PTEN Defect Facilitates Neuronal Cell Differentiation via ERK5 Activation

PTEN Defect Facilitates Neuronal Cell Differentiation via ERK5 Activation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article PTEN Defect Facilitates Neuronal Cell Differentiation via ERK5 Activation Weixia Dong, Na Fang, Yang An, Shaoping Ji This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6905743/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 14 You are reading this latest preprint version Abstract PTEN loss of function (LOF) enhances proliferation and differentiation of neuronal cells by well characterized pathways. Here, we identified ERK5 as a PTEN substrate that functions to boost NGF-induced neuronal differentiation in PC12 cells. Using knockdown approaches, we found that PTEN LOF leads to increased ERK5 phosphorylation, concomitant with increased neurite outgrowth, and upregulation of differentiation markers GAP43 and Nestin. Conversely, ERK5 overexpression produced similar outcomes, while ERK genetic LOF and pharmacological inhibition reduced neurite outgrowth and downregulated GAP43 expression. We also found that ERK5 interacted with c-Jun promoter directly to in part repress c-Jun expression. Taken together, our findings reveal that ERK5 is a novel PTEN target that mediates NGF-dependent neuronal differentiation. PTEN ERK5 phosphorylation PC12 cells differentiation neurite outgrowth Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction PTEN is a classical tumor suppressor that inhibits the PI3K/AKT/mTOR pathway to repress cell growth and proliferation( 1 ). As a dual-function enzyme with both lipid and protein phosphatase activity, PTEN converts phosphatidylinositol ( 3 , 4 , 5 )-trisphosphate (PIP3) to phosphatidylinositols-4,5-bisphosphate PIP2, but also catalyzes dephosphorylation of certain proteins( 2 ). In the developing nervous system, PTEN deletion increases proliferation of neuronal stem and progenitor cells, resulting in increased brain size and defective layer formation in the cortex, hippocampus and cerebellum, possibly as a result of defective migration( 3 , 4 ). In the adult brain, PTEN similarly control the neural stem cell self-renewal( 5 , 6 ). Whether and how PTEN is capable of directing cellular differentiation is less clear. Combined p53 and PTEN LOF results in a heightened c-Myc signature that prevents differentiation of both neural stem cells and glioma stem cells in mice( 7 ). In quiescent muscle stem cells, PTEN LOF leads to premature differentiation in the absence of proliferation( 8 ). Deletion of PTEN in other cellular populations can result in premature differentiation, and even premature senescence( 8 – 10 ), suggesting that PTEN, beyond is well established role in cell growth and proliferation, also plays a role in cell differentiation, and that these processes are likely to be interconnected. We and others previously reported that PTEN inactivation or knock-down with shRNA promoted neurite outgrowth in PC12 cells( 11 – 14 ). Conversely, PTEN overexpression inhibited neuronal cell differentiation and rescued impaired brain development in mice lack the histone demethylase Utx( 15 , 16 ). Furthermore, PTEN has been reported to regulate organ-derived cell differentiation( 17 ). PTEN was also reported to directly interact with serum response factor in the nucleus to promote expression of smooth muscle specific genes in a phosphatase-independent manner( 17 ). In the present study, we created PC12 models with knockdown and overexpression of PTEN ( PTEN _KD and PTEN _OE) to investigate cellular mechanisms of PTEN-dependent differentiation. We discovered that NGF stimulation in PTEN _KD PC12 cells increased phosphorylation levels of ERK5 (in addition to well documented effectors Akt and ERK1/2( 18 – 20 )) and surmised that ERK5 might be a novel PTEN target. To investigate this hypothesis, we created and characterized ERK5 _KD and ERK5 _OE PC12 models in the NGF-induced PC12 differentiation paradigm. Materials and Methods Materials The PC12 cell line was purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA). Poly-D-lysine was purchased from Sigma (St. Louis, MO, USA). Cell culture medium RPMI-1640, horse serum and fetal bovine serum were purchased from Gibco (ThermoFisher Scientific inc. TMO: New York). Nerve growth factor (NGF) was purchased from Sino Biological (Beijing, China). Vector pcDNA3.1(+) and lipofectamine 2000 were purchased from Invitrogen (ThermoFisher Scientific, Inc., Waltham, MA, USA). Vectors pEGFP-N1 and pIRES2-EGFP were purchased from Clontech (Mountain View, CA, USA). Lentiviral vectors used for overexpression of human PTEN or ERK5 gene were purchased from GenePharma Co., Ltd. (Shanghai, China). Vector T-easy was purchased from Promega (Madison, WI, USA). Trizol reagent, reverse transcriptase kit and SYBR Green I mix were purchased from Takara Bio Inc. (Kusatsu, Japan). Cell culture and induction of differentiation PC12 cells were maintained in poly-D-lysine coated dishes with RPMI-1640 medium containing 10% horse serum and 5% fetal bovine serum in 5% CO2 at 37°C. Differentiation of PC12 cells were induced by NGF using previously reported protocol( 11 ). Cells were plated in 6-cm dishes at low density prior to induction. To induce differentiation, cells were cultured in RPMI-1640 medium supplemented with 50 ng/ml of NGF, and fresh medium containing NGF was changed every other day. At day 1, 3, 5, the cells were photographed, and total RNA or proteins were subsequently extracted from differentiated PC12 cells. The differentiation maturity was identified by measuring the number of neurite-bearing cells as described previously( 11 ). Cells with processes of at least two cell body lengths were defined as neurite-bearing cells. Number of neurite-bearing cells was measured using an Image-Pro Plus software 3×10 random cells from three visual fields. The cell shape was observed and photographed under a microscope. DNA construction, cell transfection and infection PTEN and ERK5 CDS regions were PCR amplified using gene-specific primers, cloned into T-easy vector, verified by DNA sequencing, and then cloned into protein expression vectors. HEK293T or PC12 cells were transfected with the pEGFP-N1-PTEN or pIRES2-EGFP-ERK5 plasmids using lipofectamine 2000 according to the manufacturer’s instructions. PC12 cells were infected with PTEN or ERK5 overexpression or knock-down lentivirus constructed and packed by GenePharma Co., Ltd. (Shanghai, China), in which GFP expression was independently driven by another EF1α promoter. After 60 h, cells were selected with 2 µg/ml puromycin. Two weeks later, positive cell clones with stably integrated PTEN or ERK5 or their control shRNA were obtained. For PTEN mutation assay, PTEN K13E, K289E and K13E + K289E mutants were constructed by fusion PCR using the primers containing specific point mutation, respectively. All the constructions were verified by DNA sequencing, and then the cDNAs were cloned into the expression vector pEGFP-N1. The forward and reverse primer sequences for fusion PCR were: 5’-ATGACAGCCATCATCAAAGAG-3’ and 5’-GCGACTTTTGTAATTTGTGTATG-3’; for K13E mutant, 5’-CCGCTCGAGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACGAAAGGAGATATCA-3’; for K289E mutant, 5’-GACCAGAGGAAACCTCAGAAGAAGTAGAAAATGGAAGTCT-3’; for K13E + K289E mutant, fusion PCR was performed using K13E and K289E mutant cDNAs as templates. GST fusion protein expression and purification To clone rat PTEN CDS into vector pGEX-6P-1, primers are forward: 5’-GGATCCatgacagccatcatcaaagag-3’ and reverse: 5’-GAATTCtcagacttttgtaatttgtga-3’ with restriction enzyme sites BamHI and EcoRI. To clone PTEN-N-terminus (1-185aa), primers are 5’-GGATCCatgacagccatcatcaaagag-3’ and 5’-GAATTCgtaatccaggtgattctttaa-3’. To clone PTEN-C-terminus (186-403aa), primers are 5’-GGATCCagaccagtggcactgttgttt-3’ and 5’-GAATTCtcagacttttgtaatttgtga-3’. The PCR products, which were purified in agarose gel, were subsequently cloned into pGEX-6P-1. Induction expression of the fusion protein was performed as described in a regular protocol of GST fusion protein. Quantitative RT-PCR Total RNA was extracted from the PC12 cells using the Trizol reagent, and cDNA was synthesized using the reverse transcriptase kit by which the genome DNA was removed before reverse transcription according to the manufacturer’s protocol. The forward and reverse primers sequences respectively were: Twist1 , 5’-CGGACAAGCTGAGCAAGATT-3’ and 5’-CCTTCTCTGGAAACAATGAC-3’; c-Fos , 5’-AGCGCCCCATCCTTACGG-3’ and 5’-CTTGGAGCGTATCTGTCAG-3’; CREB , 5’-ATTCGCACAGCACCCACTA-3’ and 5’-CTGCCACTCTGTTCTCTAAA-3’; c-Myc , 5’-GCTGCTGTCCTCCGAGTC-3’ and 5’-TGGAGCATTTGCGGTTGTTG-3’; Cyclin D1 , 5’-CGCCCTCCGTTTCTTACTT-3’ and 5’-GGGAATGGTCTCCTTCATCT-3’; c-Jun , 5’-GGGCACATCACCACTACAC-3’ and 5’-AAGTTGCTGAGGTTGGCGTA-3’; Hif1a , 5’-GAGCCTAACAGTCCCAGTG-3’ and 5’-CGGTGGCAGTGACAGTGAT-3’; PML , 5’-TGTGGCAAGTGCTTTGATGC-3’ and 5’-CCTCCAGAGCCTGCGTCAT-3’; FoxO3 , 5’-TCGCAACGACCCAATGATGT-3’ and 5’-CCCATGACGGGAAGGTTTG-3’; NF-kB , 5’-ACACGGGACCAGGAACAG-3’ and 5’-ACACGGGACCAGGAACAG-3’. Quantitative RT-PCR was performed on a PikoReal®480 Real-Time PCR System (Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR Green I mix according to the manufacturer’s instructions. The results were normalized to GAPDH or β-actin. Western blotting The total proteins were extracted from the PC12 cells using RIPA lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 mM EDTA) supplemented with protease and phosphatase inhibitor cocktail (Bimake, Shanghai, China) as described previously( 21 ). After SDS-PAGE separation, the proteins were transferred to PVDF membranes. The primary antibodies used for Western blotting included anti-PTEN (#9188), anti-ERK5 (#3372), anti-p-ERK5 (#3371), anti-ERK1/2 (#4695), anti-p-ERK1/2 (#4370), anti-p38 (#4511), anti-p-p38 (#9212), anti-JNK (#9252), anti-p-JNK (#4668), anti-Akt (#9272), anti-p-Akt (#4060), anti-Tpl2 (#71184), anti-p-Tpl2 (#4491), anti-GAPDH (#2118), anti-LaminB (#13435) (Cell Signaling Technology, Inc., Danvers, MA, USA), anti-MEK5 (ab210748), anti-p-MEK5 (ab254134), anti-TrkA (ab109010) and anti-p-TrkA (ab197071) (Abcam, Cambridge, UK), anti-GAP43 (PA5-34943) (Thermo Fisher Scientific, Inc.), and anti-β-actin (AF5001) and anti-β-tubulin (AF1216) (Beyotime Biotechnology, Haimen, China). The membranes were incubated with primary antibodies in TBST (Tris buffered saline with Tween-20) buffer with 5% skim milk or 3% BSA at 4℃ overnight. The secondary antibodies were incubated in the presence of 5% skim milk at room temperature for 2 hr. The membranes were then visualized with chemiluminescence. To reuse the membranes with different antibodies, the membranes were stripped with a stripping buffer (65 mM Tris–HCl, 2% SDS, 100 mM β-mercaptoethanol, pH 6.8) at 60℃for 30 min with a gentle agitation. Isolation of nuclei from cytoplasm PC12 cells were transfected with the wild type (WT), K13E, K289E and K13E + K289E mutant PTEN and blank plasmids, respectively. The nuclei were isolated from cytoplasm according to manufacturer’s instruction (Thermo Fisher Scientific, Inc.). In brief, 5x10 6 cells were shoveled off with a cell shovel and washed twice with cold PBS (0.8% NaCl, 0.02% KCl, 0.144% Na2HPO4, 0.024% KH2PO4, pH 7.4) buffer. The cell pellet was collected into a microcentrifuge tube, re-suspended in 500 µl CER I reagent and incubated on ice for 15 min. Then 27.5 µl CER II reagent was added and mixed in the microcentrifuge tube. The sample was centrifuged at 12,000 g and 4°C for 5 min. The supernatant contains the cytoplasmic fraction and the pellet is the nuclear fraction. The two fractions were processed as protein samples described above. Immunofluorescence For immunofluorescence assay, PC12 cells were fixed with 4% paraformaldehyde for 15 min, and then the fixed cells were washed 3 times with PBS. After washing, the cells were treated with 0.3% Triton X-100 for 10 min, and the permeated cells were washed as described above in PBS The cells were incubated with blocking buffer (2% BSA in PBS) for 30 min and subsequently with the primary antibody (anti-GAP43) and Alexa Fluor™ 555-labeled secondary antibody (Thermo Fisher Scientific, Inc.) in blocking buffer for 1 h. Cells were stained with DAPI (Beyotime Biotechnology, Shanghai, China), then the fluorescence was observed and photographed under a fluorescence microscope. GST-pull down assay Glutathione S-transferase (GST)-PTEN or GST-PTEN-N/C terminus fusion protein was produced in E. coli BL21 strain and purified by glutathione beads. To perform the pulldown assay, the cells were transfected with ERK5 plasmids to overexpress ERK5. After 48 h, the purified GST-PTEN, GST-PTEN-N or GST-PTEN-C bound to agarose beads were incubated with the cell lysate (ERK5-overexpressed) at 4°C overnight. After washing the beads 4 times with RIPA buffer, the pellet complex was isolated by boiling beads in 2× SDS-loading buffer for 10 min and subjected to Western blot analysis using previously reported protocol( 1 ). Co-immunoprecipitation assay Co-immunoprecipitation (co-IP) was performed as previously reported( 1 ). The cells were overexpressed with PTEN and lysed in ice-cold RIPA buffer supplemented with protease inhibitor cocktail (Bimake, Shanghai, China). After pre-clearing with protein A/G beads, the supernatant of cell lysate was incubated with anti-PTEN or anti-ERK5 antibody or normal IgG as control at 4°C overnight. Subsequently, the samples were incubated with protein A/G sepharose beads (Santa Cruz Biotechnology, CA, USA) for 2 hours at 4°C. The precipitated complex was collected by centrifugation at 12,000g for 10 min and then washed 4 times with RIPA buffer. The pellet was re-suspended and boiled in 2× SDS-loading buffer to extract the co-precipitated proteins. The samples were subjected to Western blotting. ChIP assay For chromatin immunoprecipitation (ChIP) assay, PC12 cells were cultured in 10 cm dishes. Formaldehyde (37%) was added to medium to a final concentration of 1% and incubated at room temperature for 10 min. Then, 1.25 M glycine was added to the dishes with a final concentration of 125 mM and incubated for 5 min. Cells were scraped and collected by centrifugation at 1000 g for 5 min at 4°C. Cell pellets were re-suspended in lysis buffer (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 1% Triton X-100, 0.1% Sodium deoxycholate, 0.1% SDS) containing protease inhibitor. The isolated chromatin was sheared by sonication (80 W, 10 s) to an average size of 200–1000 bp, then centrifuged at 8000 g and 4°C for 30 sec, and the supernatant is transferred to a new centrifuge tube. After pre-clearing with protein A/G beads, the DNA-protein complex was precipitated by being incubated with anti-ERK5 antibody at 4°C overnight. The DNA was extracted by phenol-chloroform and used as a template for PCR. Respectively, the forward and reverse primers used were: c-Jun , 5’-TATGGAGCGGAGTCACAAGA-3’ and 5’-GGGATGAGAAGGGAGCAG-3’; PML , 5’-AAGCCCAGCAGGGACACA − 3’ and 5’- TAACGCTACAACTGAAGAGTA − 3’; CREB , 5’-GGGGTTTCCAGCAAGTCC-3’ and 5’- AACGGTCCTATCCTCGCTAT-3’; FoxO3 , 5’-TGCGATTCCAGAGTGTGTGA-3’ and 5’- CCGGGAGTGCTGCTGTGC-3’; c-Myc , 5’-GCTCCACAGGGGCAAAGA − 3’ and 5’- CCCGTTCGGACCTTCCAC − 3’; Twist1 , 5’-TGTGGTCATTGTCTCTGGAT-3’ and 5’- CGGAAACGCTGGGGTGTG-3’. RT-PCR RT-PCR was performed to measure mRNA levels of c-Jun and PML with ERK5 overexpression or knockdown in PC12 cells. The total RNA