A novel genotyping technique for discriminating LVAS-associated high-frequency variants in SLC26A4 gene | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Original article A novel genotyping technique for discriminating LVAS-associated high-frequency variants in SLC26A4 gene Chen Zhou, Xiangman Zou, Cuiying Peng, Guoqiang Gao, Zifen Guo This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.20855/v2 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Sep, 2020 Read the published version in AMB Express → Version 2 posted 4 You are reading this latest preprint version Show more versions Abstract An increasing number of biological and epidemiological evidence suggests that c.919-2A>G and c.2168A>G variants of solute carrier family 26, member 4 ( SLC26A4 ) gene play a critical role in the development of large vestibular aqueduct syndrome (LVAS). In this study, we developed a rapid genotyping method for discriminating LVAS-associated high-frequency variants in SLC26A4 gene. The genotyping technique consists of 3’ terminal exonuclease-resistant phosphorothioate-modified allele specific primer extension mediated by exo + polymerase. In PCR amplification by Pfu polymerase, allelic specific primers perfectly matching wild type allele were extended while no specific products were yielded from primers targeting variant allele. Similarly, allelic specific primers perfectly matching variant allele were extended and no specific products were observed from primers targeting wild type allele. The clinical application of 3’ terminal phosphorothioate-modified allele specific primer extension mediated by Pfu polymerase identified both homozygous for SLC26A4 gene c.919-2A>G variant in two patients clinically diagnosed as LVAS by temporal bone CT scan. The genetic results from this method are consistent with that of DNA sequencing. The data suggest that exo + polymerase-mediated 3’ terminal phosphorothioate-modified primer extension is reliable in the identification of SLC26A4 gene high-frequency variant prior to high-resolution CT scan. The method is extremely suitable for quickly molecular etiologic screening and early diagnosis and aggressive prevention therapy of LVAS. Epigenetics & Genomics Solute carrier family 26 member 4 large vestibular aqueduct syndrome exo+ polymerase phosphorothioate modification Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Large vestibular aqueduct syndrome (LVAS) is an autosomal recessive genetic hearing loss disorder with a high incidence which is mainly accompanied by progressive and fluctuating hearing loss (Tong et al. 1997; Claros et al. 2017). It is well known that the solute carrier family 26, member 4 ( SLC26A4 ) gene plays a critical role in the development of LVAS, and about 90% of LVAS is closely attributed to SLC26A4 gene variants (Nishio et al. 2016; Chao et al. 2019; Kim et al. 2019). The human SLC26A4 gene is mapped to chromosome 7q31, encompasses 21 exons and contains a 2343 bp open reading frame encoding a protein of 780 amino acids. To date, more than 100 of SLC26A4 gene variants have been identified and described as causally related to hereditary hearing impairment (https://hereditaryhearingloss.org/). Before the clinical application of gene diagnosis, the imageological examination was the only way of LVAS diagnosis and had stated clearly that LVAS is the most common inner ear malformation(Connor et al. 2019; Yang and Liu 2019). Previous studies revealed that SLC26A4 gene variant has obvious racial specificity, LVAS patients from different races with unique variant spectra and different variant frequencies(Berrettini et al. 2005; Hu et al. 2007; Lee et al. 2008). For years, the interest in SLC26A4 gene variant closely associated with Chinese LVAS individuals has been focused on c.919-2A>G and c. 2168A>G variants (Hu et al. 2007; Zhu et al. 2012), The two most common types (c.919-2A>G and c. 2168A>G) accounted for 69.1% (Hu et al. 2007) and 33.06% (Guo et al. 2008) variants respectively. Therefore, screening the high-frequency variant can early diagnose LVAS patients and find variant carriers and then taking measures to prevent further hearing loss by keeping LVAS patients from cold and head injury. We have previously reported that exo + polymerase-mediated 3’ terminal exonuclease-resistant phosphorothioate-modified allele specific primer extension formed a molecular switch sensitive to single nucleotide discrimination (Zhang and Li 2003; Zhang et al. 2005). For 3’ allele-specific primers with phosphorothioate-modification, perfect-matched primer turns on and mismatched primer turns off DNA polymerization. Exo + polymerases generated products only from perfect-matched primers and no products from mismatched primers, which provided an unambiguous readout for yes or no in a specific variant detection assay. In this study, we will construct a double PCR technology platform mediated by variant sensitive molecular switch for rapid screening the SLC26A4 gene c.919-2A>G and c.2168A>G high-frequency variants and explore strategies for clinical genetic diagnosis. Materials And Methods Reagents Pfu DNA polymerase with strong 3’→5’ exonuclease activity was purchased from TaKaRa Bio Inc. (Dalian, China). KOD-Plus-Mutagenesis Kit used in this study was obtained from TOYOBO Inc. (Shanghai, China). pMD19-T vector was the product of TaKaRa Bio Inc. (Dalian, China). Both unmodified primers and phosphorothioate-modified primers were synthesized commercially by TaKaRa Bio Inc. (Dalian, China). Primer design There are three types of primers: wild template preparation primers, mutagenesis primers and detection primers. The unmodified primers for wild type SLC26A4 gene preparation were designed based on the information of the Genebank database (NC_000007.14). The mutagenesis primers for SLC26A4 gene c.919-2A>G and c.2168A>G variants through inverse PCR were designed to create point variants in the corresponding sites according to the Muta Primer 2.0 software. Allelic specific detection primers targeting wild and mutant templates were both designed with 3’ terminal phosphorothioate-modification. The 3’ terminal upstream to the -2 base (T or C) of the reverse primer of c.919-2A>G and the forward primer of c.2168A>G (A or G) were the respective variant loci. All primers were synthesized by TaKaRa Bio Inc according to the following sequences as illustrated in Table 1, and the graphic illustration of primers is shown as supplementary material. Vector construction and identification Overlapping PCR generated SLC26A4 gene fragment harboring c.919-2A>G and c.2168A>G flanking sequence, which was subsequently added A base and then inserted into the pMD19-T vector followed by transforming into E.coli JM109 competent cells. After 37℃ incubation for 12 h, some clones were formed on the LB-agar plates containing X-Gal, IPTG and Ampicillin. White clones were randomly picked up for bacilli PCR amplification reaction with the M13 primers as an initial identification of the inserted DNA overlapped fragment by their size, and 1.0 ml bacilli of each positive clone were sent to Invitrogen Biotechnology Co. Ltd. (Shanghai, China) for DNA sequencing. Inverse PCR according to the manufacturer’s protocol was performed twice for site-directed mutagenesis of c.919-2A>G and c.2168A>G variant in SLC26A4 gene. Following the degradation of the methylated DNA template by DpnI endonuclease, the mutant circular PCR product was transformed into E.coli JM109 competent cells again. Similarly, the SLC26A4 gene c.919-2A>G and c.2168A>G mutant template was also confirmed by sequence analysis. Extension of phosphorothioate-modified primers by exo + polymerase Two-directional primer extension was setup. Following denaturation at 95°C for 2 min, the primer extension was carried out for 30 cycles as follows: 30 sec for denaturation at 95°C, 30 sec for annealing at 60°C, and 20 sec for extension at 72°C. After the 30 cycles, an extra extension of 2 min was done before the reaction mixture was cooled down to 4°C. The primer extension reaction was performed in a total volume of 30 µL with 20 pg of template, 0.2 mmol/L dNTP, 10 Ku/L of polymerase, 10 pmol/µL of both sense and antisense primers, and 2.5µL of the 10x Pfu polymerase reaction buffer which provides a final concentration of 10 mmol/L KCl, 20 mmol/L Tris-HCl (pH 8.8 at 25 °C), 10 mmol/L (NH 4 ) 2 SO 4 , 2 mmol/L MgSO 4 , 0.1% Triton X-100. Electrophoresis in a 2.0% agarose EtBr gel at 8 V/cm in 0.5x TBE buffer was used to check whether the two-directional primer extension products were produced or not. High-frequency variants screening on clinical LVAS patient 2.0 ml of peripheral vein blood was obtained from two cases from the second affiliated hospital of University of South China, who were diagnosed as LVAS by the high-resolution temporal bone CT imageological examination, and the human genomic DNA from the peripheral blood lymphocytes was extracted using phenol-chloroform extraction method. Pfu DNA polymerase combining with 3’ terminal phosphorothioate-modified primers targeting c.919-2A>G and c.2168A>G variants were utilized to screen the