Effects of dietary supplementation of Bacillus subtilis and bacteriophage on water quality, carcass traits and muscle growth of Magang Geese

Effects of dietary supplementation of Bacillus subtilis and bacteriophage on water quality, carcass traits and muscle growth of Magang Geese | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of dietary supplementation of Bacillus subtilis and bacteriophage on water quality, carcass traits and muscle growth of Magang Geese Yong Li, Yongquan Luo, Yuanhao Han, Zhiyuan Liu, Songchao Li, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6625383/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Presence of Escherichia coli and Salmonella causes poor bath water quality, which is an important factor plaguing the development of the goose farming industry. As these bacteria release stable endotoxins like Lipopolysaccharide (LPS), which can affects goose farming by impairing their immune health. Bacillus subtilis is a non-toxic Gram-positive probiotic that can decompose organic matter in water, improves feed efficiency in animals, inhibit harmful bacteria, and enhances the animal growth. Bacteriophages are virus which can specifically kill bacteria, reduce their numbers in the environment. To evaluate the effects of dietary supplementation of Bacillus subtilis and bacteriophage on Magang geese's carcass traits, skeletal muscle weight percentage, myogenic gene and immunity factor gene mRNA expression during different rearing stages, 288 one-day old Magang geese were divied into 4 groups with with 6 replicates. The dietary treatments were group A, basal diet (with no treatment), group B, basal diet with 5.0×10 10 PFU/L bacteriophage at a concentration of 1/10 3 , group C, basal diet with 5.0×10 9 CFU/kg Bacillus subtilis and group D, basal diet with bacteriophage and Bacillus subtilis in combination same as group B and C. The results indicated that dietary supplementation of Bacillus subtilis and bacteriophage or their combination significantly increased wing length, tibia length and live weight on 60 d, reduced the levels of feeding environment water endotoxin as well as blood endotoxin in all stages, and suppressed the levels of Escherichia coli , Salmonella , and total bacterial colony in the water. It may also play a role in promoting muscle production through the mRNA and protein expression of muscle-associated factors ( MYOD , MYOG , MYH1 ), insulin like growth factor ( IGF-1 ) and reducing the mRNA and protein expression of inflammatory factors ( TNF-α , IL-6 ), which may promote the growth of myofiber diameter and improve growth performance. These findings may guide new strategies to improve goose productivity and immunity, provide new eco-friendly methods to manage farming environments and thereby reducing the use of antibiotics. goose carcass trait skeletal muscle Bacillus subtilis bacteriophage Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction China produced 530 million meat geese in 2022, which is the country with the largest number of meat geese in the world according to data provided by China animal Husbandry association and the world Food and Agriculture Organization (FAO)[ 1 ]. Today, semi-intensive and intensive feeding systems are more profitable than traditional feeding methods[ 2 , 3 ]. In traditional feeding methods, after waterfowl excreta are discharged into the water body, with the prolongation of breeding time and the accumulation of feces, Gram-negative bacteria in the water body use the nitrogen and phosphorus in the feces to continuously multiply, releasing endotoxin (LPS) after the death of bacteria, which enters into the chicks and accumulates in the body unable to be completely eliminated, thus causing adverse effects on the organism. Semi-intensive and intensive feeding systems are characterized by a high degree of amenities, automation, and more scientific and effective disease prevention and control, reducing the probability of disease occurrence, and relatively high breeding density, more breeding numbers per unit area, and higher economic benefits[ 4 ].Effective environmental control of waterfowl farming is particularly important as the demand for waterfowl products continues to grow with the increase in population. It is now widely accepted that the main cause of these problems is increased level of bacteria and lipopolysaccharide (LPS) in the goose rearing environment. Muscle development is a complicated process that includes somatic cell proliferation, migration, and differentiation. Skeletal muscle development in geese varies at different periods. The number of myofibers in waterfowl skeletal muscle is essentially determined at the embryonic stage, the acquisition of muscle mass after hatching is largely dependent on protein deposition and reflected in the thickening and growth of myofibers[ 5 ]. Myofiber density was the highest at 1 d and gradually decreased with time, while myofiber diameter increased. The diameter and cross-sectional area of myofibers increased gradually, and the density decreased gradually, but the number of myofibers contained in the muscle bundles did not change greatly[ 6 ] Skeletal muscle growth and development is regulated by multiple genes. Several myogenic regulatory factors (MRFs) are associated with myogenesis, including Myf5 , MYOD , MYOG and MYH1 . It is widely recognized that Myf5 and MYOD are early factors in satellite cell myogenesis and determine whether muscle satellite cells can be activated to become myoblasts with myogenic properties. And much evidence supports that MYOG plays an important role in the differentiation of myoblasts and the maintenance of myofiber homeostasis while MYH1 assumes the role of encoding the MYHC protein[ 7 ]. Insulin-like growth factor-1 ( IGF-1 ) is one of the best-characterized growth factors, and it has been shown to modulate muscle size and play a critical role in regulating muscle function[ 8 ]. Several lines of evidence indicate that cytokines such as interleukin-6 ( IL-6 ), and tumor necrosis factor-α ( TNF-α ) are important regulators of muscle protein balance. TNF-α impairs muscle protein metabolism when administered to control animals[ 9 ]. IL-6 supports satellites cell proliferation and differentiation[ 10 ] LPSs are bacterial surface glycolipids, produced by Gram-negative bacteria. It is present in the outer membrane of most Gram-negative bacteria, which stimulates the secretion of immune elements. Geese direct excretion into water can lead to increased levels of bacteria and LPS over time, which in turn leads to the accumulation of endotoxins in geese, resulting in disease and reduced performance. Previous studies have shown that LPS injection inhibited growth performance of broilers and led to an inflammatory response, which negatively affected several parameters including splenic and bursal relative weight[ 11 ], meanwhile, LPS significantly induced inflammatory cytokine production in both proliferation and differentiation stages of goose myoblasts[ 7 ]. Bacillus subtilis serves as a facultative anaerobe and is widely used as a possible candidate in monogastric feed due to high resistance of its spores to the harsh environment (such as the gastrointestinal tract of animals), and the possibility of long-term storage at ambient temperature[ 12 ]. It has been shown that Bacillus subtilis has a growth-promoting effect and can effectively improve the growth performance, immunity and intestinal morphology of poultry[ 13 – 15 ]. The bacteriophage is probably the most abundant virus which are a group of biological entities with a genome consisting either of DNA or RNA and encapsulated in a protein coat (capsid)[ 9 ]. Dietary addition of bacteriophage increased Lactobacillus and Bifidobacterium amount, and decreased Salmonella and Coliform amount in the fecal microbiota of growing pigs[ 16 ]. Previous studies about the application of Bacillus subtilis and bacteriophage mainly concentrated in the effects of dietary Bacillus subtilis or bacteriophage supplementation on intestinal morphology and gut microbiota[ 17 – 20 ] Animal carcass traits is an index reflecting the growth and development of animals. However, there is still limited information on the influence of Bacillus subtilis , bacteriophage and their combination on water quality, carcass traits and muscle growth during waterfowl rearing. The specific mechanism regarding how Bacillus subtilis or bacteriophage improves the waterfowl muscle function remains elusive. Thus, in the present study, we challenged to clarify the effect of Bacillus subtilis and bacteriophage individually or in combination on slaughtering performance, breeding water and serum endotoxin, as well as effects on serum inflammatory cytokine and myogenesis-related factor gene expression and protein expression,which would in turn improve the productivity and efficiency of goose farming. Materials and Methods Animal ethics The experimental procedures strictly adhered to the ethical guidelines established by the Animal Care Committee of Zhongkai University of Agriculture and Engineering, with all protocols reviewed and approved by the institution’s Animal Experiment Committee (NO. 2021112709). Measures were rigorously implemented to minimize discomfort and distress in the study subjects.To ensure minimal distress, geese were euthanized via rapid exsanguination (cervical vessel transection) without prior anesthesia, as this method is recognized for immediate unconsciousness due to rapid cerebral hypoperfusion. Animals and management One-day-old Magang goslings were procured from Guangdong Lvfengyuan Modern Agriculture Development Co., Ltd., and maintained under controlled conditions with unrestricted access to water and standardized feed (GB/18823). The formulated diet comprised maize, wheat, soybean meal, vegetable meal, sodium chloride, calcium hydrogen phosphate, L-lysine sulfate, DL-methionine, and vitamin supplements. Experimental design In this experiment, there were 72 replicates per group. The number of replicated groups of feeding was increased by subdividing it into 6 replicates and 12 replicates per replicate to minimize experimental error and make the experiment more rigorous.60 days of feeding, 1–20 day old for yard-housing feeding and 21–60 day old for semi-dry feeding. The experimental groupings are shown in Table 1 . The feeding trial was conducted in September-October, and the ambient temperature was maintained at around 39℃ for yard feeding from 1–20 days old, and around 30–35℃ for semi-dry feeding from 21–60 days old. The composition of feed ingredients for Magang geese during the experimental period was maize, wheat, soybean meal, vegetable meal, sodium chloride, calcium hydrogen phosphate, L-lysine sulfate, DL methionine, and vitamins. Specific nutritional levels are shown in Table 2 . Bacteriophage used in the present study was a commercial product from Green-Agr Biotechnology Co., Ltd. Wuhan, China, consisting of a mixture of bacteriophage in a ratio of 1:1, targeting Escherichia coli and Salmonella . Bacillus subtilis was purchased from Huizhou Huinong Bio-technology Co., Ltd. The live bacteria number > 5×10 10 CFU/g. Table 1 Grouping design group treatment A control, a basal diet without treatment B a basal diet plus 5.0×10 10 PFU/L bacteriophage at a concentration of 1/10 3 C a basal diet plus 5.0×10 9 CFU/kg Bacillus subtilis D a basal diet plus 5.0×10 10 PFU/L bacteriophage at a concentration of 1/10 3 and 5.0×10 9 CFU/kg Bacillus subtilis same as group B and C Table 2 Nutritional Level of Magang Goose Diet Nutrient Content Crude protein 12.0 Crude Fiber 12.0 Crude Ash 12.0 Calcium 0.5–1.2 Total phosphorus 0.3–1.2 Sodium chloride 0.25–0.8 Moisture 13.5 Lysine 0.5 Water and blood sample procedure Blood specimens were obtained from six randomly selected geese per group on days 1, 30, and 60 for serum isolation and subsequent analytical procedures. Water samples were concurrently collected from the avian bathing pool on days 30 and 60. At each sampling event, 100 mL aliquots were drawn from five predefined locations (four peripheral corners and central region) within the pool at depths of 10–20 cm. These subsamples were homogenized to form a composite 500 mL representative sample per timepoint. Slaughtering performance 24 geese (6 replicates per group) were randomly selected and fasted for 12 h with access to water before slaughtering on 1, 30 and 60 d, 6 geese per group were weighed to record live weight and measure wing and tibial length. On 60 d, after slaughtering and releasing the blood, the geese were de-feathered, and recorded as slaughter weight. The whole body including heart, liver, kidneys, glandular stomach, myogastrics exfoliated membranes and contents, surrounding fat as well as lung were measured and recorded as half-eviscerated weight. Then removed visceral tissue and recorded as carcass weight. The breast muscle weight and leg muscle was removed and their weights were recorded. Dressed percentage = (slaughter weight/live weight) × 100% Half-eviscerated weight percentage = (half-eviscerated weight percentage/live weight) × 100% Carcass weight percentage = (carcass weight percentage/live weight) × 100% Breast muscle weight percentage = (Breast muscle weight/ carcass weight) × 100% Leg muscle weight percentage = (Leg muscle weight/ carcass weight) × 100% Bacterial colony culture Precisely measure 33 g Nutrient Agar (NA), 36 g Luria-Bertani (LB) agar, 50 g MacConkey agar, and 58.5 g SS agar powders, and resuspend in 1 L deionized water. Securely cap the mixture container, agitate thoroughly until complete dissolution, and sterilize via autoclaving (121℃, 15 min). After cooling to 50℃ aseptically dispense the liquefied media into pre-sterilized petri dishes and allow solidification under ambient conditions. For microbial quantification, water samples were serially diluted 10 3 -10 4 ⁴times under laminar flow conditions. Aliquots (100 µL) of each dilution were spread uniformly across agar surfaces using sterile L-shaped glass rods. Plates were incubated upright for 10–20 min at 37℃ to absorb residual moisture, then inverted and cultured aerobically (37℃, 18–24 h). Post-incubation, discrete colonies were quantified via standardized plate-count methodology, with colony-forming units (CFU) per plate systematically recorded. Endotoxin determination Endotoxin levels in serum on days 1, 30, 60 and water samples on day 30 and 60 were quantified using horseshoe crab lysate reagent (BIOENDO, Fujian, China). Serial dilutions of the endotoxin calibrant were prepared to generate a standard concentration series, which were then combined with the lysate reagent following manufacturer-specified ratios. Reaction mixtures were incubated under controlled thermal conditions (37℃, 10–15 min), and absorbance values for each standard were measured at the prescribed wavelength using a Thermo Fisher enzymatic microplate reader. A calibration curve was constructed by plotting endotoxin concentrations (logarithmic scale) against their corresponding absorbance values (linear scale).Negative controls containing only reagent and buffer were processed in parallel to account for background interference. Test samples were diluted iteratively based on their matrix properties and projected endotoxin levels. Diluted samples were mixed with reagent as per protocol, incubated under identical thermal parameters as the standards, and promptly analyzed for absorbance at the target wavelength. Final endotoxin concentrations were derived by interpolating sample absorbance values against the standard curve, with results adjusted by subtracting the blank control’s baseline absorbance. Sample collection and H&E Staining A tissue block of the breast muscle superficialis muscle and leg muscle were removed on 1, 30, and 60 d, which still attached to the bone, was cross-sectioned perpendicular to the orientation of the myofibers, and the cross sectional area was traced on a transparent paper[ 5 ]. The sampling site for the leg muscle is the gastrocnemius muscle, and the sampling site for the breast muscle is a cross-section of the entire muscle. Skeletal muscle from 6 geese of 1, 30, and 60 d were utilized. Sections were processed by hematoxylin & eosin staining. A 20.0× image of muscle tissue was captured for each section on CaseViewer 2.2 scanning and viewing soft-ware. The micrographs were taken with the Axio Imager Z1 (ZEISS), zooming in 400× for each area. One field of view was selected for each of the three biological replicates of each species in each period for the statistics. Three randomly selected fields of view per slice from 6 slices were photographed for each section, 6 myofibers or muscle bundles were randomly selected for each view, and the diameter of the myofibers (µm) or the cross-sectional area of the muscle bundles (µm 2 ) was measured and averaged. The number and diameter (µm) of all myofiber in the field of view of the section were counted by Adobe Photoshop 2021, and the density was calculated by the number and field area of the section. The total number of myofiber was calculated by myofiber density and cross-sectional area. RNA extraction and Real-Time Quantitative PCR Total RNA was isolated following the Trizol (Thermo Fisher, Waltham, MA, USA) protocol. RNA purity and concentration were quantified via full-wavelength spectrophotometry after resuspension in DEPC-treated water. cDNA synthesis utilized the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). RT-qPCR primers were designed using Primer Premier 5.0 (Table 3 ) through alignment with NCBI GenBank sequences. GAPDH served as the endogenous control. SYBR Select Master Mix (Thermo, USA) was prepared on ice for 20 µL reaction assemblies. Relative mRNA levels were determined via the 2 −∆∆CT method. Table 3 Primer sequences for RT-qPCR. Primer name Forwad (5'-3') Reverse (3'-5') Annealing temperature (℃) MYH1 CTCCTCACGCTTTGGTAAAT GCTCTGGCTTCTTGTTGGAC 55 MYOD AAGGCGTGCAAGAGGAAGAC TGGTTGGGGTTGGTGGA 55 MYOG CCCGAGCACTGCCCCGGGCAAT CGCTCCTGCTGGTTGAGGCTGCTG 55 GAPDH TCTGTCGTGGACCTGACCTGC GCCAGCACCCGCATCAAA 60 IGF-1 AGGTCGTCCATCGTAGTCCTTGCACTTTT ACAGCGTCGTTATCGTTCCTGCAAACACAGGCCAAGGTAG 55 IL-6 TTCGACGAGGAGAAATGCTT CCTTATCGTCGTTGCCAGAT 55 TNF-α ATGAACCCTCCTCCGTACAC AGAGGCCACCACATGATAGC 60 Western blotting Protein lysates underwent electrophoretic separation via SDS-PAGE and were subsequently electrophoretically transferred onto PVDF membranes. Membranes were blocked for 1 h with 5% skim milk in PBST (phosphate-buffered saline with 0.1% Tween-20). Primary antibodies included: anti-MYOD (1:1000, Abcam ab16148, UK), anti-IL-6 (1:1000, Wanlei WL02841, China), anti-TNF-α (1:1000, Wanlei WL01581, China), anti-MyHC (1:10000, Sigma M4276, USA), and anti-GAPDH (1:10000, Abcam ab181602, UK), which were applied in PBST at 4℃ overnight. Following PBS-T washes, membranes were probed with HRP-conjugated secondary antibodies—goat anti-mouse IgG (1:10000, Abcam ab97023, UK) or goat anti-rabbit IgG (1:10000, Wanlei WLA32023a, China) for 1 h at ambient temperature. A secondary incubation step was performed at 37℃ for 1 h to enhance antigen-antibody binding. Chemiluminescent signals were generated using an ECL substrate (Beyotime, Beijing, China) and