was isolated as described above in Quantitative RT-PCR. PCR primers for rat c-Jun are forward: 5’-ctgcaggcgctgaaggaagag-3’ and reverse: 5’- tcaaaacgtttgcaactgctg-3’; and primers for rat PML are forward: 5’-cagtgctttgcttccctgcag-3’ and reverse: 5’-ctaggccaggcatcccttatt-3’. PCR condition was set as 94℃for 30 sec, 60℃for 40 sec, and 72℃ for 60 sec. The PCR products were analyzed by agarose gel. Growth curve To draw the cell growth curve, PC12 cells (ERK5_OE or ERK5_KD) were cultured in 24-well plates (5×10 4 cells/well), and the medium was changed every two days. Cells were trypsinized and counted using an automatic cell counter (Countstar®; Ruiyu Biotech, Shanghai, China) on days 1 to 5. Cell counts were recorded to draw the growth curves using GraphPad Prism 7 software (GraphPad Software, Inc., La Jolla, CA, USA). XMD8-92 treatment As an inhibitor of ERK5, XMD8-92 can inhibit the activity of ERK5 and decrease p-ERK5 level. To determine the optimal time for XMD8-92 treatment, PC12 cells were seeded in 6-well plates and treated with 20 µM XMD8-92 (Bimake, Shanghai, China) with DMSO (Sigma, St. Louis, MO, USA) as a solvent control. The total proteins were extracted from the cells at 10 min, 1 h, 2 h, 24 h and 48 h after inhibitor treatment. To determine the optimal concentration for XMD8-92 treatment, PC12 cells were treated with XMD8-92 in various concentrations (1 µM, 5 µM, 10 µM and 20 µM) for 48 h, and the total proteins were extracted. Then, the p-ERK5 level was measured by Western blotting to observe the inhibitory effect of XMD8-92. For cell differentiation, PC12 cells were treated with 20 µM XMD8-92 or DMSO and then added with NGF to induce cell differentiation as described above in ‘Cell culture and induction of differentiation’. The medium supplemented with XMD8-92 or DMSO plus NGF was changed every other day. At day 1, 3, 5, 7, total RNA and proteins were extracted from differentiated PC12 cells to measure the level of differentiation marker GAP43, and cells were photographed to identify the differentiation maturity. Statistical analysis Statistical analysis was performed by GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA) and exhibited as means + SD of three separate experiments. The significance was assessed by t-test, and p value less than 0.05 was considered statistically significant (* p < 0.05, ** p < 0.01). Results PTEN knockdown facilitates neurite growth PC12 cell line is an ideal model for studying the differentiation of neuronal cells. To study PTEN gain and loss of function, we infected PC12 cells with lentivirus overexpressing or knock-down of PTEN under antibiotic selection. Four knockdown and three overexpression islets were isolated and evaluated relative to infected control intact PC12 cells, resulting in verification of two representative PC12 cell strains with stable PTEN knockdown ( PTEN _KD) and one strain with stable PTEN overexpression ( PTEN _OE). Expression levels of mRNA and protein were measured by RT-PCR and Western blot, respectively (Fig. 1 A and B). PTEN expression was efficiently knocked down or overexpressed in PC12 cells as demonstrated by Western blot (Fig. 1 C). Subsequently, control and stable transfected cells were cultured in regular medium in the absence of NGF. Consistent with earlier work, we observed neurite growth in stable PTEN _KD cells but not in PTEN _OE or control cells (Fig. 1 D). We also verified that PTEN overexpression inhibited cell proliferation while its knockdown increased cell proliferation (Fig. S1 ). Outgrowth induced by PTEN knockdown may involve ERK5 We next examined whether phosphorylation levels of TrkA, MAPKs and Akt were altered in PTEN _KD cells, as such changes might be mechanistically linked with PTEN mediated regulation of neurite outgrowth. To this end, we pulsed intact PC12 cells or PTEN _KD cells with NGF for up to 10 min in serum-free media and analyzed phosphorylation levels of TrkA, MAPKs and Akt with phosphorylation-specific antibodies. The results showed that phosphorylation levels of ERK5 and ERK1/2 were significantly increased in 5 min of NGF stimulation (Fig. 2 A). Considering that ERK1/2 is known to be primarily involved in cell proliferation and growth( 19 , 23 ), we elected to focus on ERK5, which has been reported to regulate neuronal differentiation and development( 24 , 25 ). PTEN directly dephosphorylates and interacts with ERK5 We first asked whether upstream known regulators MEK5 and MEKK2/3, and potential regulator Cot/Tpl2, in the ERK5 signaling pathway were dephosphorylated by PTEN. To this end, we examined phosphorylation levels of Cot/Tpl2, MEKK2/3 and MEK5 in PTEN _KD cells. As shown in Fig. 2 B, PTEN knockdown did not affect phosphorylation levels of Cot/Tpl2 and MEK5. Unfortunately, in our hands, the signal from the anti-phospho-MEKK2/3 antibody was not sufficiently specific to allow us to draw conclusions about MEKK2/3 regulation. However, phosphorylation levels of ERK5 were remarkably increased compared with levels in intact PC12 cells under NGF stimulation (Fig. 2 B). This data suggests that PTEN is likely to dephosphorylate ERK5 directly. To probe whether PTEN directly interacts/associates with ERK5, we performed co-immunoprecipitation with normal IgG as a control in lysates from PTEN _OE cells. Compared to control IgG, we detected PTEN in the complex precipitated by the anti-ERK5 antibody, whereas little PTEN was detected from intact PC12 cells (Fig. 2 C). Because ERK5 was only detected in immuno-precipitates from PTEN _OE cells, but not in intact PC12 cells (Fig. 2 D), we surmised that the interaction between PTEN and ERK5 might be weak and can only be detected with PTEN overexpression. We next investigated which domain of PTEN is involved in the interaction with ERK5. PTEN has a protein binding domain (PBD) and a phosphatase domain (1-185aa) at the N-terminus. At its C-terminus, PTEN has a C2 domain (which targets proteins to cell membranes), a Tail domain (believed to regulate substrate specificity) and a PDBAD domain (186-403aa). We created and overexpressed full-length PTEN and Glutathione S-transferase (GST)-fused N-terminus and C-terminus PTEN domains in E.coli BL21 cells, respectively. We then used purified fusion proteins and GST to pull-down ERK5 from PC12 cells, followed by Western blot analysis of pull-down complexes. Although both GST-PTEN and GST were purified to reasonable purity (Fig. 2 E), ERK5 was only pulled down by GST-PTEN from the PC12 cell lysate (and not by GST or glutathione Sepharose 4B beads which capture GST or GST-fusion proteins) (Fig. 2 F). Purified GST-fused PTEN C-terminus (186-403aa) was mainly able to pull down ERK5 from PC12 cell lysates (Fig. 2 G). This data reveals that ERK5 appears to primarily bind to the PTEN-C-terminus, which play a critical role in reaction with other proteins, probably the PTEN N-terminus was associated with little ERK5 (Fig. 2 H). Preventing PTEN nuclear translocation represses neurite outgrowth Mono-ubiquitination of PTEN at K13 (lysine 13) or K289 (lysine 289) is known to facilitate PTEN translocation into the nucleus, where PTEN acts to repress AKT signaling ( 26 ). To evaluate whether nuclear translocation of PTEN is critical to regulate neurite outgrowth in PC12 cells, we replaced the K13 and K289 of PTEN with glutamic acid residues (E by mutagenesis through an overlap extension PCR). We found that the K13 residue played a stronger role than the K289 residue in nuclear importation of PTEN in both HEK293T and PC12 cells (Fig. 3 A and 3 B). Subsequently, we examined effects of wild-type (WT) and mutated PTEN on ERK5 phosphorylation within nuclei using Western blotting. As shown in Fig. 3 C, both K13E- PTEN and K13E + K289E- PTEN transfection caused up-regulation of nuclear ERK5 phosphorylation and down-regulation of cytoplasmic ERK5 phosphorylation compared to WT PTEN (Fig. 3 C). This data suggests PTEN is capable of dephosphorylating ERK5 in the nucleus. PC12 cell differentiation can be evaluated by quantification of neurite outgrowth ( 27 ). Hence, we next set out to investigate whether loss of nuclear PTEN would impact neurite outgrowth in PC12 cells. Transfected cells were treated with NGF for 5 days, after which cells with at least one neurite in length equal to two cell diameters were characterized as differentiated cells. Using this approach, we found that WT PTEN efficiently repressed neurite outgrowth relative to blank vector control (Fig. 3 D). Similarly, cells in which a PTEN mutation prevented nuclear import also resulted in a decrease in neurite outgrowth compared to blank vector control, but less so than for WT PTEN cells (Fig. 3 D). No significant difference was observed among the three mutants (K13E- PTEN , K289E- PTEN and K13E + K289E- PTEN ) in repressing neurite growth (Fig. 3 D). These data are consistent with the previous reports of PTEN translocation( 26 ), suggesting that nuclear PTEN plays a repressor role in PC12 cell differentiation. Neuronal growth-associated protein GAP43 is an important component of axons, and is typically used as a neuronal differentiation marker( 28 , 29 ). We previously reported that PTEN knockdown increased neurite outgrowth in PC12 cells( 11 ). In the current study, we identified ERK5 as a substrate for PTEN dephosphorylation and suppression. To determine whether ERK5 activation by phosphorylation changes during PC12 cell differentiation, we examined GAP43 expression in PTEN _OE and PTEN _KD cells cultured with NGF for 1–7 days. As shown in Fig. 3 E, ERK5 phosphorylation was significantly increased upon PTEN knockdown at day 1, 3 or 5. However, ERK5 phosphorylation was unexpectedly decreased at day 7, regardless of PTEN OE or KD (Fig. 3 E). Thus, it is possible that ERK5 activity is no longer required when the cell completed differentiation at day 7. GAP43 expression continuously increased under NGF stimulation, but its level was higher with PTEN _KD than PTEN _OE or intact cells at day 5 (Fig. 3 E). This data suggests that in the absence of PTEN, ERK5 remains phosphorylated during PC12 differentiation. ERK5 enhances NGF-induced cell differentiation and neurite outgrowth ERK5 has been reported to both enhance cell proliferation( 30 – 32 ) and facilitate cell differentiation( 33 , 34 ). To explore the role of ERK5 in PC12 cell proliferation and differentiation, we generated three siRNAs targeting ERK5 and evaluated these for efficiency on ERK5_KD. All three siRNAs efficiently knocked down ERK5 expression in PC12 cells with siRNA-1 being the most potent one (Fig. S2 A). The sequence of siRNA-1 was submitted to GenePharma Co. Ltd. (Shanghai, China) and packaged into lentiviral particles. For OE studies we fused ERK5 with GFP or inserted ERK5 in a bicistronic vector containing a separate GFP expression cassette. Efficiency of infection was evaluated 48h after infection (Fig. S2 B). The expression level of ERK5 was detected by Western blot (Fig. 4 A), with ERK5 being efficiently knocked–down relative to both control and ERK5 _OE PC12 cells. To ascertain whether ERK5 alone would influence neurite outgrowth in the absence of NGF stimulation, ERK5 _OE PC12 cells were cultured in regular medium for 5 consecutive days. We found that the cell soma became flattened with short neurites/processes compared to either control or PTEN _OE cells, which neither have neurites/processes (Fig. 4 B and 1 D). With higher magnification (100×) this observation is even more evident, suggesting that ERK5 alone is capable of initiating PC12 cell differentiation without NGF stimulation, and can be more effective in promoting differentiation with NGF stimulation (Fig. S2 C). However, ERK5 itself was not capable of inducing complete differentiation. We next cultured intact cells, ERK5 _OE and ERK5 _KD cells with NGF stimulation for 1–5 days. GAP43 was detected via Western blot and quantitative PCR, and was observed to distribute in the cytoplasm and cell processes. We found that ERK5 OE enhanced GAP43 expression under NGF stimulation compared to both control and ERK5 KD (Fig. 4 C and S2 D). In contrast, ERK5 KD reduced GAP43 expression compared to control and ERK5 OE (Fig. 4 C and S2 D). Furthermore, ERK5 OE led to elevated GAP43, TrkA/NGFR and Nestin expression at the mRNA level as demonstrated by quantitative RT-PCR (qRT-PCR) (Fig. 4 D, E and F), but had no significant effects on Tubb3 expression, a neuronal marker (Fig. 4 G). Taken together, these data suggested that ERK5 in and of itself could not completely induce PC12 cell differentiation, and that NGF stimulation is required for full differentiation. Neurite outgrowth and elongation are primary features of PC12 cell differentiation. To explore effect of ERK5 on PC12 cell differentiation, we measured neurite length during 5 days of NGF treatment. ERK5 _OE augmented PC12 cell differentiation by inducing neurite outgrowth and elongation more so than in control cells. In contrast, in ERK5 _KD cells neurite elongation was impaired and cell differentiation was blocked (Fig. 4 H and I). Considering that proliferation is a process that is superseded by differentiation, we simultaneously examine the effect of ERK5 on PC12 cell proliferation. The cell proliferation curve (Fig. 4 J) showed that PC12 cell proliferation was indeed reduced in ERK5 _OE cells while increased in ERK5 _KD cells compared to the control cells. We next investigated if pharmacological inhibition of ERK5 would mirror the effects we had observed in ERK5 _KD cells. To this end, we treated PC12 cells with XMD8-92, a potent and selective ERK5 inhibitor, under different doses and time points. The effect of XMD8-92 reached its peak around 2 h of treatment (Fig. 5 A and B). Subsequently, we titrated the concentration of XMD8-92 to be able to detect inhibition of ERK5 activity. As shown in Fig. S3 B and C, XMD8-92 down-regulated ERK5 phosphorylation in a dose-dependent manner and reached its maximal repression of ERK5 phosphorylation at 20 µM. We next examined whether inhibition of ERK5 phosphorylation via XMD8-92 affected GAP43 expression and PC12 cell differentiation. Notably, GAP43 expression was reduced in the presence of XMD8-92 (Fig. 5 C), particularly at day 5 (Fig. 5 D). In addition, XMD8-92 treatment lead to reduction in neurite length (Fig. 5 E and F). This data suggests that pharmacological inhibition of ERK5 by XMD8-92 represses PC12 differentiation (Fig. S3 D). Molecular analysis of ERK5 function during PC12 differentiation To begin to understand molecular pathways downstream of ERK5 inhibition in the PC12 differentiation model, we first took to q-PCR. Similar to what we observed in ERK5 _KD cells, expression levels of GAP43 and TrkA were reduced in the presence of XMD8-92 (Fig. 6 A and B), whereas Tubb3 expression levels remained unchanged (Fig. 6 C). Intriguingly, in the presence of XMD8-92, Nestin expression was increased compared to control (Fig. 6 D), which differed from what we had observed in ERK5 _KD cells, where Nestin expression was reduced (Fig. 4 F). It is possible that XMD8-92 might inhibit activity of other kinases that regulate Nestin expression, or Nestin is not an ideal indicator to indicate the cell differentiation. Genes that regulate gene transcription and cell differentiation downstream of ERK5 have been well documented( 35 ). Here, we found that expression levels of CREB, cyclin D1, FoxO3 and PML were up-regulated in ERK5 _OE cells; whereas the expression