Regulation of Tert methylation alleviates food allergy via regulating the Tert-IL10 signal pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Regulation of Tert methylation alleviates food allergy via regulating the Tert-IL10 signal pathway Haotao Zeng, Lingzhi Xu, Jiangqi Liu, Lihua Mo, Minyao Li, Shuo Song, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4152216/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jul, 2024 Read the published version in Immunologic Research → Version 1 posted 12 You are reading this latest preprint version Abstract The pathogenesis of food allergy (FA) is still not fully understood. Telomerases are involved in the regulation of immune responses. The aim of this study is to understand the contribution of telomerase reverse transcriptase (TERT) to the pathogenesis of FA. A murine FA model was established with ovalbumin as the specific antigen. This murine model was used to test the role of TERT in the regulation of dendritic cell (DC) immune tolerogenic functions. We observed that the Tert promoter was at demethylation status and the Tert expression was elevated in DCs of FA mice. The FA response was positively correlated with the Tert expression in DCs. Induction of Il10 expression in DCs was hindered by TERT. TERT hindered the immune tolerogenic functions of DCs. The immune tolerogenic functions of DC were restored by CpG by boosting the Tert promoter methylation. Administration of CpG promoted the therapeutic effects of allergen specific immunotherapy in FA mice. In conclusion, low levels of Il10 expression and high levels of Tert expression were observed in intestinal DCs of FA mice. CpG exposure restored the expression of Il10 and increased the therapeutic benefits of allergen-specific immunotherapy. Food allergy dendritic cell IL-10 TERT immunotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Food allergy (FA) is a common disease. It has a prevalence of around 2–8% worldwide. The pathogenesis of FA is not clear [ 1 ]. FA attacks induce various clinical symptoms, such as slight abdominal discomfort, abdominal pain, diarrhea, or even the life-threatening anaphylactic shock [ 2 ]. The therapies for FA are limited currently, that mainly focusing on avoiding taking the offending foods, and controlling the clinical symptoms [ 3 ]. It is imperative to investigate the mechanism of FA further and develop more effective therapies for FA. Immunologically, FA is an immune disease featuring Th2 cell polarization in the intestine. Dendritic cells (DCs) capture food antigens in the intestine. After processing, DCs transfer antigen information to CD4 + T cells to induce Th2 cells. The Th2 cell polarization indicates that Th2 cells aggregate in the local tissues, where a large quantity of Th2 cytokine is produced by Th2 cells [ 4 ]. Th2 cytokines facilitate the production of IgE. IgE binds to the high affinity IgE receptor on the surface of mast cells to make mast cells sensitized. Upon re-exposure to specific antigens, sensitized mast cells release allergic mediators. These allergic mediators, such as histamine, tryptase, and serotonin, trigger FA attacks [ 5 ]. In general, the immune responses are tightly regulated by the immune regulatory system [ 6 ]. The Th2 cell polarization in the intestine indicates that the local immune regulatory system is not functioning properly. One of the major immune regulatory cell fractions are Regulatory T cells (Treg cells). Treg cells can be classified into two main subsets, Foxp3 + CD25 + Treg cells and type 1 Treg cells (Tr1 cells). Upon activation, Tr1 cells release IL-10 to suppress other immune cell activities to avoid self-injury [ 7 ]. Tr1 cells can be induced by DC-derived IL-10 [ 8 ]. Dysfunctional Tr1 cells have been noted in individuals with FA [ 9 , 10 ]. Factors and mechanisms that affect the functional status of Tr1 cells are not fully understood yet. In this study, we observed that Tr1 cells in FA mice were at a dysfunctional status. The expression of telomerase reverse transcriptase (TERT) was found to be high in DCs of FA mice. The TERT interfered with the expression of IL-10 in DCs to compromise the immune tolerogenic functions. Materials and methods Reagents Antibodies (Abs) of c-Maf (Clone#: E-7, Cat#: sc-518062), ubiquitin (P4D1, sc-8017), CD19 (B-1, sc-390244, AF488) and IL-10 (3C12C12, sc-32815, AF546), CD14 (H-4, sc-515785, AF594), F4/80 (D-11, sc-365340, AF648), MHC II (7-1H, sc-13556, AF680), CD5 (UCH-T2, sc-1180, AF700), CD1d (G-12, sc-373858, AF790), CD3 (PC3/188A, sc-20047, AF488), CD4 (MT310, sc-19641, AF546), CD25 (C-9, sc-393326, AF648), LAG3 (D-8, sc-514993, AF488) and CD49b (C-9, sc-74466, AF546) were purchased from Santa Cruz Biotech (Santa Cruz, CA). Ovalbumin, collagenase IV, and DNase I were purchased from Sigma Aldrich (St. Louis, MO). CpG-ODN 1826 (TCCATGACGTTCCTGACGTT), ELISA kits of IL-5, IL-4, IL-13, IL-10, Mcpt1, EPX, and ovalbumin (OVA)-specific IgE were purchased from Dakewe BioMart (Shenzhen, China). OVA, GM-CSF, phorbol myristate acetate, ionomycin, collagenase IV, were purchased from Sigma Aldrich (St. Louis., MO). Reagents and materials for Western blotting, RT-qPCR, immunoprecipitation (IP), and chromatin IP (ChIP) were purchased from Invitrogen (Carlsbad, CA). Neutralizing anti-IL-10 Ab (JES5-2A5, ab189392) was purchased from abcam (Cambridge, MA). Mice Male BALB/c mice (6-8-week-old) were purchased from Guangdong Experimental Animal Center (Fushan, China). Mice were maintained in a pathogen-free facility with access to food and water freely. The experiments were carried out in accordance with the ARRIVE guidelines. The Animal Ethics Committee at Shenzhen University reviewed and approved the animal experimental protocol (Approve#: 2022085). Establishment of a murine FA model A murine FA model was established based on the established procedures [ 11 ]. Briefly, mice received subcutaneous injections of OVA (100 µg/mouse in 0.1 ml alum) on day 1 and day 7, respectively. Mice were then gavage-fed with OVA (1 mg/mouse in 0.3 ml saline) daily from day 9 to day 14. On day 15, mice were orally challenged with OVA (50 mg/mouse in 0.3 ml saline). Assessment of the FA response The core temperature was recorded from each mouse 30 min after the oral challenge. Mice with diarrhea were counted during 3 h after the challenge. Mice were then sacrificed by cervical dislocation. A jejunum segment (15 cm) was excised. The intestinal cavity was rinsed with 1 ml PBS, which was retrieved and used as the gut lavage fluid (GLF) for other experiments. The amounts of eosinophil peroxidase (EPX), mouse mast cell protease-1 (Mcpt1), IL-4, IL-5, IL-13, and OVA-specific IgE in GLF were determined by ELISA with commercial reagent kits following the manufacturer’s instruction. Preparation of lamina propria mononuclear cells (LPMCs) After the sacrifice, the small intestine was removed from the mice and opened longitudinally. The intestine was cut into segments about 5 cm in size, rinsed with PBS to wash out the contents in the intestinal cavity. The samples were incubated with ethylenediaminetetraacetic acid disodium salt (EDTA, 0.02%) for 5 min, and rinsed with PBS again. The tissues were cut into small pieces and incubated with the enzyme cocktail of 1 mg/ml collagenase IV and 2500 U/ml DNase I in complete RPMI1640 medium containing 2% fetal bovine serum (FBS) for 30 min at 37°C with mild agitation. Single cells were filtered through a cell strainer (100 µm first, then 70 µm). LPMCs were isolated from the single cells by the Percoll gradient density centrifugation. Cell culture Cells were cultured in RPMI1640 medium supplemented with L-glutamine (2 mM), streptomycin (0.1 mg/ml), penicillin (100 U/ml), and fetal calf serum (10%). The Trypan blue exclusion assay showed that the cell viability was over 99%. Flow cytometry (FCM) The surface markers of cells were stained using surface staining procedures. Briefly, live cells were stained with Abs of interest (labeled with proper fluorochromes; diluted to 1 µg/ml) or isotype IgG for 30 min at 4°C. Cells were washed with FCM buffer (phosphate-buffered saline, PBS, containing 1% bovine serum albumin) three times, and analyzed with a flow cytometer (BD FACSCanto II). To stain the intracellular molecules, cells were fixed with 1% paraformaldehyde (containing 0.05% Triton X-100 to increase the membrane permeability) for 1 h. After washing with PBS, cells were processed using the surface staining procedures. The data were processed with a software package, Flowjo (TreeStar Inc., Ashland, OR), with the data obtained from the isotype IgG staining as gating references. Isolation of immune cells by FCM cell sorting Single cells were prepared, and labeled with fluorochrome-labeled Abs. Cell types of interested (detailed in figures) were isolated by FCM cell sorting. The purity of isolated cells was assessed by FCM. It was over 95%. preparation of bone marrow derived dendritic cells (BMDCs) The femurs bones were excised from naïve mice. The bone marrows were flushed out by saline. A red blood lysis kit was used to lyse red blood cells. Bone marrow cells were cultured in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF, 20 ng/ml) for 8 days. The non-adherent cells were collected, and used as BMDCs [ 12 ]. Methylation-Specific PCR Assay DNA was extracted from purified DCs and treated with sodium bisulfate using the CpGenome DNA modification kit (Intergen, Purchase, NY). The modified DNA was analyzed by PCR as follows. Sense and antisense primer sequences for methylated and unmethylated Tert promoter (methylated: and ccccaaccaaattcaataattacta; unmethylated: aggatagatttttttgtttgttattt and ccccaaccaaattcaataattacta; both are 165 bp). PCR was performed using specific primers in 25 ml of a mixture containing 1× PCR buffer, 0.5 mM concentration of each primer, 0.5 mM dNTP, 1 U of Taq polymerase. Real-time quantitative RT-PCR (RT-qPCR) TRIzol reagents were used to extract RNA samples from cells harvested from relevant experiments. cDNA was generated with a reverse transcription kit following the manufacturer’s instructions. The cDNA samples were amplified in a qPCR device (Bio-Rad CFX96) with a SYBR Green Master Mix kit. The primers used in the present study include Tert (actcagcaacctccagccta and catattggcactctgcatgg), Maf (aaggaggaggtgatccgact and tctcctgcttgaggtggtct), Il10 (ccaagccttatcggaaatga and ttttcacaggggagaaatcg), and Actb (agccatgtacgtagccatcc and ctctcagctgtggtggtgaa). The results were processed using the formula of 2 -∆∆Ct against the results of the housekeeping gene Actb , and presented as relative expression (RE). Western blotting Cells from relevant experiments were used to prepare protein extracts, which were fractionated by sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with 5% skim milk for 30 min to block the non-specific binding, followed by incubated with primary Abs (Ab types are detailed in figures; diluted to 200 ng/ml) and second Abs (labeled with horseradish peroxidase; diluted to 20 ng/ml). After each incubation, the membrane was washed three times with Tris-buffered saline (containing 0.05% Tween 20; TBST). Enhanced chemiluminescence was used to develop immunoblots on the membrane and they were photographed using an imaging device (UVP, Cambridge, UK). Immunoprecipitation (IP) Protein G agarose beads were used to precleared protein complexes in protein samples for 2 h. After centrifugation, the beads were discarded. After overnight incubation with Abs of interest or isotype IgG, the samples were then incubated with protein G agarose beads for 2 h. After centrifugation, the beads were collected. Western blotting was used to analyze proteins on the beads. Chromatin IP (ChIP) Cells were fixed with 1% formalin for 15 min, lysed with a lysing buffer, and sonicated to shear the DNA into small pieces. The samples were then processed using IP procedures. The protein-DNA on the beads was eluted with an eluting buffer and analyzed by qPCR in the presence of the Tert promoter primers. The results are presented as a fold change compared to the input. Enforced expression of Tert in BMDCs Tert expression plasmids were constructed by a biotech company (Shanghai Sangon Biotech, Shanghai, China), and transfected into BMDCs with lipofectamine following the manufacturer’s instructions. The recombinant TERT protein in BMDCs was assessed by Western blotting 48 h after the transfection. Assessment the immune tolerogenic function of DC CD1d + CD5 + DCs were isolated from LPMCs, and CD3 + CD4 + CD25⁻ T cells were isolated from the naïve mouse spleen by FCM cell sorting. The DCs and T cells were cocultured at a ratio of 1:5 in the presence of non-specific cell activators [phorbol myristate acetate (PMA, 50 ng/ml) and ionomycin (100 ng/ml)]. The induction of Tr1 cells was assessed by FCM three days later. Allergen specific immunotherapy (AIT) Following published procedures [ 13 ], FA mice were treated with oral AIT or/and CpG (100 µg/mouse). Briefly, OVA was gavage-fed with doses of 1 mg (days 1 and 2), 2 mg (days 3 and 4), 3 mg (days 5–7), 4 mg (days 8 and 9), and 5 mg (days 10–14). Control mice were treated with PBS. Oral challenge with OVA was conducted one day after the last treatment of AIT. FA response was assessed for each mouse. Statistics Student's t -test was used to determine the difference between two groups. ANOVA + Bonferroni test was performed for multiple comparisons. Correlation between groups was carried out using the Pearson correlation coefficient test. p < 0.05 was set as a significant criterion. Results Tert promoter is in demethylation status in DCs of FA mice LPMCs (lamina propria mononuclear cells) were prepared, and analyzed by flow cytometry (FCM). We found that fewer IL-10 + DCs were detected in the FA group than the naïve control (NC) group (Fig. 1 A-B). The FA group had a significantly lower quantity of IL-10 (the median fluorescence intensity, MFI) than the NC group (Fig. 1 C). CD1d + CD5 + DCs (the IL-10 + DCs [ 14 ]) (Fig. 1 D) were isolated from LPMCs by FCM cell sorting, and analyzed by RT-qPCR and methylation specific PCR. The results showed that the Tert mRNA levels were higher in FA DCs (Fig. 1 E). FA DCs had a demethylation status of the Tert promoter compared to naive control (NC) DCs (Fig. 1 F). The levels of IL-10 MFI in DCs were positively correlated with the Tert promoter DNA methylation status (Fig. 1 G). The Tert mRNA levels in DCs were negatively correlated with the IL-10 MFI amounts (Fig. 1 H). The findings suggest that TERT could influence the production of IL-10 in intestinal DCs. Tert expression in DCs is positively correlated with the FA response The association between Tert expression in intestinal DCs and the FA response was tested. A FA murine model was established with reported procedures [ 15 ] (Fig. 2 A). FA mice showed the FA response, including diarrhea, a drop in core temperature, elevated amounts of EPX, Mcpt1, Th2 cytokines, and specific IgE in the gut lavage fluids (GLF) (Fig. 2 B). The FA response and the amounts of Tert mRNA in intestinal DCs were found to have a positive correlation (Fig. 2 C). The results point to a link between the expression of Tert in intestinal DCs and the pathogenesis of FA. TERT interferes with Il10 induction in DCs Bone marrow derived DCs (BMDCs) were exposed to LPS in culture overnight. The expression of Il10 in BMDCs was elevated. Enforced production of TERT in BMDCs (Fig. 3 A-B) markedly decreased the IL-10 induction (Fig. 3 C). The amount of Maf and Il10 mRNA levels in BMDCs decreased (Fig. 3 D-E). By immunoprecipitation (IP) assay, a complex of TERT and CMIP was detected in BMDCs with enforced production of TERT (Fig. 3 F). Ubiquitination was detected in CMIP protein in BMDCs, which was followed by protein degradation (Fig. 3 G). Additionally, CMIP protein was detected in intestine-isolated DCs, the amounts of which were significantly lower in the FA group (Fig. 3 H). The results demonstrate that TERT can interfere with the production of IL-10 in BMDCs by inducing CMIP degradation. TERT impairs DCs’ immune tolerogenic functions CD1d + CD5 + DCs were isolated from the intestinal tissues of FA mice and NC mice, and cultured with naïve CD4 + T cells in the presence of phorbol myristate acetate (PMA) and ionomycin (non-specific cell activators) for 3 days. NC DCs (DCs were isolated from NC mice) induced about 6.1 ± 1.5% type 1 regulatory T cells (Tr1 cells), while FA DCs induced about 1.7 ± 0.5% Tr1 cells (Fig. 4 A-B). The efficiency of Tr1 cell induction was negatively correlated with the Tert mRNA levels in DCs (Fig. 4 C-D). On the other hand, LPS-primed BMDCs were cocultured with naïve CD4 + T cells in the presence of PMA and ionomycin for 3 days. About 6% Tr1 cells were induced, which was abolished by enforced expression of Tert in BMDCs (Fig. 4 E-F). The results demonstrate that the over expression of Tert affects the immune tolerogenic functions in DCs. The immune tolerogenic functions of DC can be restored by CpG The methylation of the Tert promoter in FA DCs was increased by treating with CpG in culture (Fig. 5 A), and reduced the expression of Tert in the DCs (Fig. 5 B). The expression of Maf and Il10 was also up regulated by CpG (Fig. 5 C-D). CpG-primed DCs were cocultured with naive CD4 T cells for a period of 3 days. The results showed that the CpG-primed DCs converted about 4.46 ± 0.25% CD4 + T cells to Tr1 cells in contrast that only about 1.62 ± 0.24% CD4 + T cells were converted to Tr1 cells by non-primed FA DCs (Fig. 5 E-F). The results indicate that CpG can restore the immune tolerogenic functions in FA DCs. CpG promotes the therapeutic effects of allergen specific immunotherapy (AIT) in FA mice The murine FA model was established using ovalbumin (OVA) as the specific antigen (Fig. 2 A). The mice were treated with AIT with or without the addition of CpG. The sensitized mice showed the FA response, including diarrhea (Fig. 6 A), the core temperature decreased (Fig. 6 B), the amounts of EPX, Mcpt1, Th2 cytokines and sIgE were increased in GLF (Fig. 6 C-H), the amounts of IL-10 were decreased in GLF (Fig. 6 I). which was suppressed by AIT (Fig. 6 ). The therapeutic effects of AIT were significantly promoted by the addition of CpG, which was abolished by the presence of a neutralizing anti-IL-10 Ab (Fig. 6 ). We also found that the amounts of methylated Tert promoter were increased (Fig. 7 A), Tert mRNA were decreased (Fig. 7 B), Il10 mRNA levels were increased (Fig. 7 C), in DCs of FA mice, the frequency of Tr1 cells in the intestine was increased (Fig. 7 D-E), after the treatment of AIT together with CpG. The results demonstrate that CpG can be an adjuvant used to promote the effects of AIT. Discussion The present study revealed that the Tert promoter was at demethylated status in FA mouse intestinal DCs. FA DCs expressed high levels of Tert . The amounts of Tert mRNA in FA DCs were negatively correlated with the expression of Il10 . The FA response was correlated with the high levels of Tert and low expression of Il10 . The FA mouse intestine had a lower frequency of IL-10 + DCs. FA intestinal DCs had impaired immune tolerogenic functions, which could be restored by exposure to CpG. The effectiveness of AIT in experimental FA could be enhanced by the addition of CpG. The data indicates that Tert expression is elevated in intestinal DCs of FA mice. TERT is known to be involved in the pathogenesis of cancer. Inhibition of TERT has been employed in the studies of cancer treatment [ 16 ]. TERT influences immune cells’ functions [ 17 ]. Although the links between telomerases and inflammation remain to be investigated, association between telomerases and autoimmune diseases, such as diabetes, rheumatoid arthritis, systemic lupus erythematosus, has been documented [ 18 ]. Our data has added a new aspect to this study area by demonstrating that TERT interacts with CMIP in DCs. As a result, the expression of Il10 is decreased. The tolerogenic feature of DCs is impaired. The data indicates that intestinal DCs of FA mice had high TERT levels. The FA response and TERT amounts were found to have a positive correlation. The fact implies that the pathogenesis of FA is linked to the abnormal expression of TERT. TERT was found to have a negative impact on the expression of Il10 in DCs. IL-10 is one of the important immune regulatory mediators [ 19 ]. It suppresses other immune cells’ activities to modulate the ongoing immune reactions [ 19 ]. Cumulative reports indicate that insufficient or lack of IL-10 is associated with many immune diseases. Such as Il10 -/- mice show spontaneous enterocolitis [ 20 ]. The autoimmune encephalomyelitis (EAE) can automatically occur in Il10 -deficient mice [ 21 ]. Our data are in line with those pioneer studies by showing that the over expression of