SLC26A4 gene on LVAS patients whether harboring either c.919-2A>G or c.2168A>G high-frequency variant. Furthermore, another PCR amplification was also carried out to separately get exon7+8 and exon19 fragment in SLC26A4 gene, which is suitable product including c.919-2A>G and c.2168A>G locus, and 1.0 ml of the purified primer extended products were further used for sequence analysis from Invitrogen Biotechnology Co. Ltd. (Shanghai, China). Results Construction and identification of vector PCR-generated wild DNA fragment separately harboring SLC26A4 gene c.919-2A>G and c.2168A>G flanking sequence were successfully overlapped (Fig. 1). After the overlapped DNA fragment was inserted into the pMD19-T vector and subsequently transformed into E.coli JM109 competent cells, some white clones were formed on the X-Gal/IPTG/ampicillin/LB-agar plates and randomly picked up for bacilli PCR amplification with the M13 primers to obtain positive clones. DNA sequencing not only confirmed the correctness of wild vector sequence as wild type template (Fig. 2a,2c), and also documented the mutagenesis of c.919-2A>G and c.2168A>G through inverse PCR: the existence of SLC26A4 gene c.919-2G and c.2168G variants in the mutant vector as mutant type template (Fig. 2b, 2d). Nucleotide Discrimination by exo + polymerase The data illustrated in Table 2 and Fig. 3 clearly showed that c.919-2A>G and c.2168A>G allelic specific primers perfectly matching wild type allele template were extended while no products were produced from point-mutated LVAS-associated mutant type allele template, and also allelic specific primers perfectly matching point-mutated LVAS-associated mutant type allele template were extended but no products were observed from wild type allele template. Furthermore, we carried out double PCR for SLC26A4 gene c.919-2A>G and c.2168A>G variants identification, and similarly, the matched primer extension was extended while the mismatched primer was not. But it was important to remind that duplex PCR generated an additional 518bp nonspecific fragment regardless of primers perfectly matching constructed vector template or not, which was the product from the pair of amplification primer consisting of the forward detection primer of c.919-2A>G and the reverse detection primer of c.2168A>G. Since 3’→5’ exonuclease activity of high-fidelity DNA polymerase can efficiently detect and proofread the mismatched base of the allele specific primer, once high-fidelity DNA polymerase combining with 3’ terminal exonuclease-resistant phosphorothioate-modified allele specific primer, the perfect-matched primer turned on and the mismatched primer turned off DNA polymerization. That provides an unambiguous readout for yes or no in single nucleotide discrimination: only the perfect-matched phosphorothioate-modified primer extension mediated by pfu DNA polymerase generated specific products and the mismatched primers extension not. Clinical application on screening the SLC26A4 high-frequency variant Pfu DNA polymerase-mediated phosphorothioate-modified primer extension was used to identify the SLC26A4 gene variant on the LVAS patients who had been diagnosed as LVAS by temporal bone CT scan. The two LVAS patients both harbored c.919-2A>G variant and were both homozygous for c.919-2A>G variant confirmed by DNA sequencing (Fig.4). Discussion LVAS is frequently seen in children and teenagers, and congenital or acquired sensorineural hearing loss is its main manifestation. Now high-resolution temporal bone CT and MRI imageological examination are still the gold standards and a prerequisite for the correct diagnosis of LVAS. However, most domestic hospitals not only lack the requirement suitable for imageological diagnosis but also have no technologies that seem appropriate. As a result, most LVAS patients cannot receive timely correct diagnosis so that the doctor cannot provide effective treatment and prevention advice to him. Thankfully, with the clinical application of deafness-associated gene variant screening, it has demonstrated the particular advantages in the etiologic diagnosis of deafness. Numerous studies indicate that c.919-2A>G and c.2168A>G variants in SLC26A4 gene are the high-frequency variants associated with Chinese LVAS individuals(Hu et al. 2007; Guo et al. 2008; Jiang et al. 2010; Li et al. 2011), which is similar to other patients in East Asia(Shin et al. 2012; Tsukamoto et al. 2003) and benefits SLC26A4 gene high-frequency variant screening in clinical application. Remarkably, none can effectively cure LVAS patients from etiology to symptoms until now, so early diagnosis and aggressive prevention therapy have great practical significance in preventing hearing further decline. Detecting LVAS-associated high-frequency variant c.919-2A>G and c.2168A>G is extremely useful in the early diagnosis and intervention of LVAS, and the current research has focused on how to quickly screen SLC26A4 gene variant for foundationally preventing the occurrence of LVAS. Prohibiting either c.919-2A>G or c.2168A>G variant carrier from marrying another one with the same variant is thus the most effective way to protect the occurrence of LVAS. As we all know, many gene variants assay technologies have been developed over the past decades, and the most popular methods are different variants of allele-specific primer extension mediated by DNA polymerases: High-throughput sequencing, Sanger’s method, restriction fragment length polymorphism (RFLP), multiplex ligation-dependent probe amplification (MLPA) and so on. High-throughput sequencing is a revolutionary technological innovation in gene sequencing researches and also known as next-generation sequencing (NGS). Although NGS is characterized by low cost and high-throughput data making it widely applied in multi-level researches, a high rate of false positives and requirement for prior PCR amplification or demands for expensive equipment remain the major obstacles to their effective wide applications. Sanger’s method is also known as the “chain-termination method” and still considered the gold standard of gene sequencing technology today since it provides a high degree of accuracy and long-read capabilities, but the low throughput and high cost of sample preparation make it difficult to support a diverse range of applications in many research areas. RFLP is based on the alterations in restriction sites, so it is not suitable to assay gene variants not residing within restriction sites. MLPA relies on sequence-specific probe hybridization of genomic DNA, followed by multiplex-PCR amplification of the hybridized probe, so a suitable DNA extraction method must be chosen to keep DNA integrity and purity. Undoubtedly, exo+ polymerase-mediated phosphorothioate-modified primer extension bypasses the limitation of template-dependent product generation by exo+ polymerases through exonuclease-digestible allele-specific primers extension. Generally, it is easy to operate, economic and reliable, and these advantageous features make it very suitable for clinical genetic detection and variant screening. So in this study, we applied the variant sensitive molecular switch consisting of 3’ terminal exonuclease-resistant phosphorothioate-modified allele specific primer combining exo + polymerase in single-base discrimination of c.919-2A>G and c.2168A>G variants in SLC26A4 gene. In our present study, the data from DNA sequence analysis proved that large amounts of wild and mutant type templates were successfully prepared by inserting the SLC26A4 gene overlapped PCR products into the pMD19-T vector and inverse PCR respectively. The two-directional primer extension showed that exo + polymerases, combining 3’ terminal phosphorothioate-modified mismatched primer, work as an off-switch in DNA polymerization, the perfect match primer turned on and the mismatched primer turned off DNA polymerization respectively. So only allelic specific primer perfectly matching template yielded specific PCR product while allelic specific primer mismatching template not, which provided an unambiguous readout for yes or no in single nucleotide discrimination. The consequence of the off-switch effect resulted from the exonuclease-resistant property of the phosphorothioate-modification that blocked mismatched base excision of the primer during 3’→5’ exonuclease proofreading procedure. Remarkably, an extra 518bp nonspecific fragment was generated from the constructed vector template regardless of primers perfectly matching or not, while no nonspecific fragment was produced from the genomic DNA. The extra 518bp nonspecific fragment was the product from the pair of amplification primer consisting of the forward detection primer of c.919-2A>G and the reverse detection primer of c.2168A>G. Of course, owing to ineffective amplification when using genomic DNA as the PCR template, the additional 518bp nonspecific product was not yielded. So when we applied Pfu DNA polymerase-mediated phosphorothioate-modified primer extension to screening the SLC26A4 gene on LVAS patients diagnosed as LVAS by temporal bone CT scan whether harboring