of c-Jun, Twist1 and c-Myc were down-regulated in ERK5 _KD cells (Fig. 6 E). We next performed ChIP assays to evaluate direct binding of ERK5 to promoter regions of candidate genes with a ChIP-grade anti-ERK5 antibody. We tested two different pairs of the primers for each gene, and selected the optimized primers for our PCR experiments (Fig. 6 F). Recovered DNA was evaluated in agarose gel for shearing effect of ultrasonic homogenization (Fig. S4 ). In three independent ChIP experiments, the results indicated that ERK5 was associated with the c-Jun promoter (Fig. 6 G). We also detected a possible association between ERK5 and the PML promoter, however this result was less clear as there was also a positive band in the IgG control lane (Fig. 6 G). We next examined expression levels of c-Jun and PML in NGF stimulated ERK5 _KD and ERK5 _OE cells using RT-PCR. We found that ERK5 knockdown significantly increased c-Jun expressions regardless of NGF stimulation (Fig. 6 H). This suggests that c-Jun plays a repressor role in PC12 cell differentiation induced by ERK5. Discussion PTEN down-regulation in cell proliferation and growth via PI3K-Akt is well documented( 2 ). However, the underlying molecular mechanism on how PTEN facilitates cell neurite outgrowth remains unknown ( 11 ). Here, we discovered that ERK5 functions as a PTEN effector during PC12 cell differentiation. NGF is known to induce PC12 differentiation via the TrkA pathway( 36 ). However, our data show that PTEN signals primarily via ERK5, and not TrkA, as TrkA phosphorylation did not change significantly in PTEN cellular models. ERK5, also known as MAP kinase 7, is the biggest MAP kinase among all MAPKs. As a transcription regulator, activated ERK5 translocates into the nucleus to phosphorylate/activate transcription factors or act as a co-activator to interact with transcription factors in a kinase-dependent or independent manner( 37 ). More recent works demonstrate that some ERK5 effects are mediated by bromo-domains and independent of phosphorylation( 30 ). ERK5 is involved in development, proliferation and differentiation of the nervous and non-nervous systems ( 30 , 34 , 38 ). PTEN dephosphorylation of ERK5 directly, or upstream signaling components, could mediate NGF-driven PC12 cell differentiation. PTEN plays a repressor role in neural cell differentiation, particularly in early stage through repressing ERK5 activity, which enhances cell differentiation. We found that phosphorylation levels of Cot/Tpl2, MEKK2/3 and MEK5 did not change upon NGF induction, and were comparable between PTEN _KD and control cells. In contrast, ERK5 phosphorylation was highly sensitive to NGF induction, and more pronounced in PTEN _KD cells, implicating a direct regulation by PTEN. We were unable to detect a direct interaction between PTEN and ERK5 in WT PC12 cells. However, ERK5 is quite a large protein, making it difficult to co-precipitate with an anti-PTEN antibody. In co-immunoprecipitation experiments in PTEN _OE cells, we successfully detected a robust interaction between ERK5 and PTEN. The N-terminus of PTEN protein contains phosphatase and PBD domains, and the C-terminus consists of a C2 domain, tail, and PDZ domain( 2 ). Our experiments show that ERK5 mainly binds to the C-terminus. On the basis of this data, we surmise that direct binding of PTEN to ERK5 is necessary for PTEN to dephosphorylate ERK5, leading to ERK5 inactivation and PC12 cell differentiation repression. PTEN translocates to the nucleus where it plays a similar role in controlling Akt signaling and stabilizing chromosomes as it does in the cytoplasm during cell division( 39 ). Hence, we asked whether preventing nuclear translocation of PTEN would affect PC12 cell differentiation. In point mutation experiments, we found that K13 was more critical for nuclear import of PTEN than K289. Mono-ubiquitination at both sites has been reported to mediate PTEN nuclear translocation( 2 ). Here, we did not detect marked differences among PTEN with K13E, K289E and K13E + K289E point mutations. We speculate that endogenous PTEN able to distribute to the nucleus masks any defects on nuclear import imparted by our PTEN constructs. As a result, we also observed more subtle effects on neurite outgrowth. PTEN in nuclear properly regulates ERK5 activity by binding and dephosphorylating it, since PTEN complete loss will lead to the cell premature and failed development( 8 , 9 ). GAP43 is a well-known marker of neuronal differentiation( 40 ). Previous work found that PC12 cell differentiation is largely completed by day 6, with GAP43 expression reaching maximum levels at early time points( 27 ). Our experiments indicated that ERK5 activity was primarily regulated by PTEN, and that PTEN knock-down or ERK5 overexpression promoted cell differentiation. We also found that although onset of ERK5 phosphorylation was rapid, ERK5 phosphorylation levels abated by day 7, indicating that a transient phosphorylation phase was sufficient to initiate neuronal differentiation. Our findings with the specific ERK5 inhibitor XMD8-92 corroborated the conclusion that XMD8-92 efficiently reduced ERK5 phosphorylation and down-regulated GAP43 expression. Accordingly, XMD8-92 treatment also reduced the neurite length. The mechanism underlying ERK5 signaling pathway in cell differentiation has not been precisely known. To identify possible candidates regulated by ERK5 signaling and involved in the differentiation, we examined the expression levels of ERK5 down-stream genes using q-PCR. We assumed and tested the binding of ERK5 to the promoters of these genes, and observed that ERK5 binds to the promoter region of c-Jun . We also observed binding of ERK5 to the PML promoter region in ChIP assay. However, this interaction was less specific as we could also see a band in IgG control lane (Fig. 6 G). We did not have a more specific antibody available to distinguish these results. As an AP-1 transcriptional factor, c-Jun is involved in cell cycle progression and neuronal differentiation( 41 ). C-Jun LOF facilitated axonal regeneration after injury in neuronal cells, indicating it is likely to suppress axonal outgrowth or elongation in normal cells( 42 ). Thus, ERK5 may function to release differentiation suppression controlled by c-Jun. Taking c-Jun into a thorough consideration in this experimental system, we speculated that ERK5 may release the suppression of c-Jun and facilitates PC12 cell differentiation. Conclusion Taken together, our findings demonstrate that initiation of PC12 cell differentiation under PTEN LOF conditions is augmented by increased ERK5 phosphorylation/activity, which releases c-Jun mediated repression of PC12 cell differentiation. Neither PTEN knock-down nor ERK5 overexpression could induce PC12 cell differentiation without NGF induction. Hence we conclude that ERK5 is capable of inducing de-repression mechanisms to initiate differentiation, but further regulators are likely required to complete full differentiation. Declarations Conflict of Interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Author Contributions YA: Data curation, Formal analysis, Investigation, Validation, and Writing-original draft; SW: Data curation, Formal analysis, Investigation and Methodology; YW and YH: Data curation, Formal analysis, Validation; MX: Investigation and Methodology; YL: Validation and Methodology; XX and LS: Resources and Software; LS: Methodology; NF: Project administration; JY: Writing-review & editing; SJ: Conceptualization, Funding acquisition, Project administration, Writing-original draft and review & editing. Funding This work was supported by the National Natural Science Foundation of China (No.31371386); Natural Science Foundation of Henan Province (No.162300410042); Program for Science and Technology Development in Henan Province (No.212102310616); Innovation Project for College Students of Henan University (No.202210475039; No.202210475011). Ethics declaration It is not applicable. This research does not involve any animal and human samples. References Ji SP, Zhang Y, Van Cleemput J, Jiang W, Liao M, Li L, et al. Disruption of PTEN coupling with 5-HT2C receptors suppresses behavioral responses induced by drugs of abuse. Nature medicine. 2006, 12(3): 324-9. DOI: 10.1038/nm1349 Hopkins BD, Hodakoski C, Barrows D, Mense SM, Parsons RE. PTEN function: the long and the short of it. Trends in biochemical sciences. 2014, 39(4): 183-90. DOI: 10.1016/j.tibs.2014.02.006 Groszer M, Erickson R, Scripture-Adams DD, Lesche R, Trumpp A, Zack JA, et al. Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science. 2001, 294(5549): 2186-9. DOI: 10.1126/science.1065518 Marino S, Krimpenfort P, Leung C, van der Korput HA, Trapman J, Camenisch I, et al. PTEN is essential for cell migration but not for fate determination and tumourigenesis in the cerebellum. Development. 2002, 129(14): 3513-22. Gregorian C, Nakashima J, Le Belle J, Ohab J, Kim R, Liu A, et al. Pten deletion in adult neural stem/progenitor cells enhances constitutive neurogenesis. J Neurosci. 2009, 29(6): 1874-86. DOI: 10.1523/JNEUROSCI.3095-08.2009 Amiri A, Cho W, Zhou J, Birnbaum SG, Sinton CM, McKay RM, et al. Pten deletion in adult hippocampal neural stem/progenitor cells causes cellular abnormalities and alters neurogenesis. J Neurosci. 2012, 32(17): 5880-90. DOI: 10.1523/JNEUROSCI.5462-11.2012 Zheng H, Ying H, Yan H, Kimmelman AC, Hiller DJ, Chen AJ, et al. p53 and Pten control neural and glioma stem/progenitor cell renewal and differentiation. Nature. 2008, 455(7216): 1129-33. DOI: 10.1038/nature07443 Yue F, Bi P, Wang C, Shan T, Nie Y, Ratliff TL, et al. Pten is necessary for the quiescence and maintenance of adult muscle stem cells. Nature communications. 2017, 8: 14328. DOI: 10.1038/ncomms14328 Lee JJ, Kim BC, Park MJ, Lee YS, Kim YN, Lee BL, et al. PTEN status switches cell fate between premature senescence and apoptosis in glioma exposed to ionizing radiation. Cell Death Differ. 2011, 18(4): 666-77. DOI: 10.1038/cdd.2010.139 Dragojlovic-Munther M, Martinez-Agosto JA. Multifaceted roles of PTEN and TSC orchestrate growth and differentiation of Drosophila blood progenitors. Development. 2012, 139(20): 3752-63. DOI: 10.1242/dev.074203 Jia L, Ji S, Maillet JC, Zhang X. PTEN suppression promotes neurite development exclusively in differentiating PC12 cells via PI3-kinase and MAP kinase signaling. J Cell Biochem. 2010, 111(6): 1390-400. DOI: 10.1002/jcb.22867 Zhu G, Chow LM, Bayazitov IT, Tong Y, Gilbertson RJ, Zakharenko SS, et al. Pten deletion causes mTorc1-dependent ectopic neuroblast differentiation without causing uniform migration defects. Development. 2012, 139(18): 3422-31. DOI: 10.1242/dev.083154 Song Z, Han X, Shen L, Zou H, Zhang B, Liu J, et al. PTEN silencing enhances neuronal proliferation and differentiation by activating PI3K/Akt/GSK3beta pathway in vitro. Exp Cell Res. 2018, 363(2): 179-87. DOI: 10.1016/j.yexcr.2018.01.001 Yang T, Moore M, He F. Pten regulates neural crest proliferation and differentiation during mouse craniofacial development. Dev Dyn. 2018, 247(2): 304-14. DOI: 10.1002/dvdy.24605 Musatov S, Roberts J, Brooks AI, Pena J, Betchen S, Pfaff DW, et al. Inhibition of neuronal phenotype by PTEN in PC12 cells. Proc Natl Acad Sci U S A. 2004, 101(10): 3627-31. DOI: 10.1073/pnas.0308289101 Lei X, Jiao J. UTX Affects Neural Stem Cell Proliferation and Differentiation through PTEN Signaling. Stem Cell Reports. 2018, 10(4): 1193-207. DOI: 10.1016/j.stemcr.2018.02.008 Horita H, Wysoczynski CL, Walker LA, Moulton KS, Li M, Ostriker A, et al. Nuclear PTEN functions as an essential regulator of SRF-dependent transcription to control smooth muscle differentiation. Nature communications. 2016, 7: 10830. DOI: 10.1038/ncomms10830 Cheng P, Alberts I, Li X. The role of ERK1/2 in the regulation of proliferation and differentiation of astrocytes in developing brain. Int J Dev Neurosci. 2013, 31(8): 783-9. DOI: 10.1016/j.ijdevneu.2013.09.008 Roskoski R, Jr. ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res. 2012, 66(2): 105-43. DOI: 10.1016/j.phrs.2012.04.005 Chetram MA, Hinton CV. PTEN regulation of ERK1/2 signaling in cancer. J Recept Signal Transduct Res. 2012, 32(4): 190-5. DOI: 10.3109/10799893.2012.695798 Ji S, Doucette JR, Nazarali AJ. Sirt2 is a novel in vivo downstream target of Nkx2.2 and enhances oligodendroglial cell differentiation. Journal of molecular cell biology. 2011, 3(6): 351-9. DOI: 10.1093/jmcb/mjr009 Yang S, Qi F, Tang C, Wang H, Qin H, Li X, et al. CD147 promotes the proliferation, invasiveness, migration and angiogenesis of human lung carcinoma cells. Oncol Lett. 2017, 13(2): 898-904. DOI: 10.3892/ol.2016.5502 Mebratu Y, Tesfaigzi Y. How ERK1/2 activation controls cell proliferation and cell death: Is subcellular localization the answer? Cell Cycle. 2009, 8(8): 1168-75. DOI: 10.4161/cc.8.8.8147 Liu L, Cundiff P, Abel G, Wang Y, Faigle R, Sakagami H, et al. Extracellular signal-regulated kinase (ERK) 5 is necessary and sufficient to specify cortical neuronal fate. Proc Natl Acad Sci U S A. 2006, 103(25): 9697-702. DOI: 10.1073/pnas.0603373103 Li T, Pan YW, Wang W, Abel G, Zou J, Xu L, et al. Targeted deletion of the ERK5 MAP kinase impairs neuronal differentiation, migration, and survival during adult neurogenesis in the olfactory bulb. PLoS One. 2013, 8(4): e61948. DOI: 10.1371/journal.pone.0061948 Trotman LC, Wang X, Alimonti A, Chen Z, Teruya-Feldstein J, Yang H, et al. Ubiquitination regulates PTEN nuclear import and tumor suppression. Cell. 2007, 128(1): 141-56. DOI: 10.1016/j.cell.2006.11.040 Das KP, Freudenrich TM, Mundy WR. Assessment of PC12 cell differentiation and neurite growth: a comparison of morphological and neurochemical measures. Neurotoxicol Teratol. 2004, 26(3): 397-406. DOI: 10.1016/j.ntt.2004.02.006 Laux T, Fukami K, Thelen M, Golub T, Frey D, Caroni P. GAP43, MARCKS, and CAP23 modulate PI(4,5)P(2) at plasmalemmal rafts, and regulate cell cortex actin dynamics through a common mechanism. J Cell Biol. 2000, 149(7): 1455-72. Kaneda M, Nagashima M, Mawatari K, Nunome T, Muramoto K, Sugitani K, et al. Growth-associated protein43 (GAP43) is a biochemical marker for the whole period of fish optic nerve regeneration. Adv Exp Med Biol. 2010, 664: 97-104. DOI: 10.1007/978-1-4419-1399-9_12 Lin EC, Amantea CM, Nomanbhoy TK, Weissig H, Ishiyama J, Hu Y, et al. ERK5 kinase activity is dispensable for cellular immune response and proliferation. Proc Natl Acad Sci U S A. 2016, 113(42): 11865-70. DOI: 10.1073/pnas.1609019113 de Jong PR, Taniguchi K, Harris AR, Bertin S, Takahashi N, Duong J, et al. ERK5 signalling rescues intestinal epithelial turnover and tumour cell proliferation upon ERK1/2 abrogation. Nat Commun. 2016, 7: 11551. DOI: 10.1038/ncomms11551 Perez-Madrigal D, Finegan KG, Paramo B, Tournier C. The extracellular-regulated protein kinase 5 (ERK5) promotes cell proliferation through the down-regulation of inhibitors of cyclin dependent protein kinases (CDKs). Cell Signal. 