulatory roles of MYC TFs in plant stamen development. Plant Sci, 333 , 111734.LIU, Y., DU, M., DENG, L., SHEN, J., FANG, M., CHEN, Q., LU, Y., WANG, Q., LI, C. & ZHAI, Q. 2019. MYC2 Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative Feedback Loop. Plant Cell, 31 , 106-127.MANDAOKAR, A. & BROWSE, J. 2009. MYB108 acts together with MYB24 to regulate jasmonate-mediated stamen maturation in Arabidopsis. Plant Physiol, 149 , 851-62.MIN, D., LI, F., ZHANG, X., CUI, X., SHU, P., DONG, L. & REN, C. 2018. SlMYC2 Involved in Methyl Jasmonate-Induced Tomato Fruit Chilling Tolerance. J Agric Food Chem, 66 , 3110-3117.NIU, Z., LI, G., HU, H., LV, J., ZHENG, Q., LIU, J. & WAN, D. 2021. A gene that underwent adaptive evolution, LAC2 (LACCASE), in Populus euphratica improves drought tolerance by improving water transport capacity. Hortic Res, 8 , 88.PIREYRE, M. & BUROW, M. 2015. Regulation of MYB and bHLH transcription factors: a glance at the protein level. Mol Plant, 8 , 378-88.QI, T., WANG, J., HUANG, H., LIU, B., GAO, H., LIU, Y., SONG, S. & XIE, D. 2015. Regulation of Jasmonate-Induced Leaf Senescence by Antagonism between bHLH Subgroup IIIe and IIId Factors in Arabidopsis. Plant Cell, 27 , 1634-49.SCHUBERT, R., DOBRITZSCH, S., GRUBER, C., HAUSE, G., ATHMER, B., SCHREIBER, T., MARILLONNET, S., OKABE, Y., EZURA, H., ACOSTA, I. F., TARKOWSKA, D. & HAUSE, B. 2019. Tomato MYB21 Acts in Ovules to Mediate Jasmonate-Regulated Fertility. Plant Cell, 31 , 1043-1062.SHAMLOO-DASHTPAGERDI, R., LINDLöF, A. & NOURIPOUR-SISAKHT, J. 2023. Unraveling the regulatory role of MYC2 on ASMT gene expression in wheat: Implications for melatonin biosynthesis and drought tolerance. Physiol Plant, 175 , e14015.SONG, S., QI, T., HUANG, H., REN, Q., WU, D., CHANG, C., PENG, W., LIU, Y., PENG, J. & XIE, D. 2011. The Jasmonate-ZIM domain proteins interact with the R2R3-MYB transcription factors MYB21 and MYB24 to affect Jasmonate-regulated stamen development in Arabidopsis. Plant Cell, 23 , 1000-13.SONG, Z., ZHAO, L., MA, W., PENG, Z., SHI, J., PAN, F., GAO, Y., SUI, X., RENGEL, Z., CHEN, Q. & WANG, B. 2023. Ethylene inhibits ABA-induced stomatal closure via regulating NtMYB184-mediated flavonol biosynthesis in tobacco. J Exp Bot, 74 , 6735-6748.SU, Z., MA, X., GUO, H., SUKIRAN, N. L., GUO, B., ASSMANN, S. M. & MA, H. 2013. Flower development under drought stress: morphological and transcriptomic analyses reveal acute responses and long-term acclimation in Arabidopsis. Plant Cell, 25 , 3785-807.SUN, X., WANG, Y. & SUI, N. 2018. Transcriptional regulation of bHLH during plant response to stress. Biochem Biophys Res Commun, 503 , 397-401.ULLAH, A., UL QAMAR, M. T., NISAR, M., HAZRAT, A., RAHIM, G., KHAN, A. H., HAYAT, K., AHMED, S., ALI, W., KHAN, A. & YANG, X. 2020. Characterization of a novel cotton MYB gene, GhMYB108-like responsive to abiotic stresses. Mol Biol Rep, 47 , 1573-1581.WANG, J., ZHANG, X., YANG, H., LI, S., HU, Y., WEI, D., TANG, Q., YANG, Y., TIAN, S. & WANG, Z. 2024a. Eggplant NAC domain transcription factor SmNST1 as an activator promotes secondary cell wall thickening. Plant Cell Environ .WANG, L., CHEN, H., CHEN, G., LUO, G., SHEN, X., OUYANG, B. & BIE, Z. 2024b. Transcription factor SlWRKY50 enhances cold tolerance in tomato by activating the jasmonic acid signaling. Plant Physiol, 194 , 1075-1090.WANG, W., SHI, X., CHEN, D., WANG, F. & ZHANG, H. J. E. J. H. S. 2020. The Brassica napus MYC2 regulates drought tolerance by monitoring stomatal closure. 