TERT-related IL-10 reduction plays an important role in the development of FA. DC-derived IL-10 can induce type 1 regulatory T cells (Tr1 cells) [ 22 ]. Current data also show a decreased frequency of Tr1 cells in the intestine of FA mice. The amount of IL-10 in intestinal DCs is correlated with this. The fact points to a connection between the low levels of IL-10 in DCs and the induction of Tr1 cells in the intestine. Tr1 cells are an important fraction of immune cells in the maintenance of the homeostasis in the body [ 23 , 24 ]. By producing IL-10, Tr1 cells suppress abnormal inflammation [ 24 ]. Depletion of IL-10 results in autoimmune inflammation in the body. Our data indicate that DCs isolated from FA mouse intestine are incompetent in the induction of Tr1 cells. The findings suggest that TERT inhibition could be a therapeutic approach for FA. We found that the amounts of CMIP were less in FA DCs compared to those in NC DCs. CMIP is the inducer of c-Maf [ 25 ], the transcription factor of Il10 . The assessment of the expression of Maf and Il10 in DCs was in line with the amounts of CMIP, as shown by the present data. According to the data, the low expression of Il10 in FA DCs could be attributed to the low levels of CMIP in FA DCs. In addition, we discovered a complex of TERT and CMIP in FA DCs. The physical contact between TERT and CMIP resulted in a decrease in Il10 expression in DCs. Tolerogenic DCs fulfill their immune tolerogenic functions through the mediation of IL-10. The results suggest that TERT may interfere with the ability of DCs to induce Tr1 cells. Current data validated the inference by demonstrating that FA DCs induced less Tr1 cells than NC DCs. It was observed that recombinant TERT could decrease Tr1 induction by DCs. The Tert promoter's methylation status can be increased by exposure to CpG, as shown in the data. In general, promoter methylation suppresses the gene expression [ 26 ]. Exposure to CpG in culture resulted in a decrease in Tert expression in FA DCs. The results implicate a therapeutic potential of CpG for the treatment of FA. AIT is a therapy that focuses on etiology and targets allergic diseases. The therapeutic efficacy of it needs to be improved. Our research indicates that the addition of CpG can enhance the effects of AIT on the treatment of experimental FA. In short, the intestinal DCs of FA mice exhibit a high expression of Tert , which impedes the expression of Il10 in DCs and hinders their tolerogenic ability. Tert expression in FA DCs can be inhibited by CpG administration and immune tolerogenic functions can be restored. The therapeutic effects of experimental FA can be enhanced by adding CpG to AIT. Abbreviations food allergy (FA); telomerase reverse transcriptase (TERT); dendritic cell (DC); type 1 Treg cells (Tr1 cells); Regulatory T cells (Treg cells); ovalbumin (OVA); gut lavage fluid (GLF); eosinophil peroxidase (EPX); mouse mast cell protease-1 (Mcpt1); lamina propria mononuclear cells (LPMCs); Flow cytometry (FCM); bone marrow derived dendritic cells (BMDCs); Allergen specific immunotherapy (AIT). Declarations Data availability : All the data are included in this paper. Conflict of interest : None to declare. Author contributions : Zeng H, Xu L, Liu J, Mo L, Li M, Song S, Xu X and Miao S performed experiments, analyzed data, and reviewed the manuscript. Yang P and Zhao M designed the project, supervised experiments, and prepared the manuscript. Acknowledgement : This study was supported by research grants of the National Natural Science Foundation of China (32090052), Shenzhen Key Medical Discipline Construction Fund (No. SZXK062), and Shenzhen science, technology, and innovation committee (KQTD20170331145453160). References Sicherer SH, Sampson HA. Food allergy: A review and update on epidemiology, pathogenesis, diagnosis, prevention, and management. J Allergy Clin Immunol. 2018;141:41–58. Seth D, Poowutikul P, Pansare M, Kamat D. Food Allergy: A Review. Pediatr Ann. 2020;49:e50–8. De Martinis M, Sirufo MM, Suppa M, Ginaldi L. New Perspectives in Food Allergy. Int J Mol Sci 2020; 21. Iweala OI, Burks AW. Food Allergy: Our Evolving Understanding of Its Pathogenesis, Prevention, and Treatment. Curr Allergy Asthma Rep. 2016;16:37. Anvari S, Miller J, Yeh CY, Davis CM. IgE-Mediated Food Allergy. Clin Rev Allergy Immunol. 2019;57:244–60. Abdel-Gadir A, Stephen-Victor E, Gerber GK, Noval Rivas M, Wang S, Harb H, Wang L, Li N, Crestani E, Spielman S, Secor W, Biehl H, DiBenedetto N, Dong X, Umetsu DT, Bry L, Rachid R, Chatila TA. Microbiota therapy acts via a regulatory T cell MyD88/RORγt pathway to suppress food allergy. Nat Med. 2019;25:1164–74. Brockmann L, Gagliani N, Steglich B, Giannou AD, Kempski J, Pelczar P, Geffken M, Mfarrej B, Huber F, Herkel J, Wan YY, Esplugues E, Battaglia M, Krebs CF, Flavell RA, Huber S. IL-10 Receptor Signaling Is Essential for TR1 Cell Function In Vivo. J Immunol. 2017;198:1130–41. Fortunato M, Amodio G, Gregori S. IL-10-Engineered Dendritic Cells Modulate Allogeneic CD8(+) T Cell Responses. Int J Mol Sci 2023; 24. Li L, Xu X, Wang X, Zhang S, Yao W, Liu J, Liu Z, Yang P. Galectin-9 in synergy with NF-κB inhibition restores immune regulatory capability in dendritic cells of subjects with food allergy. Clin Exp Immunol. 2023;213:155–63. Nedelkopoulou N, Dhawan A, Xinias I, Gidaris D, Farmaki E. Interleukin 10: the critical role of a pleiotropic cytokine in food allergy. Allergol Immunopathol (Madr). 2020;48:401–8. Yang LT, Li XX, Qiu SQ, Zeng L, Li LJ, Feng BS, Zheng PY, Liu ZG, Yang PC. Micro RNA-19a suppresses thrombospondin-1 in CD35(+) B cells in the intestine of mice with food allergy. Am J Transl Res. 2016;8:5503–11. So EY, Winchester T, Ouchi T. The screening of a microRNA expression during development of human macrophages and mouse dendritic cells. Cancer Biol Ther. 2017;18:152–7. He W, Yang C, Xia L, Zhao MZ, Ge RT, Huang H, Ji Q, Yang PC, Liu Z. CD4(+) T cells from food allergy model are resistant to TCR-dependent apoptotic induction. Cytokine. 2014;68:32–9. Islam SMT, Won J, Khan M, Mannie MD, Singh I. Hypoxia-inducible factor-1 drives divergent immunomodulatory functions in the pathogenesis of autoimmune diseases. Immunology. 2021;164:31–42. Yu D, Liu JQ, Mo LH, Luo XQ, Liu ZQ, Wu GH, Yang LT, Liu DB, Wang S, Liu ZG, Yang PC. Specific antigen-guiding exosomes inhibit food allergies by inducing regulatory T cells. Immunol Cell Biol. 2020;98:639–49. Yuan X, Larsson C, Xu D. Mechanisms underlying the activation of TERT transcription and telomerase activity in human cancer: old actors and new players. Oncogene. 2019;38:6172–83. Mao J, Zhang Q, Wang Y, Zhuang Y, Xu L, Ma X, Guan D, Zhou J, Liu J, Wu X, Liang Q, Wang M, Cong YS. TERT activates endogenous retroviruses to promote an immunosuppressive tumour microenvironment. EMBO Rep. 2022;23:e52984. Wu L, Fidan K, Um JY, Ahn KS. Telomerase: Key regulator of inflammation and cancer. Pharmacol Res. 2020;155:104726. Ouyang W, O'Garra A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity. 2019;50:871–91. Kühn R, Löhler J, Rennick D, Rajewsky K, Müller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75:263–74. Seifert HA, Gerstner G, Kent G, Vandenbark AA, Offner H. Estrogen-induced compensatory mechanisms protect IL-10-deficient mice from developing EAE. J Neuroinflammation. 2019;16:195. Ness S, Lin S, Gordon JR. Regulatory Dendritic Cells, T Cell Tolerance, and Dendritic Cell Therapy for Immunologic Disease. Front Immunol. 2021;12:633436. Jäger A, Kuchroo VK. Effector and regulatory T-cell subsets in autoimmunity and tissue inflammation. Scand J Immunol. 2010;72:173–84. Roncarolo MG, Gregori S, Battaglia M, Bacchetta R, Fleischhauer K, Levings MK. Interleukin-10-secreting type 1 regulatory T cells in rodents and humans. Immunol Rev. 2006;212:28–50. Wang Q, Li L, Li C, Cao H, Chen Y, Zhou W, Yang G, Yang H. Circadian protein CLOCK modulates regulatory B cell functions of nurses engaging day-night shift rotation. Cell Signal. 2022;96:110362. Greenberg MVC, Bourc'his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol. 2019;20:590–607. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 21 Jul, 2024 Read the published version in Immunologic Research → Version 1 posted Editorial decision: Revision requested 16 May, 2024 Reviews received at journal 15 May, 2024 Reviewers agreed at journal 08 May, 2024 Reviews received at journal 08 May, 2024 Reviewers agreed at journal 29 Apr, 2024 Reviews received at journal 04 Apr, 2024 Reviewers agreed at journal 29 Mar, 2024 Reviewers agreed at journal 27 Mar, 2024 Reviewers invited by journal 27 Mar, 2024 Editor assigned by journal 26 Mar, 2024 Submission checks completed at journal 26 Mar, 2024 First submitted to journal 22 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4152216","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":284523134,"identity":"5f36c360-c1ad-4c13-a313-ba636c7ff8d7","order_by":0,"name":"Haotao Zeng","email":"","orcid":"","institution":"Longgang ENT Hospital \u0026 Shenzhen ENT Institute","correspondingAuthor":false,"prefix":"","firstName":"Haotao","middleName":"","lastName":"Zeng","suffix":""},{"id":284523135,"identity":"bf62f49e-1df7-4624-92d1-d95f05808c17","order_by":1,"name":"Lingzhi Xu","email":"","orcid":"","institution":"Weifang Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lingzhi","middleName":"","lastName":"Xu","suffix":""},{"id":284523136,"identity":"62afcb98-b88f-473f-8428-44dfb7873aa9","order_by":2,"name":"Jiangqi Liu","email":"","orcid":"","institution":"Longgang ENT Hospital \u0026 Shenzhen ENT Institute","correspondingAuthor":false,"prefix":"","firstName":"Jiangqi","middleName":"","lastName":"Liu","suffix":""},{"id":284523138,"identity":"df72754a-dd28-4c52-b1eb-e5d61f1e67ac","order_by":3,"name":"Lihua Mo","email":"","orcid":"","institution":"Shenzhen University","correspondingAuthor":false,"prefix":"","firstName":"Lihua","middleName":"","lastName":"Mo","suffix":""},{"id":284523140,"identity":"da2a449c-4895-476d-9e8d-bb868ece8efa","order_by":4,"name":"Minyao Li","email":"","orcid":"","institution":"Shenzhen University","correspondingAuthor":false,"prefix":"","firstName":"Minyao","middleName":"","lastName":"Li","suffix":""},{"id":284523142,"identity":"fbf495f3-b458-4ee9-ab4a-6ecc219772e7","order_by":5,"name":"Shuo Song","email":"","orcid":"","institution":"Shenzhen