c.919-2A>G or c.2168A>G variant, we could only observe specific PCR product without 518bp nonspecific fragment. Actually, when using primer mixtures of c.919-2A>G site for G allele and c.2168A>G site for G allele, only specific primer of c.919-2A>G site for G allele yielded specific PCR product, which showed that the two LVAS patients both harbored c.919-2A>G variant. For further identifying the allele type of LVAS patients, the double PCR from primer mixtures of c.919-2A>G site for A allele and c.2168A>G site for A allele were carried out again. On the contrary, not specific primer of c.919-2A>G site for A allele but c.2168A>G site for A allele yielded specific PCR products. Thus it showed that both LVAS cases were homozygous for c.919-2A>G variant. Moreover, DNA sequencing also confirmed the reliability of exo + polymerase-mediated phosphorothioate-modified primer extension in the identification SLC26A4 c.919-2A>G and c.2168A>G variant prior to high-resolution CT scan. The method is extremely suitable for quickly molecular etiologic screening. As an important testing means, genetic diagnosis of c.919-2A>G and c.2168A>G variants and imageological examination are complementary with each other and can improve early diagnosis and deepen aggressive prevention therapy of LVAS. Therefore, an easy, cheap and fast molecular diagnostics of c.919-2A>G and c.2168A>G variants in SLC26A4 gene will greatly benefit patients. Through the wide application in clinical otology, genetic diagnostic techniques can guide pre-lingual deaf patients as soon as possible to make use of residual hearing with hearing aids or implanted electronic cochlea for preventing variable dumb and avoiding any further damage to the hearing of deafness patients themselves; More importantly, it can also be used for the assessment of the risk of post-lingual deaf patients, prenatal diagnosis or prognosis, and patients with the marriage, birth genetic information to prevent the occurrence of LVAS patient fundamentally. Declarations Authors’ contributions Guo Zifen conceived and designed the research. Guo Zifen and Zhou Chen conducted the experiments. Gao Guoqiang contributed peripheral vein blood of clinical LAVS cases. Guo Zifen and Peng Cuiying analyzed data. Zhou Chen and Xiangman Zou wrote the manuscript. All authors read and approved the manuscript. Funding This work was partially funded by the Natural Science Foundation of Hunan Province (No.2018JJ2350) and the key project of the Education Department of Hunan Province (No.19A419). Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate The study was conducted after agreement from the ethics committee of University of South China and with two patients and a healthy volunteer' informed consent statement. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. References Berrettini S, Forli F, Bogazzi F, Neri E, Salvatori L, Casani AP, Franceschini SS (2005) Large vestibular aqueduct syndrome: audiological, radiological, clinical, and genetic features. Am J Otolaryngol 26:363-371. Chao JR, Chattaraj P, Munjal T, Honda K, King KA, Zalewski CK, Chien WW, Brewer CC, Griffith AJ (2019) SLC26A4 -linked CEVA haplotype correlates with phenotype in patients with enlargement of the vestibular aqueduct. BMC Med Genet 20:118. Claros P, Fokouo JV, Claros A (2017) Cochlear implantation in patients with enlarged vestibular aqueduct. A case series with literature review. Cochlear Implants Int 18:125-129. Connor SEJ, Dudau C, Pai I, Gaganasiou M (2019) Is CT or MRI the optimal imaging investigation for the diagnosis of large vestibular aqueduct syndrome and large endolymphatic sac anomaly? European Archives of Oto-Rhino-Laryngology 276:693-702. Guo YF, Liu XW, Guan J, Han MK, Wang DY, Zhao YL, Rao SQ, Wang QJ (2008) GJB2 , SLC26A4 and mitochondrial DNA A1555G mutations in prelingual deafness in Northern Chinese subjects. Acta oto-laryngologica 128 :297-303. Hu H, Wu L, Feng Y, Pan Q, Long Z, Li J, Dai H, Xia K, Liang D, Niikawa N, Xia J (2007) Molecular analysis of hearing loss associated with enlarged vestibular aqueduct in the mainland Chinese: a unique SLC26A4 mutation spectrum. J Hum Genet 52:492-497. Jiang L, Feng Y, Chen H, He C, Mei L (2010) [An investigation of SLC26A4 gene mutation in nonsydromic hearing impairment in Hunan province of China]. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 24:587-591. Kim MA, Kim SH, Ryu N, Ma JH, Kim YR, Jung J, Hsu CJ, Choi JY, Lee KY, Wangemann P, Bok J, Kim UK (2019) Gene therapy for hereditary hearing loss by SLC26A4 mutations in mice reveals distinct functional roles of pendrin in normal hearing. Theranostics 9:7184-7199. Lee KY, Choi SY, Bae JW, Kim S, Chung KW, Drayna D, Kim UK, Lee SH (2008) Molecular analysis of the GJB2 , GJB6 and SLC26A4 genes in Korean deafness patients. Int J Pediatr Otorhinolaryngol 72:1301-1309. Li H, Li HB, Mao J, Liu MJ, Cheng HB, Li SL, Chen Y (2011) Genetic screening of mutation hot-spots for nonsyndromic hearing loss in southern Jiangsu province with SNaPshot. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 28:383-386. Nishio A, Ito T, Cheng H, Fitzgerald TS, Wangemann P, Griffith AJ (2016) SLC26A4 expression prevents fluctuation of hearing in a mouse model of large vestibular aqueduct syndrome. Neuroscience 329:74-82. Shin JW, Lee SC, Lee HK, Park HJ (2012) Genetic Screening of GJB2 and SLC26A4 in Korean Cochlear Implantees: Experience of Soree Ear Clinic. Clinical and Experimental Otorhinolaryngology 5:S10-S3. Tong KA, Harnsberger HR, Dahlen RT, Carey JC, Ward K (1997) Large vestibular aqueduct syndrome: a genetic disease? AJR Am J Roentgenol 168:1097-101. Tsukamoto K, Suzuki H, Harada D, Namba A, Abe S, Usami S (2003) Distribution and frequencies of PDS (SLC26A4) mutations in Pendred syndrome and nonsyndromic hearing loss associated with enlarged vestibular aqueduct: a unique spectrum of mutations in Japanese. Eur J Hum Genet 11:916-22. Yang L, Liu J (2019) Comparative Analysis of CT and MRI Diagnosis of Large Vestibular Aqueduct Syndrome (LVAS) in Children. J Coll Physicians Surg Pak 29:753-756. Zhang J, Li K (2003) On-off regulation of 3' exonuclease excision to DNA polymerization by Exo + polymerase. J Biochem Mol Biol 36:525-528. Zhang J, Li K, Pardinas JR, Sommer SS, Yao KT (2005) Proofreading genotyping assays mediated by high fidelity exo + DNA polymerases. Trends Biotechnol 23:92-96. Zhu Q, Zang W, Yuan Y, Han H, Zhang X, Jiang X, Ren X, Feng C, Lu H (2012) Investigation of SLC26A4 mutations associated with inner ear malformations. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 26:22-26. Tables Table 1 Sequences of all the primers used in this study Primer name sequence Primer1 for c.919-2A>G wild fragment 5' TGCGTGTAGCAGCAGGAAGTAT 3' Primer2 for c.919-2A>G wild fragment 5' CTCATTCTATTGCCCAGGCTTTCCAGGTTGGCTCCATA 3' Primer3 for c.2168A>G wild fragment 5' TATGGAGCCAACCTGGAAAGCCTGGGCAATAGAATGAG 3' Primer4 for c.2168A>G wild fragment 5' TAGTCTTCATATCTACCTAGCAAGGTTAAT 3' primer5 for c.919-2A>G mutagenesis 5' GTTTTATTTCGGACGATAATTGCTACTGCCATTTCATATGGAGCC 3' primer6 for c.919-2A>G mutagenesis 5'GGCTCCATATGAAATGGCAGTAGCAATTATCGTCCGAAATAAAAC3' primer7 for c.2168A>G mutagenesis 5' TTTGACGGTCCGTGATGCTATACTCTATCTACAGAACC 3' primer8 for c.2168A>G mutagenesis 5' GGTTCTGTAGATAGAGTATAGCATCACGGACCGTCAAA 3' Primer9: Forward detection primer of c.919-2A>G 5' TTTTTATAGACGCTGGTTGAGATT TT * 3' Primer10: Reverse detection primer of c.919-2A>G for A allele 5' GGCAGTAGCAATTATCGTC T G 3' Primer11: Reverse detection primer of c.919-2A>G for G allele 5' GGCAGTAGCAATTATCGTC C G 3' Primer12: Forward detection primer of c.2168A>G for A allele 5' CACATTCTTTTTGACGGTCC A T 3' Primer13: Forward detection primer of c.2168A>G for G allele 5' CACATTCTTTTTGACGGTCC G T 3' Primer14: Reverse detection primer of c.2168A>G 5' CCTCTTGAGATTTCACTTGGTTC TG 3' * The phosphorothioate-modified bases are underlined and the bases matching the allele in high-frequency variant loci are labeled with red color. Table 2 Discrimination of c.919-2A>G and c.2168A>G mutations in SLC26A4 gene through the combination of 3’ phosphorothioate-modified primers and Pfu DNA polymerase Lane Template Mutation locus Primer ( 3’ base-pairing with template) Product (yes or no) 1 wild template c.919-2A>G c.919-2A allele (matched) yes 2 wild template c.919-2A>G c.919-2G allele (mismatched) no 3 wild template c.2168A>G c.2168A allele (matched) yes 4 wild template c.2168A>G c.2168G allele (mismatched) no 5 wild template c.919-2A>G +c.2168A>G c.919-2A allele + c.2168A allele (matched) yes 6 wild template c.919-2A>G +c.2168A>G c.919-2G allele + c.2168G allele (mismatched) no 7 mutant template c.919-2A>G c.919-2G allele (matched) yes 8 mutant template c.919-2A>G c.919-2A allele (mismatched) no 9 mutant template c.2168A>G c.2168G allele (matched) yes 10 mutant template c.2168A>G c.2168A allele (mismatched) no 11 mutant template c.919-2A>G +c.2168A>G c.919-2G allele + c.2168G allele (matched) yes 12 mutant template c.919-2A>G +c.2168A>G c.919-2A allele + c.2168A allele (mismatched) no Supplementary Files supplymentmaterial828.doc Cite Share Download PDF Status: Published