2012, 24(12): 2360-8. DOI: 10.1016/j.cellsig.2012.08.001 Adam C, Gluck L, Ebert R, Goebeler M, Jakob F, Schmidt M. The MEK5/ERK5 mitogen-activated protein kinase cascade is an effector pathway of bone-sustaining bisphosphonates that regulates osteogenic differentiation and mineralization. Bone. 2018, 111: 49-58. DOI: 10.1016/j.bone.2018.03.020 Chen TH, Chen CY, Wen HC, Chang CC, Wang HD, Chuu CP, et al. YAP promotes myogenic differentiation via the MEK5-ERK5 pathway. FASEB J. 2017, 31(7): 2963-72. DOI: 10.1096/fj.201601090R Hoang VT, Yan TJ, Cavanaugh JE, Flaherty PT, Beckman BS, Burow ME. Oncogenic signaling of MEK5-ERK5. Cancer Lett. 2017, 392: 51-9. DOI: 10.1016/j.canlet.2017.01.034 Eggert A, Ikegaki N, Liu X, Chou TT, Lee VM, Trojanowski JQ, et al. Molecular dissection of TrkA signal transduction pathways mediating differentiation in human neuroblastoma cells. Oncogene. 2000, 19(16): 2043-51. DOI: 10.1038/sj.onc.1203518 Gomez N, Erazo T, Lizcano JM. ERK5 and Cell Proliferation: Nuclear Localization Is What Matters. Front Cell Dev Biol. 2016, 4: 105. DOI: 10.3389/fcell.2016.00105 Zou J, Pan YW, Wang Z, Chang SY, Wang W, Wang X, et al. Targeted deletion of ERK5 MAP kinase in the developing nervous system impairs development of GABAergic interneurons in the main olfactory bulb and behavioral discrimination between structurally similar odorants. J Neurosci. 2012, 32(12): 4118-32. DOI: 10.1523/JNEUROSCI.6260-11.2012 Shen WH, Balajee AS, Wang J, Wu H, Eng C, Pandolfi PP, et al. Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell. 2007, 128(1): 157-70. DOI: 10.1016/j.cell.2006.11.042 Boczek T, Ferenc B, Lisek M, Zylinska L. Regulation of GAP43/calmodulin complex formation via calcineurin-dependent mechanism in differentiated PC12 cells with altered PMCA isoforms composition. Mol Cell Biochem. 2015, 407(1-2): 251-62. DOI: 10.1007/s11010-015-2473-4 Schreiber M, Kolbus A, Piu F, Szabowski A, Mohle-Steinlein U, Tian J, et al. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev. 1999, 13(5): 607-19. Fontana X, Hristova M, Da Costa C, Patodia S, Thei L, Makwana M, et al. c-Jun in Schwann cells promotes axonal regeneration and motoneuron survival via paracrine signaling. J Cell Biol. 2012, 198(1): 127-41. DOI: 10.1083/jcb.201205025 Hadjimichael C, Chanoumidou K, Nikolaou C, Klonizakis A, Theodosi GI, Makatounakis T, et al. Promyelocytic Leukemia Protein Is an Essential Regulator of Stem Cell Pluripotency and Somatic Cell Reprogramming. Stem Cell Reports. 2017, 8(5): 1366-78. DOI: 10.1016/j.stemcr.2017.03.006 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigureslegnds.docx FigureS1.ai FigureS2.ai FigureS3.ai FigureS4.ai Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 13 Apr, 2026 Reviews received at journal 07 Apr, 2026 Reviews received at journal 05 Apr, 2026 Reviews received at journal 03 Apr, 2026 Reviewers agreed at journal 26 Mar, 2026 Reviewers agreed at journal 24 Mar, 2026 Reviewers agreed at journal 24 Mar, 2026 Reviewers agreed at journal 24 Mar, 2026 Reviewers agreed at journal 23 Sep, 2025 Reviewers agreed at journal 12 Jul, 2025 Reviewers invited by journal 07 Jul, 2025 Editor assigned by journal 01 Jul, 2025 Submission checks completed at journal 01 Jul, 2025 First submitted to journal 16 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6905743","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":482288470,"identity":"2f0912f2-978c-460e-a0fa-1e5331b39fbc","order_by":0,"name":"Weixia Dong","email":"","orcid":"","institution":"Zhengzhou Health College","correspondingAuthor":false,"prefix":"","firstName":"Weixia","middleName":"","lastName":"Dong","suffix":""},{"id":482288471,"identity":"bddea346-5031-4c40-8228-296c32de066b","order_by":1,"name":"Na Fang","email":"","orcid":"","institution":"Henan University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Fang","suffix":""},{"id":482288472,"identity":"14ccb9e8-1b9a-419c-9f2f-cc174125d56c","order_by":2,"name":"Yang An","email":"","orcid":"","institution":"Zhengzhou Health College","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"An","suffix":""},{"id":482288473,"identity":"a8de6859-fb11-4593-bbc5-cd86ce639b7e","order_by":3,"name":"Shaoping Ji","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIiWNgGAWjYDACCRBhwMDA2Mx8DCqUQLQWtjRStIABjxlxWuRnNz98XFBwx665nefbg487DjPws+cYMPzcgVuLwZ1jxsYzDJ4lNzbzbjeceeYwg2TPGwPG3jN4tEgkmEnzGBxOZmzm3SbN23aYweBGjgEzYxseh81I/wbVwvNM+i9Qiz0hLQw3csC22AG1sEkzgmyRIKAF6IxioF8OJwAD2Uyyty2dR+LMs4KDvfgdtvFxwZ/D9ob9h59J/GyzluNvT9744Cc+hwEBMxAnbmyAcHhAxAH8GiBa7OUJqRoFo2AUjIKRCwAbPE5aoOCYaAAAAABJRU5ErkJggg==","orcid":"","institution":"Zhengzhou Health College","correspondingAuthor":true,"prefix":"","firstName":"Shaoping","middleName":"","lastName":"Ji","suffix":""}],"badges":[],"createdAt":"2025-06-16 12:53:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6905743/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6905743/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86328475,"identity":"e93e61b6-e193-4e82-a72a-3b516ae568b1","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":739026,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003ePTEN\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e knock-down induced neurite outgrowth in PC12 cells.\u003c/strong\u003e(A) Expression of \u003cem\u003ePTEN\u003c/em\u003e was knocked-down through shRNA in lentivirus and examined with RT-PCR (PTEN: the stronger band with high background), and (B) Western blot analysis. (C) \u003cem\u003ePTEN\u003c/em\u003e overexpression or knocked-down (clone 1) was analyzed by Western blot analysis. (D) \u003cem\u003ePTEN\u003c/em\u003e was overexpressed (\u003cem\u003ePTEN\u003c/em\u003e_OE) or knocked-down (\u003cem\u003ePTEN\u003c/em\u003e_KD) in PC12 cells, which remained in growth culture medium. \u003cem\u003ePTEN\u003c/em\u003e_KD cells have shorter neurite outgrowth compared with control cells or \u003cem\u003ePTEN\u003c/em\u003e_OE cells. CT: control cells, no treatment; EV: empty vector; OE: overexpression; KD: knock-down.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/a7daee98c239c241adc5d737.png"},{"id":86328470,"identity":"e895f7fe-d695-400a-8067-6fe4676f2a1f","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2017504,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePTEN binds to and dephosphorylates ERK5.\u003c/strong\u003e (A) Phosphorylation of TrkA, Akt, JNK, ERK1/2, p38 and ERK5 was induced by NGF in \u003cem\u003ePTEN\u003c/em\u003e_KD or control PC12 cells. The change of ERK5 phosphorylation level is even higher than Akt and ERK1/2. (B) Phosphorylation levels of each molecule involved in the ERK5 signaling pathway was examined with NGF stimulation. The results indicated that only the ERK5 phosphorylation level has a significant change. (C) Immuno-precipitation with anti-ERK5 antibody was performed in \u003cem\u003ePTEN\u003c/em\u003e_OE PC12 cells or the intact cells. PTEN was remarkably detected in the complex precipitated from \u003cem\u003ePTEN\u003c/em\u003e_OE PC12 cells, and little was detected or was not visible from the intact cells (data not shown). (D) In contrast, ERK5 was detected in the complex precipitated from \u003cem\u003ePTEN\u003c/em\u003e_OE PC12 cells, but it is not detected in the intact cells. (E) GST-PTEN and GST alone were expression in E.coli and purified with glutathione-resin beads. (F) Pull-down assay and western blot analysis with anti-ERK5 antibody were performed with purified GST-PTEN and GST on the glutathione-resin beads. (G) PTEN-amino terminus, and-carboxyl terminus fused with GST or GST alone were expressed and purified. (H) Similarly, another pull-own and western blot analysis were performed with GST-PTEN amino terminus, carboxyl terminus and GST, and complex was analyzed with anti-ERK5 antibody.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/4e4430c3f1cf11be770db6e2.png"},{"id":86328665,"identity":"9b6ca227-971d-45ea-821a-b8015e743e59","added_by":"auto","created_at":"2025-07-09 11:36:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1929374,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePTEN down-regulated ERK5 phosphorylation and suppressed GAP43 expression or neurite outgrowth in cytoplasm and nucleus.\u003c/strong\u003e (A) The ability of K13 and K289 of PTEN to mediate PTEN importing nucleus through mono-ubiquitination was confirmed with mutation of K13E, K289E or K13E+K289Ein HEK293T cells. The empty vector and PTEN WT (wild type) act as control. (B) K13E alone and K13E+K289E were further confirmed in the transfection of PC12 cells with DAPI staining. (C) Different mutation of \u003cem\u003ePTEN\u003c/em\u003e plus control were transfected into PC12 cells, and nuclei were isolated from cytoplasm. ERK5 and phosphorylated ERK5 were detected from nuclei and cytoplasm respectively. (D) Cells transfected with different mutation of \u003cem\u003ePTEN\u003c/em\u003e were induced to differentiate by NGF and the ratio of the differentiated cells were measured (n=3). (E) Effects of \u003cem\u003ePTEN\u003c/em\u003eoverexpression (OE) or knock-down (KD) on ERK5 phosphorylation and GAP43 expression level were examined with specific antibodies in western blot analysis.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/b20573b119ad4297bd09df45.png"},{"id":86328472,"identity":"c29344bd-9d72-472b-8e84-cfff593f93ac","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1973754,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of ERK5 on GAP43 expression and cell differentiation.\u003c/strong\u003e (A) Expression levels of ERK5 mediated by lentivirus for OE and KD were detected by western blot analysis. (B) PC12 cell shapes were photographed with \u003cem\u003eERK5\u003c/em\u003e_OE, \u003cem\u003eERK5\u003c/em\u003e_KD or the control. ERK5 facilitated neurite outgrowth in PC12 cells without NGF stimulation. (C) GAP43 expression was detected by western blot analysis in the PC12 cells with \u003cem\u003eERK5\u003c/em\u003e_OE, control cells or \u003cem\u003eERK5\u003c/em\u003e_KD under NGF stimulation. \u003ca href=\"https://www.thesaurus.com/browse/apart%20from\"\u003eApart from\u003c/a\u003e GAP43 (D), expression of TrkA/NGFR (E), Nestin (F) and Tubb3 (G) in mRNA levels withalteration of ERK5 expression level were measured in q-PCR. (H) PC12 cells were photographed under NGF stimulation for 5 days with the alteration of ERK5 expression level. (I) The differentiated ratio of PC12 cells was measured with the alteration of ERK5 expression level under NGF stimulation. (J) Effects of ERK5 on PC12 cell proliferation were measured by the cell number counting. CT: control cells, no treatment; EV: empty vector; OE: overexpression; KD: knock-down.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/26d13b2f8cba293e6968ec31.png"},{"id":86328474,"identity":"d24b0561-0694-48cc-87c2-b7f705da2dc1","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1324275,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERK5 inhibitor XMD8-92suppressed ERK5 activity and PC12 differentiation.\u003c/strong\u003e (A) Effects of ERK5 inhibitor XMD8-92 on ERK5 phosphorylation level, which was measured by western blot analysis at different time points and (B) the phosphorylation level was quantified (n=3). (C) Effects of XMD8-92 on ERK5 activity/phosphorylation and GAP43 expression under NGF stimulation for 1-5 days were measured by western blot analysis, and (D) data were quantified (n=3). (E) Ratio of the differentiated cell to total cells was determined, and (F) the induced differentiation cells were photographed. CT: control cells, no treatment; DMSO: solvent control.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/f38a9c611cf32fb7be7d1b2f.png"},{"id":86328482,"identity":"cf569905-c87e-48ef-a034-e000afe802ef","added_by":"auto","created_at":"2025-07-09 11:28:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":828237,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERK5 enhances PC12 cell differentiation probably through suppressing c-Jun expression.\u003c/strong\u003e The mRNA expression of GAP43 (A), TrkA (B), Tubb3 (C) and Nestin(D) with XMD8-92 treatment under NGF stimulation were measured by quantitative RT-PCR. (E) mRNA expression levels of gene CREB, cyclin D1, FoxO3, c-Jun, Hif1a, Twist1, PML, NFkB, c-Fos and c-Myc were measured by quantitative RT-PCR. (F) To perform chromatin immunoprecipitation, two pairs of primers for each gene were tested for three times to optimize the primers for the following experiments. (G) Chromatin immunoprecipitation was performed in PC12 cells under NGF stimulation with anti-ERK5 antibody and IgG was taken as control. (H) Cultured PC12 cells with or without NGF stimulation, as well as with \u003cem\u003eERK5\u003c/em\u003e_OE or \u003cem\u003eERK5\u003c/em\u003e_KD were examined for c-Jun and PML expression in mRNA levels.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/bec5397c552594e8114ba945.png"},{"id":86328737,"identity":"0afc6f3b-89c3-4fcc-8554-afb67a7c24b3","added_by":"auto","created_at":"2025-07-09 11:36:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10399806,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/22b22de2-a864-422b-b7ed-7ec3d3ed9251.pdf"},{"id":86328666,"identity":"e640cbbe-b92b-4400-9ca6-775528ed519d","added_by":"auto","created_at":"2025-07-09 11:36:09","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":26724,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigureslegnds.docx","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/c3dbf0f2d3e8865e6f3183a8.docx"},{"id":86328478,"identity":"d73216bc-ff94-454a-8b90-db588bb1c0c6","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"ai","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1847896,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.ai","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/cb6e3ab0a26937c2d6930ed7.ai"},{"id":86328471,"identity":"0f313d9b-671e-4e91-a25d-14bd11a594e2","added_by":"auto","created_at":"2025-07-09 11:28:08","extension":"ai","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":4070115,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.ai","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/60f1cf56583b5368fd399715.ai"},{"id":86328489,"identity":"04b5438d-ad5a-4602-b3ef-9d692ebb5580","added_by":"auto","created_at":"2025-07-09 11:28:09","extension":"ai","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2027600,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.ai","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/86478b4dabb0133652527705.ai"},{"id":86328485,"identity":"09336b83-632e-4ca4-af61-542109829e44","added_by":"auto","created_at":"2025-07-09 11:28:09","extension":"ai","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1814513,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.ai","url":"https://assets-eu.researchsquare.com/files/rs-6905743/v1/0e5be056c4eeab13199c15a7.ai"}],"financialInterests":"No competing interests reported.","formattedTitle":"PTEN Defect Facilitates Neuronal Cell Differentiation via ERK5 Activation","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePTEN is a classical tumor suppressor that inhibits the PI3K/AKT/mTOR pathway to repress cell growth and proliferation(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). As a dual-function enzyme with both lipid and protein phosphatase activity, PTEN converts phosphatidylinositol (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e)-trisphosphate (PIP3) to phosphatidylinositols-4,5-bisphosphate PIP2, but also catalyzes dephosphorylation of certain proteins(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). In the developing nervous system, \u003cem\u003ePTEN\u003c/em\u003e deletion increases proliferation of neuronal stem and progenitor cells, resulting in increased brain size and defective layer formation in the cortex, hippocampus and cerebellum, possibly as a result of defective migration(\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). In the adult brain, PTEN similarly control the neural stem cell self-renewal(\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). Whether and how PTEN is capable of directing cellular differentiation is less clear.