University","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Song","suffix":""},{"id":284523144,"identity":"c61fe0d7-eefc-4a71-bfb7-315d4ffcd9f4","order_by":6,"name":"Xuejie Xu","email":"","orcid":"","institution":"Shenzhen University","correspondingAuthor":false,"prefix":"","firstName":"Xuejie","middleName":"","lastName":"Xu","suffix":""},{"id":284523146,"identity":"9530eacd-c41d-407b-bf75-acdc5382da72","order_by":7,"name":"Shihan Miao","email":"","orcid":"","institution":"Lihu Campus of Shenzhen University","correspondingAuthor":false,"prefix":"","firstName":"Shihan","middleName":"","lastName":"Miao","suffix":""},{"id":284523149,"identity":"3c33431e-256a-479b-9de3-11a1d96bc0ac","order_by":8,"name":"Miao Zhao","email":"","orcid":"","institution":"Longgang ENT Hospital \u0026 Shenzhen ENT Institute","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Zhao","suffix":""},{"id":284523151,"identity":"9c3617a2-58b8-498e-ba8f-9efa43393fd0","order_by":9,"name":"Pingchang Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYHACxocf/9jIsbG3HyBaC7OxZEOaMR/PmQSitbBJ8DYcSpwn4WBAnHpz9jMGEpI7DqS3STAkMPyo2EZYi2VPjoFB4Zk7uW3SjQcYe87cJqzF4AaPQYIE27PcNpkDCcyMbURqOcDDdjidTSLBgGgthg28bYcTiNdi2ZNWzCxxJs2wDRjIB4nyizn74e0/P1TYyMu3tx988KOCGIcxcCCi4wBh9WAt7A+IUjgKRsEoGAUjGAAA2049co5ZqN8AAAAASUVORK5CYII=","orcid":"","institution":"Lihu Campus of Shenzhen University","correspondingAuthor":true,"prefix":"","firstName":"Pingchang","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2024-03-23 00:14:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4152216/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4152216/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12026-024-09504-6","type":"published","date":"2024-07-22T02:52:15+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":53671846,"identity":"4e86f92a-357e-4c3a-b928-6d2d13f73f21","added_by":"auto","created_at":"2024-03-28 18:04:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":94964,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eTert\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e status in IL-10\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e DCs in the intestine\u003c/strong\u003e. A-C, LPMCs were prepared and analyzed by FCM. A, gating strategy of IL-10\u003csup\u003e+\u003c/sup\u003e DCs. B, DC counts. C, IL-10 MFI in IL-10\u003csup\u003e+\u003c/sup\u003e DCs. D, counts of CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003eIL-10\u003csup\u003e+\u003c/sup\u003e DCs. E-G, CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs (the IL-10\u003csup\u003e+\u003c/sup\u003e DC) were isolated from LPMCs. E, the \u003cem\u003eTert\u003c/em\u003e mRNA levels. F, the \u003cem\u003eTert\u003c/em\u003e promoter methylation status. G-H, correlation between IL-10 MFI and \u003cem\u003eTert\u003c/em\u003e mRNA (G) or \u003cem\u003eTert\u003c/em\u003e promoter methylation (H) in IL-10\u003csup\u003e+\u003c/sup\u003e DCs. Data of bars are presented as mean ± SD from 6 mice per group. Each dot in bars presents one sample (tested in triplicate). Statistics: Student’s \u003cem\u003et\u003c/em\u003e-test (C-F) and Pearson correlation coefficient test (G, H). The experiments were repeated three times.\u003c/p\u003e\n\u003cp\u003eAbbreviations: NC: Naïve control. FA: Food allergy. DC: Dendritic cell. LPMC: Lamina propria mononuclear cell. FCM: Flow cytometry.\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/7eee0567c9368bd714407cc1.png"},{"id":53671849,"identity":"c608b37d-1ae6-424d-98f4-3d3b2161f923","added_by":"auto","created_at":"2024-03-28 18:04:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":59808,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of the association between the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl10\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression in intestinal DCs and the FA response\u003c/strong\u003e. A, phase I: mice were sensitized by subcutaneous injection with OVA (100 μg/mouse in 0.1 ml alum) on the back skin on day 1 and day 7, respectively. Phase II: Mice receive gavage-feeding with OVA (1 mg/mouse in 0.3 ml PBS. Phase III: Mice were challenged by gavage-feeding with OVA (50 mg/mouse in 0.3 ml PBS). B, GLF was collected from mice and analyzed by ELISA. Bars present mean ± SD of the amounts of indicated molecules from 6 mice per group. Each dot in bars presents one sample (tested in triplicate). C, a heatmap shows correlation between indicated molecules in GLF and the mRNA levels of \u003cem\u003eIl10\u003c/em\u003e and \u003cem\u003eTert\u003c/em\u003ein intestinal DCs. Statistics: Student’s t-test (B, p values are presented in figures where appropriate) and Pearson correlation coefficient test (the coefficients are presented in each square of the heatmap). The experiments were repeated three times.\u003c/p\u003e\n\u003cp\u003eAbbreviations: NC: Naïve control. FA: Food allergy. OVA: Ovalbumin. GLF: Gut lavage fluid. Temp: Temperature.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/b02218bbfaf9dae11cd43272.png"},{"id":53671852,"identity":"90db18fd-3fba-40f3-871c-a07f4269ceb0","added_by":"auto","created_at":"2024-03-28 18:04:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":72843,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of the role of TERT interferes with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eIl10\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e expression in BMDCs\u003c/strong\u003e. A-G, BMDCs were prepared and treated as indicated procedures. A, \u003cem\u003eTert\u003c/em\u003e plasmid plasmid information. B, immunoblots show recombinant TERT in BMDCs. C-E, BMDCs were treated with the conditions denoted on the X axis. C, the amounts of IL-10 in culture supernatant after exposure to LPS (10 μg/ml) in culture for 24 h. D-E, the amounts of \u003cem\u003eMaf\u003c/em\u003e mRNA (D) and \u003cem\u003eIl10\u003c/em\u003e mRNA (E) in BMDCs. F, a complex of CMIP and TERT in BMDCs. G, ubiquitin staining of CMIP. H, mouse intestinal CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated and analyzed by Western blotting. Immunoblots show CMIP protein levels. Data of C-E are mean ± SD. Each dot in bars presents one sample (tested in triplicate). Statistics: ANOVA + Bonferroni test. \u003cem\u003ep\u003c/em\u003e values are presented in figures where appropriate. Experiments were repeated three times.\u003c/p\u003e\n\u003cp\u003eAbbreviations: BMDC: Bone marrow derived dendritic cell. Ef: Enforced expression of TERT. cEf: BMDCs were transfected with control plasmids.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/b34ff20ef814769e9e3674ed.png"},{"id":53671850,"identity":"a835ba93-aac4-4266-9344-a000cdadd8ce","added_by":"auto","created_at":"2024-03-28 18:04:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":60015,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTert affects the immune tolerogenic functions of DC\u003c/strong\u003e. A-D, CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated from the mouse intestinal tissues, and cocultured with naïve CD4\u003csup\u003e+\u003c/sup\u003e T cells for 3 days in the presence of PMA/ionomycin. A, gated FCM plots show Tr1 cell counts. B, mean ± SD of Tr1 cell counts from 6 mice per group. C, \u003cem\u003eTert\u003c/em\u003e mRNA levels in DCs. D, negative correlation between induced Tr1 cell counts and the \u003cem\u003eTert\u003c/em\u003e mRNA levels in DCs. E-F, BMDCs were firstly primed with LPS. Primed BMDCs were cocultured with naïve CD4\u003csup\u003e+\u003c/sup\u003e T cells for 3 days. E, gated plots show induced Tr1 cells. F, mean ± SD of Tr1 cell counts. Each dot in bars presents one sample. Statistics: Student’s t-test (B, C), ANOVA + Bonferroni test (F), and Pearson correlation coefficient test (D). \u003cem\u003ep\u003c/em\u003e values are presented in figures where appropriate. Experiments were repeated three times.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Abbreviations: NC: Naïve control. FA: Food allergy. PMA: Phorbol myristate acetate. FCM: Flow cytometry. BMDC: Bone marrow derived dendritic cell. Ef: Enforced expression of \u003cem\u003eTert\u003c/em\u003e in BMDCs. cEf: BMDCs were transfected with control plasmids.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/d9156e24a9b6c656186356fb.png"},{"id":53671847,"identity":"80add6af-c7ed-48ba-83ab-d8e6984e51a3","added_by":"auto","created_at":"2024-03-28 18:04:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":39682,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCpG restores the immune tolerogenic functions of FA DCs\u003c/strong\u003e. A-D, CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated from FA mouse intestinal tissues, and cultured with CpG (5 μg/ml) for 24 h. Bars indicate mean ± SD of the amounts of indicated molecules in DCs. E-F, the CpG-primed DCs were cultured with naïve CD4\u003csup\u003e+\u003c/sup\u003e T cells for 3 days. Gated FCM plots show the induced Tr1 cells. Bars show mean ± SD of induced Tr1 cells. Each dot in bars presents one sample (tested in triplicate). Statistics: Student’s \u003cem\u003et\u003c/em\u003e-test. \u003cem\u003ep\u003c/em\u003e values are presented in figures where appropriate.\u003c/p\u003e\n\u003cp\u003eAbbreviations: FA: Food allergy. DC: Dendritic cell. FCM: Flow cytometry. Tr1 cell: Type 1 regulatory T cell.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/f3438953f7900b31e81f4c48.png"},{"id":53671851,"identity":"046f0ffc-8cb0-4ed9-ae0f-024ba93a478a","added_by":"auto","created_at":"2024-03-28 18:04:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":100915,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCpG promotes the effects of AIT on FA\u003c/strong\u003e. FA mice were treated with the procedures denoted on the X axis. FA response was assessed. A, bars show diarrhea mice. B, bars show core temperature decreases in mice. C-I, bars show mean ± SD of the amounts of the indicated molecules in GLF. Each dot in bars presents one sample (tested in triplicate). Statistics: ANOVA + Bonferroni test. \u003cem\u003ep\u003c/em\u003e values are presented in figures where appropriate.\u003c/p\u003e\n\u003cp\u003eAbbreviations: NC: Naïve control. FA: Food allergy. FA response: FA related parameters. AIT: Allergen specific immunotherapy. GLF: Gut lavage fluid.