85 , 226-231.XIA, Y., JIANG, S., WU, W., DU, K. & KANG, X. 2024. MYC2 regulates stomatal density and water use efficiency via targeting EPF2/EPFL4/EPFL9 in poplar. New Phytol, 241 , 2506-2522.XING, Q., LIAO, J., CAO, S., LI, M., LV, T. & QI, H. 2020. CmLOX10 positively regulates drought tolerance through jasmonic acid -mediated stomatal closure in oriental melon (Cucumis melo var. makuwa Makino). Sci Rep, 10 , 17452.XU, X. F., WANG, B., FENG, Y. F., XUE, J. S., QIAN, X. X., LIU, S. Q., ZHOU, J., YU, Y. H., YANG, N. Y., XU, P. & YANG, Z. N. 2019. AUXIN RESPONSE FACTOR17 Directly Regulates MYB108 for Anther Dehiscence. Plant Physiol, 181 , 645-655.ZHANG, F., GONZALEZ, A., ZHAO, M., PAYNE, C. T. & LLOYD, A. 2003. A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis. Development, 130 , 4859-69.ZHANG, Q., XIE, Z., ZHANG, R., XU, P., LIU, H., YANG, H., DOBLIN, M. S., BACIC, A. & LI, L. 2018. Blue Light Regulates Secondary Cell Wall Thickening via MYC2/MYC4 Activation of the NST1-Directed Transcriptional Network in Arabidopsis. Plant Cell, 30 , 2512-2528.ZHAO, W., HUANG, H., WANG, J., WANG, X., XU, B., YAO, X., SUN, L., YANG, R., WANG, J., SUN, A. & WANG, S. 2023. Jasmonic acid enhances osmotic stress responses by MYC2-mediated inhibition of protein phosphatase 2C1 and response regulators 26 transcription factor in tomato. Plant J, 113 , 546-561.ZHONG, R., LEE, C., ZHOU, J., MCCARTHY, R. L. & YE, Z. H. 2008. A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell, 20 , 2763-82.ZHU, Z., QUAN, R., CHEN, G., YU, G., LI, X., HAN, Z., XU, W., LI, G., SHI, J. & LI, B. 2022. An R2R3-MYB transcription factor VyMYB24, isolated from wild grape Vitis yanshanesis J. X. Chen., regulates the plant development and confers the tolerance to drought. Front Plant Sci, 13 , 966641. Supplementary figure Supplementary figure 1 Screening of AbA resistance concentration of Y1H Gold (pAbAi- PrSmMYC2 ) strain Information & Authors Information Version history V1 Version 1 26 February 2025 Peer review timeline Published Plant Cell Reports Version of Record 14 Nov 2025 Published Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords drought resilience eggplant growth scw thickening smmyc2 Authors Affiliations Sirui Li Southwest University College of Horticulture and Landscape Architecture View all articles by this author Yao Hu Southwest University College of Horticulture and Landscape Architecture View all articles by this author Dayong Wei Southwest University College of Horticulture and Landscape Architecture View all articles by this author Qinglin Tang Southwest University College of Horticulture and Landscape Architecture View all articles by this author Yang Yang Chongqing Academy of Agricultural Sciences View all articles by this author Zhimin Wang 0000-0001-8548-2552 [email protected] Southwest University College of Horticulture and Landscape Architecture View all articles by this author Metrics & Citations Metrics Article Usage 161 views 109 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Sirui Li, Yao Hu, Dayong Wei, et al. Transcription factor SmMYC2 regulates secondary cell wall thickening to enhance drought resilience in eggplant. Authorea . 26 February 2025. DOI: https://doi.org/10.22541/au.174055213.39024882/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174055213.39024882/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'a00fcea52e9e593a',t:'MTc3OTY2MjQ4MA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();