\u003c/p\u003e\u003cp\u003eCombined p53 and PTEN LOF results in a heightened c-Myc signature that prevents differentiation of both neural stem cells and glioma stem cells in mice(\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). In quiescent muscle stem cells, PTEN LOF leads to premature differentiation in the absence of proliferation(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Deletion of \u003cem\u003ePTEN\u003c/em\u003e in other cellular populations can result in premature differentiation, and even premature senescence(\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e), suggesting that PTEN, beyond is well established role in cell growth and proliferation, also plays a role in cell differentiation, and that these processes are likely to be interconnected.\u003c/p\u003e\u003cp\u003eWe and others previously reported that \u003cem\u003ePTEN\u003c/em\u003e inactivation or knock-down with shRNA promoted neurite outgrowth in PC12 cells(\u003cspan additionalcitationids=\"CR12 CR13\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Conversely, \u003cem\u003ePTEN\u003c/em\u003e overexpression inhibited neuronal cell differentiation and rescued impaired brain development in mice lack the histone demethylase Utx(\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). Furthermore, PTEN has been reported to regulate organ-derived cell differentiation(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). PTEN was also reported to directly interact with serum response factor in the nucleus to promote expression of smooth muscle specific genes in a phosphatase-independent manner(\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn the present study, we created PC12 models with knockdown and overexpression of \u003cem\u003ePTEN\u003c/em\u003e (\u003cem\u003ePTEN\u003c/em\u003e_KD and \u003cem\u003ePTEN\u003c/em\u003e_OE) to investigate cellular mechanisms of PTEN-dependent differentiation. We discovered that NGF stimulation in \u003cem\u003ePTEN\u003c/em\u003e_KD PC12 cells increased phosphorylation levels of ERK5 (in addition to well documented effectors Akt and ERK1/2(\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e)) and surmised that ERK5 might be a novel PTEN target. To investigate this hypothesis, we created and characterized \u003cem\u003eERK5\u003c/em\u003e_KD and \u003cem\u003eERK5\u003c/em\u003e_OE PC12 models in the NGF-induced PC12 differentiation paradigm.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMaterials\u003c/h2\u003e\u003cp\u003eThe PC12 cell line was purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA). Poly-D-lysine was purchased from Sigma (St. Louis, MO, USA). Cell culture medium RPMI-1640, horse serum and fetal bovine serum were purchased from Gibco (ThermoFisher Scientific inc. TMO: New York). Nerve growth factor (NGF) was purchased from Sino Biological (Beijing, China). Vector pcDNA3.1(+) and lipofectamine 2000 were purchased from Invitrogen (ThermoFisher Scientific, Inc., Waltham, MA, USA). Vectors pEGFP-N1 and pIRES2-EGFP were purchased from Clontech (Mountain View, CA, USA). Lentiviral vectors used for overexpression of human \u003cem\u003ePTEN\u003c/em\u003e or \u003cem\u003eERK5\u003c/em\u003e gene were purchased from GenePharma Co., Ltd. (Shanghai, China). Vector T-easy was purchased from Promega (Madison, WI, USA). Trizol reagent, reverse transcriptase kit and SYBR Green I mix were purchased from Takara Bio Inc. (Kusatsu, Japan).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eCell culture and induction of differentiation\u003c/h3\u003e\n\u003cp\u003ePC12 cells were maintained in poly-D-lysine coated dishes with RPMI-1640 medium containing 10% horse serum and 5% fetal bovine serum in 5% CO2 at 37\u0026deg;C. Differentiation of PC12 cells were induced by NGF using previously reported protocol(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Cells were plated in 6-cm dishes at low density prior to induction. To induce differentiation, cells were cultured in RPMI-1640 medium supplemented with 50 ng/ml of NGF, and fresh medium containing NGF was changed every other day. At day 1, 3, 5, the cells were photographed, and total RNA or proteins were subsequently extracted from differentiated PC12 cells. The differentiation maturity was identified by measuring the number of neurite-bearing cells as described previously(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Cells with processes of at least two cell body lengths were defined as neurite-bearing cells. Number of neurite-bearing cells was measured using an Image-Pro Plus software 3\u0026times;10 random cells from three visual fields. The cell shape was observed and photographed under a microscope.\u003c/p\u003e\n\u003ch3\u003eDNA construction, cell transfection and infection\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003ePTEN\u003c/em\u003e and \u003cem\u003eERK5\u003c/em\u003e CDS regions were PCR amplified using gene-specific primers, cloned into T-easy vector, verified by DNA sequencing, and then cloned into protein expression vectors. HEK293T or PC12 cells were transfected with the pEGFP-N1-PTEN or pIRES2-EGFP-ERK5 plasmids using lipofectamine 2000 according to the manufacturer\u0026rsquo;s instructions. PC12 cells were infected with \u003cem\u003ePTEN\u003c/em\u003e or \u003cem\u003eERK5\u003c/em\u003e overexpression or knock-down lentivirus constructed and packed by GenePharma Co., Ltd. (Shanghai, China), in which GFP expression was independently driven by another EF1α promoter. After 60 h, cells were selected with 2 \u0026micro;g/ml puromycin. Two weeks later, positive cell clones with stably integrated \u003cem\u003ePTEN\u003c/em\u003e or \u003cem\u003eERK5\u003c/em\u003e or their control shRNA were obtained.\u003c/p\u003e\u003cp\u003eFor \u003cem\u003ePTEN\u003c/em\u003e mutation assay, \u003cem\u003ePTEN\u003c/em\u003e K13E, K289E and K13E\u0026thinsp;+\u0026thinsp;K289E mutants were constructed by fusion PCR using the primers containing specific point mutation, respectively. All the constructions were verified by DNA sequencing, and then the cDNAs were cloned into the expression vector pEGFP-N1. The forward and reverse primer sequences for fusion PCR were: 5\u0026rsquo;-ATGACAGCCATCATCAAAGAG-3\u0026rsquo; and 5\u0026rsquo;-GCGACTTTTGTAATTTGTGTATG-3\u0026rsquo;; for K13E mutant, 5\u0026rsquo;-CCGCTCGAGATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACGAAAGGAGATATCA-3\u0026rsquo;; for K289E mutant, 5\u0026rsquo;-GACCAGAGGAAACCTCAGAAGAAGTAGAAAATGGAAGTCT-3\u0026rsquo;; for K13E\u0026thinsp;+\u0026thinsp;K289E mutant, fusion PCR was performed using K13E and K289E mutant cDNAs as templates.\u003c/p\u003e\n\u003ch3\u003eGST fusion protein expression and purification\u003c/h3\u003e\n\u003cp\u003eTo clone rat PTEN CDS into vector pGEX-6P-1, primers are forward: 5\u0026rsquo;-GGATCCatgacagccatcatcaaagag-3\u0026rsquo; and reverse: 5\u0026rsquo;-GAATTCtcagacttttgtaatttgtga-3\u0026rsquo; with restriction enzyme sites BamHI and EcoRI. To clone PTEN-N-terminus (1-185aa), primers are 5\u0026rsquo;-GGATCCatgacagccatcatcaaagag-3\u0026rsquo; and 5\u0026rsquo;-GAATTCgtaatccaggtgattctttaa-3\u0026rsquo;. To clone PTEN-C-terminus (186-403aa), primers are 5\u0026rsquo;-GGATCCagaccagtggcactgttgttt-3\u0026rsquo; and 5\u0026rsquo;-GAATTCtcagacttttgtaatttgtga-3\u0026rsquo;. The PCR products, which were purified in agarose gel, were subsequently cloned into pGEX-6P-1. Induction expression of the fusion protein was performed as described in a regular protocol of GST fusion protein.\u003c/p\u003e\n\u003ch3\u003eQuantitative RT-PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from the PC12 cells using the Trizol reagent, and cDNA was synthesized using the reverse transcriptase kit by which the genome DNA was removed before reverse transcription according to the manufacturer\u0026rsquo;s protocol. The forward and reverse primers sequences respectively were: \u003cem\u003eTwist1\u003c/em\u003e, 5\u0026rsquo;-CGGACAAGCTGAGCAAGATT-3\u0026rsquo; and 5\u0026rsquo;-CCTTCTCTGGAAACAATGAC-3\u0026rsquo;; \u003cem\u003ec-Fos\u003c/em\u003e, 5\u0026rsquo;-AGCGCCCCATCCTTACGG-3\u0026rsquo; and 5\u0026rsquo;-CTTGGAGCGTATCTGTCAG-3\u0026rsquo;; \u003cem\u003eCREB\u003c/em\u003e, 5\u0026rsquo;-ATTCGCACAGCACCCACTA-3\u0026rsquo; and 5\u0026rsquo;-CTGCCACTCTGTTCTCTAAA-3\u0026rsquo;; \u003cem\u003ec-Myc\u003c/em\u003e, 5\u0026rsquo;-GCTGCTGTCCTCCGAGTC-3\u0026rsquo; and 5\u0026rsquo;-TGGAGCATTTGCGGTTGTTG-3\u0026rsquo;; \u003cem\u003eCyclin D1\u003c/em\u003e, 5\u0026rsquo;-CGCCCTCCGTTTCTTACTT-3\u0026rsquo; and 5\u0026rsquo;-GGGAATGGTCTCCTTCATCT-3\u0026rsquo;; \u003cem\u003ec-Jun\u003c/em\u003e, 5\u0026rsquo;-GGGCACATCACCACTACAC-3\u0026rsquo; and 5\u0026rsquo;-AAGTTGCTGAGGTTGGCGTA-3\u0026rsquo;; \u003cem\u003eHif1a\u003c/em\u003e, 5\u0026rsquo;-GAGCCTAACAGTCCCAGTG-3\u0026rsquo; and 5\u0026rsquo;-CGGTGGCAGTGACAGTGAT-3\u0026rsquo;; \u003cem\u003ePML\u003c/em\u003e, 5\u0026rsquo;-TGTGGCAAGTGCTTTGATGC-3\u0026rsquo; and 5\u0026rsquo;-CCTCCAGAGCCTGCGTCAT-3\u0026rsquo;; \u003cem\u003eFoxO3\u003c/em\u003e, 5\u0026rsquo;-TCGCAACGACCCAATGATGT-3\u0026rsquo; and 5\u0026rsquo;-CCCATGACGGGAAGGTTTG-3\u0026rsquo;; \u003cem\u003eNF-kB\u003c/em\u003e, 5\u0026rsquo;-ACACGGGACCAGGAACAG-3\u0026rsquo; and 5\u0026rsquo;-ACACGGGACCAGGAACAG-3\u0026rsquo;. Quantitative RT-PCR was performed on a PikoReal\u0026reg;480 Real-Time PCR System (Thermo Fisher Scientific, Inc., Waltham, MA, USA) using SYBR Green I mix according to the manufacturer\u0026rsquo;s instructions. The results were normalized to GAPDH or β-actin.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eWestern blotting\u003c/h2\u003e\u003cp\u003eThe total proteins were extracted from the PC12 cells using RIPA lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 mM EDTA) supplemented with protease and phosphatase inhibitor cocktail (Bimake, Shanghai, China) as described previously(\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). After SDS-PAGE separation, the proteins were transferred to PVDF membranes. The primary antibodies used for Western blotting included anti-PTEN (#9188), anti-ERK5 (#3372), anti-p-ERK5 (#3371), anti-ERK1/2 (#4695), anti-p-ERK1/2 (#4370), anti-p38 (#4511), anti-p-p38 (#9212), anti-JNK (#9252), anti-p-JNK (#4668), anti-Akt (#9272), anti-p-Akt (#4060), anti-Tpl2 (#71184), anti-p-Tpl2 (#4491), anti-GAPDH (#2118), anti-LaminB (#13435) (Cell Signaling Technology, Inc., Danvers, MA, USA), anti-MEK5 (ab210748), anti-p-MEK5 (ab254134), anti-TrkA (ab109010) and anti-p-TrkA (ab197071) (Abcam, Cambridge, UK), anti-GAP43 (PA5-34943) (Thermo Fisher Scientific, Inc.), and anti-β-actin (AF5001) and anti-β-tubulin (AF1216) (Beyotime Biotechnology, Haimen, China). The membranes were incubated with primary antibodies in TBST (Tris buffered saline with Tween-20) buffer with 5% skim milk or 3% BSA at 4℃ overnight. The secondary antibodies were incubated in the presence of 5% skim milk at room temperature for 2 hr. The membranes were then visualized with chemiluminescence. To reuse the membranes with different antibodies, the membranes were stripped with a stripping buffer (65 mM Tris\u0026ndash;HCl, 2% SDS, 100 mM β-mercaptoethanol, pH 6.8) at 60℃for 30 min with a gentle agitation.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eIsolation of nuclei from cytoplasm\u003c/h3\u003e\n\u003cp\u003ePC12 cells were transfected with the wild type (WT), K13E, K289E and K13E\u0026thinsp;+\u0026thinsp;K289E mutant \u003cem\u003ePTEN\u003c/em\u003e and blank plasmids, respectively. The nuclei were isolated from cytoplasm according to manufacturer\u0026rsquo;s instruction (Thermo Fisher Scientific, Inc.). In brief, 5x10\u003csup\u003e6\u003c/sup\u003e cells were shoveled off with a cell shovel and washed twice with cold PBS (0.8% NaCl, 0.02% KCl, 0.144% Na2HPO4, 0.024% KH2PO4, pH 7.4) buffer. The cell pellet was collected into a microcentrifuge tube, re-suspended in 500 \u0026micro;l CER I reagent and incubated on ice for 15 min. Then 27.5 \u0026micro;l CER II reagent was added and mixed in the microcentrifuge tube. The sample was centrifuged at 12,000 g and 4\u0026deg;C for 5 min. The supernatant contains the cytoplasmic fraction and the pellet is the nuclear fraction. The two fractions were processed as protein samples described above.\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003eFor immunofluorescence assay, PC12 cells were fixed with 4% paraformaldehyde for 15 min, and then the fixed cells were washed 3 times with PBS. After washing, the cells were treated with 0.3% Triton X-100 for 10 min, and the permeated cells were washed as described above in PBS The cells were incubated with blocking buffer (2% BSA in PBS) for 30 min and subsequently with the primary antibody (anti-GAP43) and Alexa Fluor\u0026trade; 555-labeled secondary antibody (Thermo Fisher Scientific, Inc.) in blocking buffer for 1 h. Cells were stained with DAPI (Beyotime Biotechnology, Shanghai, China), then the fluorescence was observed and photographed under a fluorescence microscope.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eGST-pull down assay\u003c/h2\u003e\u003cp\u003eGlutathione S-transferase (GST)-PTEN or GST-PTEN-N/C terminus fusion protein was produced in E. coli BL21 strain and purified by glutathione beads. To perform the pulldown assay, the cells were transfected with ERK5 plasmids to overexpress ERK5. After 48 h, the purified GST-PTEN, GST-PTEN-N or GST-PTEN-C bound to agarose beads were incubated with the cell lysate (ERK5-overexpressed) at 4\u0026deg;C overnight. After washing the beads 4 times with RIPA buffer, the pellet complex was isolated by boiling beads in 2\u0026times; SDS-loading buffer for 10 min and subjected to Western blot analysis using previously reported protocol(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eCo-immunoprecipitation assay\u003c/h2\u003e\u003cp\u003eCo-immunoprecipitation (co-IP) was performed as previously reported(\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The cells were overexpressed with PTEN and lysed in ice-cold RIPA buffer supplemented with protease inhibitor cocktail (Bimake, Shanghai, China). After pre-clearing with protein A/G beads, the supernatant of cell lysate was incubated with anti-PTEN or anti-ERK5 antibody or normal IgG as control at 4\u0026deg;C overnight. Subsequently, the samples were incubated with protein A/G sepharose beads (Santa Cruz Biotechnology, CA, USA) for 2 hours at 4\u0026deg;C. The precipitated complex was collected by centrifugation at 12,000g for 10 min and then washed 4 times with RIPA buffer. The pellet was re-suspended and boiled in 2\u0026times; SDS-loading buffer to extract the co-precipitated proteins. The samples were subjected to Western blotting.