\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/4f953cf7549be46778c90721.png"},{"id":53671853,"identity":"7ba7dc64-3a03-4dc1-93be-30d65bf4dd83","added_by":"auto","created_at":"2024-03-28 18:04:16","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":83814,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAssessment of the role of CpG in regulating intestinal DCs’ tolerogenic functions in FA mice\u003c/strong\u003e. FA mice were treated with the procedures denoted on the X axis of bar graphs. A-C, CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated from the intestine, and analyzed by methylation qPCR and RT-qPCR. A, Tert promoter methylation levels. B-C, mRNA levels of \u003cem\u003eTert\u003c/em\u003e (B) and \u003cem\u003eIl10\u003c/em\u003e (C). D-E, LPMCs were analyzed by FCM. The gated FCM plots show Tr1 cells (D). Bars show Tr1 cell counts in LPMCs (E). The data of bars are presented as mean ± SD from 6 mice per group. Each dot in bars presents one sample (tested in triplicate). Statistics: ANOVA + Bonferroni test. p values are presented in figures where appropriate.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Abbreviations: NC: Naïve control. FA: Food allergy. FCM: Flow cytometry. DC: Dendritic cell. LPMC: Lamina propria mononuclear cell.\u003c/p\u003e","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/6f52a5c87a8a9430603d43cc.png"},{"id":60781046,"identity":"ebbf1177-f167-4a84-93d4-fc9047fff84f","added_by":"auto","created_at":"2024-07-22 02:52:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1430139,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4152216/v1/37e0a34d-1f66-44a6-8cc9-7406393f4f3f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Regulation of Tert methylation alleviates food allergy via regulating the Tert-IL10 signal pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFood allergy (FA) is a common disease. It has a prevalence of around 2\u0026ndash;8% worldwide. The pathogenesis of FA is not clear [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. FA attacks induce various clinical symptoms, such as slight abdominal discomfort, abdominal pain, diarrhea, or even the life-threatening anaphylactic shock [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The therapies for FA are limited currently, that mainly focusing on avoiding taking the offending foods, and controlling the clinical symptoms [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. It is imperative to investigate the mechanism of FA further and develop more effective therapies for FA.\u003c/p\u003e \u003cp\u003eImmunologically, FA is an immune disease featuring Th2 cell polarization in the intestine. Dendritic cells (DCs) capture food antigens in the intestine. After processing, DCs transfer antigen information to CD4\u003csup\u003e+\u003c/sup\u003e T cells to induce Th2 cells. The Th2 cell polarization indicates that Th2 cells aggregate in the local tissues, where a large quantity of Th2 cytokine is produced by Th2 cells [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Th2 cytokines facilitate the production of IgE. IgE binds to the high affinity IgE receptor on the surface of mast cells to make mast cells sensitized. Upon re-exposure to specific antigens, sensitized mast cells release allergic mediators. These allergic mediators, such as histamine, tryptase, and serotonin, trigger FA attacks [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In general, the immune responses are tightly regulated by the immune regulatory system [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The Th2 cell polarization in the intestine indicates that the local immune regulatory system is not functioning properly.\u003c/p\u003e \u003cp\u003eOne of the major immune regulatory cell fractions are Regulatory T cells (Treg cells). Treg cells can be classified into two main subsets, Foxp3\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003e Treg cells and type 1 Treg cells (Tr1 cells). Upon activation, Tr1 cells release IL-10 to suppress other immune cell activities to avoid self-injury [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Tr1 cells can be induced by DC-derived IL-10 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Dysfunctional Tr1 cells have been noted in individuals with FA [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Factors and mechanisms that affect the functional status of Tr1 cells are not fully understood yet. In this study, we observed that Tr1 cells in FA mice were at a dysfunctional status. The expression of telomerase reverse transcriptase (TERT) was found to be high in DCs of FA mice. The TERT interfered with the expression of IL-10 in DCs to compromise the immune tolerogenic functions.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eAntibodies (Abs) of c-Maf (Clone#: E-7, Cat#: sc-518062), ubiquitin (P4D1, sc-8017), CD19 (B-1, sc-390244, AF488) and IL-10 (3C12C12, sc-32815, AF546), CD14 (H-4, sc-515785, AF594), F4/80 (D-11, sc-365340, AF648), MHC II (7-1H, sc-13556, AF680), CD5 (UCH-T2, sc-1180, AF700), CD1d (G-12, sc-373858, AF790), CD3 (PC3/188A, sc-20047, AF488), CD4 (MT310, sc-19641, AF546), CD25 (C-9, sc-393326, AF648), LAG3 (D-8, sc-514993, AF488) and CD49b (C-9, sc-74466, AF546) were purchased from Santa Cruz Biotech (Santa Cruz, CA). Ovalbumin, collagenase IV, and DNase I were purchased from Sigma Aldrich (St. Louis, MO). CpG-ODN 1826 (TCCATGACGTTCCTGACGTT), ELISA kits of IL-5, IL-4, IL-13, IL-10, Mcpt1, EPX, and ovalbumin (OVA)-specific IgE were purchased from Dakewe BioMart (Shenzhen, China). OVA, GM-CSF, phorbol myristate acetate, ionomycin, collagenase IV, were purchased from Sigma Aldrich (St. Louis., MO). Reagents and materials for Western blotting, RT-qPCR, immunoprecipitation (IP), and chromatin IP (ChIP) were purchased from Invitrogen (Carlsbad, CA). Neutralizing anti-IL-10 Ab (JES5-2A5, ab189392) was purchased from abcam (Cambridge, MA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eMale BALB/c mice (6-8-week-old) were purchased from Guangdong Experimental Animal Center (Fushan, China). Mice were maintained in a pathogen-free facility with access to food and water freely. The experiments were carried out in accordance with the ARRIVE guidelines. The Animal Ethics Committee at Shenzhen University reviewed and approved the animal experimental protocol (Approve#: 2022085).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of a murine FA model\u003c/h2\u003e \u003cp\u003eA murine FA model was established based on the established procedures [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Briefly, mice received subcutaneous injections of OVA (100 \u0026micro;g/mouse in 0.1 ml alum) on day 1 and day 7, respectively. Mice were then gavage-fed with OVA (1 mg/mouse in 0.3 ml saline) daily from day 9 to day 14. On day 15, mice were orally challenged with OVA (50 mg/mouse in 0.3 ml saline).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAssessment of the FA response\u003c/h2\u003e \u003cp\u003eThe core temperature was recorded from each mouse 30 min after the oral challenge. Mice with diarrhea were counted during 3 h after the challenge. Mice were then sacrificed by cervical dislocation. A jejunum segment (15 cm) was excised. The intestinal cavity was rinsed with 1 ml PBS, which was retrieved and used as the gut lavage fluid (GLF) for other experiments. The amounts of eosinophil peroxidase (EPX), mouse mast cell protease-1 (Mcpt1), IL-4, IL-5, IL-13, and OVA-specific IgE in GLF were determined by ELISA with commercial reagent kits following the manufacturer\u0026rsquo;s instruction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of lamina propria mononuclear cells (LPMCs)\u003c/h2\u003e \u003cp\u003eAfter the sacrifice, the small intestine was removed from the mice and opened longitudinally. The intestine was cut into segments about 5 cm in size, rinsed with PBS to wash out the contents in the intestinal cavity. The samples were incubated with ethylenediaminetetraacetic acid disodium salt (EDTA, 0.02%) for 5 min, and rinsed with PBS again. The tissues were cut into small pieces and incubated with the enzyme cocktail of 1 mg/ml collagenase IV and 2500 U/ml DNase I in complete RPMI1640 medium containing 2% fetal bovine serum (FBS) for 30 min at 37\u0026deg;C with mild agitation. Single cells were filtered through a cell strainer (100 \u0026micro;m first, then 70 \u0026micro;m). LPMCs were isolated from the single cells by the Percoll gradient density centrifugation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eCells were cultured in RPMI1640 medium supplemented with L-glutamine (2 mM), streptomycin (0.1 mg/ml), penicillin (100 U/ml), and fetal calf serum (10%). The Trypan blue exclusion assay showed that the cell viability was over 99%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry (FCM)\u003c/h2\u003e \u003cp\u003eThe surface markers of cells were stained using surface staining procedures. Briefly, live cells were stained with Abs of interest (labeled with proper fluorochromes; diluted to 1 \u0026micro;g/ml) or isotype IgG for 30 min at 4\u0026deg;C. Cells were washed with FCM buffer (phosphate-buffered saline, PBS, containing 1% bovine serum albumin) three times, and analyzed with a flow cytometer (BD FACSCanto II). To stain the intracellular molecules, cells were fixed with 1% paraformaldehyde (containing 0.05% Triton X-100 to increase the membrane permeability) for 1 h. After washing with PBS, cells were processed using the surface staining procedures. The data were processed with a software package, Flowjo (TreeStar Inc., Ashland, OR), with the data obtained from the isotype IgG staining as gating references.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of immune cells by FCM cell sorting\u003c/h2\u003e \u003cp\u003eSingle cells were prepared, and labeled with fluorochrome-labeled Abs. Cell types of interested (detailed in figures) were isolated by FCM cell sorting. The purity of isolated cells was assessed by FCM. It was over 95%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003epreparation of bone marrow derived dendritic cells (BMDCs)\u003c/h2\u003e \u003cp\u003eThe femurs bones were excised from na\u0026iuml;ve mice. The bone marrows were flushed out by saline. A red blood lysis kit was used to lyse red blood cells. Bone marrow cells were cultured in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF, 20 ng/ml) for 8 days. The non-adherent cells were collected, and used as BMDCs [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eMethylation-Specific PCR Assay\u003c/h2\u003e \u003cp\u003eDNA was extracted from purified DCs and treated with sodium bisulfate using the CpGenome DNA modification kit (Intergen, Purchase, NY). The modified DNA was analyzed by PCR as follows. Sense and antisense primer sequences for methylated and unmethylated \u003cem\u003eTert\u003c/em\u003e promoter (methylated: and ccccaaccaaattcaataattacta; unmethylated: aggatagatttttttgtttgttattt and ccccaaccaaattcaataattacta; both are 165 bp). PCR was performed using specific primers in 25 ml of a mixture containing 1\u0026times; PCR buffer, 0.5 mM concentration of each primer, 0.5 mM dNTP, 1 U of Taq polymerase.