imaged on a Tanon-200 Multi documentation system (Tanon, Shanghai, China). Quantitative densitometry was executed via ImageJ software (v1.8.0) to assess band intensity. Statistical analysis Six biological replicates were set in each group, one-way analysis of variance (ANOVA) with Graphpad Prism software (Version 5.0), and difference significance analysis was performed using Tukey's test. P > 0.05 means that the difference is not significant, P < 0.05 means that the difference is significant. Rusults Effect of Bacillus subtilis and bacteriophage on slaughtering performance. In order to determine whether dietary supplementation of Bacillus subtilis and bacteriophage affects goose slaughering performance, tibial length and wing length were measured. Body weight, half-eviscerated weight, eviscerated weight and their ratio to body weight were analyzed, as well as breast muscle weight, leg muscle weight ,breast muscle weight rate and leg muscle weight rate. Results have indicated that, on 30 d, there was a significant difference in wing length between Group B and A ( P < 0.05). On 60 d, Group B, C and D was significantly higher than group A, while group C and D was also significantly higher than group B ( P < 0.05) (Fig. 1 A). The tibial length of group C was significantly higher than that of group A, B and D on 60 d, while groups B and D did not show any differential difference from group A( P 0.05), live weight of group B, C and D were significantly higher than those of group A at 60 d, with group C being the highest and group B the second highest( P 0.05). Although significant differences were not reached, slaughter weight, half-eviscerated weight and carcass weight of bacteriophage added group showed an elevated trend (Fig. 1 D-I). Therefore, we further explored the effect of adding Bacillus subtilis and bacteriophage individually or in combination on skeletal muscle we measured breast muscle weight, leg weight, breast muscle weight percentage, and leg weight percentage on day 60. It can be seen that breast muscle weight was significantly higher in group C than in group A, B and D ( P 0.05) (Fig. 2 C). The leg weight percentage was significantly higher in group B than in group A, C and D ( P < 0.05) (Fig. 2 D), and no significant differences were shown between the leg muscle weights of the different treatment groups, although the leg weight in group B and C was slightly higher than in group A and D ( P > 0.05) (Fig. 2 B).These results suggest that dietary supplementation of Bacillus subtilis and bacteriophage individually or in combination had a positive effect on the slaughter performance of the geese especially on day 60, and dietary supplementation of Bacillus subtilis or bacteriophage alone may have a greater effect on the muscle than a mixture of the two. These findings indicate that dietary supplementation of Bacillus subtilis and bacteriophage, especially bacteriophage can significantly increase the body weight, breast skeletal muscle weight, increased skeletal muscle weight percentage increased tibal length and wing length to improved production performance of 60-day-old Magang geese. Effect of dietary supplementation with Bacillus subtilis and bacteriophage on bacteria in bath water In order to explore the bacterial effects of Bacillus subtilis and bacteriophage on the bath water of Magang geese, we examined the levels of bacterial total colony, Escherichia coli , and Salmonella in the bath water on 30 and 60 d. As it shown, total bacterial colony on 30 d was not significantly different among the groups with group D being slightly lower than group A ( P > 0.05). On day 60, group B, C and D had lower total bacterial colony as compared to group A, while those of group B and C was significantly lower than those of group A( P < 0.05)(Fig. 3 A). Group D showed lower total bacterial colony content on 30 d, but did not show significant differences. Group A showed the highest total bacterial colony content on 60 d compared with the treatment groups, while those on group C and D were significant lower ( P < 0.05) (Fig. 3 A). Escherichia coli content was significatly lower in treatment groups (B,C,D) compared to group A on 30 d, and was significantly lower in group D compared to group A, B and C on 60 d( P < 0.05) (Fig. 3 B). Although there was no significant difference in Salmonella concent on both 30 and 60 d, Salmonella concent in group B, C and D were slightly lower than in group A (Fig. 3 C). The above results have showed that bacteriophage and Bacillus subtilis can significantly reduce the concentrations of specifically quantified Escherichia coli and Salmonella in water and improve the environment of bath water. Due to limitations in the specificity of the assay, co-reduction of other pathogens cannot be excluded, but the main effect should be attributed to bacteriophage and Bacillus subtilis . Effect of dietary supplementation with Bacillus subtilis and bacteriophage on serum and bath water endotoxin In order to detect the effects of bacteriophage and Bacillus subtilis on farmed water and serum endotoxin in Magang geese, this paper examined bath water and serum endotoxin using horseshoe crab reagent colorimetric methods. On 30 d, serum endotoxins were significantly lower in both Groups B and D than in group A and C ( P 0.05). On 60 d, serum endotoxins were significantly lower in both Group B and D than in group A and C ( P 0.05) (Fig. 4 A). Bath water endotoxins were significantly lower in both Group B and D than in group A and C. On 60 days, the amount in treatment groups (B,C,D) were significantly lower than in group A ( P < 0.05)(Fig. 4 B). The results have showed that bath water and serum endotoxin both increased with period and stabilized after 30 d. Dietary supplementation of Bacillus subtilis or the combination of Bacillus subtilis and bacteriophage was able to significantly reduce bath water and serum endotoxin on 30 and 60 d, but dietary supplementation of bacteriophage alone had less effect. Effect of dietary supplementation with Bacillus subtilis and bacteriophage on the diameter and density of breast and leg myofiber. Skeletal muscle is an important criterion for judging the performance of poultry production, to explore the difference between two treatments, we performed H&E-stained section analysis. Results have indicated that there were no significant differences ( P > 0.05) in the breast muscle density and diameter of the groups at every time point during this study (Fig. 5 A). There were no significant differences ( P > 0.05) in the leg muscle density of the groups at every time point. Moreover, there were no significant differences in the leg muscle myofiber diameter at 1 and 30 d (Fig. 5 B) ( P > 0.05), leg muscle myofiber diameters were significantly higher in the treated group (B, C, D) than in the control group (group A) on day 60, with group C having the highest, which suggesting that Bacillus subtilis and bacteriophage may not be effective on the leg muscle until after the middle of the fattening period ( P < 0.05) (Fig. 6 C). Effect of dietary supplementation of Bacillus subtilis and bacteriophage on inflammation and myogenic genes The mRNA expression of proinflammatory factors and myogenic genes were measured by real-time RT-qPCR on day 1,30 and 60 after dietary supplementation of Bacillus subtilis and bacteriophage. The mRNA relative expression of TNF-α showed no significant difference among the 4 groups on day 1, 30 and 60 of breast and leg muscle (Fig. 7 A, Fig. 8 A), however, the TNF-α expression of group B, C and D was decreased compared to group A on breast muscle, meanwhile the mRNA expression of TNF-α was also decreased in group C than in group A ( P > 0.05). Dietary addition of Bacillus subtilis and bacteriophage individually or in combination significantly reduced IL-6 mRNA expression on days 30 and 60. In the leg muscles, IL-6 mRNA expression was significantly higher in groups C and D compared to groups A and B ( P < 0.05), indicating that the addition of bacteriophage or a combination of both increased IL-6 mRNA expression (Fig. 7 B, 8 B). The expression of IGF-1 mRNA difference in breast muscle was significantly higher than group C and D than in group A and B on 60 d (Fig. 7 C), meanwhile, in leg muscle, bacteriophage treated geese (group C) had higher IGF-1 mRNA expression but the difference was not statistically significant ( P > 0.05) (Fig. 8 C). We then expolored the effects of Bacillus subtilis and bacteriophage individually or in combination on myogenic mRNA expression ( P 0.05) but significant difference in breast muscle on 30 and 60 d, with group C having the highst mRNA expression, group D having the second highest ( P < 0.05) (Fig. 7 D, 8 D). MYH1 mRNA expression was significantly different in combination addition (group D) than in control (group A) on both 30 and 60 d ( P < 0.05), with bacteriophage addition (group C) have significant difference on 30 d ( P 0.05).This may suggest that the molecular mechanism by which Bacillus subtilis promotes muscle production may not be consistent with bacteriophage. There were no significant difference among the 4 groups on 1 and 30 d ( P > 0.05). However, at 60 d, the TNF-α mRNA relative expression of group C was significantly lower than group A ( P < 0.05)(Fig. 7 A), while the mRNA relative expression of IGF-1 was significantly higher in control group compared with treatment groups (Fig. 7 B). Further more, although the mRNA relative expression of MYOD did not show significant difference in different periods among the 4 groups ( P > 0.05), the mRNA relative expression of MYH1 in group D was significant higher than group A, while MYOG was significant higher than group A, C and D ( P < 0.05), which suggesting that possibly dietary supplementation of Bacillus subtilis and bacteriophage can enhance the expression of myo g enic factors. The results demonstrate dietary supplementation of Bacillus subtilis and bacteriophage can decrease the expression of inflammatory factors, increase the expression of myo g enic factors. Longer treatment with Bacillus subtilis and bacteriophage individually or in combination may lead to more efficient results. Effect of Bacillus subtilis and bacteriophage on inflammation and myogenic proteins To illustrates the effects of dietary supplementation with Bacillus subtilis and bacteriophage on the expression level of inflammatory cytokines and myogenic proteins in Magang geese,western blot analysis was utilized to evaluate the expression levels of IL-6 (inflammatory cytokine), MYOD, and MYH1 in both breast and leg muscles at different rearing stages (0, 30, and 60 days). In breast muscle, IL-6 expression levels significantly lowered across time in the treatment groups (B, C, D) as compared to the control group (A) in both 30 and 60 d ( P < 0.05) (Fig. 9 ) similarly, at day 60, IL-6 exhibits significantly higher expression in group A of leg muscles as compared to other groups ( P < 0.05)(Fig. 9 B,D). MYOD expression levels in the treatment groups were higher than in the control group. Particularly at 30 d, Group C ( Bacillus subtilis ) displayed significantly higher expression of MYOD ( P < 0.05). In addition, significant higher expression noted in groups B, C, and D as compared to group A ( P < 0.05). Likewise, MYH1 expression had a similar trend to MYOD, especially at 30 d, MYH1 expression was significantly higher in groups B,C and D than in group A ( P < 0.05)(Fig. 9 A,C). Similarly, in the leg muscles, MYH1 expression was significantly higher in groups C and D than in groups A and B at 30 d ( P < 0.05), and in groups B and D than in A and C at 60 d ( P < 0.05) (Fig. 10 ). The results showed that dietary supplementation of Bacillus subtilis and bacteriophage or their combination decreased the expression of IL-6 and increased the expression of MYOD and MYHC in both breast and leg muscle. Dietary supplementation of Bacillus subtilis and bacteriophage or their combination had a similar effect of reducing IL-6 protein expression, dietary supplementation of bacteriophage was more effective than dietary supplementation of Bacillus subtilis. in increasing the expression of myogenic factors MYOD and MYHC protein. Discussion In this study, we found that dietary supplementation of Bacillus subtilis and bacteriophage improved the growth performance of Magang geese, reduced the total number of bacterial total colony, Escherichia coli and Salmonella , improved the environment of the bath water, and enhanced the immune system, contributed to the development of the breast and leg muscles by decreasing the inflammatory response as well as promoting the expression of myo g enic factors. Dietary supplementation of Bacillus subtilis and bacteriophage improves geese growth performance With the growing interest in probiotics and their application in animal research, more and mounting supports the concept that dietary Bacillus subtilis or bacteriophage could promote the growth performance of poultry[ 13 , 21 – 23 ]. Several reports have shown that probiotics have no significant effect on body weight gain, dietary supplementation of Bacillus subtilis increased the weight gain of broiler chicks only in the early stages of life, while there was no difference in weight gain during the fattening period[ 24 , 25 ]. Moreover, other studies have shown that dietary Bacillus subtilis supplementation can improve the growth parameters even under conditions of heat stress[ 26 ] as well as body weight gain was improved by bacteriophage addition in diet[ 20 , 22 ]. Consistent with these studies, our results demonstrated that, during the breeding period, dietary supplementation of Bacillus subtilis and bacteriophage to geese diets possesses the potential to improve the slaughter performance of geese by increasing body weight, wing length, tibia length, breast muscle weight, breast muscle percentage, leg muscle weight and leg muscle percentage. Dietary supplementation of Bacillus subtilis in our study also does not seem to improve body weight gain, in agreement with those reported bacteriophage can inprove body weight. Dietary supplementation of Bacillus subtilis and bacteriophage prevents colonization and reduces proliferation of harmful bacteria It is widely accepted that the main reason for dietary supplementation of Bacillus subtilis and bacteriophage to diets to improve growth performance is colony regulation. In recent years, several reports have shown that Bacillus subtilis significantly reduced the Salmonella , load in the intestinal tract of poultry as well as in the surrounding environment[ 27 , 28 ],it can also competitively exclude Escherichia coli and Campylobacter jejuni in poultry. Moreover, research on bacteriophage therapy for bacterial diseases in livestock has been actively carried out. Bacteriophage therapy for Salmonella , Escherichia coli, Campylobacte r, Streptococcus and other pathogenic bacteria has been reported, which are not only pathogenic to livestock, but also harmful to human[ 20 , 29 – 34 ]. In our study, dietary supplementation of Bacillus subtilis or bacteriophage also seem to reduce Escherichia coli and total bacterial colony, although there was no significant difference in Salmonella load, we have seen a downward trend in Salmonella and believe that extending the addition treatment time will lead to a significant difference. In the present study, dietary supplementation of Bacillus subtilis or bacteriophage also appeared to reduce Escherichia coli and total colony counts, but there was no significant difference in Salmonella counts. Consistent with our findings, previous studies have reported that dietary supplementation of bacteriophage to diets improved the performance of broilers and laying hens while reducing the concentrations of Escherichia coli and Salmonella in feces[ 35 ]. We can assume that the lack of difference in Salmonella counts in this study may be due to the fact that dietary supplementation of Bacillus subtilis or bacteriophage works well to stop the infection of harmful bacteria and regulate the microbiota. Dietary supplementation of Bacillus subtilis and bacteriophage to diets improves growth performance possibly due to their ability to elicit an immune response and effectively reduce inflammation The immune system is closely related to growth performance. In the body, LPS commonly known as endotoxin might cause natural or innate immune responses, leading to elevation of inflammatory cytokines and a decrease in the immune function[ 36 – 38 ]. The activities of geese generally take place in water, so pollution of farm water can have an impact at all periods of growth and development, and exogenous LPS pollution can lead to increased accumulation of endotoxins in the body, which can reduce its growth performance. In this study, dietary supplementation of Bacillus subtilis or bacteriophage or a combination of the two showed varying degrees of ability to reduce water endotoxin as well as serum endotoxin, especially the Bacillus subtilis treatment and the combination of the two. This is consistent with the findings of previous studies that Bacillus subtilis or bacteriophage could alleviate the adverse effects on the growth performance of broilers challenged with LPS[ 39 , 40 ]。 