Journal Publication published 15 Sep, 2020 Read the published version in AMB Express → Version 2 posted Editorial decision: Accept 02 Sep, 2020 Editor assigned by journal 31 Aug, 2020 Submission checks completed at journal 30 Aug, 2020 Editor invited by journal 30 Aug, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-11455","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Original article","associatedPublications":[],"authors":[{"id":1974360,"identity":"8efa4867-7352-4df5-a2fd-557d588bd9b2","order_by":0,"name":"Chen Zhou","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Zhou","suffix":""},{"id":1974361,"identity":"e6c089ca-2fc0-4300-91e7-4380d3cba740","order_by":1,"name":"Xiangman Zou","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiangman","middleName":"","lastName":"Zou","suffix":""},{"id":1974362,"identity":"4f275b06-86cb-48d5-9eaf-abb659d45034","order_by":2,"name":"Cuiying Peng","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cuiying","middleName":"","lastName":"Peng","suffix":""},{"id":1974363,"identity":"cd117bd0-6700-41f5-b8c4-8d1f0053cf1c","order_by":3,"name":"Guoqiang Gao","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guoqiang","middleName":"","lastName":"Gao","suffix":""},{"id":1974364,"identity":"50bd76c2-0957-49e6-9517-9c44d1f6060e","order_by":4,"name":"Zifen Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYLCCBBsGBn4G5oYDJGhJY2CQbGAkRQsDUIvBAcYG4hTLRyQf/vAgwSbP+PjBxsO8bXcY+Nu7E/BqMbyRlmCQkJBWbHYmsQGo5RmDxJmzG/BrmZFjkJD443DitgNgLYcZDCRyCWs5kJDwP3Fz/0MitchL5Bg2JCQcSNwgQawtBjzPkhkSEpITZ9x42HBwzrnDPAT9It+efPjjjwS7xP5+YNC9KTssx9/eS8CWA0gcJh4GBh68ysG2NCBxGH8QVD8KRsEoGAUjEQAA0xVRkgiHnfAAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-3840-6295","institution":"University of South China","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Zifen","middleName":"","lastName":"Guo","suffix":""}],"badges":[],"createdAt":"2020-01-12 11:15:49","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.2.20855/v2","doiUrl":"https://doi.org/10.21203/rs.2.20855/v2","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13568-020-01102-7","type":"published","date":"2020-09-15T12:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":2232466,"identity":"6ecdee40-a531-4a8d-8b33-b047cd3d5cdb","added_by":"auto","created_at":"2020-09-03 19:51:32","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":270998,"visible":true,"origin":"","legend":"DNA product from Overlapping PCR. M: 100bp DNA marker; 1: PCR product harboring SLC26A4 gene c.919-2A\u003eG flanking sequence, and the DNA fragment is 360bp; 2: PCR product harboring SLC26A4 gene c.2168A\u003eG flanking sequence, and the DNA fragment is 444bp; 3: overlapping PCR products using the product 1 and 2 as temples, and the DNA fragment is 766bp.","description":"","filename":"GuoFigure1.tif.tif","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/GuoFigure1.tif.tif"},{"id":2232467,"identity":"4eeadc6c-d0c2-4f24-a98c-c351f66e5668","added_by":"auto","created_at":"2020-09-03 19:51:32","extension":"tif","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57058,"visible":true,"origin":"","legend":"Representative of DNA sequencing of the constructed vector. a: DNA sequencing result residing c.919-2A\u003eG site in SLC26A4 gene for A base; b: DNA sequencing result residing c.919-2A\u003eG site in SLC26A4 gene for G base; c: DNA sequencing result residing c.2168A\u003eG site in SLC26A4 gene for A base; d: DNA sequencing result residing c.2168A\u003eG site in SLC26A4 gene for G base.","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/Fig2.tif"},{"id":2232468,"identity":"c3f209b8-119b-4418-aca7-388212972657","added_by":"auto","created_at":"2020-09-03 19:51:33","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":57909,"visible":true,"origin":"","legend":"Discrimination of SLC26A4 gene c.919-2A\u003eG and c.2168A\u003eG variants by Pfu DNA polymerase-mediated phosphorothioate-modified primer extension. M is 50bp DNA marker; Lanes 1 and 8 is specific primer extension products from the primer of c.919-2A\u003eG site for A allele, Lanes 2 and 7 are specific primer extension products from the primer of c.919-2A\u003eG site for G allele, Lanes 3 and 10 are specific primer extension products from the primer of c.2168A\u003eG site for A allele, Lanes 4 and 9 are specific primer extension products from the primer of c.2168A\u003eG site for G allele, Lanes 5 and 12 are specific primer extension products from primer mixture of c.919-2A\u003eG site for A allele and c.2168A\u003eG site for A allele, Lanes 6 and 11 are specific primer extension products from primer mixture of c.919-2A\u003eG site for G allele and c.2168A\u003eG site for G allele; Lanes 1 to 6 are the PCR products using wild vector as wild template; Lanes 7 to 12 are the PCR products using mutant vector as mutant template. The specific DNA product targeting c.919-2A\u003eG and c.2168A\u003eG loci is 280bp and 65bp respectively. Lanes 5, 6, 11 and 12 generate an extra 518bp nonspecific fragment from a pair of amplification primers consisting of the forward detection primer of c.919-2A\u003eG and the reverse detection primer of c.2168A\u003eG.","description":"","filename":"GuoFigure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/GuoFigure3.jpg"},{"id":2232469,"identity":"d7d632cb-d6e3-4e60-8d3f-3f81435b0328","added_by":"auto","created_at":"2020-09-03 19:51:33","extension":"tif","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":147918,"visible":true,"origin":"","legend":"The clinical application of Pfu DNA polymerase-mediated 3’ terminal phosphorothioate-modified primer extension on screening the SLC26A4 high-frequency variant. a: M is 50bp DNA marker; Lanes 1, 2, 5 and 6 are specific primer extension products from primer mixtures of c.919-2A\u003eG site for G allele and c.2168A\u003eG site for G allele, which perfectly match mutant template; Lanes 3 and 4 are specific primer extension products from primer mixtures of c.919-2A\u003eG site for A allele and c.2168A\u003eG site for A allele, which perfectly matches wild template. Lanes 1 and 3 represent LVAS case1, and Lanes 2 and 4 represent LVAS case2. Lanes 5 is mutant vector as the positive control; Lanes 6 is wild vector as the negative control. b, c and d: Sequence analysis of SLC26A4 gene. b represents healthy volunteer, c and d respectively represent LVAS case1 and 2.","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/Fig4.tif"},{"id":13588022,"identity":"38c14759-58b6-439f-bbcc-dac3e5e85f55","added_by":"auto","created_at":"2021-09-17 04:53:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":902891,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/b66a562f-ad8d-4922-866e-6fdb35894206.pdf"},{"id":2232471,"identity":"bc693852-4063-449d-b499-752bf22174f9","added_by":"auto","created_at":"2020-09-03 19:51:33","extension":"doc","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":57344,"visible":true,"origin":"","legend":"","description":"","filename":"supplymentmaterial828.doc","url":"https://assets-eu.researchsquare.com/files/rs-11455/v2/supplymentmaterial828.doc"}],"financialInterests":"","formattedTitle":"A novel genotyping technique for discriminating LVAS-associated high-frequency variants in SLC26A4 gene","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLarge vestibular aqueduct syndrome (LVAS) is an autosomal recessive genetic hearing loss disorder with a high incidence which is mainly accompanied by progressive and fluctuating hearing loss (Tong et al. 1997; Claros et al. 2017). It is well known that the solute carrier family 26, member 4 (\u003cem\u003eSLC26A4\u003c/em\u003e) gene plays a critical role in the development of LVAS, and about 90% of LVAS is closely attributed to \u003cem\u003eSLC26A4\u003c/em\u003e gene variants (Nishio et al. 2016; Chao et al. 2019; Kim et al. 2019). The \u003cem\u003ehuman\u003c/em\u003e \u003cem\u003eSLC26A4\u003c/em\u003e gene is mapped to chromosome 7q31, encompasses 21 exons and contains a 2343 bp open reading frame encoding a protein of 780 amino acids. To date, more than 100 of \u003cem\u003eSLC26A4\u003c/em\u003e gene variants have been identified and described as causally related to hereditary hearing impairment (https://hereditaryhearingloss.org/).\u003c/p\u003e\n\u003cp\u003eBefore the clinical application of gene diagnosis, the imageological examination was the only way of LVAS diagnosis and had stated clearly that LVAS is the most common inner ear malformation(Connor et al. 2019; Yang and Liu 2019).\u003c/p\u003e\n\u003cp\u003ePrevious studies revealed that \u003cem\u003eSLC26A4\u003c/em\u003e gene variant has obvious racial specificity, LVAS patients from different races with unique variant spectra and different variant frequencies(Berrettini et al. 2005; Hu et al. 2007; Lee et al. 2008). For years, the interest in \u003cem\u003eSLC26A4\u003c/em\u003e gene variant closely associated with Chinese LVAS individuals has been focused on c.919-2A\u0026gt;G and c. 2168A\u0026gt;G variants (Hu et al. 2007; Zhu et al. 2012), The two most common types (c.919-2A\u0026gt;G and c. 2168A\u0026gt;G) accounted for 69.1% (Hu et al. 2007) and 33.06% (Guo et al. 2008) variants respectively. Therefore, screening the high-frequency variant can early diagnose LVAS patients and find variant carriers and then taking measures to prevent further hearing loss by keeping LVAS patients from cold and head injury.