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eReal-time quantitative RT-PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTRIzol reagents were used to extract RNA samples from cells harvested from relevant experiments. cDNA was generated with a reverse transcription kit following the manufacturer\u0026rsquo;s instructions. The cDNA samples were amplified in a qPCR device (Bio-Rad CFX96) with a SYBR Green Master Mix kit. The primers used in the present study include \u003cem\u003eTert\u003c/em\u003e (actcagcaacctccagccta and catattggcactctgcatgg), \u003cem\u003eMaf\u003c/em\u003e (aaggaggaggtgatccgact and tctcctgcttgaggtggtct), \u003cem\u003eIl10\u003c/em\u003e (ccaagccttatcggaaatga and ttttcacaggggagaaatcg), and \u003cem\u003eActb\u003c/em\u003e (agccatgtacgtagccatcc and ctctcagctgtggtggtgaa). The results were processed using the formula of 2\u003csup\u003e-∆∆Ct\u003c/sup\u003e against the results of the housekeeping gene \u003cem\u003eActb\u003c/em\u003e, and presented as relative expression (RE).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCells from relevant experiments were used to prepare protein extracts, which were fractionated by sodium dodecyl sulfate \u0026ndash; polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with 5% skim milk for 30 min to block the non-specific binding, followed by incubated with primary Abs (Ab types are detailed in figures; diluted to 200 ng/ml) and second Abs (labeled with horseradish peroxidase; diluted to 20 ng/ml). After each incubation, the membrane was washed three times with Tris-buffered saline (containing 0.05% Tween 20; TBST). Enhanced chemiluminescence was used to develop immunoblots on the membrane and they were photographed using an imaging device (UVP, Cambridge, UK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eImmunoprecipitation (IP)\u003c/h2\u003e \u003cp\u003eProtein G agarose beads were used to precleared protein complexes in protein samples for 2 h. After centrifugation, the beads were discarded. After overnight incubation with Abs of interest or isotype IgG, the samples were then incubated with protein G agarose beads for 2 h. After centrifugation, the beads were collected. Western blotting was used to analyze proteins on the beads.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eChromatin IP (ChIP)\u003c/h2\u003e \u003cp\u003eCells were fixed with 1% formalin for 15 min, lysed with a lysing buffer, and sonicated to shear the DNA into small pieces. The samples were then processed using IP procedures. The protein-DNA on the beads was eluted with an eluting buffer and analyzed by qPCR in the presence of the \u003cem\u003eTert\u003c/em\u003e promoter primers. The results are presented as a fold change compared to the input.\u003c/p\u003e \u003cp\u003e \u003cb\u003eEnforced expression of\u003c/b\u003e \u003cb\u003eTert\u003c/b\u003e \u003cb\u003ein BMDCs\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eTert\u003c/em\u003e expression plasmids were constructed by a biotech company (Shanghai Sangon Biotech, Shanghai, China), and transfected into BMDCs with lipofectamine following the manufacturer\u0026rsquo;s instructions. The recombinant TERT protein in BMDCs was assessed by Western blotting 48 h after the transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAssessment the immune tolerogenic function of DC\u003c/h2\u003e \u003cp\u003eCD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated from LPMCs, and CD3\u003csup\u003e+\u003c/sup\u003eCD4\u003csup\u003e+\u003c/sup\u003eCD25⁻ T cells were isolated from the na\u0026iuml;ve mouse spleen by FCM cell sorting. The DCs and T cells were cocultured at a ratio of 1:5 in the presence of non-specific cell activators [phorbol myristate acetate (PMA, 50 ng/ml) and ionomycin (100 ng/ml)]. The induction of Tr1 cells was assessed by FCM three days later.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eAllergen specific immunotherapy (AIT)\u003c/h2\u003e \u003cp\u003eFollowing published procedures [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], FA mice were treated with oral AIT or/and CpG (100 \u0026micro;g/mouse). Briefly, OVA was gavage-fed with doses of 1 mg (days 1 and 2), 2 mg (days 3 and 4), 3 mg (days 5\u0026ndash;7), 4 mg (days 8 and 9), and 5 mg (days 10\u0026ndash;14). Control mice were treated with PBS. Oral challenge with OVA was conducted one day after the last treatment of AIT. FA response was assessed for each mouse.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eStudent's \u003cem\u003et\u003c/em\u003e-test was used to determine the difference between two groups. ANOVA\u0026thinsp;+\u0026thinsp;Bonferroni test was performed for multiple comparisons. Correlation between groups was carried out using the Pearson correlation coefficient test. \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was set as a significant criterion.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eTert\u003c/b\u003e \u003cb\u003epromoter is in demethylation status in DCs of FA mice\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLPMCs (lamina propria mononuclear cells) were prepared, and analyzed by flow cytometry (FCM). We found that fewer IL-10\u003csup\u003e+\u003c/sup\u003e DCs were detected in the FA group than the na\u0026iuml;ve control (NC) group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B). The FA group had a significantly lower quantity of IL-10 (the median fluorescence intensity, MFI) than the NC group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). CD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs (the IL-10\u003csup\u003e+\u003c/sup\u003e DCs [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) were isolated from LPMCs by FCM cell sorting, and analyzed by RT-qPCR and methylation specific PCR. The results showed that the \u003cem\u003eTert\u003c/em\u003e mRNA levels were higher in FA DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). FA DCs had a demethylation status of the \u003cem\u003eTert\u003c/em\u003e promoter compared to naive control (NC) DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). The levels of IL-10 MFI in DCs were positively correlated with the \u003cem\u003eTert\u003c/em\u003e promoter DNA methylation status (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). The \u003cem\u003eTert\u003c/em\u003e mRNA levels in DCs were negatively correlated with the IL-10 MFI amounts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). The findings suggest that TERT could influence the production of IL-10 in intestinal DCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTert\u003c/b\u003e \u003cb\u003eexpression in DCs is positively correlated with the FA response\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe association between \u003cem\u003eTert\u003c/em\u003e expression in intestinal DCs and the FA response was tested. A FA murine model was established with reported procedures [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). FA mice showed the FA response, including diarrhea, a drop in core temperature, elevated amounts of EPX, Mcpt1, Th2 cytokines, and specific IgE in the gut lavage fluids (GLF) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The FA response and the amounts of \u003cem\u003eTert\u003c/em\u003e mRNA in intestinal DCs were found to have a positive correlation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The results point to a link between the expression of \u003cem\u003eTert\u003c/em\u003e in intestinal DCs and the pathogenesis of FA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eTERT interferes with\u003c/b\u003e \u003cb\u003eIl10\u003c/b\u003e \u003cb\u003einduction in DCs\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBone marrow derived DCs (BMDCs) were exposed to LPS in culture overnight. The expression of \u003cem\u003eIl10\u003c/em\u003e in BMDCs was elevated. Enforced production of TERT in BMDCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B) markedly decreased the IL-10 induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The amount of \u003cem\u003eMaf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e mRNA levels in BMDCs decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-E). By immunoprecipitation (IP) assay, a complex of TERT and CMIP was detected in BMDCs with enforced production of TERT (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Ubiquitination was detected in CMIP protein in BMDCs, which was followed by protein degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Additionally, CMIP protein was detected in intestine-isolated DCs, the amounts of which were significantly lower in the FA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). The results demonstrate that TERT can interfere with the production of IL-10 in BMDCs by inducing CMIP degradation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eTERT impairs DCs\u0026rsquo; immune tolerogenic functions\u003c/h2\u003e \u003cp\u003eCD1d\u003csup\u003e+\u003c/sup\u003eCD5\u003csup\u003e+\u003c/sup\u003e DCs were isolated from the intestinal tissues of FA mice and NC mice, and cultured with na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T cells in the presence of phorbol myristate acetate (PMA) and ionomycin (non-specific cell activators) for 3 days. NC DCs (DCs were isolated from NC mice) induced about 6.1\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5% type 1 regulatory T cells (Tr1 cells), while FA DCs induced about 1.