The cytokines in serum could reflect the inflammatory reaction of the body. he Tumor Necrosis Factor alpha ( TNF-α ) is a crucial agent that modifies the immune response and the inflammatory‐cell‐induced‐tissue‐damage, while IL-6 is generally deemed as proinflammatory cytokines produced by classically activated macrophages [ 41 ]. Inflammation was negatively correlated with body weight in human and animal studies. The mRNA expression of inflammatory factors TNF-α and IL-6 in the breast muscle were both reduced under Bacillus subtilis or bacteriophage dietary treatments, as in previous studies[ 42 , 43 ]. It has been shown that bacteriophage inhibit the expression of inflammatory factors in mouse[ 44 , 45 ] and that probiotic bacteria act as inhibitors rather than stimulators of pro-inflammatory responses against pathogenic bacteria(Guo et al., 2020). It has also been reported that bacteriophage play a positive role in the reduction of pro-inflammatory factors in pigs[ 46 ] and the results of the present study showed that the mRNA expression of inflammatory factors in the leg muscles was reduced by treatment with bacteriophage diets or a combination of the two, which is in agreement with the previous study. On the contrary, it has been reported that the relative expression of inflammatory cytokines such as IL-1b , IL-6 , IL-10 , TNF-a and IFN in the small intestinal mucosa was significantly up-regulated under the stimulation of recombinant bacteriophage[ 47 ]. The results of the present study showed that the mRNA expression of inflammatory factors in the breast muscles was reduced by dietary Bacillus subtilis supplementation, bacteriophage supplementation or a combination of the two, which is in agreement with the previous study. Consistent with previous studies, IL-6 expression in leg muscles was significantly increased by dietary addition of bacteriophage or Bacillus subtilis and bacteriophage combination, In the present study, protein expression in leg muscles showed a similar trend, which suggests that Bacillus subtilis or bacteriophage have anti-inflammatory effects, mechanisms of immune expression in breast and leg muscles are inconsistent and require further study. Dietary supplementation with Bacillus subtilis and Bacteriophage may increases breast and leg muscle weight by increased expression of immune factors and muscle-forming genes Skeletal muscle development is regulated by myo g enic regulators including MYOD , MYOG , MYH1 [ 48 – 51 ]. Dietary supplementation of Bacillus subtilis or bacteriophage or their mixture increased the expression levels of muscle-forming factors to varying degrees. Bacillus subtilis may have a stronger ability to regulate leg muscles than breast muscles, and dietary supplementation with bacteriophage or Bacillus subtilis alone may be more effective than their combination. Dietary supplementation of bacteriophage or mixture were able to increase the mRNA expression of the growth factor IGF-1 in breast muscle, which is consistent with the results of previous studies[ 49 , 52 ]. The immune system and muscle growth performance are tightly linked. Another possibility is that administration of Bacillus subtilis or bacteriophage could enhance the geese’ immunity, which in turn regulates skeletal muscle development[ 53 , 54 ]. Skeletal muscle development consists of two phases: myoblast proliferation and differentiation. Study had found that LPS reduced the differentiation ability of goose embryonic myoblasts[ 55 ]. Moreover, LPS promotes myotube apoptosis and inhibits the proliferation of myofibroblasts, which reduces muscle mass, inhibits myofiber regeneration, and ultimately leads to muscle atrophy[ 56 ]. In our study, the decrease in serum endotoxin and the increase in leg muscle myofiber diameter at day 60 after dietary supplementation of Bacillus subtilis or bacteriophage or a combination of both suggests that Bacillus subtilis and bacteriophage can play a role in regulating the proliferation and differentiation of adult myoblasts. Also, mRNA expression of myogenic factors and protein expression increased significantly reinforcing this conclusion. This suggests that dietary supplementation of Bacillus subtilis or bacteriophage or a combination of both may enhance the proliferation and differentiation of myo g enic cells and by enhancing immunocompetence. Skeletal muscle development depends greatly on the development of myofibers. Myofibers are the basic constituent unit of animal muscle[ 57 ] that can be classified into four types according to the polymorphism of myosin heavy chain (MYHC): slow oxidizing type (I), fast oxidizing type (IIa), fast glycolytic type (IIb) and intermediate type (IIx) (Schiaffino and Reggiani, 2011), which are respectively encoded by myosin heavy chain (MyHC) I, IIa, IIx, and IIb isoform genes[ 58 ]. Regarding the effect of Bacillus subtilis supplementation on muscle production, the results of different studies have been inconsistent. Previous studies have shown that the addition of Bacillus subtilis to the diet may decrease the MYH1 mRNA and protein expression[ 59 ], It was clear from our study that the administration of Bacillus subtilis had a beneficial effect on myogenic factors with a increased expression on both mRNA and protein in MYOD and MYHC, which is consistent with previous study[ 60 ]. The current studies basically investigated the effects of dietary supplementation with bacteriophage on some immune responses and intestinal gene expression, as well as the effects on bacteria[ 20 , 23 , 33 , 61 – 68 ], indicating that bacteriophage can improve the immune ability of the organism, reduce the inflammatory response, and play a role in decreasing bacterial colonization, but very few studies have been conducted to explore the role of bacteriophage on myogenic factors, and the present study found that bacteriophage played a role in promoting myogenic factors, even exceeding the effect of Bacillus subtilis , and the specific mechanism of this remains to be further explored. We hypothesize that Bacillus subtilis and bacteriophage may inhibit the proliferation of pathogenic bacteria such as Escherichia coli and Salmonella in the intestinal tract by competitive rejection and secretion of antimicrobial peptides, and reduce the entry of lipopolysaccharide into the bloodstream, which reduces the activation of the TLR4/MyD88 signaling pathway in muscle tissues and alleviates systemic inflammation. Bacillus subtilis and bacteriophage may also be activating certain metabolites through digestion which in turn activate the AMPK/mTOR pathway in muscle tissues, inhibiting NF-κB-mediated inflammatory responses, reducing TNF-α , IL-6 levels, and while promoting protein synthesis and myofiber development. Based on the data presented here, it can be concluded that after dietary supplementation of Bacillus subtilis or bacteriophage or a combination of both positively affects the rate of growth and condition of the geese, the weight, muscle production and myo g enic gene mRNA and protein expression increase, inflammatory factors mRNA and protein decrease. Considering the simplicity and economical effectiveness of Bacillus subtilis or bacteriophage or their combination dietary addition, this combination of different ecological agents offers new preventive and control strategies for environmental management in the goose industry and can reduce the use of antibiotics, thus improving the performance and immune function of geese. In this study, we found that dietary supplementation of Bacillus subtilis or bacteriophage or their combinations to the diet promoted the growth performance of geese, reduced the levels of water and blood endotoxin in the feeding environment, inhibited the level of Escherichia coli , Salmonella and total bacterial colony in water, and improved the quality of bath water. In addition, it reduces the expression of immune factors, and increases the expression of myo g enic genes, thereby thickening the diameter of myofibers and promoting myo g enesis. These findings could provide theoretical support for the use of Bacillus subtilis or bacteriophage instead of antibiotics and offer potential nutritional strategies to improve production performance and immune function in geese. Declarations Ethics approval and consent to participate This experiment was performed in accordance with the regulations and guidelines of the Animal Care Committee of the Zhongkai University of Agriculture and Engineering, and all efforts were made to minimize animal suffering. All experimental protocols were approved by the Animal Experiment Committee of Zhongkai University of Agriculture and Engineering (NO. 2021112709). Consent for publication Not applicable. Availability of data and materials Not applicable. Competing interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This research was supported by: Guangdong Provincial Key Construction Disciplines Research Capacity Enhancement Project (2024ZDJS004), Guangdong Provincial Modern Agricultural Poultry Industry Technology System Innovation Team (2024CXTD20), Special Fund for Rural Revitalization Strategy Seed Industry Revitalization Project of Guangdong Province (2023-XDY-00-001, 2022-XPY-00-011), College Students innovation and entrepeneurship training program (S202411347062) and Young innovative talents projects of Ordinary Universities in Guangdong Province (2022KQNCX028). Author Contributions Y.L., Y.L., Y.H., Z.L., S.L. performed the experiments and wrote the paper; and X.L.and Z.W. helped interpret the results. All authors have read and agreed to the published version of the manuscript. Acknowledgements Thanks to the Guangdong Provincial Waterfowl Technology Innovation Platform for providing the experimental site. References SS Hou. LZ Liu. Waterfowl Industry and Technology Development Report 2023(in chinese). 60 (03) (2024) 318-321. https://doi.org/10.19556/j.0258-7033.20240202-11. B.Y. Liu, Z.Y. Wang, H.M. Yang, J.M. Wang, D. Xu, R. Zhang, Q. Wang, Influence of rearing system on growth performance, carcass traits, and meat quality of yangzhou geese, Poult. Sci. 90 (3) (2011) 653-659. https://doi.org/10.3382/ps.2009-00591. Y. Yu, R. Wei, S. Yi, Y. Teng, R. Ning, S. Wei, L. Bai, H. Liu, L. Li, H. Xu, C. Han, Research note: integrative analysis of transcriptome and gut microbiome reveals foie gras capacity difference between cage and floor rearing systems, Poult. Sci. 103 (11) (2024) 104248. https://doi.org/10.1016/j.psj.2024.104248. M.A. Boz, M. Sarica, U.S. Yamak, Production traits of artificially and naturally hatched geese in intensive and free-range systems - II: slaughter, carcass and meat quality traits, Br. Poult. Sci. 58 (2) (2017) 166-176. https://doi.org/10.1080/00071668.2016.1261998. S. Grefte, A.M. Kuijpers-Jagtman, R. Torensma, J.W. Von den Hoff, Skeletal muscle development and regeneration, Stem Cells Dev. 16 (5) (2007) 857-868. https://doi.org/10.1089/scd.2007.0058. G.N. Scheuermann, S.F. Bilgili, S. Tuzun, D.R. Mulvaney, Comparison of chicken genotypes: myofiber number in pectoralis muscle and myostatin ontogeny, Poult. Sci. 83 (8) (2004) 1404-1412. https://doi.org/10.1093/ps/83.8.1404. J. Wang, M. Fu, D. Xu, N. Cao, W. Li, Y. Tian, X. Zhang, Y. Huang, Lipopolysaccharide promotes the proliferation and differentiation of goose embryonic myoblasts by promoting cytokine expression and appropriate apoptosis processes, Vet. Sci. 9 (11) (2022). https://doi.org/10.3390/vetsci9110615. T. Yoshida, P. Delafontaine, Mechanisms of IGF-1-mediated regulation of skeletal muscle hypertrophy and atrophy, Cells 9 (9) (2020). https://doi.org/10.3390/cells9091970. M.G. Weinbauer, Ecology of prokaryotic viruses, FEMS Microbiol. Rev. 28 (2) (2004) 127-181. https://doi.org/10.1016/j.femsre.2003.08.001. J. Farup, L. Madaro, P.L. Puri, U.R. Mikkelsen, Interactions between muscle stem cells, mesenchymal-derived cells and immune cells in muscle homeostasis, regeneration and disease, Cell Death Dis. 6 (7) (2015) e1830. https://doi.org/10.1038/cddis.2015.198. L. Shi, Y. Guo, Y. Cheng, Y. Xing, S. Guo, L. Zhang, Y. Xu, X. Jin, S. Yan, B. Shi, An artemisia ordosica extract: effects on growth performance, immune, and inflammatory response in lipopolysaccharide-challenged broilers, Front. Vet. Sci. 9 (2022) 980690. https://doi.org/10.3389/fvets.2022.980690. H.A. Hong, L.H. Duc, S.M. Cutting, The use of bacterial spore formers as probiotics, FEMS Microbiol. Rev. 29 (4) (2005) 813-835. https://doi.org/10.1016/j.femsre.2004.12.001. J. Chen, Y. Yu, Bacillus subtilis-fermented products ameliorate the growth performance and alter cecal microbiota community in broilers under lipopolysaccharide challenge, Poult. Sci. 100 (2) (2021) 875-886. https://doi.org/10.1016/j.psj.2020.10.070. Y. Xu, Y. Yu, Y. Shen, Q. Li, J. Lan, Y. Wu, R. Zhang, G. Cao, C. Yang, Effects of bacillus subtilis and bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers, Poult. Sci. 100 (9) (2021) 101358. https://doi.org/10.1016/j.psj.2021.101358. S. Liu, M. Du, J. Sun, Y. Tu, X. Gu, P. Cai, Z. Lu, Y. Wang, T. Shan, Bacillus subtilis and enterococcus faecium co-fermented feed alters antioxidant capacity, muscle fibre characteristics and lipid profiles of finishing pigs, Br. J. Nutr. 131 (8) (2024) 1298-1307. https://doi.org/10.1017/S000711452300291X. J.S. Kim, A. Hosseindoust, S.H. Lee, Y.H. Choi, M.J. Kim, J.H. Lee, I.K. Kwon, B.J. Chae, Bacteriophage cocktail and multi-strain probiotics in the feed for weanling pigs: effects on intestine morphology and targeted intestinal coliforms and clostridium, Animal 11 (1) (2017) 45-53. https://doi.org/10.1017/S1751731116001166. Y. Xu, Y. Yu, Y. Shen, Q. Li, J. Lan, Y. Wu, R. Zhang, G. Cao, C. Yang, Effects of bacillus subtilis and bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers, Poult. Sci. 100 (9) (2021) 101358. https://doi.org/10.1016/j.psj.2021.101358. Y. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899. W. Li, J. Li, X. Dai, M. Liu, A. Khalique, Z. Wang, Y. Zeng, D. Zhang, X. Ni, D. Zeng, B. Jing, K. Pan, Surface display of porcine circovirus type 2 antigen protein cap on the spores of bacillus subtilis 168: an effective mucosal vaccine candidate, Front. Immunol. 13 (2022) 1007202. https://doi.org/10.3389/fimmu.2022.1007202. S.D. Upadhaya, J.M. Ahn, J.H. Cho, J.Y. Kim, D.K. Kang, S.W. Kim, H.B. Kim, I.H. Kim, Bacteriophage cocktail supplementation improves growth performance, gut microbiome and production traits in broiler chickens, J. Anim. Sci. Biotechnol. 12 (1) (2021) 49. https://doi.org/10.1186/s40104-021-00570-6. X. Liu, H. Yan, L. Lv, Q. Xu, C. Yin, K. Zhang, P. Wang, J. Hu, Growth performance and meat quality of broiler chickens supplemented with bacillus licheniformis in drinking water, Asian Australas. J. Anim. Sci. 25 (5) (2012) 682-689. https://doi.org/10.5713/ajas.2011.11334. Z. Sarrami, M. Sedghi, I. Mohammadi, W.K. Kim, A.H. Mahdavi, Effects of bacteriophage supplement on the growth performance, microbial population, and PGC-1alpha and TLR4 gene expressions of broiler chickens, Sci. Rep. 12 (1) (2022) 14391. https://doi.org/10.1038/s41598-022-18663-1. J.P. Wang, L. Yan, J.H. Lee, I.H. Kim, Evaluation of bacteriophage supplementation on growth performance, blood characteristics, relative organ weight, breast muscle characteristics and excreta microbial shedding in broilers, Asian Australas. J. Anim. Sci. 26 (4) (2013) 573-578. https://doi.org/10.5713/ajas.2012.12544. J.H. Park, I.H. Kim, Supplemental effect of probiotic bacillus subtilis b2a on productivity, organ weight, intestinal salmonella microflora, and breast meat quality of growing broiler chicks, Poult. Sci. 93 (8) (2014) 2054-2059. https://doi.org/10.3382/ps.2013-03818. J. Yeo, K.I. Kim, Effect of feeding diets containing an antibiotic, a probiotic, or yucca extract on growth and intestinal urease activity in broiler chicks, Poult. Sci. 76 (2) (1997) 381-385. https://doi.org/10.1093/ps/76.2.381. F. Yan, W. Wang, H. Cheng, Bacillus subtilis-based probiotic promotes bone growth by inhibition of inflammation in broilers subjected to cyclic heating episodes, Poult. Sci. 99 (11) (2020) 5252-5260. https://doi.org/10.1016/j.psj.2020.08.051. I. Knap, A.B. Kehlet, M. Bennedsen, G.F. Mathis, C.L. Hofacre, B.S. Lumpkins, M.M. Jensen, M. Raun, A. Lay, Bacillus subtilis (DSM17299) significantly reduces salmonella in broilers, Poult. Sci. 90 (8) (2011) 1690-1694. https://doi.org/10.3382/ps.2010-01056. J.H. Park, I.H. Kim, Supplemental effect of probiotic bacillus subtilis b2a on productivity, organ weight, intestinal salmonella microflora, and breast meat quality of growing broiler chicks, Poult. Sci. 93 (8) (2014) 2054-2059. https://doi.org/10.3382/ps.2013-03818. J.S. Kim, A. Hosseindoust, S.H. Lee, Y.H. Choi, M.J. Kim, J.H. Lee, I.K. Kwon, B.J. Chae, Bacteriophage cocktail and multi-strain probiotics in the feed for weanling pigs: effects on intestine morphology and targeted intestinal coliforms and clostridium, Animal 11 (1) (2017) 45-53. https://doi.org/10.1017/S1751731116001166. Y. Won, S. Kim, J. Han, The protective effect of dietary supplementation of salmonella-specific bacteriophages in post-weaning piglets challenged with salmonella typhimurium, J. Adv. Vet. Anim. Res. 8 (3) (2021) 440-447. https://doi.org/10.5455/javar.2021.h529. V. Clavijo, T. Morales, M.J. Vives-Flores, A. Reyes Munoz, The gut microbiota of chickens in a commercial farm treated with a salmonella phage cocktail, Sci. Rep. 12 (1) (2022) 991. https://doi.org/10.1038/s41598-021-04679-6. A.M. Thanki, V. Clavijo, K. Healy, R.C. Wilkinson, T. Sicheritz-Ponten, A.D. Millard, M.R.J. Clokie, Development of a phage cocktail to target salmonella strains associated with swine, Pharmaceuticals 15 (1) (2022). https://doi.org/10.3390/ph15010058. A.M. Thanki, S. Hooton, N. Whenham, M.G. Salter, M.R. Bedford, H.V.M. O'Neill, M.R.J. Clokie, A bacteriophage cocktail delivered in feed significantly reduced salmonella colonization in challenged broiler chickens, Emerg. Microbes Infect. 12 (1) (2023) 2217947. https://doi.org/10.1080/22221751.2023.2217947. Y. Choi, A. Hosseindoust, S.H. Ha, J. Kim, Y. Min, Y. Jeong, J. Mun, S. Sa, J. Kim, Effects of dietary supplementation of bacteriophage cocktail on health status of weanling pigs in a non-sanitary environment, J. Anim. Sci. Biotechnol. 14 (1) (2023) 64. https://doi.org/10.1186/s40104-023-00869-6. P.A. Adhikari, D.E. Cosby, N.A. Cox, J.H. Lee, W.K. Kim, Effect of dietary bacteriophage supplementation on internal organs, fecal excretion, and ileal immune response in laying hens challenged by salmonella enteritidis, Poult. Sci. 96 (9) (2017) 3264-3271. https://doi.org/10.3382/ps/pex109. C. Alexander, E.T. Rietschel, Bacterial lipopolysaccharides and innate immunity, J Endotoxin Res 7 (3) (2001) 167-202. W. Guo, B. Liu, G. Hu, X. Kan, Y. Li, Q. Gong, D. Xu, H. Ma, Y. Cao, B. Huang, S. Fu, J. Liu, Vanillin protects the blood-milk barrier and inhibits the inflammatory response in LPS-induced mastitis in mice, Toxicol. Appl. Pharmacol. 365 (2019) 9-18. https://doi.org/10.1016/j.taap.2018.12.022. L. Shi, Y. Guo, Y. Cheng, Y. Xing, S. Guo, L. Zhang, Y. Xu, X. Jin, S. Yan, B. Shi, An artemisia ordosica extract: effects on growth performance, immune, and inflammatory response in lipopolysaccharide-challenged broilers, Front. Vet. Sci. 9 (2022) 980690. https://doi.org/10.3389/fvets.2022.980690. L. Zhang, X. Hou, L. Sun, T. He, R. Wei, M. Pang, R. Wang, Staphylococcus aureus bacteriophage suppresses LPS-induced inflammation in MAC-t bovine mammary epithelial cells, Front. Microbiol. 9 (2018) 1614. https://doi.org/10.3389/fmicb.2018.01614. C. Li, Y. Li, S. Li, S. Chen, G. Liu, X. Deng, W. Chang, H. Cai, Bacillus subtilis protects the ducks from oxidative stress induced by escherichia coli: efficacy and molecular mechanism, Antioxidants 11 (10) (2022). https://doi.org/10.3390/antiox11101951. M.N. Goodman, Tumor necrosis factor induces skeletal muscle protein breakdown in rats, Am J Physiol 260 (5 Pt 1) (1991) E727-E730. https://doi.org/10.1152/ajpendo.1991.260.5.E727. L. Zhang, X. Hou, L. Sun, T. He, R. Wei, M. Pang, R. Wang, Corrigendum: staphylococcus aureus bacteriophage suppresses LPS-induced inflammation in MAC-t bovine mammary epithelial cells, Front. Microbiol. 9 (2018) 2511. https://doi.org/10.3389/fmicb.2018.02511. X. Lei, D. Zhang, Q. Wang, G. Wang, Y. Li, Y. Zhang, M. Yu, Q. Yao, Y. Chen, Z. Guo, Dietary supplementation of two indigenous bacillus spp on the intestinal morphology, intestinal immune barrier and intestinal microbial diversity of rhynchocypris lagowskii, Fish Physiol. Biochem. 48 (5) (2022) 1315-1332. https://doi.org/10.1007/s10695-022-01121-0. C. Hung, C. Kuo, C. Wang, C. Wu, N. Tsao, Experimental phage therapy in treating klebsiella pneumoniae-mediated liver abscesses and bacteremia in mice, Antimicrob. Agents. Chemother. 55 (4) (2011) 1358-1365. https://doi.org/10.1128/AAC.01123-10. F. Cao, X. Wang, L. Wang, Z. Li, J. Che, L. Wang, X. Li, Z. Cao, J. Zhang, L. Jin, Y. Xu, Evaluation of the efficacy of a bacteriophage in the treatment of pneumonia induced by multidrug resistance klebsiella pneumoniae in mice, Biomed Res. Int. 2015 (2015) 752930. https://doi.org/10.1155/2015/752930. Y. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899. C. Li, Y. Li, S. Li, S. Chen, G. Liu, X. Deng, W. Chang, H. Cai, Bacillus subtilis protects the ducks from oxidative stress induced by escherichia coli: efficacy and molecular mechanism, Antioxidants 11 (10) (2022). https://doi.org/10.3390/antiox11101951. M.A. Rudnicki, R. Jaenisch, The MyoD family of transcription factors and skeletal myogenesis, Bioessays. 17 (3) (1995) 203-209. https://doi.org/10.1002/bies.950170306. R. Du, S. Jiao, Y. Dai, J. An, J. Lv, X. Yan, J. Wang, B. Han, Probiotic bacillus amyloliquefaciens c-1 improves growth performance, stimulates GH/IGF-1, and regulates the gut microbiota of growth-retarded beef calves, Front. Microbiol. 9 (2018) 2006. https://doi.org/10.3389/fmicb.2018.02006. S.G. Velleman, D.L. Clark, Histopathologic and myogenic gene expression changes associated with wooden breast in broiler breast muscles, Avian Dis. 59 (3) (2015) 410-418. https://doi.org/10.1637/11097-042015-Reg.1. C. Vicente-Garcia, J.D. Hernandez-Camacho, J.J. Carvajal, Regulation of myogenic gene expression, Exp. Cell Res. 419 (1) (2022) 113299. https://doi.org/10.1016/j.yexcr.2022.113299. Y. Liu, N. Zhen, D. Liao, J. Niu, R. Liu, Z. Li, Z. Lei, Z. Yang, Application of bacteriophage phiPaP11-13 attenuates rat cutibacterium acnes infection lesions by promoting keratinocytes apoptosis via inhibiting PI3k/akt pathway, Microbiol. Spectr. 12 (2) (2024) e0283823. https://doi.org/10.1128/spectrum.02838-23. M. Guo, M. Li, C. Zhang, X. Zhang, Y. Wu, Dietary administration of the bacillus subtilis enhances immune responses and disease resistance in chickens, Front. Microbiol. 11 (2020) 1768. https://doi.org/10.3389/fmicb.2020.01768. Y. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899. J. Wang, M. Fu, D. Xu, N. Cao, W. Li, Y. Tian, X. Zhang, Y. Huang, Lipopolysaccharide promotes the proliferation and differentiation of goose embryonic myoblasts by promoting cytokine expression and appropriate apoptosis processes, Vet. Sci. 9 (11) (2022). https://doi.org/10.3390/vetsci9110615. Y. Cao, Z. Wang, T. Yu, Y. Zhang, Z. Wang, Z. Lu, W. Lu, J. Yu, Sepsis induces muscle atrophy by inhibiting proliferation and promoting apoptosis via PLK1-AKT signalling, J. Cell. Mol. Med. 25 (20) (2021) 9724-9739. https://doi.org/10.1111/jcmm.16921. C. Zhang, J. Luo, B. Yu, P. Zheng, Z. Huang, X. Mao, J. He, J. Yu, J. Chen, D. Chen, Dietary resveratrol supplementation improves meat quality of finishing pigs through changing muscle fiber characteristics and antioxidative status, Meat Sci. 102 (2015) 15-21. https://doi.org/10.1016/j.meatsci.2014.11.014. Y. Zhang, H. Yan, P. Zhou, Z. Zhang, J. Liu, H. Zhang, MicroRNA-152 promotes slow-twitch myofiber formation via targeting uncoupling protein-3 gene, Animals 9 (9) (2019). https://doi.org/10.3390/ani9090669. H. Wang, C. Xiao, J. Li, R. Liang, Y. Liu, Z. Song, J. Buyse, L. Zhu, Dietary bacillus subtilis benefits meat quality by regulating the muscle fiber type and antioxidant capacity of broilers, Poult. Sci. 103 (12) (2024) 104267. https://doi.org/10.1016/j.psj.2024.104267. Y. Qiu, K. Li, X. Zhao, S. Liu, L. Wang, X. Yang, Z. Jiang, Fermented feed modulates meat quality and promotes the growth of longissimus thoracis of late-finishing pigs, Animals 10 (9) (2020). https://doi.org/10.3390/ani10091682. M.M. Molendijk, B.K.H.L. Boekema, K.R. Lattwein, M. Vlig, L.G.M. Bode, M.P.G. Koopmans, A. Verbon, M. de Graaf, W.J.B. van Wamel, Bacteriophage therapy reduces staphylococcus aureus in a porcine and human ex vivo burn wound infection model, Antimicrob. Agents. Chemother. 68 (9) (2024) e0065024. https://doi.org/10.1128/aac.00650-24. U. Gadde, W.H. Kim, S.T. Oh, H.S. Lillehoj, Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: a review, Anim. Health Res. Rev. 18 (1) (2017) 26-45. https://doi.org/10.1017/S1466252316000207. P. Huang, X. Cui, Z. Wang, C. Xiao, Q. Ji, Q. Wei, Y. Huang, G. Bao, Y. Liu, Effects of clostridium butyricum and a bacteriophage cocktail on growth performance, serum biochemistry, digestive enzyme activities, intestinal morphology, immune responses, and the intestinal microbiota in rabbits, Antibiotics-Basel 10 (11) (2021). https://doi.org/10.3390/antibiotics10111347. L. Yan, S.M. Hong, I.H. Kim, Effect of bacteriophage supplementation on the growth performance, nutrient digestibility, blood characteristics, and fecal microbial shedding in growing pigs, Asian Australas. J. Anim. Sci. 25 (10) (2012) 1451-1456. https://doi.org/10.5713/ajas.2012.12253. Y. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899. E. Gebru, J.S. Lee, J.C. Son, S.Y. Yang, S.A. Shin, B. Kim, M.K. Kim, S.C. Park, Effect of probiotic-, bacteriophage-, or organic acid-supplemented feeds or fermented soybean meal on the growth performance, acute-phase response, and bacterial shedding of grower pigs challenged with salmonella enterica serotype typhimurium, J. Anim. Sci. 88 (12) (2010) 3880-3886. https://doi.org/10.2527/jas.2010-2939. S.D. Upadhaya, J.M. Ahn, J.H. Cho, J.Y. Kim, D.K. Kang, S.W. Kim, H.B. Kim, I.H. Kim, Bacteriophage cocktail supplementation improves growth performance, gut microbiome and production traits in broiler chickens, J. Anim. Sci. Biotechnol. 12 (1) (2021) 49. https://doi.org/10.1186/s40104-021-00570-6. Z. Sarrami, M. Sedghi, I. Mohammadi, W.K. Kim, A.H. Mahdavi, Effects of bacteriophage supplement on the growth performance, microbial population, and PGC-1alpha and TLR4 gene expressions of broiler chickens, Sci. Rep. 12 (1) (2022) 14391. https://doi.org/10.1038/s41598-022-18663-1. Additional Declarations No competing interests reported. Supplementary Files supplementaryfile.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6625383","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":473140403,"identity":"511800c6-160f-478d-a8f2-91c626845503","order_by":0,"name":"Yong Li","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Li","suffix":""},{"id":473140404,"identity":"2400f2a5-0279-411a-8035-83cf0aa0a2d2","order_by":1,"name":"Yongquan Luo","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yongquan","middleName":"","lastName":"Luo","suffix":""},{"id":473140405,"identity":"4985c886-15cd-47fe-af84-8ad59c977a01","order_by":2,"name":"Yuanhao Han","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yuanhao","middleName":"","lastName":"Han","suffix":""},{"id":473140409,"identity":"75730508-5ba6-4bd9-a81e-90ba020e3754","order_by":3,"name":"Zhiyuan Liu","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Zhiyuan","middleName":"","lastName":"Liu","suffix":""},{"id":473140412,"identity":"899c5452-bda8-46c7-8928-53573358ae0a","order_by":4,"name":"Songchao Li","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Songchao","middleName":"","lastName":"Li","suffix":""},{"id":473140413,"identity":"0b713e88-33b6-4962-b41e-7879a5c7d267","order_by":5,"name":"Xiujin Li","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Xiujin","middleName":"","lastName":"Li","suffix":""},{"id":473140414,"identity":"11fa56df-cea0-4255-8626-17493f400f7d","order_by":6,"name":"Zhongping Wu","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Zhongping","middleName":"","lastName":"Wu","suffix":""},{"id":473140415,"identity":"42701673-4e54-408a-a607-dad6f7283988","order_by":7,"name":"Yunbo Tian","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yunbo","middleName":"","lastName":"Tian","suffix":""},{"id":473140416,"identity":"cf858c17-ca7a-4455-8868-bd3c107c8bfc","order_by":8,"name":"Yunmao Huang","email":"","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":false,"prefix":"","firstName":"Yunmao","middleName":"","lastName":"Huang","suffix":""},{"id":473140420,"identity":"7e6d1203-fc75-47ab-ba6d-fb7eabc14e52","order_by":9,"name":"Xumeng Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/klEQVRIiWNgGAWjYDACCQST8QFjQwKIYUC0FmYDkrWwSRClRX5287OHX9sOR/NLt1+r/LkjLbGBvXmbBEPNHZxaGOccMzeWOXM4d+acM2U3JM/kJDbwHCuTYDj2DKcWZokEM2mJisO5G27kpN0wbKtIbJDIMQO68DBOLWwS6d+kJQwO5+4HailIBGmRf4NfCw/QTMkPIFsk0o8xHGwDOkyCB78WCYmcMmmGM+m5M27kMEs2tqUZt/GkFVskHMOtRX5G+jbJn23Wuf0z0h9+/NmWLNvPfnjjjQ81uLWAg4AH4kZIdLCBiAS8GoAB/QNMsT8goG4UjIJRMApGKgAA2h5XybS4k/sAAAAASUVORK5CYII=","orcid":"","institution":"Zhongkai University of Agriculture and Engineering","correspondingAuthor":true,"prefix":"","firstName":"Xumeng","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-05-09 05:53:54","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6625383/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6625383/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84969722,"identity":"df1faf3e-2335-4937-be9c-2c7573227af6","added_by":"auto","created_at":"2025-06-19 10:39:37","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":496825,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBacillus subtilis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and bacteriophage on slaughtering performance.\u003c/strong\u003e (A) Live weight on 1,30 and 60 d. (B) Wing length on 1,30 and 60 d. (C) Tibial length on 1,30 and 60 d. (D) 60 d slaughter weight. (E) Statistical results of 60 d half-eviserated weight. (F) 60 d carass weight. (G) Statistical results of dressed percentage on 60 d. (H) Statistical results of half-eviscerated yield percentage on 60 d. (I) Statistical results of carass weight percentage on 60 d. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group.Values with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/881b893c2c71c273afb25939.png"},{"id":84969723,"identity":"ce07aab0-1058-4683-a775-688b40f583b2","added_by":"auto","created_at":"2025-06-19 10:39:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":154184,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBacillus subtilis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and bacteriophage to skeletal muscle weight and its ratio to slaughter weight. \u003c/strong\u003e(A) breast muscle weight on 60 d. (B) Leg muscle weight on 60 d. (C) Statistical results of breast muscle weight percentage on 60 d. (D) Statistical results of leg muscle weight percentage on 60 d. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/66b61b7c30de8ce459fed05d.png"},{"id":84970915,"identity":"5e188be6-f27f-4ec3-8c7c-729f9d4afe42","added_by":"auto","created_at":"2025-06-19 11:03:37","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":208235,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of dietary supplementation with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBacillus subtilis\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and bacteriophage on bacteria in bath water. \u003c/strong\u003e(A) 1,30 and 60 d total colony content. (B)1,30 and 60 d \u003cem\u003eEscherichia coli\u003c/em\u003econtent. (C) 1,30 and 60\u003cem\u003e \u003c/em\u003ed \u003cem\u003eSalmonella\u003c/em\u003econtent. Black-Control group; Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/3b315054d173593b9493409d.png"},{"id":84970008,"identity":"4c3e1b7c-e7f7-4755-a750-e64a2ac8c18b","added_by":"auto","created_at":"2025-06-19 10:47:37","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":66775,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of endotoxin treatment of cultured serum and water quality by\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e Bacillus subtilis \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand bacteriophage.\u003c/strong\u003e (A) Results of serum endotoxin content. (B) Results of endotoxin content of bathing water. Black-Control group; Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/1f4a6143228daaa01b66c227.png"},{"id":84969737,"identity":"5bffc8e5-baea-41da-b7e2-52bcc684de6e","added_by":"auto","created_at":"2025-06-19 10:39:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9157798,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of H\u0026amp;E staining of the breast muscles of Magang goose at different periods. \u003c/strong\u003e(A) Results of H\u0026amp;E staining of the leg muscles of Magang goose at different periods. (B) Statistical results of myofiber density. (C) Statistical results of myofiber diameter. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/b53e988086529fb33417d3e8.png"},{"id":84969740,"identity":"3eb394ad-37a9-48f4-b47d-3066a61f3026","added_by":"auto","created_at":"2025-06-19 10:39:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9082157,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eResults of H\u0026amp;E staining of the leg muscles of Magang goose at different periods.\u003c/strong\u003e (A) Results of H\u0026amp;E staining of the leg muscles of Magang goose at different periods. (B) Statistical results of myofiber density. (C) Statistical results of myofiber diameter. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/d934c5f5d913e9a3a44d6c42.png"},{"id":84970719,"identity":"c9a33e62-8d47-4be6-a775-52346c803abb","added_by":"auto","created_at":"2025-06-19 10:55:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":425696,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe mRNA relative expression of vital immunity and myogenic genes in breast muscle.\u003c/strong\u003e The gene expression of\u003cem\u003e TNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eIGF-1 ,MYH1, MYOD, MYOG\u003c/em\u003e in breast muscle. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. Values with different superscript letters are significantly different (\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/372417fb78eb359714d5ca2f.png"},{"id":84969729,"identity":"fe02db9a-9aef-4126-9101-ce5347bec481","added_by":"auto","created_at":"2025-06-19 10:39:37","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":432250,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe mRNA relative expression of vital immunity and myogenic genes in leg muscle.\u003c/strong\u003e The gene expression of\u003cem\u003e TNF-α ,IGF-1, MYH1, MYOD, MYOG\u003c/em\u003e in leg muscle. Black-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. The full image is a composite image, white spaces indicate the borders between images derived from different source gels. Values with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/ac66a7285c87cc039a4a9d89.png"},{"id":84970028,"identity":"be1469e4-bb6c-44f6-86a0-79f61ae81720","added_by":"auto","created_at":"2025-06-19 10:47:38","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":16704969,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe western blot picture and quantitative results of vital immunity and myogenic genes in breast muscle. \u003c/strong\u003eBlack-Control group;Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group. The full image is a composite image, white spaces indicate the borders between images derived from different source gels. Values with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/73c52d3348227f9327c9f40a.png"},{"id":84970016,"identity":"5a3ab446-54d4-45cf-bd21-b6af4bdbb633","added_by":"auto","created_at":"2025-06-19 10:47:38","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1040470,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe western blot picture and quantitative results of vital immunity and myogenic genes in leg muscle. \u003c/strong\u003eBlack-Control group; Grey-bacteriophage group; Thick grey-Bacillus subtilis group; Light grey: Mix group.\u003cstrong\u003e \u003c/strong\u003eValues with different superscript letters are significantly different (\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"Fig10.png","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/dd67cd092e5781cb34537b63.png"},{"id":86926663,"identity":"4af30fcb-d329-4687-a7d9-9a95aa389e10","added_by":"auto","created_at":"2025-07-17 08:47:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":37738503,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/8f58e3bb-cab6-4ed4-9697-6b92ff386f25.pdf"},{"id":84969726,"identity":"a1307ccf-6a49-4e33-8bb2-c7ce528909a0","added_by":"auto","created_at":"2025-06-19 10:39:37","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":710362,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfile.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6625383/v1/f999dc3264a52c191192e220.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eEffects of dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage on water quality, carcass traits and muscle growth of Magang Geese\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChina produced 530\u0026nbsp;million meat geese in 2022, which is the country with the largest number of meat geese in the world according to data provided by China animal Husbandry association and the world Food and Agriculture Organization (FAO)[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Today, semi-intensive and intensive feeding systems are more profitable than traditional feeding methods[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In traditional feeding methods, after waterfowl excreta are discharged into the water body, with the prolongation of breeding time and the accumulation of feces, Gram-negative bacteria in the water body use the nitrogen and phosphorus in the feces to continuously multiply, releasing endotoxin (LPS) after the death of bacteria, which enters into the chicks and accumulates in the body unable to be completely eliminated, thus causing adverse effects on the organism. Semi-intensive and intensive feeding systems are characterized by a high degree of amenities, automation, and more scientific and effective disease prevention and control, reducing the probability of disease occurrence, and relatively high breeding density, more breeding numbers per unit area, and higher economic benefits[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].Effective environmental control of waterfowl farming is particularly important as the demand for waterfowl products continues to grow with the increase in population. It is now widely accepted that the main cause of these problems is increased level of bacteria and lipopolysaccharide (LPS) in the goose rearing environment.