\u003c/p\u003e\n\u003cp\u003eWe have previously reported that exo\u003csup\u003e+\u003c/sup\u003e polymerase-mediated 3\u0026rsquo; terminal exonuclease-resistant phosphorothioate-modified allele specific primer extension formed a molecular switch sensitive to single nucleotide discrimination (Zhang and Li 2003; Zhang et al. 2005). For 3\u0026rsquo; allele-specific primers with phosphorothioate-modification, perfect-matched primer turns on and mismatched primer turns off DNA polymerization. Exo\u003csup\u003e+\u003c/sup\u003e polymerases generated products only from perfect-matched primers and no products from mismatched primers, which provided an unambiguous readout for yes or no in a specific variant detection assay. In this study, we will construct a double PCR technology platform mediated by variant sensitive molecular switch for rapid screening the \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G and c.2168A\u0026gt;G high-frequency variants and explore strategies for clinical genetic diagnosis.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eReagents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePfu DNA polymerase with strong 3\u0026rsquo;\u0026rarr;5\u0026rsquo; exonuclease activity was purchased from TaKaRa Bio Inc. (Dalian, China). KOD-Plus-Mutagenesis Kit used in this study was obtained from TOYOBO Inc. (Shanghai, China). pMD19-T vector was the product of TaKaRa Bio Inc. (Dalian, China). Both unmodified primers and phosphorothioate-modified primers were synthesized commercially by TaKaRa Bio Inc. (Dalian, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer design\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThere are three types of primers: wild template preparation primers, mutagenesis primers and detection primers. The unmodified primers for wild type \u003cem\u003eSLC26A4\u003c/em\u003e gene preparation were designed based on the information of the Genebank database (NC_000007.14). The mutagenesis primers for \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants through inverse PCR were designed to create point variants in the corresponding sites according to the Muta Primer 2.0 software. Allelic specific detection primers targeting wild and mutant templates were both designed with 3\u0026rsquo; terminal phosphorothioate-modification. The 3\u0026rsquo; terminal upstream to the -2 base (T or C) of the reverse primer of c.919-2A\u0026gt;G and the forward primer of c.2168A\u0026gt;G (A or G) were the respective variant loci. All primers were synthesized by TaKaRa Bio Inc according to the following sequences as illustrated in Table 1, and the graphic illustration of primers is shown as supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVector construction and identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOverlapping PCR generated \u003cem\u003eSLC26A4\u003c/em\u003e gene fragment harboring c.919-2A\u0026gt;G and c.2168A\u0026gt;G flanking sequence, which was subsequently added A base and then inserted into the pMD19-T vector followed by transforming into \u003cem\u003eE.coli JM109\u003c/em\u003e competent cells. After 37℃ incubation for 12 h, some clones were formed on the LB-agar plates containing X-Gal, IPTG and Ampicillin. White clones were randomly picked up for bacilli PCR amplification reaction with the M13 primers as an initial identification of the inserted DNA overlapped fragment by their size, and 1.0 ml bacilli of each positive clone were sent to Invitrogen Biotechnology Co. Ltd. (Shanghai, China) for DNA sequencing.\u003c/p\u003e\n\u003cp\u003eInverse PCR according to the manufacturer\u0026rsquo;s protocol was performed twice for site-directed mutagenesis of c.919-2A\u0026gt;G and c.2168A\u0026gt;G variant in \u003cem\u003eSLC26A4\u003c/em\u003e gene. Following the degradation of the methylated DNA template by \u003cem\u003eDpnI\u003c/em\u003e endonuclease, the mutant circular PCR product was transformed into \u003cem\u003eE.coli\u003c/em\u003e \u003cem\u003eJM109\u003c/em\u003e competent cells again. Similarly, the \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G and c.2168A\u0026gt;G mutant template was also confirmed by sequence analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtension of phosphorothioate-modified primers by exo\u003csup\u003e+ \u003c/sup\u003epolymerase\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTwo-directional primer extension was setup. Following denaturation at 95\u0026deg;C for 2 min, the primer extension was carried out for 30 cycles as follows: 30 sec for denaturation at 95\u0026deg;C, 30 sec for annealing at 60\u0026deg;C, and 20 sec for extension at 72\u0026deg;C. After the 30 cycles, an extra extension of 2 min was done before the reaction mixture was cooled down to 4\u0026deg;C. The primer extension reaction was performed in a total volume of 30 \u0026micro;L with 20 pg of template, 0.2 mmol/L dNTP, 10 Ku/L of polymerase, 10 pmol/\u0026micro;L of both sense and antisense primers, and 2.5\u0026micro;L of the 10x Pfu polymerase reaction buffer which provides a final concentration of 10 mmol/L KCl, 20 mmol/L Tris-HCl (pH 8.8 at 25 \u0026deg;C), 10 mmol/L (NH\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e, 2 mmol/L MgSO\u003csub\u003e4\u003c/sub\u003e, 0.1% Triton X-100. Electrophoresis in a 2.0% agarose EtBr gel at 8 V/cm in 0.5x TBE buffer was used to check whether the two-directional primer extension products were produced or not.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHigh-frequency variants\u003c/strong\u003e\u003cstrong\u003e screening on clinical LVAS patient\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e2.0 ml of peripheral vein blood was obtained from two cases from the second affiliated hospital of University of South China, who were diagnosed as LVAS by the high-resolution temporal bone CT imageological examination, and the \u003cem\u003ehuman \u003c/em\u003egenomic DNA from the peripheral blood lymphocytes was extracted using phenol-chloroform extraction method. Pfu DNA polymerase combining with 3\u0026rsquo; terminal phosphorothioate-modified primers targeting c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants were utilized to screen the \u003cem\u003eSLC26A4\u003c/em\u003e gene on LVAS patients whether harboring either c.919-2A\u0026gt;G or c.2168A\u0026gt;G high-frequency variant. Furthermore, another PCR amplification was also carried out to separately get exon7+8 and exon19 fragment in \u003cem\u003eSLC26A4\u003c/em\u003e gene, which is suitable product including c.919-2A\u0026gt;G and c.2168A\u0026gt;G locus, and 1.0 ml of the purified primer extended products were further used for sequence analysis from Invitrogen Biotechnology Co. Ltd. (Shanghai, China).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eConstruction and identification of vector\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCR-generated wild DNA fragment separately harboring \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G and c.2168A\u0026gt;G flanking sequence were successfully overlapped (Fig. 1). After the overlapped DNA fragment was inserted into the pMD19-T vector and subsequently transformed into\u003cem\u003e E.coli\u003c/em\u003e \u003cem\u003eJM109\u003c/em\u003e competent cells, some white clones were formed on the X-Gal/IPTG/ampicillin/LB-agar plates and randomly picked up for bacilli PCR amplification with the M13 primers to obtain positive clones. DNA sequencing not only confirmed the correctness of wild vector sequence as wild type template (Fig. 2a,2c), and also documented the mutagenesis of c.919-2A\u0026gt;G and c.2168A\u0026gt;G through inverse PCR: the existence of \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2G and c.2168G variants in the mutant vector as mutant type template (Fig. 2b, 2d).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNucleotide Discrimination by exo\u003csup\u003e+\u003c/sup\u003e polymerase\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data illustrated in Table 2 and Fig. 3 clearly showed that c.919-2A\u0026gt;G and c.2168A\u0026gt;G allelic specific primers perfectly matching wild type allele template were extended while no products were produced from point-mutated LVAS-associated mutant type allele template, and also allelic specific primers perfectly matching point-mutated LVAS-associated mutant type allele template were extended but no products were observed from wild type allele template. Furthermore, we carried out double PCR for \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants identification, and similarly, the matched primer extension was extended while the mismatched primer was not. But it was important to remind that duplex PCR generated an additional 518bp nonspecific fragment regardless of primers perfectly matching constructed vector template or not, which was the product from the pair of amplification primer consisting of the forward detection primer of c.919-2A\u0026gt;G and the reverse detection primer of c.2168A\u0026gt;G. Since 3\u0026rsquo;\u0026rarr;5\u0026rsquo; exonuclease activity of high-fidelity DNA polymerase can efficiently detect and proofread the mismatched base of the allele specific primer, once high-fidelity DNA polymerase combining with 3\u0026rsquo; terminal exonuclease-resistant phosphorothioate-modified allele specific primer, the perfect-matched primer turned on and the mismatched primer turned off DNA polymerization. That provides an unambiguous readout for yes or no in single nucleotide discrimination: only the perfect-matched phosphorothioate-modified primer extension mediated by pfu DNA polymerase generated specific products and the mismatched primers extension not.