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5% Tr1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B). The efficiency of Tr1 cell induction was negatively correlated with the \u003cem\u003eTert\u003c/em\u003e mRNA levels in DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D). On the other hand, LPS-primed BMDCs were cocultured with na\u0026iuml;ve CD4\u003csup\u003e+\u003c/sup\u003e T cells in the presence of PMA and ionomycin for 3 days. About 6% Tr1 cells were induced, which was abolished by enforced expression of \u003cem\u003eTert\u003c/em\u003e in BMDCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-F). The results demonstrate that the over expression of \u003cem\u003eTert\u003c/em\u003e affects the immune tolerogenic functions in DCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eThe immune tolerogenic functions of DC can be restored by CpG\u003c/h2\u003e \u003cp\u003eThe methylation of the Tert promoter in FA DCs was increased by treating with CpG in culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), and reduced the expression of \u003cem\u003eTert\u003c/em\u003e in the DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The expression of \u003cem\u003eMaf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e was also up regulated by CpG (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D). CpG-primed DCs were cocultured with naive CD4 T cells for a period of 3 days. The results showed that the CpG-primed DCs converted about 4.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25% CD4\u003csup\u003e+\u003c/sup\u003e T cells to Tr1 cells in contrast that only about 1.62\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24% CD4\u003csup\u003e+\u003c/sup\u003e T cells were converted to Tr1 cells by non-primed FA DCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-F). The results indicate that CpG can restore the immune tolerogenic functions in FA DCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eCpG promotes the therapeutic effects of allergen specific immunotherapy (AIT) in FA mice\u003c/h2\u003e \u003cp\u003eThe murine FA model was established using ovalbumin (OVA) as the specific antigen (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The mice were treated with AIT with or without the addition of CpG. The sensitized mice showed the FA response, including diarrhea (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), the core temperature decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), the amounts of EPX, Mcpt1, Th2 cytokines and sIgE were increased in GLF (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-H), the amounts of IL-10 were decreased in GLF (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI). which was suppressed by AIT (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The therapeutic effects of AIT were significantly promoted by the addition of CpG, which was abolished by the presence of a neutralizing anti-IL-10 Ab (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). We also found that the amounts of methylated \u003cem\u003eTert\u003c/em\u003e promoter were increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), \u003cem\u003eTert\u003c/em\u003e mRNA were decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB), \u003cem\u003eIl10\u003c/em\u003e mRNA levels were increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), in DCs of FA mice, the frequency of Tr1 cells in the intestine was increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD-E), after the treatment of AIT together with CpG. The results demonstrate that CpG can be an adjuvant used to promote the effects of AIT.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study revealed that the \u003cem\u003eTert\u003c/em\u003e promoter was at demethylated status in FA mouse intestinal DCs. FA DCs expressed high levels of \u003cem\u003eTert\u003c/em\u003e. The amounts of \u003cem\u003eTert\u003c/em\u003e mRNA in FA DCs were negatively correlated with the expression of \u003cem\u003eIl10\u003c/em\u003e. The FA response was correlated with the high levels of \u003cem\u003eTert\u003c/em\u003e and low expression of \u003cem\u003eIl10\u003c/em\u003e. The FA mouse intestine had a lower frequency of IL-10\u003csup\u003e+\u003c/sup\u003e DCs. FA intestinal DCs had impaired immune tolerogenic functions, which could be restored by exposure to CpG. The effectiveness of AIT in experimental FA could be enhanced by the addition of CpG.\u003c/p\u003e \u003cp\u003eThe data indicates that \u003cem\u003eTert\u003c/em\u003e expression is elevated in intestinal DCs of FA mice. TERT is known to be involved in the pathogenesis of cancer. Inhibition of TERT has been employed in the studies of cancer treatment [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. TERT influences immune cells\u0026rsquo; functions [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Although the links between telomerases and inflammation remain to be investigated, association between telomerases and autoimmune diseases, such as diabetes, rheumatoid arthritis, systemic lupus erythematosus, has been documented [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Our data has added a new aspect to this study area by demonstrating that TERT interacts with CMIP in DCs. As a result, the expression of Il10 is decreased. The tolerogenic feature of DCs is impaired.\u003c/p\u003e \u003cp\u003eThe data indicates that intestinal DCs of FA mice had high TERT levels. The FA response and TERT amounts were found to have a positive correlation. The fact implies that the pathogenesis of FA is linked to the abnormal expression of TERT. TERT was found to have a negative impact on the expression of \u003cem\u003eIl10\u003c/em\u003e in DCs. IL-10 is one of the important immune regulatory mediators [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. It suppresses other immune cells\u0026rsquo; activities to modulate the ongoing immune reactions [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Cumulative reports indicate that insufficient or lack of IL-10 is associated with many immune diseases. Such as \u003cem\u003eIl10\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mice show spontaneous enterocolitis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The autoimmune encephalomyelitis (EAE) can automatically occur in \u003cem\u003eIl10\u003c/em\u003e-deficient mice [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Our data are in line with those pioneer studies by showing that the over expression of TERT-related IL-10 reduction plays an important role in the development of FA.\u003c/p\u003e \u003cp\u003eDC-derived IL-10 can induce type 1 regulatory T cells (Tr1 cells) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Current data also show a decreased frequency of Tr1 cells in the intestine of FA mice. The amount of IL-10 in intestinal DCs is correlated with this. The fact points to a connection between the low levels of IL-10 in DCs and the induction of Tr1 cells in the intestine. Tr1 cells are an important fraction of immune cells in the maintenance of the homeostasis in the body [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. By producing IL-10, Tr1 cells suppress abnormal inflammation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Depletion of IL-10 results in autoimmune inflammation in the body. Our data indicate that DCs isolated from FA mouse intestine are incompetent in the induction of Tr1 cells. The findings suggest that TERT inhibition could be a therapeutic approach for FA.\u003c/p\u003e \u003cp\u003eWe found that the amounts of CMIP were less in FA DCs compared to those in NC DCs. CMIP is the inducer of c-Maf [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], the transcription factor of \u003cem\u003eIl10\u003c/em\u003e. The assessment of the expression of \u003cem\u003eMaf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e in DCs was in line with the amounts of CMIP, as shown by the present data. According to the data, the low expression of \u003cem\u003eIl10\u003c/em\u003e in FA DCs could be attributed to the low levels of CMIP in FA DCs. In addition, we discovered a complex of TERT and CMIP in FA DCs. The physical contact between TERT and CMIP resulted in a decrease in \u003cem\u003eIl10\u003c/em\u003e expression in DCs. Tolerogenic DCs fulfill their immune tolerogenic functions through the mediation of IL-10. The results suggest that TERT may interfere with the ability of DCs to induce Tr1 cells. Current data validated the inference by demonstrating that FA DCs induced less Tr1 cells than NC DCs. It was observed that recombinant TERT could decrease Tr1 induction by DCs.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eTert\u003c/em\u003e promoter's methylation status can be increased by exposure to CpG, as shown in the data. In general, promoter methylation suppresses the gene expression [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Exposure to CpG in culture resulted in a decrease in \u003cem\u003eTert\u003c/em\u003e expression in FA DCs. The results implicate a therapeutic potential of CpG for the treatment of FA. AIT is a therapy that focuses on etiology and targets allergic diseases. The therapeutic efficacy of it needs to be improved. Our research indicates that the addition of CpG can enhance the effects of AIT on the treatment of experimental FA.\u003c/p\u003e \u003cp\u003eIn short, the intestinal DCs of FA mice exhibit a high expression of \u003cem\u003eTert\u003c/em\u003e, which impedes the expression of Il10 in DCs and hinders their tolerogenic ability. \u003cem\u003eTert\u003c/em\u003e expression in FA DCs can be inhibited by CpG administration and immune tolerogenic functions can be restored. The therapeutic effects of experimental FA can be enhanced by adding CpG to AIT.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003efood allergy (FA); telomerase reverse transcriptase (TERT); dendritic cell (DC); type 1 Treg cells (Tr1 cells); Regulatory T cells (Treg cells); ovalbumin (OVA); gut lavage fluid (GLF); eosinophil peroxidase (EPX); mouse mast cell protease-1 (Mcpt1); lamina propria mononuclear cells (LPMCs); Flow cytometry (FCM); bone marrow derived dendritic cells (BMDCs); Allergen specific immunotherapy (AIT).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e: All the data are included in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e: None to declare.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e: Zeng H, Xu L, Liu J, Mo L, Li M, Song S, Xu X and Miao S performed experiments, analyzed data, and reviewed the manuscript. Yang P and Zhao M designed the project, supervised experiments, and prepared the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e: This study was supported by research grants of the National Natural Science Foundation of China (32090052), Shenzhen Key Medical Discipline Construction Fund (No. SZXK062), and Shenzhen science, technology, and innovation committee (KQTD20170331145453160).