\u003c/p\u003e \u003cp\u003eMuscle development is a complicated process that includes somatic cell proliferation, migration, and differentiation. Skeletal muscle development in geese varies at different periods. The number of myofibers in waterfowl skeletal muscle is essentially determined at the embryonic stage, the acquisition of muscle mass after hatching is largely dependent on protein deposition and reflected in the thickening and growth of myofibers[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Myofiber density was the highest at 1 d and gradually decreased with time, while myofiber diameter increased. The diameter and cross-sectional area of myofibers increased gradually, and the density decreased gradually, but the number of myofibers contained in the muscle bundles did not change greatly[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eSkeletal muscle growth and development is regulated by multiple genes. Several myogenic regulatory factors (MRFs) are associated with myogenesis, including \u003cem\u003eMyf5\u003c/em\u003e, \u003cem\u003eMYOD\u003c/em\u003e, \u003cem\u003eMYOG\u003c/em\u003e and \u003cem\u003eMYH1\u003c/em\u003e. It is widely recognized that \u003cem\u003eMyf5\u003c/em\u003e and \u003cem\u003eMYOD\u003c/em\u003e are early factors in satellite cell myogenesis and determine whether muscle satellite cells can be activated to become myoblasts with myogenic properties. And much evidence supports that \u003cem\u003eMYOG\u003c/em\u003e plays an important role in the differentiation of myoblasts and the maintenance of myofiber homeostasis while \u003cem\u003eMYH1\u003c/em\u003e assumes the role of encoding the MYHC protein[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Insulin-like growth factor-1 (\u003cem\u003eIGF-1\u003c/em\u003e) is one of the best-characterized growth factors, and it has been shown to modulate muscle size and play a critical role in regulating muscle function[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Several lines of evidence indicate that cytokines such as interleukin-6 (\u003cem\u003eIL-6\u003c/em\u003e), and tumor necrosis factor-α (\u003cem\u003eTNF-α\u003c/em\u003e) are important regulators of muscle protein balance. \u003cem\u003eTNF-α\u003c/em\u003e impairs muscle protein metabolism when administered to control animals[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. \u003cem\u003eIL-6\u003c/em\u003e supports satellites cell proliferation and differentiation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003cp\u003eLPSs are bacterial surface glycolipids, produced by Gram-negative bacteria. It is present in the outer membrane of most Gram-negative bacteria, which stimulates the secretion of immune elements. Geese direct excretion into water can lead to increased levels of bacteria and LPS over time, which in turn leads to the accumulation of endotoxins in geese, resulting in disease and reduced performance. Previous studies have shown that LPS injection inhibited growth performance of broilers and led to an inflammatory response, which negatively affected several parameters including splenic and bursal relative weight[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], meanwhile, LPS significantly induced inflammatory cytokine production in both proliferation and differentiation stages of goose myoblasts[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eBacillus subtilis\u003c/em\u003e serves as a facultative anaerobe and is widely used as a possible candidate in monogastric feed due to high resistance of its spores to the harsh environment (such as the gastrointestinal tract of animals), and the possibility of long-term storage at ambient temperature[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It has been shown that \u003cem\u003eBacillus subtilis\u003c/em\u003e has a growth-promoting effect and can effectively improve the growth performance, immunity and intestinal morphology of poultry[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe bacteriophage is probably the most abundant virus which are a group of biological entities with a genome consisting either of DNA or RNA and encapsulated in a protein coat (capsid)[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Dietary addition of bacteriophage increased \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003eBifidobacterium\u003c/em\u003e amount, and decreased \u003cem\u003eSalmonella\u003c/em\u003e and \u003cem\u003eColiform\u003c/em\u003e amount in the fecal microbiota of growing pigs[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Previous studies about the application of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage mainly concentrated in the effects of dietary \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage supplementation on intestinal morphology and gut microbiota[\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] Animal carcass traits is an index reflecting the growth and development of animals. However, there is still limited information on the influence of \u003cem\u003eBacillus subtilis\u003c/em\u003e, bacteriophage and their combination on water quality, carcass traits and muscle growth during waterfowl rearing. The specific mechanism regarding how \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage improves the waterfowl muscle function remains elusive.\u003c/p\u003e \u003cp\u003eThus, in the present study, we challenged to clarify the effect of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination on slaughtering performance, breeding water and serum endotoxin, as well as effects on serum inflammatory cytokine and myogenesis-related factor gene expression and protein expression,which would in turn improve the productivity and efficiency of goose farming.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimal ethics\u003c/h2\u003e \u003cp\u003e The experimental procedures strictly adhered to the ethical guidelines established by the Animal Care Committee of Zhongkai University of Agriculture and Engineering, with all protocols reviewed and approved by the institution\u0026rsquo;s Animal Experiment Committee (NO. 2021112709). Measures were rigorously implemented to minimize discomfort and distress in the study subjects.To ensure minimal distress, geese were euthanized via rapid exsanguination (cervical vessel transection) without prior anesthesia, as this method is recognized for immediate unconsciousness due to rapid cerebral hypoperfusion.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eAnimals and management\u003c/h3\u003e\n\u003cp\u003eOne-day-old Magang goslings were procured from Guangdong Lvfengyuan Modern Agriculture Development Co., Ltd., and maintained under controlled conditions with unrestricted access to water and standardized feed (GB/18823). The formulated diet comprised maize, wheat, soybean meal, vegetable meal, sodium chloride, calcium hydrogen phosphate, L-lysine sulfate, DL-methionine, and vitamin supplements.\u003c/p\u003e\n\u003ch3\u003eExperimental design\u003c/h3\u003e\n\u003cp\u003eIn this experiment, there were 72 replicates per group. The number of replicated groups of feeding was increased by subdividing it into 6 replicates and 12 replicates per replicate to minimize experimental error and make the experiment more rigorous.60 days of feeding, 1\u0026ndash;20 day old for yard-housing feeding and 21\u0026ndash;60 day old for semi-dry feeding. The experimental groupings are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The feeding trial was conducted in September-October, and the ambient temperature was maintained at around 39℃ for yard feeding from 1\u0026ndash;20 days old, and around 30\u0026ndash;35℃ for semi-dry feeding from 21\u0026ndash;60 days old. The composition of feed ingredients for Magang geese during the experimental period was maize, wheat, soybean meal, vegetable meal, sodium chloride, calcium hydrogen phosphate, L-lysine sulfate, DL methionine, and vitamins. Specific nutritional levels are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Bacteriophage used in the present study was a commercial product from Green-Agr Biotechnology Co., Ltd. Wuhan, China, consisting of a mixture of bacteriophage in a ratio of 1:1, targeting \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e. \u003cem\u003eBacillus subtilis\u003c/em\u003e was purchased from Huizhou Huinong Bio-technology Co., Ltd. The live bacteria number\u0026thinsp;\u0026gt;\u0026thinsp;5\u0026times;10\u003csup\u003e10\u003c/sup\u003e CFU/g.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGrouping design\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003egroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003etreatment\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003econtrol, a basal diet without treatment\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ea basal diet plus 5.0\u0026times;10\u003csup\u003e10\u003c/sup\u003e PFU/L bacteriophage at a concentration of 1/10\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ea basal diet plus 5.0\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/kg \u003cem\u003eBacillus subtilis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ea basal diet plus 5.0\u0026times;10\u003csup\u003e10\u003c/sup\u003e PFU/L bacteriophage at a concentration of 1/10\u003csup\u003e3\u003c/sup\u003e and 5.0\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/kg \u003cem\u003eBacillus subtilis\u003c/em\u003e same as group B and C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNutritional Level of Magang Goose Diet\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrient\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eContent\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e12.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude Fiber\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e12.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude Ash\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e12.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCalcium\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.5\u0026ndash;1.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal phosphorus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.3\u0026ndash;1.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSodium chloride\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.25\u0026ndash;0.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMoisture\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e13.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLysine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eWater and blood sample procedure\u003c/h3\u003e\n\u003cp\u003eBlood specimens were obtained from six randomly selected geese per group on days 1, 30, and 60 for serum isolation and subsequent analytical procedures. Water samples were concurrently collected from the avian bathing pool on days 30 and 60. At each sampling event, 100 mL aliquots were drawn from five predefined locations (four peripheral corners and central region) within the pool at depths of 10\u0026ndash;20 cm. These subsamples were homogenized to form a composite 500 mL representative sample per timepoint.\u003c/p\u003e\n\u003ch3\u003eSlaughtering performance\u003c/h3\u003e\n\u003cp\u003e24 geese (6 replicates per group) were randomly selected and fasted for 12 h with access to water before slaughtering on 1, 30 and 60 d, 6 geese per group were weighed to record live weight and measure wing and tibial length. On 60 d, after slaughtering and releasing the blood, the geese were de-feathered, and recorded as slaughter weight. The whole body including heart, liver, kidneys, glandular stomach, myogastrics exfoliated membranes and contents, surrounding fat as well as lung were measured and recorded as half-eviscerated weight. Then removed visceral tissue and recorded as carcass weight. The breast muscle weight and leg muscle was removed and their weights were recorded.\u003c/p\u003e \u003cp\u003eDressed percentage = (slaughter weight/live weight) \u0026times; 100%\u003c/p\u003e \u003cp\u003eHalf-eviscerated weight percentage = (half-eviscerated weight percentage/live weight) \u0026times; 100%\u003c/p\u003e \u003cp\u003eCarcass weight percentage = (carcass weight percentage/live weight) \u0026times; 100%\u003c/p\u003e \u003cp\u003eBreast muscle weight percentage = (Breast muscle weight/ carcass weight) \u0026times; 100%\u003c/p\u003e \u003cp\u003eLeg muscle weight percentage = (Leg muscle weight/ carcass weight) \u0026times; 100%\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBacterial colony culture\u003c/h2\u003e \u003cp\u003ePrecisely measure 33 g Nutrient Agar (NA), 36 g Luria-Bertani (LB) agar, 50 g MacConkey agar, and 58.5 g SS agar powders, and resuspend in 1 L deionized water. Securely cap the mixture container, agitate thoroughly until complete dissolution, and sterilize via autoclaving (121℃, 15 min). After cooling to 50℃ aseptically dispense the liquefied media into pre-sterilized petri dishes and allow solidification under ambient conditions. For microbial quantification, water samples were serially diluted 10\u003csup\u003e3\u003c/sup\u003e-10\u003csup\u003e4\u003c/sup\u003e⁴times under laminar flow conditions. Aliquots (100 \u0026micro;L) of each dilution were spread uniformly across agar surfaces using sterile L-shaped glass rods. Plates were incubated upright for 10\u0026ndash;20 min at 37℃ to absorb residual moisture, then inverted and cultured aerobically (37℃, 18\u0026ndash;24 h). Post-incubation, discrete colonies were quantified via standardized plate-count methodology, with colony-forming units (CFU) per plate systematically recorded.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eEndotoxin determination\u003c/h3\u003e\n\u003cp\u003eEndotoxin levels in serum on days 1, 30, 60 and water samples on day 30 and 60 were quantified using horseshoe crab lysate reagent (BIOENDO, Fujian, China). Serial dilutions of the endotoxin calibrant were prepared to generate a standard concentration series, which were then combined with the lysate reagent following manufacturer-specified ratios. Reaction mixtures were incubated under controlled thermal conditions (37℃, 10\u0026ndash;15 min), and absorbance values for each standard were measured at the prescribed wavelength using a Thermo Fisher enzymatic microplate reader. A calibration curve was constructed by plotting endotoxin concentrations (logarithmic scale) against their corresponding absorbance values (linear scale).Negative controls containing only reagent and buffer were processed in parallel to account for background interference. Test samples were diluted iteratively based on their matrix properties and projected endotoxin levels. Diluted samples were mixed with reagent as per protocol, incubated under identical thermal parameters as the standards, and promptly analyzed for absorbance at the target wavelength. Final endotoxin concentrations were derived by interpolating sample absorbance values against the standard curve, with results adjusted by subtracting the blank control\u0026rsquo;s baseline absorbance.\u003c/p\u003e\n\u003ch3\u003eSample collection and H\u0026E Staining\u003c/h3\u003e\n\u003cp\u003eA tissue block of the breast muscle superficialis muscle and leg muscle were removed on 1, 30, and 60 d, which still attached to the bone, was cross-sectioned perpendicular to the orientation of the myofibers, and the cross sectional area was traced on a transparent paper[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The sampling site for the leg muscle is the gastrocnemius muscle, and the sampling site for the breast muscle is a cross-section of the entire muscle. Skeletal muscle from 6 geese of 1, 30, and 60 d were utilized. Sections were processed by hematoxylin \u0026amp; eosin staining. A 20.0\u0026times; image of muscle tissue was captured for each section on CaseViewer 2.2 scanning and viewing soft-ware. The micrographs were taken with the Axio Imager Z1 (ZEISS), zooming in 400\u0026times; for each area. One field of view was selected for each of the three biological replicates of each species in each period for the statistics. Three randomly selected fields of view per slice from 6 slices were photographed for each section, 6 myofibers or muscle bundles were randomly selected for each view, and the diameter of the myofibers (\u0026micro;m) or the cross-sectional area of the muscle bundles (\u0026micro;m\u003csup\u003e2\u003c/sup\u003e) was measured and averaged. The number and diameter (\u0026micro;m) of all myofiber in the field of view of the section were counted by Adobe Photoshop 2021, and the density was calculated by the number and field area of the section. The total number of myofiber was calculated by myofiber density and cross-sectional area.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and Real-Time Quantitative PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated following the Trizol (Thermo Fisher, Waltham, MA, USA) protocol. RNA purity and concentration were quantified via full-wavelength spectrophotometry after resuspension in DEPC-treated water. cDNA synthesis utilized the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). RT-qPCR primers were designed using Primer Premier 5.0 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) through alignment with NCBI GenBank sequences. GAPDH served as the endogenous control. SYBR Select Master Mix (Thermo, USA) was prepared on ice for 20 \u0026micro;L reaction assemblies. Relative mRNA levels were determined via the 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for RT-qPCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForwad (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (3'-5')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAnnealing temperature (℃)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMYH1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCTCACGCTTTGGTAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCTGGCTTCTTGTTGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMYOD\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGCGTGCAAGAGGAAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGTTGGGGTTGGTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMYOG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCGAGCACTGCCCCGGGCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTCCTGCTGGTTGAGGCTGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTGTCGTGGACCTGACCTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCAGCACCCGCATCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIGF-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGTCGTCCATCGTAGTCCTTGCACTTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAGCGTCGTTATCGTTCCTGCAAACACAGGCCAAGGTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCGACGAGGAGAAATGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTATCGTCGTTGCCAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTNF-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGAACCCTCCTCCGTACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAGGCCACCACATGATAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eProtein lysates underwent electrophoretic separation via SDS-PAGE and were subsequently electrophoretically transferred onto PVDF membranes. Membranes were blocked for 1 h with 5% skim milk in PBST (phosphate-buffered saline with 0.1% Tween-20). Primary antibodies included: anti-MYOD (1:1000, Abcam ab16148, UK), anti-IL-6 (1:1000, Wanlei WL02841, China), anti-TNF-α (1:1000, Wanlei WL01581, China), anti-MyHC (1:10000, Sigma M4276, USA), and anti-GAPDH (1:10000, Abcam ab181602, UK), which were applied in PBST at 4℃ overnight. Following PBS-T washes, membranes were probed with HRP-conjugated secondary antibodies\u0026mdash;goat anti-mouse IgG (1:10000, Abcam ab97023, UK) or goat anti-rabbit IgG (1:10000, Wanlei WLA32023a, China) for 1 h at ambient temperature. A secondary incubation step was performed at 37℃ for 1 h to enhance antigen-antibody binding. Chemiluminescent signals were generated using an ECL substrate (Beyotime, Beijing, China) and imaged on a Tanon-200 Multi documentation system (Tanon, Shanghai, China). Quantitative densitometry was executed via ImageJ software (v1.8.0) to assess band intensity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSix biological replicates were set in each group, one-way analysis of variance (ANOVA) with Graphpad Prism software (Version 5.0), and difference significance analysis was performed using Tukey's test. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05 means that the difference is not significant, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 means that the difference is significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Rusults","content":"\u003cp\u003e \u003cb\u003eEffect of Bacillus subtilis and bacteriophage on slaughtering performance.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn order to determine whether dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage affects goose slaughering performance, tibial length and wing length were measured. Body weight, half-eviscerated weight, eviscerated weight and their ratio to body weight were analyzed, as well as breast muscle weight, leg muscle weight ,breast muscle weight rate and leg muscle weight rate.\u003c/p\u003e \u003cp\u003eResults have indicated that, on 30 d, there was a significant difference in wing length between Group B and A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). On 60 d, Group B, C and D was significantly higher than group A, while group C and D was also significantly higher than group B (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe tibial length of group C was significantly higher than that of group A, B and D on 60 d, while groups B and D did not show any differential difference from group A(\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eLive weight increased as geese\u0026rsquo;s age increased. Although there was no significant difference in live weight at 1 and 30 d (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), live weight of group B, C and D were significantly higher than those of group A at 60 d, with group C being the highest and group B the second highest(\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eOn 60 d, there was no significant difference among groups in slaughter weight, half-eviscerated weight, carcass weight and their corresponding percentage (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Although significant differences were not reached, slaughter weight, half-eviscerated weight and carcass weight of bacteriophage added group showed an elevated trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-I).\u003c/p\u003e \u003cp\u003eTherefore, we further explored the effect of adding \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination on skeletal muscle we measured breast muscle weight, leg weight, breast muscle weight percentage, and leg weight percentage on day 60. It can be seen that breast muscle weight was significantly higher in group C than in group A, B and D (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Although the breast muscle weight percentage in group C was slightly higher than that in group A, it did not show a significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The leg weight percentage was significantly higher in group B than in group A, C and D (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), and no significant differences were shown between the leg muscle weights of the different treatment groups, although the leg weight in group B and C was slightly higher than in group A and D (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).These results suggest that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination had a positive effect on the slaughter performance of the geese especially on day 60, and dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage alone may have a greater effect on the muscle than a mixture of the two. These findings indicate that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage, especially bacteriophage can significantly increase the body weight, breast skeletal muscle weight, increased skeletal muscle weight percentage increased tibal length and wing length to improved production performance of 60-day-old Magang geese.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eEffect of dietary supplementation with Bacillus subtilis and bacteriophage on bacteria in bath water\u003c/h2\u003e \u003cp\u003eIn order to explore the bacterial effects of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage on the bath water of Magang geese, we examined the levels of bacterial total colony, \u003cem\u003eEscherichia coli\u003c/em\u003e, and \u003cem\u003eSalmonella\u003c/em\u003e in the bath water on 30 and 60 d.\u003c/p\u003e \u003cp\u003eAs it shown, total bacterial colony on 30 d was not significantly different among the groups with group D being slightly lower than group A (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). On day 60, group B, C and D had lower total bacterial colony as compared to group A, while those of group B and C was significantly lower than those of group A(\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGroup D showed lower total bacterial colony content on 30 d, but did not show significant differences. Group A showed the highest total bacterial colony content on 60 d compared with the treatment groups, while those on group C and D were significant lower (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e content was significatly lower in treatment groups (B,C,D) compared to group A on 30 d, and was significantly lower in group D compared to group A, B and C on 60 d(\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eAlthough there was no significant difference in \u003cem\u003eSalmonella\u003c/em\u003e concent on both 30 and 60 d, \u003cem\u003eSalmonella\u003c/em\u003e concent in group B, C and D were slightly lower than in group A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eThe above results have showed that bacteriophage and \u003cem\u003eBacillus subtilis\u003c/em\u003e can significantly reduce the concentrations of specifically quantified \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e in water and improve the environment of bath water. Due to limitations in the specificity of the assay, co-reduction of other pathogens cannot be excluded, but the main effect should be attributed to bacteriophage and \u003cem\u003eBacillus subtilis\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffect of dietary supplementation with Bacillus subtilis and bacteriophage on serum and bath water endotoxin\u003c/h2\u003e \u003cp\u003eIn order to detect the effects of bacteriophage and \u003cem\u003eBacillus subtilis\u003c/em\u003e on farmed water and serum endotoxin in Magang geese, this paper examined bath water and serum endotoxin using horseshoe crab reagent colorimetric methods.\u003c/p\u003e \u003cp\u003eOn 30 d, serum endotoxins were significantly lower in both Groups B and D than in group A and C (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Although there was no significant difference in group C compared to group A, the amount was less than group A (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). On 60 d, serum endotoxins were significantly lower in both Group B and D than in group A and C (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), and it was lower in group C than in group A without significant difference (\u003cem\u003eP\u0026thinsp;\u0026gt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBath water endotoxins were significantly lower in both Group B and D than in group A and C. On 60 days, the amount in treatment groups (B,C,D) were significantly lower than in group A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eThe results have showed that bath water and serum endotoxin both increased with period and stabilized after 30 d. Dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or the combination of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage was able to significantly reduce bath water and serum endotoxin on 30 and 60 d, but dietary supplementation of bacteriophage alone had less effect.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of dietary supplementation with Bacillus subtilis and bacteriophage on the diameter and density of breast and leg myofiber.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSkeletal muscle is an important criterion for judging the performance of poultry production, to explore the difference between two treatments, we performed H\u0026amp;E-stained section analysis. Results have indicated that there were no significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in the breast muscle density and diameter of the groups at every time point during this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). There were no significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in the leg muscle density of the groups at every time point. Moreover, there were no significant differences in the leg muscle myofiber diameter at 1 and 30 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), leg muscle myofiber diameters were significantly higher in the treated group (B, C, D) than in the control group (group A) on day 60, with group C having the highest, which suggesting that \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage may not be effective on the leg muscle until after the middle of the fattening period (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eEffect of dietary supplementation of Bacillus subtilis and bacteriophage on inflammation and myogenic genes\u003c/h2\u003e \u003cp\u003eThe mRNA expression of proinflammatory factors and myogenic genes were measured by real-time RT-qPCR on day 1,30 and 60 after dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage.\u003c/p\u003e \u003cp\u003eThe mRNA relative expression of \u003cem\u003eTNF-α\u003c/em\u003e showed no significant difference among the 4 groups on day 1, 30 and 60 of breast and leg muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA), however, the \u003cem\u003eTNF-α\u003c/em\u003e expression of group B, C and D was decreased compared to group A on breast muscle, meanwhile the mRNA expression of \u003cem\u003eTNF-α\u003c/em\u003e was also decreased in group C than in group A (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Dietary addition of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination significantly reduced \u003cem\u003eIL-6\u003c/em\u003e mRNA expression on days 30 and 60. In the leg muscles, \u003cem\u003eIL-6\u003c/em\u003e mRNA expression was significantly higher in groups C and D compared to groups A and B (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), indicating that the addition of bacteriophage or a combination of both increased \u003cem\u003eIL-6\u003c/em\u003e mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe expression of \u003cem\u003eIGF-1\u003c/em\u003e mRNA difference in breast muscle was significantly higher than group C and D than in group A and B on 60 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), meanwhile, in leg muscle, bacteriophage treated geese (group C) had higher \u003cem\u003eIGF-1\u003c/em\u003e mRNA expression but the difference was not statistically significant (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eWe then expolored the effects of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination on myogenic mRNA expression (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). In addition, higher expression of \u003cem\u003eMYOG\u003c/em\u003e was detected in both breast and leg muscle on 60 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). There was no difference in mRNA expression level of \u003cem\u003eMYOD\u003c/em\u003e in leg muscle (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) but significant difference in breast muscle on 30 and 60 d, with group C having the highst mRNA expression, group D having the second highest (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). \u003cem\u003eMYH1\u003c/em\u003e mRNA expression was significantly different in combination addition (group D) than in control (group A) on both 30 and 60 d (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), with bacteriophage addition (group C) have significant difference on 30 d (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) and had higher mRNA expression on 60 d without statistically significant difference (\u003cem\u003eP\u0026thinsp;\u0026gt;\u003c/em\u003e\u0026thinsp;0.05).This may suggest that the molecular mechanism by which \u003cem\u003eBacillus subtilis\u003c/em\u003e promotes muscle production may not be consistent with bacteriophage.\u003c/p\u003e \u003cp\u003eThere were no significant difference among the 4 groups on 1 and 30 d (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, at 60 d, the \u003cem\u003eTNF-α\u003c/em\u003e mRNA relative expression of group C was significantly lower than group A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), while the mRNA relative expression of \u003cem\u003eIGF-1\u003c/em\u003e was significantly higher in control group compared with treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Further more, although the mRNA relative expression of \u003cem\u003eMYOD\u003c/em\u003e did not show significant difference in different periods among the 4 groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the mRNA relative expression of \u003cem\u003eMYH1\u003c/em\u003e in group D was significant higher than group A, while \u003cem\u003eMYOG\u003c/em\u003e was significant higher than group A, C and D (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), which suggesting that possibly dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage can enhance the expression of myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic factors.\u003c/p\u003e \u003cp\u003eThe results demonstrate dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage can decrease the expression of inflammatory factors, increase the expression of myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic factors. Longer treatment with \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage individually or in combination may lead to more efficient results.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffect of Bacillus subtilis and\u003c/b\u003e \u003cb\u003ebacteriophage\u003c/b\u003e \u003cb\u003eon inflammation and myogenic proteins\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo illustrates the effects of dietary supplementation with \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage on the expression level of inflammatory cytokines and myogenic proteins in Magang geese,western blot analysis was utilized to evaluate the expression levels of IL-6 (inflammatory cytokine), MYOD, and MYH1 in both breast and leg muscles at different rearing stages (0, 30, and 60 days).\u003c/p\u003e \u003cp\u003eIn breast muscle, IL-6 expression levels significantly lowered across time in the treatment groups (B, C, D) as compared to the control group (A) in both 30 and 60 d (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e) similarly, at day 60, IL-6 exhibits significantly higher expression in group A of leg muscles as compared to other groups (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB,D). MYOD expression levels in the treatment groups were higher than in the control group. Particularly at 30 d, Group C (\u003cem\u003eBacillus subtilis\u003c/em\u003e) displayed significantly higher expression of MYOD (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). In addition, significant higher expression noted in groups B, C, and D as compared to group A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05). Likewise, MYH1 expression had a similar trend to MYOD, especially at 30 d, MYH1 expression was significantly higher in groups B,C and D than in group A (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05)(Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA,C). Similarly, in the leg muscles, MYH1 expression was significantly higher in groups C and D than in groups A and B at 30 d (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05), and in groups B and D than in A and C at 60 d (\u003cem\u003eP\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results showed that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage or their combination decreased the expression of IL-6 and increased the expression of MYOD and MYHC in both breast and leg muscle. Dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage or their combination had a similar effect of reducing IL-6 protein expression, dietary supplementation of bacteriophage was more effective than dietary supplementation of \u003cem\u003eBacillus subtilis.\u003c/em\u003e in increasing the expression of myogenic factors MYOD and MYHC protein.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we found that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage improved the growth performance of Magang geese, reduced the total number of bacterial total colony, \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e, improved the environment of the bath water, and enhanced the immune system, contributed to the development of the breast and leg muscles by decreasing the inflammatory response as well as promoting the expression of myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic factors.\u003c/p\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eDietary supplementation of Bacillus subtilis and bacteriophage improves geese growth performance\u003c/h2\u003e \u003cp\u003eWith the growing interest in probiotics and their application in animal research, more and mounting supports the concept that dietary \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage could promote the growth performance of poultry[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Several reports have shown that probiotics have no significant effect on body weight gain, dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e increased the weight gain of broiler chicks only in the early stages of life, while there was no difference in weight gain during the fattening period[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Moreover, other studies have shown that dietary \u003cem\u003eBacillus subtilis\u003c/em\u003e supplementation can improve the growth parameters even under conditions of heat stress[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] as well as body weight gain was improved by bacteriophage addition in diet[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Consistent with these studies, our results demonstrated that, during the breeding period, dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage to geese diets possesses the potential to improve the slaughter performance of geese by increasing body weight, wing length, tibia length, breast muscle weight, breast muscle percentage, leg muscle weight and leg muscle percentage. Dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e in our study also does not seem to improve body weight gain, in agreement with those reported bacteriophage can inprove body weight.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eDietary supplementation of Bacillus subtilis and bacteriophage prevents colonization and reduces proliferation of harmful bacteria\u003c/h2\u003e \u003cp\u003eIt is widely accepted that the main reason for dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage to diets to improve growth performance is colony regulation.