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eChIP assay\u003c/h2\u003e\u003cp\u003eFor chromatin immunoprecipitation (ChIP) assay, PC12 cells were cultured in 10 cm dishes. Formaldehyde (37%) was added to medium to a final concentration of 1% and incubated at room temperature for 10 min. Then, 1.25 M glycine was added to the dishes with a final concentration of 125 mM and incubated for 5 min. Cells were scraped and collected by centrifugation at 1000 g for 5 min at 4\u0026deg;C. Cell pellets were re-suspended in lysis buffer (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 1% Triton X-100, 0.1% Sodium deoxycholate, 0.1% SDS) containing protease inhibitor. The isolated chromatin was sheared by sonication (80 W, 10 s) to an average size of 200\u0026ndash;1000 bp, then centrifuged at 8000 g and 4\u0026deg;C for 30 sec, and the supernatant is transferred to a new centrifuge tube. After pre-clearing with protein A/G beads, the DNA-protein complex was precipitated by being incubated with anti-ERK5 antibody at 4\u0026deg;C overnight. The DNA was extracted by phenol-chloroform and used as a template for PCR. Respectively, the forward and reverse primers used were: \u003cem\u003ec-Jun\u003c/em\u003e, 5\u0026rsquo;-TATGGAGCGGAGTCACAAGA-3\u0026rsquo; and 5\u0026rsquo;-GGGATGAGAAGGGAGCAG-3\u0026rsquo;; \u003cem\u003ePML\u003c/em\u003e, 5\u0026rsquo;-AAGCCCAGCAGGGACACA \u0026minus;\u0026thinsp;3\u0026rsquo; and 5\u0026rsquo;- TAACGCTACAACTGAAGAGTA \u0026minus;\u0026thinsp;3\u0026rsquo;; \u003cem\u003eCREB\u003c/em\u003e, 5\u0026rsquo;-GGGGTTTCCAGCAAGTCC-3\u0026rsquo; and 5\u0026rsquo;- AACGGTCCTATCCTCGCTAT-3\u0026rsquo;; \u003cem\u003eFoxO3\u003c/em\u003e, 5\u0026rsquo;-TGCGATTCCAGAGTGTGTGA-3\u0026rsquo; and 5\u0026rsquo;- CCGGGAGTGCTGCTGTGC-3\u0026rsquo;; \u003cem\u003ec-Myc\u003c/em\u003e, 5\u0026rsquo;-GCTCCACAGGGGCAAAGA \u0026minus;\u0026thinsp;3\u0026rsquo; and 5\u0026rsquo;- CCCGTTCGGACCTTCCAC \u0026minus;\u0026thinsp;3\u0026rsquo;; \u003cem\u003eTwist1\u003c/em\u003e, 5\u0026rsquo;-TGTGGTCATTGTCTCTGGAT-3\u0026rsquo; and 5\u0026rsquo;- CGGAAACGCTGGGGTGTG-3\u0026rsquo;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eRT-PCR\u003c/h2\u003e\u003cp\u003eRT-PCR was performed to measure mRNA levels of c-Jun and PML with ERK5 overexpression or knockdown in PC12 cells. The total RNA was isolated as described above in Quantitative RT-PCR. PCR primers for rat c-Jun are forward: 5\u0026rsquo;-ctgcaggcgctgaaggaagag-3\u0026rsquo; and reverse: 5\u0026rsquo;- tcaaaacgtttgcaactgctg-3\u0026rsquo;; and primers for rat PML are forward: 5\u0026rsquo;-cagtgctttgcttccctgcag-3\u0026rsquo; and reverse: 5\u0026rsquo;-ctaggccaggcatcccttatt-3\u0026rsquo;. PCR condition was set as 94℃for 30 sec, 60℃for 40 sec, and 72℃ for 60 sec. The PCR products were analyzed by agarose gel.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eGrowth curve\u003c/h2\u003e\u003cp\u003eTo draw the cell growth curve, PC12 cells (ERK5_OE or ERK5_KD) were cultured in 24-well plates (5\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well), and the medium was changed every two days. Cells were trypsinized and counted using an automatic cell counter (Countstar\u0026reg;; Ruiyu Biotech, Shanghai, China) on days 1 to 5. Cell counts were recorded to draw the growth curves using GraphPad Prism 7 software (GraphPad Software, Inc., La Jolla, CA, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eXMD8-92 treatment\u003c/h2\u003e\u003cp\u003eAs an inhibitor of ERK5, XMD8-92 can inhibit the activity of ERK5 and decrease p-ERK5 level. To determine the optimal time for XMD8-92 treatment, PC12 cells were seeded in 6-well plates and treated with 20 \u0026micro;M XMD8-92 (Bimake, Shanghai, China) with DMSO (Sigma, St. Louis, MO, USA) as a solvent control. The total proteins were extracted from the cells at 10 min, 1 h, 2 h, 24 h and 48 h after inhibitor treatment. To determine the optimal concentration for XMD8-92 treatment, PC12 cells were treated with XMD8-92 in various concentrations (1 \u0026micro;M, 5 \u0026micro;M, 10 \u0026micro;M and 20 \u0026micro;M) for 48 h, and the total proteins were extracted. Then, the p-ERK5 level was measured by Western blotting to observe the inhibitory effect of XMD8-92. For cell differentiation, PC12 cells were treated with 20 \u0026micro;M XMD8-92 or DMSO and then added with NGF to induce cell differentiation as described above in \u0026lsquo;Cell culture and induction of differentiation\u0026rsquo;. The medium supplemented with XMD8-92 or DMSO plus NGF was changed every other day. At day 1, 3, 5, 7, total RNA and proteins were extracted from differentiated PC12 cells to measure the level of differentiation marker GAP43, and cells were photographed to identify the differentiation maturity.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was performed by GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA) and exhibited as means\u0026thinsp;+\u0026thinsp;SD of three separate experiments. The significance was assessed by t-test, and p value less than 0.05 was considered statistically significant (* p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003ePTEN knockdown facilitates neurite growth\u003c/h2\u003e\u003cp\u003ePC12 cell line is an ideal model for studying the differentiation of neuronal cells. To study PTEN gain and loss of function, we infected PC12 cells with lentivirus overexpressing or knock-down of \u003cem\u003ePTEN\u003c/em\u003e under antibiotic selection. Four knockdown and three overexpression islets were isolated and evaluated relative to infected control intact PC12 cells, resulting in verification of two representative PC12 cell strains with stable \u003cem\u003ePTEN\u003c/em\u003e knockdown (\u003cem\u003ePTEN\u003c/em\u003e_KD) and one strain with stable \u003cem\u003ePTEN\u003c/em\u003e overexpression (\u003cem\u003ePTEN\u003c/em\u003e_OE). Expression levels of mRNA and protein were measured by RT-PCR and Western blot, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and B). PTEN expression was efficiently knocked down or overexpressed in PC12 cells as demonstrated by Western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Subsequently, control and stable transfected cells were cultured in regular medium in the absence of NGF. Consistent with earlier work, we observed neurite growth in stable \u003cem\u003ePTEN\u003c/em\u003e_KD cells but not in \u003cem\u003ePTEN\u003c/em\u003e_OE or control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). We also verified that \u003cem\u003ePTEN\u003c/em\u003e overexpression inhibited cell proliferation while its knockdown increased cell proliferation (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eOutgrowth induced by PTEN knockdown may involve ERK5\u003c/h2\u003e\u003cp\u003eWe next examined whether phosphorylation levels of TrkA, MAPKs and Akt were altered in \u003cem\u003ePTEN\u003c/em\u003e_KD cells, as such changes might be mechanistically linked with PTEN mediated regulation of neurite outgrowth. To this end, we pulsed intact PC12 cells or \u003cem\u003ePTEN\u003c/em\u003e_KD cells with NGF for up to 10 min in serum-free media and analyzed phosphorylation levels of TrkA, MAPKs and Akt with phosphorylation-specific antibodies. The results showed that phosphorylation levels of ERK5 and ERK1/2 were significantly increased in 5 min of NGF stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Considering that ERK1/2 is known to be primarily involved in cell proliferation and growth(\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e), we elected to focus on ERK5, which has been reported to regulate neuronal differentiation and development(\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003ePTEN directly dephosphorylates and interacts with ERK5\u003c/h2\u003e\u003cp\u003eWe first asked whether upstream known regulators MEK5 and MEKK2/3, and potential regulator Cot/Tpl2, in the ERK5 signaling pathway were dephosphorylated by PTEN. To this end, we examined phosphorylation levels of Cot/Tpl2, MEKK2/3 and MEK5 in \u003cem\u003ePTEN\u003c/em\u003e_KD cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, \u003cem\u003ePTEN\u003c/em\u003e knockdown did not affect phosphorylation levels of Cot/Tpl2 and MEK5. Unfortunately, in our hands, the signal from the anti-phospho-MEKK2/3 antibody was not sufficiently specific to allow us to draw conclusions about MEKK2/3 regulation. However, phosphorylation levels of ERK5 were remarkably increased compared with levels in intact PC12 cells under NGF stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). This data suggests that PTEN is likely to dephosphorylate ERK5 directly. To probe whether PTEN directly interacts/associates with ERK5, we performed co-immunoprecipitation with normal IgG as a control in lysates from \u003cem\u003ePTEN\u003c/em\u003e_OE cells. Compared to control IgG, we detected PTEN in the complex precipitated by the anti-ERK5 antibody, whereas little PTEN was detected from intact PC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Because ERK5 was only detected in immuno-precipitates from \u003cem\u003ePTEN\u003c/em\u003e_OE cells, but not in intact PC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), we surmised that the interaction between PTEN and ERK5 might be weak and can only be detected with \u003cem\u003ePTEN\u003c/em\u003e overexpression.\u003c/p\u003e\u003cp\u003eWe next investigated which domain of PTEN is involved in the interaction with ERK5. PTEN has a protein binding domain (PBD) and a phosphatase domain (1-185aa) at the N-terminus. At its C-terminus, PTEN has a C2 domain (which targets proteins to cell membranes), a Tail domain (believed to regulate substrate specificity) and a PDBAD domain (186-403aa). We created and overexpressed full-length PTEN and Glutathione S-transferase (GST)-fused N-terminus and C-terminus PTEN domains in E.coli BL21 cells, respectively. We then used purified fusion proteins and GST to pull-down ERK5 from PC12 cells, followed by Western blot analysis of pull-down complexes. Although both GST-PTEN and GST were purified to reasonable purity (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), ERK5 was only pulled down by GST-PTEN from the PC12 cell lysate (and not by GST or glutathione Sepharose 4B beads which capture GST or GST-fusion proteins) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Purified GST-fused PTEN C-terminus (186-403aa) was mainly able to pull down ERK5 from PC12 cell lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). This data reveals that ERK5 appears to primarily bind to the PTEN-C-terminus, which play a critical role in reaction with other proteins, probably the PTEN N-terminus was associated with little ERK5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eH).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003ePreventing PTEN nuclear translocation represses neurite outgrowth\u003c/h2\u003e\u003cp\u003eMono-ubiquitination of PTEN at K13 (lysine 13) or K289 (lysine 289) is known to facilitate PTEN translocation into the nucleus, where PTEN acts to repress AKT signaling (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). To evaluate whether nuclear translocation of PTEN is critical to regulate neurite outgrowth in PC12 cells, we replaced the K13 and K289 of PTEN with glutamic acid residues (E by mutagenesis through an overlap extension PCR). We found that the K13 residue played a stronger role than the K289 residue in nuclear importation of PTEN in both HEK293T and PC12 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Subsequently, we examined effects of wild-type (WT) and mutated \u003cem\u003ePTEN\u003c/em\u003e on ERK5 phosphorylation within nuclei using Western blotting. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, both K13E-\u003cem\u003ePTEN\u003c/em\u003e and K13E\u0026thinsp;+\u0026thinsp;K289E-\u003cem\u003ePTEN\u003c/em\u003e transfection caused up-regulation of nuclear ERK5 phosphorylation and down-regulation of cytoplasmic ERK5 phosphorylation compared to WT PTEN (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). This data suggests PTEN is capable of dephosphorylating ERK5 in the nucleus. PC12 cell differentiation can be evaluated by quantification of neurite outgrowth (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Hence, we next set out to investigate whether loss of nuclear PTEN would impact neurite outgrowth in PC12 cells. Transfected cells were treated with NGF for 5 days, after which cells with at least one neurite in length equal to two cell diameters were characterized as differentiated cells. Using this approach, we found that WT PTEN efficiently repressed neurite outgrowth relative to blank vector control (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Similarly, cells in which a \u003cem\u003ePTEN\u003c/em\u003e mutation prevented nuclear import also resulted in a decrease in neurite outgrowth compared to blank vector control, but less so than for WT \u003cem\u003ePTEN\u003c/em\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). No significant difference was observed among the three mutants (K13E-\u003cem\u003ePTEN\u003c/em\u003e, K289E-\u003cem\u003ePTEN\u003c/em\u003e and K13E\u0026thinsp;+\u0026thinsp;K289E-\u003cem\u003ePTEN\u003c/em\u003e) in repressing neurite growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These data are consistent with the previous reports of PTEN translocation(\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e), suggesting that nuclear PTEN plays a repressor role in PC12 cell differentiation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eNeuronal growth-associated protein GAP43 is an important component of axons, and is typically used as a neuronal differentiation marker(\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). We previously reported that \u003cem\u003ePTEN\u003c/em\u003e knockdown increased neurite outgrowth in PC12 cells(\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). In the current study, we identified ERK5 as a substrate for PTEN dephosphorylation and suppression. To determine whether ERK5 activation by phosphorylation changes during PC12 cell differentiation, we examined GAP43 expression in \u003cem\u003ePTEN\u003c/em\u003e_OE and \u003cem\u003ePTEN\u003c/em\u003e_KD cells cultured with NGF for 1\u0026ndash;7 days. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, ERK5 phosphorylation was significantly increased upon \u003cem\u003ePTEN\u003c/em\u003e knockdown at day 1, 3 or 5. However, ERK5 phosphorylation was unexpectedly decreased at day 7, regardless of PTEN OE or KD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Thus, it is possible that ERK5 activity is no longer required when the cell completed differentiation at day 7. GAP43 expression continuously increased under NGF stimulation, but its level was higher with \u003cem\u003ePTEN\u003c/em\u003e_KD than \u003cem\u003ePTEN\u003c/em\u003e_OE or intact cells at day 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). This data suggests that in the absence of PTEN, ERK5 remains phosphorylated during PC12 differentiation.