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSicherer SH, Sampson HA. Food allergy: A review and update on epidemiology, pathogenesis, diagnosis, prevention, and management. J Allergy Clin Immunol. 2018;141:41\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeth D, Poowutikul P, Pansare M, Kamat D. Food Allergy: A Review. Pediatr Ann. 2020;49:e50\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Martinis M, Sirufo MM, Suppa M, Ginaldi L. New Perspectives in Food Allergy. Int J Mol Sci 2020; 21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIweala OI, Burks AW. Food Allergy: Our Evolving Understanding of Its Pathogenesis, Prevention, and Treatment. Curr Allergy Asthma Rep. 2016;16:37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnvari S, Miller J, Yeh CY, Davis CM. IgE-Mediated Food Allergy. Clin Rev Allergy Immunol. 2019;57:244\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel-Gadir A, Stephen-Victor E, Gerber GK, Noval Rivas M, Wang S, Harb H, Wang L, Li N, Crestani E, Spielman S, Secor W, Biehl H, DiBenedetto N, Dong X, Umetsu DT, Bry L, Rachid R, Chatila TA. Microbiota therapy acts via a regulatory T cell MyD88/RORγt pathway to suppress food allergy. Nat Med. 2019;25:1164\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrockmann L, Gagliani N, Steglich B, Giannou AD, Kempski J, Pelczar P, Geffken M, Mfarrej B, Huber F, Herkel J, Wan YY, Esplugues E, Battaglia M, Krebs CF, Flavell RA, Huber S. IL-10 Receptor Signaling Is Essential for TR1 Cell Function In Vivo. J Immunol. 2017;198:1130\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFortunato M, Amodio G, Gregori S. IL-10-Engineered Dendritic Cells Modulate Allogeneic CD8(+) T Cell Responses. Int J Mol Sci 2023; 24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi L, Xu X, Wang X, Zhang S, Yao W, Liu J, Liu Z, Yang P. Galectin-9 in synergy with NF-κB inhibition restores immune regulatory capability in dendritic cells of subjects with food allergy. Clin Exp Immunol. 2023;213:155\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNedelkopoulou N, Dhawan A, Xinias I, Gidaris D, Farmaki E. Interleukin 10: the critical role of a pleiotropic cytokine in food allergy. Allergol Immunopathol (Madr). 2020;48:401\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang LT, Li XX, Qiu SQ, Zeng L, Li LJ, Feng BS, Zheng PY, Liu ZG, Yang PC. Micro RNA-19a suppresses thrombospondin-1 in CD35(+) B cells in the intestine of mice with food allergy. Am J Transl Res. 2016;8:5503\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSo EY, Winchester T, Ouchi T. The screening of a microRNA expression during development of human macrophages and mouse dendritic cells. Cancer Biol Ther. 2017;18:152\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe W, Yang C, Xia L, Zhao MZ, Ge RT, Huang H, Ji Q, Yang PC, Liu Z. CD4(+) T cells from food allergy model are resistant to TCR-dependent apoptotic induction. Cytokine. 2014;68:32\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIslam SMT, Won J, Khan M, Mannie MD, Singh I. Hypoxia-inducible factor-1 drives divergent immunomodulatory functions in the pathogenesis of autoimmune diseases. Immunology. 2021;164:31\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu D, Liu JQ, Mo LH, Luo XQ, Liu ZQ, Wu GH, Yang LT, Liu DB, Wang S, Liu ZG, Yang PC. Specific antigen-guiding exosomes inhibit food allergies by inducing regulatory T cells. Immunol Cell Biol. 2020;98:639\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan X, Larsson C, Xu D. Mechanisms underlying the activation of TERT transcription and telomerase activity in human cancer: old actors and new players. Oncogene. 2019;38:6172\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao J, Zhang Q, Wang Y, Zhuang Y, Xu L, Ma X, Guan D, Zhou J, Liu J, Wu X, Liang Q, Wang M, Cong YS. TERT activates endogenous retroviruses to promote an immunosuppressive tumour microenvironment. EMBO Rep. 2022;23:e52984.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu L, Fidan K, Um JY, Ahn KS. Telomerase: Key regulator of inflammation and cancer. Pharmacol Res. 2020;155:104726.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang W, O'Garra A. IL-10 Family Cytokines IL-10 and IL-22: from Basic Science to Clinical Translation. Immunity. 2019;50:871\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026uuml;hn R, L\u0026ouml;hler J, Rennick D, Rajewsky K, M\u0026uuml;ller W. Interleukin-10-deficient mice develop chronic enterocolitis. Cell. 1993;75:263\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeifert HA, Gerstner G, Kent G, Vandenbark AA, Offner H. Estrogen-induced compensatory mechanisms protect IL-10-deficient mice from developing EAE. J Neuroinflammation. 2019;16:195.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNess S, Lin S, Gordon JR. Regulatory Dendritic Cells, T Cell Tolerance, and Dendritic Cell Therapy for Immunologic Disease. Front Immunol. 2021;12:633436.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ\u0026auml;ger A, Kuchroo VK. Effector and regulatory T-cell subsets in autoimmunity and tissue inflammation. Scand J Immunol. 2010;72:173\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoncarolo MG, Gregori S, Battaglia M, Bacchetta R, Fleischhauer K, Levings MK. Interleukin-10-secreting type 1 regulatory T cells in rodents and humans. Immunol Rev. 2006;212:28\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Li L, Li C, Cao H, Chen Y, Zhou W, Yang G, Yang H. Circadian protein CLOCK modulates regulatory B cell functions of nurses engaging day-night shift rotation. Cell Signal. 2022;96:110362.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreenberg MVC, Bourc'his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol. 2019;20:590\u0026ndash;607.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"immunologic-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"imre","sideBox":"Learn more about [Immunologic Research](http://link.springer.com/journal/12026)","snPcode":"12026","submissionUrl":"https://submission.nature.com/new-submission/12026/3","title":"Immunologic Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Food allergy, dendritic cell, IL-10, TERT, immunotherapy","lastPublishedDoi":"10.21203/rs.3.rs-4152216/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4152216/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe pathogenesis of food allergy (FA) is still not fully understood. Telomerases are involved in the regulation of immune responses. The aim of this study is to understand the contribution of telomerase reverse transcriptase (TERT) to the pathogenesis of FA. A murine FA model was established with ovalbumin as the specific antigen. This murine model was used to test the role of TERT in the regulation of dendritic cell (DC) immune tolerogenic functions. We observed that the \u003cem\u003eTert\u003c/em\u003e promoter was at demethylation status and the \u003cem\u003eTert\u003c/em\u003e expression was elevated in DCs of FA mice. The FA response was positively correlated with the \u003cem\u003eTert\u003c/em\u003e expression in DCs. Induction of \u003cem\u003eIl10\u003c/em\u003e expression in DCs was hindered by TERT. TERT hindered the immune tolerogenic functions of DCs. The immune tolerogenic functions of DC were restored by CpG by boosting the \u003cem\u003eTert\u003c/em\u003e promoter methylation. Administration of CpG promoted the therapeutic effects of allergen specific immunotherapy in FA mice. In conclusion, low levels of \u003cem\u003eIl10\u003c/em\u003e expression and high levels of \u003cem\u003eTert\u003c/em\u003e expression were observed in intestinal DCs of FA mice. CpG exposure restored the expression of \u003cem\u003eIl10\u003c/em\u003e and increased the therapeutic benefits of allergen-specific immunotherapy.\u003c/p\u003e","manuscriptTitle":"Regulation of Tert methylation alleviates food allergy via regulating the Tert-IL10 signal pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-28 18:04:10","doi":"10.21203/rs.3.rs-4152216/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-05-16T07:49:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-15T14:43:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"244606743407363617158032400798910819416","date":"2024-05-09T01:53:06+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-05-08T11:09:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"191355873181804425840853576049599749527","date":"2024-04-29T04:26:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-04T11:01:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4a901b88-2326-4480-814b-da23b498ab52","date":"2024-03-29T05:45:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"153c88e0-ceba-4af6-b0f0-10771a7b22b7","date":"2024-03-27T12:15:43+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-27T04:43:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-26T05:44:13+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-26T05:44:12+00:00","index":"","fulltext":""},{"type":"submitted","content":"Immunologic Research","date":"2024-03-23T00:09:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"immunologic-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"imre","sideBox":"Learn more about [Immunologic Research](http://link.springer.com/journal/12026)","snPcode":"12026","submissionUrl":"https://submission.nature.com/new-submission/12026/3","title":"Immunologic Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8435e18a-9efc-4c8c-91e4-ad3e8459b883","owner":[],"postedDate":"March 28th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-07-22T02:52:15+00:00","versionOfRecord":{"articleIdentity":"rs-4152216","link":"https://doi.org/10.1007/s12026-024-09504-6","journal":{"identity":"immunologic-research","isVorOnly":false,"title":"Immunologic Research"},"publishedOn":"2024-07-22 02:52:15","publishedOnDateReadable":"July 22nd, 2024"},"versionCreatedAt":"2024-03-28 18:04:10","video":"","vorDoi":"10.1007/s12026-024-09504-6","vorDoiUrl":"https://doi.org/10.1007/s12026-024-09504-6","workflowStages":[]},"version":"v1","identity":"rs-4152216","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4152216","identity":"rs-4152216","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.