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical application on screening the \u003cem\u003eSLC26A4\u003c/em\u003e high-frequency variant\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePfu DNA polymerase-mediated phosphorothioate-modified primer extension was used to identify the \u003cem\u003eSLC26A4\u003c/em\u003e gene variant on the LVAS patients who had been diagnosed as LVAS by temporal bone CT scan. The two LVAS patients both harbored c.919-2A\u0026gt;G variant and were both homozygous for c.919-2A\u0026gt;G variant confirmed by DNA sequencing (Fig.4).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eLVAS is frequently seen in children and teenagers, and congenital or acquired sensorineural hearing loss is its main manifestation. Now high-resolution temporal bone CT and MRI imageological examination are still the gold standards and a prerequisite for the correct diagnosis of LVAS. However, most domestic hospitals not only lack the requirement suitable for imageological diagnosis but also have no technologies that seem appropriate. As a result, most LVAS patients cannot receive timely correct diagnosis so that the doctor cannot provide effective treatment and prevention advice to him. Thankfully, with the clinical application of deafness-associated gene variant screening, it has demonstrated the particular advantages in the etiologic diagnosis of deafness.\u003c/p\u003e\n\u003cp\u003eNumerous studies indicate that c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants in \u003cem\u003eSLC26A4\u003c/em\u003e gene are the high-frequency variants associated with Chinese LVAS individuals(Hu et al. 2007; Guo et al. 2008; Jiang et al. 2010; Li et al. 2011), which is similar to other patients in East Asia(Shin et al. 2012; Tsukamoto et al. 2003) and benefits \u003cem\u003eSLC26A4\u003c/em\u003e gene high-frequency variant screening in clinical application. Remarkably, none can effectively cure LVAS patients from etiology to symptoms until now, so early diagnosis and aggressive prevention therapy have great practical significance in preventing hearing further decline. Detecting LVAS-associated high-frequency variant c.919-2A\u0026gt;G and c.2168A\u0026gt;G is extremely useful in the early diagnosis and intervention of LVAS, and the current research has focused on how to quickly screen \u003cem\u003eSLC26A4\u003c/em\u003e gene variant for foundationally preventing the occurrence of LVAS. Prohibiting either c.919-2A\u0026gt;G or c.2168A\u0026gt;G variant carrier from marrying another one with the same variant is thus the most effective way to protect the occurrence of LVAS.\u003c/p\u003e\n\u003cp\u003eAs we all know, many gene variants assay technologies have been developed over the past decades, and the most popular methods are different variants of allele-specific primer extension mediated by DNA polymerases: High-throughput sequencing, Sanger\u0026rsquo;s method, restriction fragment length polymorphism (RFLP), multiplex ligation-dependent probe amplification (MLPA) and so on. High-throughput sequencing is a revolutionary technological innovation in gene sequencing researches and also known as next-generation sequencing (NGS). Although NGS is characterized by low cost and high-throughput data making it widely applied in multi-level researches, a high rate of false positives and requirement for prior PCR amplification or demands for expensive equipment remain the major obstacles to their effective wide applications. Sanger\u0026rsquo;s method is also known as the \u0026ldquo;chain-termination method\u0026rdquo; and still considered the gold standard of gene sequencing technology today since it provides a high degree of accuracy and long-read capabilities, but the low throughput and high cost of sample preparation make it difficult to support a diverse range of applications in many research areas. RFLP is based on the alterations in restriction sites, so it is not suitable to assay gene variants not residing within restriction sites. MLPA relies on sequence-specific probe hybridization of genomic DNA, followed by multiplex-PCR amplification of the hybridized probe, so a suitable DNA extraction method must be chosen to keep DNA integrity and purity. Undoubtedly, exo+ polymerase-mediated phosphorothioate-modified primer extension bypasses the limitation of template-dependent product generation by exo+ polymerases through exonuclease-digestible allele-specific primers extension. Generally, it is easy to operate, economic and reliable, and these advantageous features make it very suitable for clinical genetic detection and variant screening. So in this study, we applied the variant sensitive molecular switch consisting of 3\u0026rsquo; terminal exonuclease-resistant phosphorothioate-modified allele specific primer combining exo\u003csup\u003e+\u003c/sup\u003e polymerase in single-base discrimination of c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants in \u003cem\u003eSLC26A4\u003c/em\u003e gene.\u003c/p\u003e\n\u003cp\u003eIn our present study, the data from DNA sequence analysis proved that large amounts of wild and mutant type templates were successfully prepared by inserting the \u003cem\u003eSLC26A4\u003c/em\u003e gene overlapped PCR products into the pMD19-T vector and inverse PCR respectively. The two-directional primer extension showed that exo\u003csup\u003e+\u003c/sup\u003e polymerases, combining 3\u0026rsquo; terminal phosphorothioate-modified mismatched primer, work as an off-switch in DNA polymerization, the perfect match primer turned on and the mismatched primer turned off DNA polymerization respectively. So only allelic specific primer perfectly matching template yielded specific PCR product while allelic specific primer mismatching template not, which provided an unambiguous readout for yes or no in single nucleotide discrimination. The consequence of the off-switch effect resulted from the exonuclease-resistant property of the phosphorothioate-modification that blocked mismatched base excision of the primer during 3\u0026rsquo;\u0026rarr;5\u0026rsquo; exonuclease proofreading procedure. Remarkably, an extra 518bp nonspecific fragment was generated from the constructed vector template regardless of primers perfectly matching or not, while no nonspecific fragment was produced from the genomic DNA. The extra 518bp nonspecific fragment was the product from the pair of amplification primer consisting of the forward detection primer of c.919-2A\u0026gt;G and the reverse detection primer of c.2168A\u0026gt;G. Of course, owing to ineffective amplification when using genomic DNA as the PCR template, the additional 518bp nonspecific product was not yielded. So when we applied Pfu DNA polymerase-mediated phosphorothioate-modified primer extension to screening the \u003cem\u003eSLC26A4\u003c/em\u003e gene on LVAS patients diagnosed as LVAS by temporal bone CT scan whether harboring c.919-2A\u0026gt;G or c.2168A\u0026gt;G variant, we could only observe specific PCR product without 518bp nonspecific fragment. Actually, when using primer mixtures of c.919-2A\u0026gt;G site for G allele and c.2168A\u0026gt;G site for G allele, only specific primer of c.919-2A\u0026gt;G site for G allele yielded specific PCR product, which showed that the two LVAS patients both harbored c.919-2A\u0026gt;G variant. For further identifying the allele type of LVAS patients, the double PCR from primer mixtures of c.919-2A\u0026gt;G site for A allele and c.2168A\u0026gt;G site for A allele were carried out again. On the contrary, not specific primer of c.919-2A\u0026gt;G site for A allele but c.2168A\u0026gt;G site for A allele yielded specific PCR products. Thus it showed that both LVAS cases were homozygous for c.919-2A\u0026gt;G variant. Moreover, DNA sequencing also confirmed the reliability of exo\u003csup\u003e+\u003c/sup\u003e polymerase-mediated phosphorothioate-modified primer extension in the identification \u003cem\u003eSLC26A4\u003c/em\u003e c.919-2A\u0026gt;G and c.2168A\u0026gt;G variant prior to high-resolution CT scan. The method is extremely suitable for quickly molecular etiologic screening. As an important testing means, genetic diagnosis of c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants and imageological examination are complementary with each other and can improve early diagnosis and deepen aggressive prevention therapy of LVAS.