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eERK5 enhances NGF-induced cell differentiation and neurite outgrowth\u003c/h2\u003e\u003cp\u003eERK5 has been reported to both enhance cell proliferation(\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e) and facilitate cell differentiation(\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). To explore the role of ERK5 in PC12 cell proliferation and differentiation, we generated three siRNAs targeting ERK5 and evaluated these for efficiency on ERK5_KD. All three siRNAs efficiently knocked down \u003cem\u003eERK5\u003c/em\u003e expression in PC12 cells with siRNA-1 being the most potent one (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA). The sequence of siRNA-1 was submitted to GenePharma Co. Ltd. (Shanghai, China) and packaged into lentiviral particles. For OE studies we fused \u003cem\u003eERK5\u003c/em\u003e with GFP or inserted \u003cem\u003eERK5\u003c/em\u003e in a bicistronic vector containing a separate GFP expression cassette. Efficiency of infection was evaluated 48h after infection (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). The expression level of ERK5 was detected by Western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), with \u003cem\u003eERK5\u003c/em\u003e being efficiently knocked\u0026ndash;down relative to both control and \u003cem\u003eERK5\u003c/em\u003e_OE PC12 cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo ascertain whether ERK5 alone would influence neurite outgrowth in the absence of NGF stimulation, \u003cem\u003eERK5\u003c/em\u003e_OE PC12 cells were cultured in regular medium for 5 consecutive days. We found that the cell soma became flattened with short neurites/processes compared to either control or \u003cem\u003ePTEN\u003c/em\u003e_OE cells, which neither have neurites/processes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). With higher magnification (100\u0026times;) this observation is even more evident, suggesting that ERK5 alone is capable of initiating PC12 cell differentiation without NGF stimulation, and can be more effective in promoting differentiation with NGF stimulation (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC). However, ERK5 itself was not capable of inducing complete differentiation.\u003c/p\u003e\u003cp\u003eWe next cultured intact cells, \u003cem\u003eERK5\u003c/em\u003e_OE and \u003cem\u003eERK5\u003c/em\u003e_KD cells with NGF stimulation for 1\u0026ndash;5 days. GAP43 was detected via Western blot and quantitative PCR, and was observed to distribute in the cytoplasm and cell processes. We found that \u003cem\u003eERK5\u003c/em\u003e OE enhanced GAP43 expression under NGF stimulation compared to both control and \u003cem\u003eERK5\u003c/em\u003e KD (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD). In contrast, \u003cem\u003eERK5\u003c/em\u003e KD reduced GAP43 expression compared to control and \u003cem\u003eERK5\u003c/em\u003e OE (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD). Furthermore, \u003cem\u003eERK5\u003c/em\u003e OE led to elevated GAP43, TrkA/NGFR and Nestin expression at the mRNA level as demonstrated by quantitative RT-PCR (qRT-PCR) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, E and F), but had no significant effects on Tubb3 expression, a neuronal marker (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Taken together, these data suggested that ERK5 in and of itself could not completely induce PC12 cell differentiation, and that NGF stimulation is required for full differentiation.\u003c/p\u003e\u003cp\u003eNeurite outgrowth and elongation are primary features of PC12 cell differentiation. To explore effect of ERK5 on PC12 cell differentiation, we measured neurite length during 5 days of NGF treatment. \u003cem\u003eERK5\u003c/em\u003e_OE augmented PC12 cell differentiation by inducing neurite outgrowth and elongation more so than in control cells. In contrast, in \u003cem\u003eERK5\u003c/em\u003e_KD cells neurite elongation was impaired and cell differentiation was blocked (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eH and I). Considering that proliferation is a process that is superseded by differentiation, we simultaneously examine the effect of ERK5 on PC12 cell proliferation. The cell proliferation curve (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ) showed that PC12 cell proliferation was indeed reduced in \u003cem\u003eERK5\u003c/em\u003e_OE cells while increased in \u003cem\u003eERK5\u003c/em\u003e_KD cells compared to the control cells.\u003c/p\u003e\u003cp\u003eWe next investigated if pharmacological inhibition of ERK5 would mirror the effects we had observed in \u003cem\u003eERK5\u003c/em\u003e_KD cells. To this end, we treated PC12 cells with XMD8-92, a potent and selective ERK5 inhibitor, under different doses and time points. The effect of XMD8-92 reached its peak around 2 h of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B). Subsequently, we titrated the concentration of XMD8-92 to be able to detect inhibition of ERK5 activity. As shown in Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eB and C, XMD8-92 down-regulated ERK5 phosphorylation in a dose-dependent manner and reached its maximal repression of ERK5 phosphorylation at 20 \u0026micro;M. We next examined whether inhibition of ERK5 phosphorylation via XMD8-92 affected GAP43 expression and PC12 cell differentiation. Notably, GAP43 expression was reduced in the presence of XMD8-92 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), particularly at day 5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In addition, XMD8-92 treatment lead to reduction in neurite length (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and F). This data suggests that pharmacological inhibition of ERK5 by XMD8-92 represses PC12 differentiation (Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003eMolecular analysis of ERK5 function during PC12 differentiation\u003c/h2\u003e\u003cp\u003eTo begin to understand molecular pathways downstream of ERK5 inhibition in the PC12 differentiation model, we first took to q-PCR. Similar to what we observed in \u003cem\u003eERK5\u003c/em\u003e_KD cells, expression levels of GAP43 and TrkA were reduced in the presence of XMD8-92 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and B), whereas Tubb3 expression levels remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Intriguingly, in the presence of XMD8-92, Nestin expression was increased compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), which differed from what we had observed in \u003cem\u003eERK5\u003c/em\u003e_KD cells, where Nestin expression was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). It is possible that XMD8-92 might inhibit activity of other kinases that regulate Nestin expression, or Nestin is not an ideal indicator to indicate the cell differentiation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eGenes that regulate gene transcription and cell differentiation downstream of ERK5 have been well documented(\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Here, we found that expression levels of CREB, cyclin D1, FoxO3 and PML were up-regulated in \u003cem\u003eERK5\u003c/em\u003e_OE cells; whereas the expression of c-Jun, Twist1 and c-Myc were down-regulated in \u003cem\u003eERK5\u003c/em\u003e_KD cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003eWe next performed ChIP assays to evaluate direct binding of ERK5 to promoter regions of candidate genes with a ChIP-grade anti-ERK5 antibody. We tested two different pairs of the primers for each gene, and selected the optimized primers for our PCR experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Recovered DNA was evaluated in agarose gel for shearing effect of ultrasonic homogenization (Fig. \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). In three independent ChIP experiments, the results indicated that ERK5 was associated with the \u003cem\u003ec-Jun\u003c/em\u003e promoter (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). We also detected a possible association between ERK5 and the \u003cem\u003ePML\u003c/em\u003e promoter, however this result was less clear as there was also a positive band in the IgG control lane (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). We next examined expression levels of c-Jun and PML in NGF stimulated \u003cem\u003eERK5\u003c/em\u003e_KD and \u003cem\u003eERK5\u003c/em\u003e_OE cells using RT-PCR. We found that \u003cem\u003eERK5\u003c/em\u003e knockdown significantly increased c-Jun expressions regardless of NGF stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). This suggests that c-Jun plays a repressor role in PC12 cell differentiation induced by ERK5.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePTEN down-regulation in cell proliferation and growth via PI3K-Akt is well documented(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). However, the underlying molecular mechanism on how PTEN facilitates cell neurite outgrowth remains unknown (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Here, we discovered that ERK5 functions as a PTEN effector during PC12 cell differentiation. NGF is known to induce PC12 differentiation via the TrkA pathway(\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e). However, our data show that PTEN signals primarily via ERK5, and not TrkA, as TrkA phosphorylation did not change significantly in PTEN cellular models.\u003c/p\u003e\u003cp\u003eERK5, also known as MAP kinase 7, is the biggest MAP kinase among all MAPKs. As a transcription regulator, activated ERK5 translocates into the nucleus to phosphorylate/activate transcription factors or act as a co-activator to interact with transcription factors in a kinase-dependent or independent manner(\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). More recent works demonstrate that some ERK5 effects are mediated by bromo-domains and independent of phosphorylation(\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e). ERK5 is involved in development, proliferation and differentiation of the nervous and non-nervous systems (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). PTEN dephosphorylation of ERK5 directly, or upstream signaling components, could mediate NGF-driven PC12 cell differentiation. PTEN plays a repressor role in neural cell differentiation, particularly in early stage through repressing ERK5 activity, which enhances cell differentiation.\u003c/p\u003e\u003cp\u003eWe found that phosphorylation levels of Cot/Tpl2, MEKK2/3 and MEK5 did not change upon NGF induction, and were comparable between \u003cem\u003ePTEN\u003c/em\u003e_KD and control cells. In contrast, ERK5 phosphorylation was highly sensitive to NGF induction, and more pronounced in \u003cem\u003ePTEN\u003c/em\u003e_KD cells, implicating a direct regulation by PTEN. We were unable to detect a direct interaction between PTEN and ERK5 in WT PC12 cells. However, ERK5 is quite a large protein, making it difficult to co-precipitate with an anti-PTEN antibody. In co-immunoprecipitation experiments in \u003cem\u003ePTEN\u003c/em\u003e_OE cells, we successfully detected a robust interaction between ERK5 and PTEN. The N-terminus of PTEN protein contains phosphatase and PBD domains, and the C-terminus consists of a C2 domain, tail, and PDZ domain(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Our experiments show that ERK5 mainly binds to the C-terminus. On the basis of this data, we surmise that direct binding of PTEN to ERK5 is necessary for PTEN to dephosphorylate ERK5, leading to ERK5 inactivation and PC12 cell differentiation repression.\u003c/p\u003e\u003cp\u003ePTEN translocates to the nucleus where it plays a similar role in controlling Akt signaling and stabilizing chromosomes as it does in the cytoplasm during cell division(\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Hence, we asked whether preventing nuclear translocation of PTEN would affect PC12 cell differentiation. In point mutation experiments, we found that K13 was more critical for nuclear import of PTEN than K289. Mono-ubiquitination at both sites has been reported to mediate PTEN nuclear translocation(\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Here, we did not detect marked differences among PTEN with K13E, K289E and K13E\u0026thinsp;+\u0026thinsp;K289E point mutations. We speculate that endogenous PTEN able to distribute to the nucleus masks any defects on nuclear import imparted by our PTEN constructs. As a result, we also observed more subtle effects on neurite outgrowth. PTEN in nuclear properly regulates ERK5 activity by binding and dephosphorylating it, since PTEN complete loss will lead to the cell premature and failed development(\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGAP43 is a well-known marker of neuronal differentiation(\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Previous work found that PC12 cell differentiation is largely completed by day 6, with GAP43 expression reaching maximum levels at early time points(\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). Our experiments indicated that ERK5 activity was primarily regulated by PTEN, and that \u003cem\u003ePTEN\u003c/em\u003e knock-down or \u003cem\u003eERK5\u003c/em\u003e overexpression promoted cell differentiation. We also found that although onset of ERK5 phosphorylation was rapid, ERK5 phosphorylation levels abated by day 7, indicating that a transient phosphorylation phase was sufficient to initiate neuronal differentiation. Our findings with the specific ERK5 inhibitor XMD8-92 corroborated the conclusion that XMD8-92 efficiently reduced ERK5 phosphorylation and down-regulated GAP43 expression. Accordingly, XMD8-92 treatment also reduced the neurite length.\u003c/p\u003e\u003cp\u003eThe mechanism underlying ERK5 signaling pathway in cell differentiation has not been precisely known. To identify possible candidates regulated by ERK5 signaling and involved in the differentiation, we examined the expression levels of ERK5 down-stream genes using q-PCR. We assumed and tested the binding of ERK5 to the promoters of these genes, and observed that ERK5 binds to the promoter region of \u003cem\u003ec-Jun\u003c/em\u003e. We also observed binding of ERK5 to the \u003cem\u003ePML\u003c/em\u003e promoter region in ChIP assay. However, this interaction was less specific as we could also see a band in IgG control lane (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). We did not have a more specific antibody available to distinguish these results. As an AP-1 transcriptional factor, c-Jun is involved in cell cycle progression and neuronal differentiation(\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). C-Jun LOF facilitated axonal regeneration after injury in neuronal cells, indicating it is likely to suppress axonal outgrowth or elongation in normal cells(\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Thus, ERK5 may function to release differentiation suppression controlled by c-Jun. Taking c-Jun into a thorough consideration in this experimental system, we speculated that ERK5 may release the suppression of c-Jun and facilitates PC12 cell differentiation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTaken together, our findings demonstrate that initiation of PC12 cell differentiation under PTEN LOF conditions is augmented by increased ERK5 phosphorylation/activity, which releases c-Jun mediated repression of PC12 cell differentiation. Neither \u003cem\u003ePTEN\u003c/em\u003e knock-down nor \u003cem\u003eERK5\u003c/em\u003e overexpression could induce PC12 cell differentiation without NGF induction. Hence we conclude that ERK5 is capable of inducing de-repression mechanisms to initiate differentiation, but further regulators are likely required to complete full differentiation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eConflict of Interest\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003eAuthor Contributions\u003c/p\u003e\n\u003cp\u003eYA: Data curation, Formal analysis, Investigation, Validation, and Writing-original draft; SW: Data curation, Formal analysis, Investigation and Methodology; YW and YH: Data curation, Formal analysis, Validation; MX: Investigation and Methodology; YL: Validation and Methodology; XX and LS: Resources and Software; LS: Methodology; NF: Project administration; JY: Writing-review \u0026amp; editing; SJ: Conceptualization, Funding acquisition, Project administration, Writing-original draft and review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No.31371386); Natural Science Foundation of Henan Province (No.162300410042); Program for Science and Technology Development in Henan Province (No.212102310616); Innovation Project for College Students of Henan University (No.202210475039; No.202210475011).