\u003c/p\u003e \u003cp\u003eIn recent years, several reports have shown that \u003cem\u003eBacillus subtilis\u003c/em\u003e significantly reduced the \u003cem\u003eSalmonella\u003c/em\u003e, load in the intestinal tract of poultry as well as in the surrounding environment[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e],it can also competitively exclude \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eCampylobacter jejuni\u003c/em\u003e in poultry. Moreover, research on bacteriophage therapy for bacterial diseases in livestock has been actively carried out. Bacteriophage therapy for \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eEscherichia coli, Campylobacte\u003c/em\u003er, \u003cem\u003eStreptococcus\u003c/em\u003e and other pathogenic bacteria has been reported, which are not only pathogenic to livestock, but also harmful to human[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR30 CR31 CR32 CR33\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In our study, dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage also seem to reduce \u003cem\u003eEscherichia coli\u003c/em\u003e and total bacterial colony, although there was no significant difference in \u003cem\u003eSalmonella\u003c/em\u003e load, we have seen a downward trend in \u003cem\u003eSalmonella\u003c/em\u003e and believe that extending the addition treatment time will lead to a significant difference. In the present study, dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage also appeared to reduce \u003cem\u003eEscherichia coli\u003c/em\u003e and total colony counts, but there was no significant difference in \u003cem\u003eSalmonella\u003c/em\u003e counts. Consistent with our findings, previous studies have reported that dietary supplementation of bacteriophage to diets improved the performance of broilers and laying hens while reducing the concentrations of Escherichia coli and \u003cem\u003eSalmonella\u003c/em\u003e in feces[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. We can assume that the lack of difference in \u003cem\u003eSalmonella\u003c/em\u003e counts in this study may be due to the fact that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage works well to stop the infection of harmful bacteria and regulate the microbiota.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDietary supplementation of Bacillus subtilis and bacteriophage to diets improves growth performance possibly due to their ability to elicit an immune response and effectively reduce inflammation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe immune system is closely related to growth performance. In the body, LPS commonly known as endotoxin might cause natural or innate immune responses, leading to elevation of inflammatory cytokines and a decrease in the immune function[\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The activities of geese generally take place in water, so pollution of farm water can have an impact at all periods of growth and development, and exogenous LPS pollution can lead to increased accumulation of endotoxins in the body, which can reduce its growth performance. In this study, dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or a combination of the two showed varying degrees of ability to reduce water endotoxin as well as serum endotoxin, especially the \u003cem\u003eBacillus subtilis\u003c/em\u003e treatment and the combination of the two. This is consistent with the findings of previous studies that \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage could alleviate the adverse effects on the growth performance of broilers challenged with LPS[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]。\u003c/p\u003e \u003cp\u003eThe cytokines in serum could reflect the inflammatory reaction of the body. he Tumor Necrosis Factor alpha (\u003cem\u003eTNF-α\u003c/em\u003e) is a crucial agent that modifies the immune response and the inflammatory‐cell‐induced‐tissue‐damage, while \u003cem\u003eIL-6\u003c/em\u003e is generally deemed as proinflammatory cytokines produced by classically activated macrophages [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInflammation was negatively correlated with body weight in human and animal studies. The mRNA expression of inflammatory factors \u003cem\u003eTNF-α\u003c/em\u003e and \u003cem\u003eIL-6\u003c/em\u003e in the breast muscle were both reduced under \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage dietary treatments, as in previous studies[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. It has been shown that bacteriophage inhibit the expression of inflammatory factors in mouse[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and that probiotic bacteria act as inhibitors rather than stimulators of pro-inflammatory responses against pathogenic bacteria(Guo et al., 2020). It has also been reported that bacteriophage play a positive role in the reduction of pro-inflammatory factors in pigs[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and the results of the present study showed that the mRNA expression of inflammatory factors in the leg muscles was reduced by treatment with bacteriophage diets or a combination of the two, which is in agreement with the previous study. On the contrary, it has been reported that the relative expression of inflammatory cytokines such as \u003cem\u003eIL-1b\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eIL-10\u003c/em\u003e,\u003cem\u003eTNF-a\u003c/em\u003e and \u003cem\u003eIFN\u003c/em\u003e in the small intestinal mucosa was significantly up-regulated under the stimulation of recombinant bacteriophage[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The results of the present study showed that the mRNA expression of inflammatory factors in the breast muscles was reduced by dietary \u003cem\u003eBacillus subtilis\u003c/em\u003e supplementation, bacteriophage supplementation or a combination of the two, which is in agreement with the previous study. Consistent with previous studies, \u003cem\u003eIL-6\u003c/em\u003e expression in leg muscles was significantly increased by dietary addition of bacteriophage or \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage combination, In the present study, protein expression in leg muscles showed a similar trend, which suggests that \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage have anti-inflammatory effects, mechanisms of immune expression in breast and leg muscles are inconsistent and require further study.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDietary supplementation with Bacillus subtilis and Bacteriophage may increases breast and leg muscle weight by increased expression of immune factors and muscle-forming genes\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSkeletal muscle development is regulated by myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic regulators including \u003cem\u003eMYOD\u003c/em\u003e, \u003cem\u003eMYOG\u003c/em\u003e, \u003cem\u003eMYH1\u003c/em\u003e[\u003cspan additionalcitationids=\"CR49 CR50\" citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or their mixture increased the expression levels of muscle-forming factors to varying degrees. \u003cem\u003eBacillus subtilis\u003c/em\u003e may have a stronger ability to regulate leg muscles than breast muscles, and dietary supplementation with bacteriophage or \u003cem\u003eBacillus subtilis\u003c/em\u003e alone may be more effective than their combination.\u003c/p\u003e \u003cp\u003eDietary supplementation of bacteriophage or mixture were able to increase the mRNA expression of the growth factor \u003cem\u003eIGF-1\u003c/em\u003e in breast muscle, which is consistent with the results of previous studies[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The immune system and muscle growth performance are tightly linked.\u003c/p\u003e \u003cp\u003eAnother possibility is that administration of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage could enhance the geese\u0026rsquo; immunity, which in turn regulates skeletal muscle development[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Skeletal muscle development consists of two phases: myoblast proliferation and differentiation. Study had found that LPS reduced the differentiation ability of goose embryonic myoblasts[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Moreover, LPS promotes myotube apoptosis and inhibits the proliferation of myofibroblasts, which reduces muscle mass, inhibits myofiber regeneration, and ultimately leads to muscle atrophy[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In our study, the decrease in serum endotoxin and the increase in leg muscle myofiber diameter at day 60 after dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or a combination of both suggests that \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage can play a role in regulating the proliferation and differentiation of adult myoblasts. Also, mRNA expression of myogenic factors and protein expression increased significantly reinforcing this conclusion. This suggests that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or a combination of both may enhance the proliferation and differentiation of myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic cells and by enhancing immunocompetence.\u003c/p\u003e \u003cp\u003eSkeletal muscle development depends greatly on the development of myofibers. Myofibers are the basic constituent unit of animal muscle[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e] that can be classified into four types according to the polymorphism of myosin heavy chain (MYHC): slow oxidizing type (I), fast oxidizing type (IIa), fast glycolytic type (IIb) and intermediate type (IIx) (Schiaffino and Reggiani, 2011), which are respectively encoded by myosin heavy chain (MyHC) I, IIa, IIx, and IIb isoform genes[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Regarding the effect of \u003cem\u003eBacillus subtilis\u003c/em\u003e supplementation on muscle production, the results of different studies have been inconsistent. Previous studies have shown that the addition of \u003cem\u003eBacillus subtilis\u003c/em\u003e to the diet may decrease the \u003cem\u003eMYH1\u003c/em\u003e mRNA and protein expression[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], It was clear from our study that the administration of \u003cem\u003eBacillus subtilis\u003c/em\u003e had a beneficial effect on myogenic factors with a increased expression on both mRNA and protein in MYOD and MYHC, which is consistent with previous study[\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. The current studies basically investigated the effects of dietary supplementation with bacteriophage on some immune responses and intestinal gene expression, as well as the effects on bacteria[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan additionalcitationids=\"CR62 CR63 CR64 CR65 CR66 CR67\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e], indicating that bacteriophage can improve the immune ability of the organism, reduce the inflammatory response, and play a role in decreasing bacterial colonization, but very few studies have been conducted to explore the role of bacteriophage on myogenic factors, and the present study found that bacteriophage played a role in promoting myogenic factors, even exceeding the effect of \u003cem\u003eBacillus subtilis\u003c/em\u003e, and the specific mechanism of this remains to be further explored. We hypothesize that \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage may inhibit the proliferation of pathogenic bacteria such as \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e in the intestinal tract by competitive rejection and secretion of antimicrobial peptides, and reduce the entry of lipopolysaccharide into the bloodstream, which reduces the activation of the TLR4/MyD88 signaling pathway in muscle tissues and alleviates systemic inflammation. \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage may also be activating certain metabolites through digestion which in turn activate the AMPK/mTOR pathway in muscle tissues, inhibiting NF-κB-mediated inflammatory responses, reducing \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e levels, and while promoting protein synthesis and myofiber development.\u003c/p\u003e \u003cp\u003eBased on the data presented here, it can be concluded that after dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or a combination of both positively affects the rate of growth and condition of the geese, the weight, muscle production and myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic gene mRNA and protein expression increase, inflammatory factors mRNA and protein decrease. Considering the simplicity and economical effectiveness of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or their combination dietary addition, this combination of different ecological agents offers new preventive and control strategies for environmental management in the goose industry and can reduce the use of antibiotics, thus improving the performance and immune function of geese.\u003c/p\u003e \u003cp\u003eIn this study, we found that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage or their combinations to the diet promoted the growth performance of geese, reduced the levels of water and blood endotoxin in the feeding environment, inhibited the level of \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e and total bacterial colony in water, and improved the quality of bath water. In addition, it reduces the expression of immune factors, and increases the expression of myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenic genes, thereby thickening the diameter of myofibers and promoting myo\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eg\u003c/span\u003eenesis. These findings could provide theoretical support for the use of \u003cem\u003eBacillus subtilis\u003c/em\u003e or bacteriophage instead of antibiotics and offer potential nutritional strategies to improve production performance and immune function in geese.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis experiment was performed in accordance with the regulations and guidelines of the Animal Care Committee of the Zhongkai University of Agriculture and Engineering, and all efforts were made to minimize animal suffering. All experimental protocols were approved by the Animal Experiment Committee of Zhongkai University of Agriculture and Engineering (NO. 2021112709).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by: Guangdong Provincial Key Construction Disciplines Research Capacity Enhancement Project (2024ZDJS004), Guangdong Provincial Modern Agricultural Poultry Industry Technology System Innovation Team (2024CXTD20), Special Fund for Rural Revitalization Strategy Seed Industry Revitalization Project of Guangdong Province (2023-XDY-00-001, 2022-XPY-00-011), College Students innovation and entrepeneurship training program (S202411347062) and Young innovative talents projects of Ordinary Universities in Guangdong Province (2022KQNCX028).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthor Contributions\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.L., Y.L., Y.H., Z.L., S.L. performed the experiments and wrote the paper; and X.L.and Z.W. helped interpret the results. All authors have read and agreed to the published version of the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAcknowledgements\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks to the Guangdong Provincial Waterfowl Technology Innovation Platform for providing the experimental site.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSS Hou. LZ Liu. Waterfowl Industry and Technology Development Report 2023(in chinese). 60 (03) (2024) 318-321. https://doi.org/10.19556/j.0258-7033.20240202-11.\u003c/li\u003e\n\u003cli\u003eB.Y. Liu, Z.Y. Wang, H.M. Yang, J.M. Wang, D. Xu, R. Zhang, Q. Wang, Influence of rearing system on growth performance, carcass traits, and meat quality of yangzhou geese, Poult. Sci. 90 (3) (2011) 653-659. https://doi.org/10.3382/ps.2009-00591.\u003c/li\u003e\n\u003cli\u003eY. Yu, R. Wei, S. Yi, Y. Teng, R. Ning, S. Wei, L. Bai, H. Liu, L. Li, H. Xu, C. Han, Research note: integrative analysis of transcriptome and gut microbiome reveals foie gras capacity difference between cage and floor rearing systems, Poult. Sci. 103 (11) (2024) 104248. https://doi.org/10.1016/j.psj.2024.104248.\u003c/li\u003e\n\u003cli\u003eM.A. Boz, M. Sarica, U.S. Yamak, Production traits of artificially and naturally hatched geese in intensive and free-range systems - II: slaughter, carcass and meat quality traits, Br. Poult. Sci. 58 (2) (2017) 166-176. https://doi.org/10.1080/00071668.2016.1261998.\u003c/li\u003e\n\u003cli\u003eS. Grefte, A.M. Kuijpers-Jagtman, R. Torensma, J.W. Von den Hoff, Skeletal muscle development and regeneration, Stem Cells Dev. 16 (5) (2007) 857-868. https://doi.org/10.1089/scd.2007.0058.\u003c/li\u003e\n\u003cli\u003eG.N. Scheuermann, S.F. Bilgili, S. Tuzun, D.R. Mulvaney, Comparison of chicken genotypes: myofiber number in pectoralis muscle and myostatin ontogeny, Poult. Sci. 83 (8) (2004) 1404-1412. https://doi.org/10.1093/ps/83.8.1404.\u003c/li\u003e\n\u003cli\u003eJ. Wang, M. Fu, D. Xu, N. Cao, W. Li, Y. Tian, X. Zhang, Y. Huang, Lipopolysaccharide promotes the proliferation and differentiation of goose embryonic myoblasts by promoting cytokine expression and appropriate apoptosis processes, Vet. Sci. 9 (11) (2022). https://doi.org/10.3390/vetsci9110615.\u003c/li\u003e\n\u003cli\u003eT. Yoshida, P. Delafontaine, Mechanisms of IGF-1-mediated regulation of skeletal muscle hypertrophy and atrophy, Cells 9 (9) (2020). https://doi.org/10.3390/cells9091970.\u003c/li\u003e\n\u003cli\u003eM.G. Weinbauer, Ecology of prokaryotic viruses, FEMS Microbiol. Rev. 28 (2) (2004) 127-181. https://doi.org/10.1016/j.femsre.2003.08.001.\u003c/li\u003e\n\u003cli\u003eJ. Farup, L. Madaro, P.L. Puri, U.R. Mikkelsen, Interactions between muscle stem cells, mesenchymal-derived cells and immune cells in muscle homeostasis, regeneration and disease, Cell Death Dis. 6 (7) (2015) e1830. https://doi.org/10.1038/cddis.2015.198.\u003c/li\u003e\n\u003cli\u003eL. Shi, Y. Guo, Y. Cheng, Y. Xing, S. Guo, L. Zhang, Y. Xu, X. Jin, S. Yan, B. Shi, An artemisia ordosica extract: effects on growth performance, immune, and inflammatory response in lipopolysaccharide-challenged broilers, Front. Vet. Sci. 9 (2022) 980690. https://doi.org/10.3389/fvets.2022.980690.\u003c/li\u003e\n\u003cli\u003eH.A. Hong, L.H. Duc, S.M. Cutting, The use of bacterial spore formers as probiotics, FEMS Microbiol. Rev. 29 (4) (2005) 813-835. https://doi.org/10.1016/j.femsre.2004.12.001.\u003c/li\u003e\n\u003cli\u003eJ. Chen, Y. Yu, Bacillus subtilis-fermented products ameliorate the growth performance and alter cecal microbiota community in broilers under lipopolysaccharide challenge, Poult. Sci. 100 (2) (2021) 875-886. https://doi.org/10.1016/j.psj.2020.10.070.\u003c/li\u003e\n\u003cli\u003eY. Xu, Y. Yu, Y. Shen, Q. Li, J. Lan, Y. Wu, R. Zhang, G. Cao, C. Yang, Effects of bacillus subtilis and bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers, Poult. Sci. 100 (9) (2021) 101358. https://doi.org/10.1016/j.psj.2021.101358.