\u003c/p\u003e\n\u003cp\u003eTherefore, an easy, cheap and fast molecular diagnostics of c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants in \u003cem\u003eSLC26A4\u003c/em\u003e gene will greatly benefit patients. Through the wide application in clinical otology, genetic diagnostic techniques can guide pre-lingual deaf patients as soon as possible to make use of residual hearing with hearing aids or implanted electronic cochlea for preventing variable dumb and avoiding any further damage to the hearing of deafness patients themselves; More importantly, it can also be used for the assessment of the risk of post-lingual deaf patients, prenatal diagnosis or prognosis, and patients with the marriage, birth genetic information to prevent the occurrence of LVAS patient fundamentally.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGuo Zifen conceived and designed the research. Guo Zifen and Zhou Chen conducted the experiments. Gao Guoqiang contributed peripheral vein blood of clinical LAVS cases. Guo Zifen and Peng Cuiying analyzed data. Zhou Chen and Xiangman Zou wrote the manuscript. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was partially funded by the Natural Science Foundation of Hunan Province (No.2018JJ2350) and the key project of the Education Department of Hunan Province (No.19A419).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe\u0026ensp;study\u0026ensp;was conducted after\u0026ensp;agreement\u0026ensp;from the ethics\u0026ensp;committee of University of South China and\u0026ensp;with\u0026ensp;two patients\u0026ensp;and a healthy volunteer' informed\u0026ensp;consent statement.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003eBerrettini S, Forli F, Bogazzi F, Neri E, Salvatori L, Casani AP, Franceschini SS (2005) Large vestibular aqueduct syndrome: audiological, radiological, clinical, and genetic features. Am J Otolaryngol 26:363-371.\u003c/p\u003e\n\u003cp\u003eChao JR, Chattaraj P, Munjal T, Honda K, King KA, Zalewski CK, Chien WW, Brewer CC, Griffith AJ (2019) \u003cem\u003eSLC26A4\u003c/em\u003e-linked CEVA haplotype correlates with phenotype in patients with enlargement of the vestibular aqueduct. BMC Med Genet 20:118.\u003c/p\u003e\n\u003cp\u003eClaros P, Fokouo JV, Claros A (2017) Cochlear implantation in patients with enlarged vestibular aqueduct. A case series with literature review. Cochlear Implants Int 18:125-129.\u003c/p\u003e\n\u003cp\u003eConnor SEJ, Dudau C, Pai I, Gaganasiou M (2019) Is CT or MRI the optimal imaging investigation for the diagnosis of large vestibular aqueduct syndrome and large endolymphatic sac anomaly? European Archives of Oto-Rhino-Laryngology 276:693-702.\u003c/p\u003e\n\u003cp\u003eGuo YF, Liu XW, Guan J, Han MK, Wang DY, Zhao YL, Rao SQ, Wang QJ (2008) \u003cem\u003eGJB2\u003c/em\u003e, \u003cem\u003eSLC26A4\u003c/em\u003e and mitochondrial DNA A1555G mutations in prelingual deafness in Northern Chinese subjects. Acta oto-laryngologica 128 :297-303.\u003c/p\u003e\n\u003cp\u003eHu H, Wu L, Feng Y, Pan Q, Long Z, Li J, Dai H, Xia K, Liang D, Niikawa N, Xia J (2007) Molecular analysis of hearing loss associated with enlarged vestibular aqueduct in the mainland Chinese: a unique \u003cem\u003eSLC26A4\u003c/em\u003e mutation spectrum. J Hum Genet 52:492-497.\u003c/p\u003e\n\u003cp\u003eJiang L, Feng Y, Chen H, He C, Mei L (2010) [An investigation of \u003cem\u003eSLC26A4\u003c/em\u003e gene mutation in nonsydromic hearing impairment in Hunan province of China]. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 24:587-591.\u003c/p\u003e\n\u003cp\u003eKim MA, Kim SH, Ryu N, Ma JH, Kim YR, Jung J, Hsu CJ, Choi JY, Lee KY, Wangemann P, Bok J, Kim UK (2019) Gene therapy for hereditary hearing loss by \u003cem\u003eSLC26A4\u003c/em\u003e mutations in mice reveals distinct functional roles of pendrin in normal hearing. Theranostics 9:7184-7199.\u003c/p\u003e\n\u003cp\u003eLee KY, Choi SY, Bae JW, Kim S, Chung KW, Drayna D, Kim UK, Lee SH (2008) Molecular analysis of the \u003cem\u003eGJB2\u003c/em\u003e, \u003cem\u003eGJB6\u003c/em\u003e and \u003cem\u003eSLC26A4\u003c/em\u003e genes in Korean deafness patients. Int J Pediatr Otorhinolaryngol 72:1301-1309.\u003c/p\u003e\n\u003cp\u003eLi H, Li HB, Mao J, Liu MJ, Cheng HB, Li SL, Chen Y (2011) \u0026nbsp;Genetic screening of mutation hot-spots for nonsyndromic hearing loss in southern Jiangsu province with SNaPshot. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 28:383-386.\u003c/p\u003e\n\u003cp\u003eNishio A, Ito T, Cheng H, Fitzgerald TS, Wangemann P, Griffith AJ (2016) \u003cem\u003eSLC26A4 \u003c/em\u003eexpression prevents fluctuation of hearing in a mouse model of large vestibular aqueduct syndrome. Neuroscience 329:74-82.\u003c/p\u003e\n\u003cp\u003eShin JW, Lee SC, Lee HK, Park HJ (2012) Genetic Screening of \u003cem\u003eGJB2\u003c/em\u003e and\u003cem\u003e SLC26A4 \u003c/em\u003ein Korean Cochlear Implantees: Experience of Soree Ear Clinic. Clinical and Experimental Otorhinolaryngology 5:S10-S3.\u003c/p\u003e\n\u003cp\u003eTong KA, Harnsberger HR, Dahlen RT, Carey JC, Ward K (1997) Large vestibular aqueduct syndrome: a genetic disease? AJR Am J Roentgenol 168:1097-101.\u003c/p\u003e\n\u003cp\u003eTsukamoto K, Suzuki H, Harada D, Namba A, Abe S, Usami S (2003) Distribution and frequencies of \u003cem\u003ePDS (SLC26A4) \u003c/em\u003emutations in Pendred syndrome and nonsyndromic hearing loss associated with enlarged vestibular aqueduct: a unique spectrum of mutations in Japanese. Eur J Hum Genet 11:916-22.\u003c/p\u003e\n\u003cp\u003eYang L, Liu J (2019) Comparative Analysis of CT and MRI Diagnosis of Large Vestibular Aqueduct Syndrome (LVAS) in Children. J Coll Physicians Surg Pak 29:753-756.\u003c/p\u003e\n\u003cp\u003eZhang J, Li K (2003) On-off regulation of 3' exonuclease excision to DNA polymerization by Exo\u003csup\u003e+\u003c/sup\u003e polymerase. J Biochem Mol Biol 36:525-528.\u003c/p\u003e\n\u003cp\u003eZhang J, Li K, Pardinas JR, Sommer SS, Yao KT (2005) Proofreading genotyping assays mediated by high fidelity exo\u003csup\u003e+\u003c/sup\u003e DNA polymerases. Trends Biotechnol 23:92-96.\u003c/p\u003e\n\u003cp\u003eZhu Q, Zang W, Yuan Y, Han H, Zhang X, Jiang X, Ren X, Feng C, Lu H (2012) Investigation of \u003cem\u003eSLC26A4\u003c/em\u003e mutations associated with inner ear malformations. Lin Chung Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 26:22-26.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Tables","content":"\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"2\"\u003e\n\u003cp\u003eTable 1 Sequences of all the primers used in this study\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer name\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003esequence\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer1 for c.919-2A\u0026gt;G wild fragment\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' TGCGTGTAGCAGCAGGAAGTAT 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer2 for c.919-2A\u0026gt;G wild fragment\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' CTCATTCTATTGCCCAGGCTTTCCAGGTTGGCTCCATA 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer3 for c.2168A\u0026gt;G wild fragment\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' TATGGAGCCAACCTGGAAAGCCTGGGCAATAGAATGAG 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer4 for c.2168A\u0026gt;G wild fragment\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' TAGTCTTCATATCTACCTAGCAAGGTTAAT 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003eprimer5 for c.919-2A\u0026gt;G mutagenesis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' GTTTTATTTCGGACGATAATTGCTACTGCCATTTCATATGGAGCC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003eprimer6 for c.919-2A\u0026gt;G mutagenesis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5'GGCTCCATATGAAATGGCAGTAGCAATTATCGTCCGAAATAAAAC3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003eprimer7 for c.2168A\u0026gt;G mutagenesis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' TTTGACGGTCCGTGATGCTATACTCTATCTACAGAACC 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003eprimer8 for c.2168A\u0026gt;G mutagenesis\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' GGTTCTGTAGATAGAGTATAGCATCACGGACCGTCAAA 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer9: Forward detection primer of c.919-2A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' TTTTTATAGACGCTGGTTGAGATT\u003cstrong\u003e\u003cspan style=\"color: #000000;\"\u003e\u003cu\u003eTT\u003c/u\u003e\u003c/span\u003e\u003ca href=\"#_ftn1\" name=\"_ftnref1\"\u003e*\u003c/a\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer10: Reverse detection primer of c.919-2A\u0026gt;G for A allele\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' GGCAGTAGCAATTATCGTC\u003cstrong\u003e\u003cu\u003e\u003cspan style=\"color: #ff0000;\"\u003eT\u003c/span\u003eG\u003c/u\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer11: Reverse detection primer of c.919-2A\u0026gt;G for G allele\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' GGCAGTAGCAATTATCGTC\u003cstrong\u003e\u003cu\u003e\u003cspan style=\"color: #ff0000;\"\u003eC\u003c/span\u003eG\u003c/u\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer12: Forward detection primer of c.2168A\u0026gt;G for A allele\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' CACATTCTTTTTGACGGTCC\u003cstrong\u003e\u003cu\u003e\u003cspan style=\"color: #ff0000;\"\u003eA\u003c/span\u003eT\u003c/u\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer13: Forward detection primer of c.2168A\u0026gt;G for G allele\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' CACATTCTTTTTGACGGTCC\u003cstrong\u003e\u003cu\u003e\u003cspan style=\"color: #ff0000;\"\u003eG\u003c/span\u003eT\u003c/u\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd\u003e\n\u003cp\u003ePrimer14: Reverse detection primer of c.