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIt is not applicable. This research does not involve any animal and human samples.\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eJi SP, Zhang Y, Van Cleemput J, Jiang W, Liao M, Li L, et al. Disruption of PTEN coupling with 5-HT2C receptors suppresses behavioral responses induced by drugs of abuse. Nature medicine. 2006, 12(3): 324-9. DOI: 10.1038/nm1349\u003c/li\u003e\n\u003cli\u003eHopkins BD, Hodakoski C, Barrows D, Mense SM, Parsons RE. PTEN function: the long and the short of it. Trends in biochemical sciences. 2014, 39(4): 183-90. DOI: 10.1016/j.tibs.2014.02.006\u003c/li\u003e\n\u003cli\u003eGroszer M, Erickson R, Scripture-Adams DD, Lesche R, Trumpp A, Zack JA, et al. Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science. 2001, 294(5549): 2186-9. DOI: 10.1126/science.1065518\u003c/li\u003e\n\u003cli\u003eMarino S, Krimpenfort P, Leung C, van der Korput HA, Trapman J, Camenisch I, et al. PTEN is essential for cell migration but not for fate determination and tumourigenesis in the cerebellum. Development. 2002, 129(14): 3513-22. \u003c/li\u003e\n\u003cli\u003eGregorian C, Nakashima J, Le Belle J, Ohab J, Kim R, Liu A, et al. Pten deletion in adult neural stem/progenitor cells enhances constitutive neurogenesis. J Neurosci. 2009, 29(6): 1874-86. DOI: 10.1523/JNEUROSCI.3095-08.2009\u003c/li\u003e\n\u003cli\u003eAmiri A, Cho W, Zhou J, Birnbaum SG, Sinton CM, McKay RM, et al. Pten deletion in adult hippocampal neural stem/progenitor cells causes cellular abnormalities and alters neurogenesis. J Neurosci. 2012, 32(17): 5880-90. DOI: 10.1523/JNEUROSCI.5462-11.2012\u003c/li\u003e\n\u003cli\u003eZheng H, Ying H, Yan H, Kimmelman AC, Hiller DJ, Chen AJ, et al. p53 and Pten control neural and glioma stem/progenitor cell renewal and differentiation. Nature. 2008, 455(7216): 1129-33. DOI: 10.1038/nature07443\u003c/li\u003e\n\u003cli\u003eYue F, Bi P, Wang C, Shan T, Nie Y, Ratliff TL, et al. Pten is necessary for the quiescence and maintenance of adult muscle stem cells. Nature communications. 2017, 8: 14328. DOI: 10.1038/ncomms14328\u003c/li\u003e\n\u003cli\u003eLee JJ, Kim BC, Park MJ, Lee YS, Kim YN, Lee BL, et al. PTEN status switches cell fate between premature senescence and apoptosis in glioma exposed to ionizing radiation. Cell Death Differ. 2011, 18(4): 666-77. DOI: 10.1038/cdd.2010.139\u003c/li\u003e\n\u003cli\u003eDragojlovic-Munther M, Martinez-Agosto JA. Multifaceted roles of PTEN and TSC orchestrate growth and differentiation of Drosophila blood progenitors. Development. 2012, 139(20): 3752-63. DOI: 10.1242/dev.074203\u003c/li\u003e\n\u003cli\u003eJia L, Ji S, Maillet JC, Zhang X. PTEN suppression promotes neurite development exclusively in differentiating PC12 cells via PI3-kinase and MAP kinase signaling. J Cell Biochem. 2010, 111(6): 1390-400. DOI: 10.1002/jcb.22867\u003c/li\u003e\n\u003cli\u003eZhu G, Chow LM, Bayazitov IT, Tong Y, Gilbertson RJ, Zakharenko SS, et al. Pten deletion causes mTorc1-dependent ectopic neuroblast differentiation without causing uniform migration defects. Development. 2012, 139(18): 3422-31. DOI: 10.1242/dev.083154\u003c/li\u003e\n\u003cli\u003eSong Z, Han X, Shen L, Zou H, Zhang B, Liu J, et al. PTEN silencing enhances neuronal proliferation and differentiation by activating PI3K/Akt/GSK3beta pathway in vitro. Exp Cell Res. 2018, 363(2): 179-87. DOI: 10.1016/j.yexcr.2018.01.001\u003c/li\u003e\n\u003cli\u003eYang T, Moore M, He F. Pten regulates neural crest proliferation and differentiation during mouse craniofacial development. Dev Dyn. 2018, 247(2): 304-14. DOI: 10.1002/dvdy.24605\u003c/li\u003e\n\u003cli\u003eMusatov S, Roberts J, Brooks AI, Pena J, Betchen S, Pfaff DW, et al. Inhibition of neuronal phenotype by PTEN in PC12 cells. Proc Natl Acad Sci U S A. 2004, 101(10): 3627-31. DOI: 10.1073/pnas.0308289101\u003c/li\u003e\n\u003cli\u003eLei X, Jiao J. UTX Affects Neural Stem Cell Proliferation and Differentiation through PTEN Signaling. Stem Cell Reports. 2018, 10(4): 1193-207. DOI: 10.1016/j.stemcr.2018.02.008\u003c/li\u003e\n\u003cli\u003eHorita H, Wysoczynski CL, Walker LA, Moulton KS, Li M, Ostriker A, et al. Nuclear PTEN functions as an essential regulator of SRF-dependent transcription to control smooth muscle differentiation. Nature communications. 2016, 7: 10830. DOI: 10.1038/ncomms10830\u003c/li\u003e\n\u003cli\u003eCheng P, Alberts I, Li X. The role of ERK1/2 in the regulation of proliferation and differentiation of astrocytes in developing brain. Int J Dev Neurosci. 2013, 31(8): 783-9. DOI: 10.1016/j.ijdevneu.2013.09.008\u003c/li\u003e\n\u003cli\u003eRoskoski R, Jr. ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res. 2012, 66(2): 105-43. DOI: 10.1016/j.phrs.2012.04.005\u003c/li\u003e\n\u003cli\u003eChetram MA, Hinton CV. PTEN regulation of ERK1/2 signaling in cancer. J Recept Signal Transduct Res. 2012, 32(4): 190-5. DOI: 10.3109/10799893.2012.695798\u003c/li\u003e\n\u003cli\u003eJi S, Doucette JR, Nazarali AJ. Sirt2 is a novel in vivo downstream target of Nkx2.2 and enhances oligodendroglial cell differentiation. Journal of molecular cell biology. 2011, 3(6): 351-9. DOI: 10.1093/jmcb/mjr009\u003c/li\u003e\n\u003cli\u003eYang S, Qi F, Tang C, Wang H, Qin H, Li X, et al. CD147 promotes the proliferation, invasiveness, migration and angiogenesis of human lung carcinoma cells. Oncol Lett. 2017, 13(2): 898-904. DOI: 10.3892/ol.2016.5502\u003c/li\u003e\n\u003cli\u003eMebratu Y, Tesfaigzi Y. How ERK1/2 activation controls cell proliferation and cell death: Is subcellular localization the answer? Cell Cycle. 2009, 8(8): 1168-75. DOI: 10.4161/cc.8.8.8147\u003c/li\u003e\n\u003cli\u003eLiu L, Cundiff P, Abel G, Wang Y, Faigle R, Sakagami H, et al. Extracellular signal-regulated kinase (ERK) 5 is necessary and sufficient to specify cortical neuronal fate. Proc Natl Acad Sci U S A. 2006, 103(25): 9697-702. DOI: 10.1073/pnas.0603373103\u003c/li\u003e\n\u003cli\u003eLi T, Pan YW, Wang W, Abel G, Zou J, Xu L, et al. Targeted deletion of the ERK5 MAP kinase impairs neuronal differentiation, migration, and survival during adult neurogenesis in the olfactory bulb. PLoS One. 2013, 8(4): e61948. DOI: 10.1371/journal.pone.0061948\u003c/li\u003e\n\u003cli\u003eTrotman LC, Wang X, Alimonti A, Chen Z, Teruya-Feldstein J, Yang H, et al. Ubiquitination regulates PTEN nuclear import and tumor suppression. Cell. 2007, 128(1): 141-56. DOI: 10.1016/j.cell.2006.11.040\u003c/li\u003e\n\u003cli\u003eDas KP, Freudenrich TM, Mundy WR. Assessment of PC12 cell differentiation and neurite growth: a comparison of morphological and neurochemical measures. Neurotoxicol Teratol. 2004, 26(3): 397-406. DOI: 10.1016/j.ntt.2004.02.006\u003c/li\u003e\n\u003cli\u003eLaux T, Fukami K, Thelen M, Golub T, Frey D, Caroni P. GAP43, MARCKS, and CAP23 modulate PI(4,5)P(2) at plasmalemmal rafts, and regulate cell cortex actin dynamics through a common mechanism. J Cell Biol. 2000, 149(7): 1455-72. \u003c/li\u003e\n\u003cli\u003eKaneda M, Nagashima M, Mawatari K, Nunome T, Muramoto K, Sugitani K, et al. Growth-associated protein43 (GAP43) is a biochemical marker for the whole period of fish optic nerve regeneration. Adv Exp Med Biol. 2010, 664: 97-104. DOI: 10.1007/978-1-4419-1399-9_12\u003c/li\u003e\n\u003cli\u003eLin EC, Amantea CM, Nomanbhoy TK, Weissig H, Ishiyama J, Hu Y, et al. ERK5 kinase activity is dispensable for cellular immune response and proliferation. Proc Natl Acad Sci U S A. 2016, 113(42): 11865-70. DOI: 10.1073/pnas.1609019113\u003c/li\u003e\n\u003cli\u003ede Jong PR, Taniguchi K, Harris AR, Bertin S, Takahashi N, Duong J, et al. ERK5 signalling rescues intestinal epithelial turnover and tumour cell proliferation upon ERK1/2 abrogation. Nat Commun. 2016, 7: 11551. DOI: 10.1038/ncomms11551\u003c/li\u003e\n\u003cli\u003ePerez-Madrigal D, Finegan KG, Paramo B, Tournier C. The extracellular-regulated protein kinase 5 (ERK5) promotes cell proliferation through the down-regulation of inhibitors of cyclin dependent protein kinases (CDKs). Cell Signal. 2012, 24(12): 2360-8. DOI: 10.1016/j.cellsig.2012.08.001\u003c/li\u003e\n\u003cli\u003eAdam C, Gluck L, Ebert R, Goebeler M, Jakob F, Schmidt M. The MEK5/ERK5 mitogen-activated protein kinase cascade is an effector pathway of bone-sustaining bisphosphonates that regulates osteogenic differentiation and mineralization. Bone. 2018, 111: 49-58. DOI: 10.1016/j.bone.2018.03.020\u003c/li\u003e\n\u003cli\u003eChen TH, Chen CY, Wen HC, Chang CC, Wang HD, Chuu CP, et al. YAP promotes myogenic differentiation via the MEK5-ERK5 pathway. FASEB J. 2017, 31(7): 2963-72. DOI: 10.1096/fj.201601090R\u003c/li\u003e\n\u003cli\u003eHoang VT, Yan TJ, Cavanaugh JE, Flaherty PT, Beckman BS, Burow ME. Oncogenic signaling of MEK5-ERK5. Cancer Lett. 2017, 392: 51-9. DOI: 10.1016/j.canlet.2017.01.034\u003c/li\u003e\n\u003cli\u003eEggert A, Ikegaki N, Liu X, Chou TT, Lee VM, Trojanowski JQ, et al. Molecular dissection of TrkA signal transduction pathways mediating differentiation in human neuroblastoma cells. Oncogene. 2000, 19(16): 2043-51. DOI: 10.1038/sj.onc.1203518\u003c/li\u003e\n\u003cli\u003eGomez N, Erazo T, Lizcano JM. ERK5 and Cell Proliferation: Nuclear Localization Is What Matters. Front Cell Dev Biol. 2016, 4: 105. DOI: 10.3389/fcell.2016.00105\u003c/li\u003e\n\u003cli\u003eZou J, Pan YW, Wang Z, Chang SY, Wang W, Wang X, et al. Targeted deletion of ERK5 MAP kinase in the developing nervous system impairs development of GABAergic interneurons in the main olfactory bulb and behavioral discrimination between structurally similar odorants. J Neurosci. 2012, 32(12): 4118-32. DOI: 10.1523/JNEUROSCI.6260-11.2012\u003c/li\u003e\n\u003cli\u003eShen WH, Balajee AS, Wang J, Wu H, Eng C, Pandolfi PP, et al. Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell. 2007, 128(1): 157-70. DOI: 10.1016/j.cell.2006.11.042\u003c/li\u003e\n\u003cli\u003eBoczek T, Ferenc B, Lisek M, Zylinska L. Regulation of GAP43/calmodulin complex formation via calcineurin-dependent mechanism in differentiated PC12 cells with altered PMCA isoforms composition. Mol Cell Biochem. 2015, 407(1-2): 251-62. DOI: 10.1007/s11010-015-2473-4\u003c/li\u003e\n\u003cli\u003eSchreiber M, Kolbus A, Piu F, Szabowski A, Mohle-Steinlein U, Tian J, et al. Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev. 1999, 13(5): 607-19. \u003c/li\u003e\n\u003cli\u003eFontana X, Hristova M, Da Costa C, Patodia S, Thei L, Makwana M, et al. c-Jun in Schwann cells promotes axonal regeneration and motoneuron survival via paracrine signaling. J Cell Biol. 2012, 198(1): 127-41. DOI: 10.1083/jcb.201205025\u003c/li\u003e\n\u003cli\u003eHadjimichael C, Chanoumidou K, Nikolaou C, Klonizakis A, Theodosi GI, Makatounakis T, et al. Promyelocytic Leukemia Protein Is an Essential Regulator of Stem Cell Pluripotency and Somatic Cell Reprogramming. Stem Cell Reports. 2017, 8(5): 1366-78. DOI: 10.1016/j.stemcr.2017.03.006\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-medical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejmr","sideBox":"Learn more about [European Journal of Medical Research](http://eurjmedres.biomedcentral.com)","snPcode":"40001","submissionUrl":"https://submission.nature.com/new-submission/40001/3","title":"European Journal of Medical Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"PTEN, ERK5, phosphorylation, PC12 cells, differentiation, neurite outgrowth","lastPublishedDoi":"10.21203/rs.3.rs-6905743/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6905743/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePTEN loss of function (LOF) enhances proliferation and differentiation of neuronal cells by well characterized pathways. Here, we identified ERK5 as a PTEN substrate that functions to boost NGF-induced neuronal differentiation in PC12 cells. Using knockdown approaches, we found that PTEN LOF leads to increased ERK5 phosphorylation, concomitant with increased neurite outgrowth, and upregulation of differentiation markers GAP43 and Nestin. Conversely, \u003cem\u003eERK5\u003c/em\u003e overexpression produced similar outcomes, while ERK genetic LOF and pharmacological inhibition reduced neurite outgrowth and downregulated GAP43 expression. We also found that ERK5 interacted with \u003cem\u003ec-Jun\u003c/em\u003e promoter directly to in part repress c-Jun expression. Taken together, our findings reveal that ERK5 is a novel PTEN target that mediates NGF-dependent neuronal differentiation.\u003c/p\u003e","manuscriptTitle":"PTEN Defect Facilitates Neuronal Cell Differentiation via ERK5 Activation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-09 11:28:03","doi":"10.21203/rs.3.rs-6905743/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-13T18:03:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-07T04:15:28+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-06T00:13:16+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-04T00:44:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"271332583751547028428507882987647143261","date":"2026-03-26T15:53:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"103315924770587744007067744003418192811","date":"2026-03-25T01:38:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"26891770302633229988512055832478423215","date":"2026-03-24T22:42:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257269479988205016693797809060287980611","date":"2026-03-24T22:15:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"177142957676776589428803279478068843325","date":"2025-09-23T23:01:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"181430384819845916044508999735826060867","date":"2025-07-12T13:51:18+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-07T13:33:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-01T07:47:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-01T07:02:46+00:00","index":"","fulltext":""},{"type":"submitted","content":"European Journal of Medical Research","date":"2025-06-16T12:44:23+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"european-journal-of-medical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ejmr","sideBox":"Learn more about [European Journal of Medical Research](http://eurjmedres.biomedcentral.com)","snPcode":"40001","submissionUrl":"https://submission.nature.com/new-submission/40001/3","title":"European Journal of Medical Research","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"10fa13ab-19d6-41e1-bd3d-65242fc4f914","owner":[],"postedDate":"July 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-19T01:53:18+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-09 11:28:03","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6905743","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6905743","identity":"rs-6905743","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}