\u003c/li\u003e\n\u003cli\u003eS. Liu, M. Du, J. Sun, Y. Tu, X. Gu, P. Cai, Z. Lu, Y. Wang, T. Shan, Bacillus subtilis and enterococcus faecium co-fermented feed alters antioxidant capacity, muscle fibre characteristics and lipid profiles of finishing pigs, Br. J. Nutr. 131 (8) (2024) 1298-1307. https://doi.org/10.1017/S000711452300291X.\u003c/li\u003e\n\u003cli\u003eJ.S. Kim, A. Hosseindoust, S.H. Lee, Y.H. Choi, M.J. Kim, J.H. Lee, I.K. Kwon, B.J. Chae, Bacteriophage cocktail and multi-strain probiotics in the feed for weanling pigs: effects on intestine morphology and targeted intestinal coliforms and clostridium, Animal 11 (1) (2017) 45-53. https://doi.org/10.1017/S1751731116001166.\u003c/li\u003e\n\u003cli\u003eY. Xu, Y. Yu, Y. Shen, Q. Li, J. Lan, Y. Wu, R. Zhang, G. Cao, C. Yang, Effects of bacillus subtilis and bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers, Poult. Sci. 100 (9) (2021) 101358. https://doi.org/10.1016/j.psj.2021.101358.\u003c/li\u003e\n\u003cli\u003eY. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899.\u003c/li\u003e\n\u003cli\u003eW. Li, J. Li, X. Dai, M. Liu, A. Khalique, Z. Wang, Y. Zeng, D. Zhang, X. Ni, D. Zeng, B. Jing, K. Pan, Surface display of porcine circovirus type 2 antigen protein cap on the spores of bacillus subtilis 168: an effective mucosal vaccine candidate, Front. Immunol. 13 (2022) 1007202. https://doi.org/10.3389/fimmu.2022.1007202.\u003c/li\u003e\n\u003cli\u003eS.D. Upadhaya, J.M. Ahn, J.H. Cho, J.Y. Kim, D.K. Kang, S.W. Kim, H.B. Kim, I.H. Kim, Bacteriophage cocktail supplementation improves growth performance, gut microbiome and production traits in broiler chickens, J. Anim. Sci. Biotechnol. 12 (1) (2021) 49. https://doi.org/10.1186/s40104-021-00570-6.\u003c/li\u003e\n\u003cli\u003eX. Liu, H. Yan, L. Lv, Q. Xu, C. Yin, K. Zhang, P. Wang, J. Hu, Growth performance and meat quality of broiler chickens supplemented with bacillus licheniformis in drinking water, Asian Australas. J. Anim. Sci. 25 (5) (2012) 682-689. https://doi.org/10.5713/ajas.2011.11334.\u003c/li\u003e\n\u003cli\u003eZ. Sarrami, M. Sedghi, I. Mohammadi, W.K. Kim, A.H. Mahdavi, Effects of bacteriophage supplement on the growth performance, microbial population, and PGC-1alpha and TLR4 gene expressions of broiler chickens, Sci. Rep. 12 (1) (2022) 14391. https://doi.org/10.1038/s41598-022-18663-1.\u003c/li\u003e\n\u003cli\u003eJ.P. Wang, L. Yan, J.H. Lee, I.H. Kim, Evaluation of bacteriophage supplementation on growth performance, blood characteristics, relative organ weight, breast muscle characteristics and excreta microbial shedding in broilers, Asian Australas. J. Anim. Sci. 26 (4) (2013) 573-578. https://doi.org/10.5713/ajas.2012.12544.\u003c/li\u003e\n\u003cli\u003eJ.H. Park, I.H. Kim, Supplemental effect of probiotic bacillus subtilis b2a on productivity, organ weight, intestinal salmonella microflora, and breast meat quality of growing broiler chicks, Poult. Sci. 93 (8) (2014) 2054-2059. https://doi.org/10.3382/ps.2013-03818.\u003c/li\u003e\n\u003cli\u003eJ. Yeo, K.I. Kim, Effect of feeding diets containing an antibiotic, a probiotic, or yucca extract on growth and intestinal urease activity in broiler chicks, Poult. Sci. 76 (2) (1997) 381-385. https://doi.org/10.1093/ps/76.2.381.\u003c/li\u003e\n\u003cli\u003eF. Yan, W. Wang, H. Cheng, Bacillus subtilis-based probiotic promotes bone growth by inhibition of inflammation in broilers subjected to cyclic heating episodes, Poult. Sci. 99 (11) (2020) 5252-5260. https://doi.org/10.1016/j.psj.2020.08.051.\u003c/li\u003e\n\u003cli\u003eI. Knap, A.B. Kehlet, M. Bennedsen, G.F. Mathis, C.L. Hofacre, B.S. Lumpkins, M.M. Jensen, M. Raun, A. Lay, Bacillus subtilis (DSM17299) significantly reduces salmonella in broilers, Poult. Sci. 90 (8) (2011) 1690-1694. https://doi.org/10.3382/ps.2010-01056.\u003c/li\u003e\n\u003cli\u003eJ.H. Park, I.H. Kim, Supplemental effect of probiotic bacillus subtilis b2a on productivity, organ weight, intestinal salmonella microflora, and breast meat quality of growing broiler chicks, Poult. Sci. 93 (8) (2014) 2054-2059. https://doi.org/10.3382/ps.2013-03818.\u003c/li\u003e\n\u003cli\u003eJ.S. Kim, A. Hosseindoust, S.H. Lee, Y.H. Choi, M.J. Kim, J.H. Lee, I.K. Kwon, B.J. Chae, Bacteriophage cocktail and multi-strain probiotics in the feed for weanling pigs: effects on intestine morphology and targeted intestinal coliforms and clostridium, Animal 11 (1) (2017) 45-53. https://doi.org/10.1017/S1751731116001166.\u003c/li\u003e\n\u003cli\u003eY. Won, S. Kim, J. Han, The protective effect of dietary supplementation of salmonella-specific bacteriophages in post-weaning piglets challenged with salmonella typhimurium, J. Adv. Vet. Anim. Res. 8 (3) (2021) 440-447. https://doi.org/10.5455/javar.2021.h529.\u003c/li\u003e\n\u003cli\u003eV. Clavijo, T. Morales, M.J. Vives-Flores, A. Reyes Munoz, The gut microbiota of chickens in a commercial farm treated with a salmonella phage cocktail, Sci. Rep. 12 (1) (2022) 991. https://doi.org/10.1038/s41598-021-04679-6.\u003c/li\u003e\n\u003cli\u003eA.M. Thanki, V. Clavijo, K. Healy, R.C. Wilkinson, T. Sicheritz-Ponten, A.D. Millard, M.R.J. Clokie, Development of a phage cocktail to target salmonella strains associated with swine, Pharmaceuticals 15 (1) (2022). https://doi.org/10.3390/ph15010058.\u003c/li\u003e\n\u003cli\u003eA.M. Thanki, S. Hooton, N. Whenham, M.G. Salter, M.R. Bedford, H.V.M. O\u0026apos;Neill, M.R.J. Clokie, A bacteriophage cocktail delivered in feed significantly reduced salmonella colonization in challenged broiler chickens, Emerg. Microbes Infect. 12 (1) (2023) 2217947. https://doi.org/10.1080/22221751.2023.2217947.\u003c/li\u003e\n\u003cli\u003eY. Choi, A. Hosseindoust, S.H. Ha, J. Kim, Y. Min, Y. Jeong, J. Mun, S. Sa, J. Kim, Effects of dietary supplementation of bacteriophage cocktail on health status of weanling pigs in a non-sanitary environment, J. Anim. Sci. Biotechnol. 14 (1) (2023) 64. https://doi.org/10.1186/s40104-023-00869-6.\u003c/li\u003e\n\u003cli\u003eP.A. Adhikari, D.E. Cosby, N.A. Cox, J.H. Lee, W.K. Kim, Effect of dietary bacteriophage supplementation on internal organs, fecal excretion, and ileal immune response in laying hens challenged by salmonella enteritidis, Poult. Sci. 96 (9) (2017) 3264-3271. https://doi.org/10.3382/ps/pex109.\u003c/li\u003e\n\u003cli\u003eC. Alexander, E.T. Rietschel, Bacterial lipopolysaccharides and innate immunity, J Endotoxin Res 7 (3) (2001) 167-202.\u003c/li\u003e\n\u003cli\u003eW. Guo, B. Liu, G. Hu, X. Kan, Y. Li, Q. Gong, D. Xu, H. Ma, Y. Cao, B. Huang, S. Fu, J. Liu, Vanillin protects the blood-milk barrier and inhibits the inflammatory response in LPS-induced mastitis in mice, Toxicol. Appl. Pharmacol. 365 (2019) 9-18. https://doi.org/10.1016/j.taap.2018.12.022.\u003c/li\u003e\n\u003cli\u003eL. Shi, Y. Guo, Y. Cheng, Y. Xing, S. Guo, L. Zhang, Y. Xu, X. Jin, S. Yan, B. Shi, An artemisia ordosica extract: effects on growth performance, immune, and inflammatory response in lipopolysaccharide-challenged broilers, Front. Vet. Sci. 9 (2022) 980690. https://doi.org/10.3389/fvets.2022.980690.\u003c/li\u003e\n\u003cli\u003eL. Zhang, X. Hou, L. Sun, T. He, R. Wei, M. Pang, R. Wang, Staphylococcus aureus bacteriophage suppresses LPS-induced inflammation in MAC-t bovine mammary epithelial cells, Front. Microbiol. 9 (2018) 1614. https://doi.org/10.3389/fmicb.2018.01614.\u003c/li\u003e\n\u003cli\u003eC. Li, Y. Li, S. Li, S. Chen, G. Liu, X. Deng, W. Chang, H. Cai, Bacillus subtilis protects the ducks from oxidative stress induced by escherichia coli: efficacy and molecular mechanism, Antioxidants 11 (10) (2022). https://doi.org/10.3390/antiox11101951.\u003c/li\u003e\n\u003cli\u003eM.N. Goodman, Tumor necrosis factor induces skeletal muscle protein breakdown in rats, Am J Physiol 260 (5 Pt 1) (1991) E727-E730. https://doi.org/10.1152/ajpendo.1991.260.5.E727.\u003c/li\u003e\n\u003cli\u003eL. Zhang, X. Hou, L. Sun, T. He, R. Wei, M. Pang, R. Wang, Corrigendum: staphylococcus aureus bacteriophage suppresses LPS-induced inflammation in MAC-t bovine mammary epithelial cells, Front. Microbiol. 9 (2018) 2511. https://doi.org/10.3389/fmicb.2018.02511.\u003c/li\u003e\n\u003cli\u003eX. Lei, D. Zhang, Q. Wang, G. Wang, Y. Li, Y. Zhang, M. Yu, Q. Yao, Y. Chen, Z. Guo, Dietary supplementation of two indigenous bacillus spp on the intestinal morphology, intestinal immune barrier and intestinal microbial diversity of rhynchocypris lagowskii, Fish Physiol. Biochem. 48 (5) (2022) 1315-1332. https://doi.org/10.1007/s10695-022-01121-0.\u003c/li\u003e\n\u003cli\u003eC. Hung, C. Kuo, C. Wang, C. Wu, N. Tsao, Experimental phage therapy in treating klebsiella pneumoniae-mediated liver abscesses and bacteremia in mice, Antimicrob. Agents. Chemother. 55 (4) (2011) 1358-1365. https://doi.org/10.1128/AAC.01123-10.\u003c/li\u003e\n\u003cli\u003eF. Cao, X. Wang, L. Wang, Z. Li, J. Che, L. Wang, X. Li, Z. Cao, J. Zhang, L. Jin, Y. Xu, Evaluation of the efficacy of a bacteriophage in the treatment of pneumonia induced by multidrug resistance klebsiella pneumoniae in mice, Biomed Res. Int. 2015 (2015) 752930. https://doi.org/10.1155/2015/752930.\u003c/li\u003e\n\u003cli\u003eY. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899.\u003c/li\u003e\n\u003cli\u003eC. Li, Y. Li, S. Li, S. Chen, G. Liu, X. Deng, W. Chang, H. Cai, Bacillus subtilis protects the ducks from oxidative stress induced by escherichia coli: efficacy and molecular mechanism, Antioxidants 11 (10) (2022). https://doi.org/10.3390/antiox11101951.\u003c/li\u003e\n\u003cli\u003eM.A. Rudnicki, R. Jaenisch, The MyoD family of transcription factors and skeletal myogenesis, Bioessays. 17 (3) (1995) 203-209. https://doi.org/10.1002/bies.950170306.\u003c/li\u003e\n\u003cli\u003eR. Du, S. Jiao, Y. Dai, J. An, J. Lv, X. Yan, J. Wang, B. Han, Probiotic bacillus amyloliquefaciens c-1 improves growth performance, stimulates GH/IGF-1, and regulates the gut microbiota of growth-retarded beef calves, Front. Microbiol. 9 (2018) 2006. https://doi.org/10.3389/fmicb.2018.02006.\u003c/li\u003e\n\u003cli\u003eS.G. Velleman, D.L. Clark, Histopathologic and myogenic gene expression changes associated with wooden breast in broiler breast muscles, Avian Dis. 59 (3) (2015) 410-418. https://doi.org/10.1637/11097-042015-Reg.1.\u003c/li\u003e\n\u003cli\u003eC. Vicente-Garcia, J.D. Hernandez-Camacho, J.J. Carvajal, Regulation of myogenic gene expression, Exp. Cell Res. 419 (1) (2022) 113299. https://doi.org/10.1016/j.yexcr.2022.113299.\u003c/li\u003e\n\u003cli\u003eY. Liu, N. Zhen, D. Liao, J. Niu, R. Liu, Z. Li, Z. Lei, Z. Yang, Application of bacteriophage phiPaP11-13 attenuates rat cutibacterium acnes infection lesions by promoting keratinocytes apoptosis via inhibiting PI3k/akt pathway, Microbiol. Spectr. 12 (2) (2024) e0283823. https://doi.org/10.1128/spectrum.02838-23.\u003c/li\u003e\n\u003cli\u003eM. Guo, M. Li, C. Zhang, X. Zhang, Y. Wu, Dietary administration of the bacillus subtilis enhances immune responses and disease resistance in chickens, Front. Microbiol. 11 (2020) 1768. https://doi.org/10.3389/fmicb.2020.01768.\u003c/li\u003e\n\u003cli\u003eY. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899.\u003c/li\u003e\n\u003cli\u003eJ. Wang, M. Fu, D. Xu, N. Cao, W. Li, Y. Tian, X. Zhang, Y. Huang, Lipopolysaccharide promotes the proliferation and differentiation of goose embryonic myoblasts by promoting cytokine expression and appropriate apoptosis processes, Vet. Sci. 9 (11) (2022). https://doi.org/10.3390/vetsci9110615.\u003c/li\u003e\n\u003cli\u003eY. Cao, Z. Wang, T. Yu, Y. Zhang, Z. Wang, Z. Lu, W. Lu, J. Yu, Sepsis induces muscle atrophy by inhibiting proliferation and promoting apoptosis via PLK1-AKT signalling, J. Cell. Mol. Med. 25 (20) (2021) 9724-9739. https://doi.org/10.1111/jcmm.16921.\u003c/li\u003e\n\u003cli\u003eC. Zhang, J. Luo, B. Yu, P. Zheng, Z. Huang, X. Mao, J. He, J. Yu, J. Chen, D. Chen, Dietary resveratrol supplementation improves meat quality of finishing pigs through changing muscle fiber characteristics and antioxidative status, Meat Sci. 102 (2015) 15-21. https://doi.org/10.1016/j.meatsci.2014.11.014.\u003c/li\u003e\n\u003cli\u003eY. Zhang, H. Yan, P. Zhou, Z. Zhang, J. Liu, H. Zhang, MicroRNA-152 promotes slow-twitch myofiber formation via targeting uncoupling protein-3 gene, Animals 9 (9) (2019). https://doi.org/10.3390/ani9090669.\u003c/li\u003e\n\u003cli\u003eH. Wang, C. Xiao, J. Li, R. Liang, Y. Liu, Z. Song, J. Buyse, L. Zhu, Dietary bacillus subtilis benefits meat quality by regulating the muscle fiber type and antioxidant capacity of broilers, Poult. Sci. 103 (12) (2024) 104267. https://doi.org/10.1016/j.psj.2024.104267.\u003c/li\u003e\n\u003cli\u003eY. Qiu, K. Li, X. Zhao, S. Liu, L. Wang, X. Yang, Z. Jiang, Fermented feed modulates meat quality and promotes the growth of longissimus thoracis of late-finishing pigs, Animals 10 (9) (2020). https://doi.org/10.3390/ani10091682.\u003c/li\u003e\n\u003cli\u003eM.M. Molendijk, B.K.H.L. Boekema, K.R. Lattwein, M. Vlig, L.G.M. Bode, M.P.G. Koopmans, A. Verbon, M. de Graaf, W.J.B. van Wamel, Bacteriophage therapy reduces staphylococcus aureus in a porcine and human ex vivo burn wound infection model, Antimicrob. Agents. Chemother. 68 (9) (2024) e0065024. https://doi.org/10.1128/aac.00650-24.\u003c/li\u003e\n\u003cli\u003eU. Gadde, W.H. Kim, S.T. Oh, H.S. Lillehoj, Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: a review, Anim. Health Res. Rev. 18 (1) (2017) 26-45. https://doi.org/10.1017/S1466252316000207.\u003c/li\u003e\n\u003cli\u003eP. Huang, X. Cui, Z. Wang, C. Xiao, Q. Ji, Q. Wei, Y. Huang, G. Bao, Y. Liu, Effects of clostridium butyricum and a bacteriophage cocktail on growth performance, serum biochemistry, digestive enzyme activities, intestinal morphology, immune responses, and the intestinal microbiota in rabbits, Antibiotics-Basel 10 (11) (2021). https://doi.org/10.3390/antibiotics10111347.\u003c/li\u003e\n\u003cli\u003eL. Yan, S.M. Hong, I.H. Kim, Effect of bacteriophage supplementation on the growth performance, nutrient digestibility, blood characteristics, and fecal microbial shedding in growing pigs, Asian Australas. J. Anim. Sci. 25 (10) (2012) 1451-1456. https://doi.org/10.5713/ajas.2012.12253.\u003c/li\u003e\n\u003cli\u003eY. Zeng, Z. Wang, T. Zou, J. Chen, G. Li, L. Zheng, S. Li, J. You, Bacteriophage as an alternative to antibiotics promotes growth performance by regulating intestinal inflammation, intestinal barrier function and gut microbiota in weaned piglets, Front. Vet. Sci. 8 (2021) 623899. https://doi.org/10.3389/fvets.2021.623899.\u003c/li\u003e\n\u003cli\u003eE. Gebru, J.S. Lee, J.C. Son, S.Y. Yang, S.A. Shin, B. Kim, M.K. Kim, S.C. Park, Effect of probiotic-, bacteriophage-, or organic acid-supplemented feeds or fermented soybean meal on the growth performance, acute-phase response, and bacterial shedding of grower pigs challenged with salmonella enterica serotype typhimurium, J. Anim. Sci. 88 (12) (2010) 3880-3886. https://doi.org/10.2527/jas.2010-2939.\u003c/li\u003e\n\u003cli\u003eS.D. Upadhaya, J.M. Ahn, J.H. Cho, J.Y. Kim, D.K. Kang, S.W. Kim, H.B. Kim, I.H. Kim, Bacteriophage cocktail supplementation improves growth performance, gut microbiome and production traits in broiler chickens, J. Anim. Sci. Biotechnol. 12 (1) (2021) 49. https://doi.org/10.1186/s40104-021-00570-6.\u003c/li\u003e\n\u003cli\u003eZ. Sarrami, M. Sedghi, I. Mohammadi, W.K. Kim, A.H. Mahdavi, Effects of bacteriophage supplement on the growth performance, microbial population, and PGC-1alpha and TLR4 gene expressions of broiler chickens, Sci. Rep. 12 (1) (2022) 14391. https://doi.org/10.1038/s41598-022-18663-1.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"goose, carcass trait, skeletal muscle, Bacillus subtilis, bacteriophage","lastPublishedDoi":"10.21203/rs.3.rs-6625383/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6625383/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePresence of \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eSalmonella\u003c/em\u003e causes poor bath water quality, which is an important factor plaguing the development of the goose farming industry. As these bacteria release stable endotoxins like Lipopolysaccharide (LPS), which can affects goose farming by impairing their immune health. \u003cem\u003eBacillus subtilis\u003c/em\u003e is a non-toxic Gram-positive probiotic that can decompose organic matter in water, improves feed efficiency in animals, inhibit harmful bacteria, and enhances the animal growth. Bacteriophages are virus which can specifically kill bacteria, reduce their numbers in the environment. To evaluate the effects of dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage on Magang geese's carcass traits, skeletal muscle weight percentage, myogenic gene and immunity factor gene mRNA expression during different rearing stages, 288 one-day old Magang geese were divied into 4 groups with with 6 replicates. The dietary treatments were group A, basal diet (with no treatment), group B, basal diet with 5.0\u0026times;10\u003csup\u003e10\u003c/sup\u003e PFU/L bacteriophage at a concentration of 1/10\u003csup\u003e3\u003c/sup\u003e, group C, basal diet with 5.0\u0026times;10\u003csup\u003e9\u003c/sup\u003e CFU/kg \u003cem\u003eBacillus subtilis\u003c/em\u003e and group D, basal diet with bacteriophage and \u003cem\u003eBacillus subtilis\u003c/em\u003e in combination same as group B and C. The results indicated that dietary supplementation of \u003cem\u003eBacillus subtilis\u003c/em\u003e and bacteriophage or their combination significantly increased wing length, tibia length and live weight on 60 d, reduced the levels of feeding environment water endotoxin as well as blood endotoxin in all stages, and suppressed the levels of \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e, and total bacterial colony in the water. It may also play a role in promoting muscle production through the mRNA and protein expression of muscle-associated factors (\u003cem\u003eMYOD\u003c/em\u003e, \u003cem\u003eMYOG\u003c/em\u003e, \u003cem\u003eMYH1\u003c/em\u003e), insulin like growth factor (\u003cem\u003eIGF-1\u003c/em\u003e) and reducing the mRNA and protein expression of inflammatory factors (\u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eIL-6\u003c/em\u003e), which may promote the growth of myofiber diameter and improve growth performance. These findings may guide new strategies to improve goose productivity and immunity, provide new eco-friendly methods to manage farming environments and thereby reducing the use of antibiotics.\u003c/p\u003e","manuscriptTitle":"Effects of dietary supplementation of Bacillus subtilis and bacteriophage on water quality, carcass traits and muscle growth of Magang Geese","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-19 10:39:32","doi":"10.21203/rs.3.rs-6625383/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b408790b-5e16-430b-8645-0465fab9dfba","owner":[],"postedDate":"June 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-07-17T08:39:14+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-19 10:39:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6625383","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6625383","identity":"rs-6625383","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}