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd\u003e\n\u003cp\u003e5' CCTCTTGAGATTTCACTTGGTTC\u003cstrong\u003e\u003cu\u003eTG\u003c/u\u003e\u003c/strong\u003e 3'\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003ca href=\"#_ftnref1\" name=\"_ftn1\"\u003e*\u003c/a\u003e \u003csup\u003eThe phosphorothioate-modified bases are underlined and the bases matching the allele in high-frequency variant loci are\u0026nbsp;labeled\u0026nbsp;with\u0026nbsp;red\u0026nbsp;color.\u003c/sup\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"1\" width=\"100%\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"5\" width=\"100%\"\u003e\n\u003cp\u003eTable 2 Discrimination of c.919-2A\u0026gt;G and c.2168A\u0026gt;G mutations in \u003cem\u003eSLC26A4\u003c/em\u003e gene through the combination of 3\u0026rsquo; phosphorothioate-modified primers and Pfu DNA polymerase\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003eLane\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003eTemplate\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003eMutation locus\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ePrimer\u0026nbsp; ( 3\u0026rsquo; base-pairing with template)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eProduct (yes or no)\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2A allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2G allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.2168A allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.2168G allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G +c.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2A allele + c.2168A allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003ewild template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G +c.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2G allele + c.2168G allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2G allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2A allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e9\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.2168G allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.2168A allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e11\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G +c.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2G allele + c.2168G allele (matched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eyes\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd width=\"8%\"\u003e\n\u003cp\u003e12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"15%\"\u003e\n\u003cp\u003emutant template\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"20%\"\u003e\n\u003cp\u003ec.919-2A\u0026gt;G +c.2168A\u0026gt;G\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"36%\"\u003e\n\u003cp\u003ec.919-2A allele + c.2168A allele (mismatched)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd width=\"18%\"\u003e\n\u003cp\u003eno\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"amb-express","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ambe","sideBox":"Learn more about [AMB Express](http://amb-express.springeropen.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/AMBE/default.aspx","title":"AMB Express","twitterHandle":"@SpringerOpen","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Solute carrier family 26 member 4, large vestibular aqueduct syndrome, exo+ polymerase, phosphorothioate modification ","lastPublishedDoi":"10.21203/rs.2.20855/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.20855/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAn increasing number of biological and epidemiological evidence suggests that c.919-2A\u0026gt;G and c.2168A\u0026gt;G variants of solute carrier family 26, member 4 (\u003cem\u003eSLC26A4\u003c/em\u003e) gene play a critical role in the development of large vestibular aqueduct syndrome (LVAS). In this study, we developed a rapid genotyping method for discriminating LVAS-associated high-frequency variants in \u003cem\u003eSLC26A4 \u003c/em\u003egene. The genotyping technique consists of 3’ terminal exonuclease-resistant phosphorothioate-modified allele specific primer extension mediated by exo\u003csup\u003e+\u003c/sup\u003e polymerase. In PCR amplification by Pfu polymerase, allelic specific primers perfectly matching wild type allele were extended while no specific products were yielded from primers targeting variant allele. Similarly, allelic specific primers perfectly matching variant allele were extended and no specific products were observed from primers targeting wild type allele. The clinical application of 3’ terminal phosphorothioate-modified allele specific primer extension mediated by Pfu polymerase identified both homozygous for \u003cem\u003eSLC26A4\u003c/em\u003e gene c.919-2A\u0026gt;G\u003cstrong\u003e \u003c/strong\u003evariant in two patients clinically diagnosed as LVAS by temporal bone CT scan. The genetic results from this method are consistent with that of DNA sequencing. The data suggest that exo\u003csup\u003e+\u003c/sup\u003e polymerase-mediated 3’ terminal phosphorothioate-modified primer extension is reliable in the identification of \u003cem\u003eSLC26A4\u003c/em\u003e gene\u003cem\u003e \u003c/em\u003ehigh-frequency variant prior to high-resolution CT scan. The method is extremely suitable for quickly molecular etiologic screening and early diagnosis and aggressive prevention therapy of LVAS.\u003c/p\u003e","manuscriptTitle":"A novel genotyping technique for discriminating LVAS-associated high-frequency variants in SLC26A4 gene","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2020-09-03 19:51:10","doi":"10.21203/rs.2.20855/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Accept","date":"2020-09-02T12:00:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-08-31T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-08-30T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-08-30T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"amb-express","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ambe","sideBox":"Learn more about [AMB Express](http://amb-express.springeropen.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/AMBE/default.aspx","title":"AMB Express","twitterHandle":"@SpringerOpen","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-01-15 16:20:29","doi":"10.21203/rs.2.20855/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2020-07-31T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable due to the journal's policy.\n"},{"type":"decision","content":"Major Revision","date":"2020-07-31T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-07-17T12:00:00+00:00","index":2,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-03-19T12:00:00+00:00","index":1,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-01-21T12:00:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2020-01-13T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-01-12T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-01-12T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-01-10T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"amb-express","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"ambe","sideBox":"Learn more about [AMB Express](http://amb-express.springeropen.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/AMBE/default.aspx","title":"AMB Express","twitterHandle":"@SpringerOpen","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a4e6fd7b-4f4a-4eb1-a625-3439bef77131","owner":[],"postedDate":"September 3rd, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":49858,"name":"Epigenetics \u0026 Genomics"}],"tags":[],"updatedAt":"2020-09-20T15:02:24+00:00","versionOfRecord":{"articleIdentity":"rs-11455","link":"https://doi.org/10.1186/s13568-020-01102-7","journal":{"identity":"amb-express","isVorOnly":false,"title":"AMB Express"},"publishedOn":"2020-09-15 12:00:00","publishedOnDateReadable":"September 15th, 2020"},"versionCreatedAt":"2020-09-03 19:51:10","video":"","vorDoi":"10.1186/s13568-020-01102-7","vorDoiUrl":"https://doi.org/10.1186/s13568-020-01102-7","workflowStages":[]},"version":"v2","identity":"rs-11455","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-11455","version":["v2"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.