Modular genetic control of social status in a cichlid fish

preprint OA: closed CC-BY-ND-4.0
📄 Open PDF Full text JSON View at publisher
⚙ AI-generated deep summary by qwen3.7-flash, 2026-09-07 · read from full text ⓘ

This study investigates the genetic mechanisms underlying social dominance in the African cichlid fish Astatotilapia burtoni by utilizing CRISPR/Cas9 gene editing to create mutants lacking either of two androgen receptor paralogs, ARα or ARβ. The researchers found that these receptors exert modular control over distinct aspects of social status: ARβ is necessary for physical traits like testes growth and bright coloration, while ARα drives reproductive behavior and aggressive displays. This dissociation suggests that gene duplication allows for independent regulation of physiological and behavioral components of dominance, facilitating social plasticity. The paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Social hierarchies are ubiquitous in social species and profoundly influence physiology and behavior. Androgens like testosterone have been strongly linked to social status, yet the molecular mechanisms regulating social status are not known. The African cichlid fish Astatotilapia burtoni is a powerful model species for elucidating the role of androgens in social status given their rich social hierarchy and genetic tractability. Dominant A. burtoni males possess large testes, bright coloration, and perform aggressive and reproductive behaviors while non-dominant males do not. Social status in A. burtoni is in flux, however, as males alter their status depending on the social environment. Due to a teleost-specific whole-genome duplication, A. burtoni possess two androgen receptor (AR) paralogs, ARα and ARβ , providing a unique opportunity to disentangle the role of gene duplication in the evolution of social systems. Here, we used CRISPR/Cas9 gene editing to generate AR mutant A. burtoni and performed a suite of experiments to interrogate the mechanistic basis of social dominance. We find that ARβ , but not ARα , is required for testes growth and bright coloration, while ARα , but not ARβ , is required for the performance of reproductive behavior and aggressive displays. Both receptors are required to reduce flees from females and either AR is sufficient for attacking males. Thus, social status in A. burtoni is inordinately dissociable and under the modular control of two AR paralogs. This type of non-redundancy may be important in facilitating social plasticity in A. burtoni and other species whose social status relies on social experience. Significance Statement Social rank along a hierarchy determines physiological state and behavioral performance. A ubiquitous feature of social hierarchies is the communication of rank through non-physical signaling systems (e.g., coloration) and aggression, traits that correlate with the reproductive status of an individual. Despite the links identified between social status, physiology, and behavior, the molecular basis of social status is not known. Here, we genetically dissect social status in the African cichlid fish Astatotilapia burtoni using CRISPR/Cas9 gene editing. We show that two distinct androgen receptor (AR) genes control social status in a highly modular manner. This type of coordination of social status may be fundamental across species that rely on social information to optimally guide physiology and behavior.
Full text 61,049 characters · extracted from preprint-html · click to expand
Modular genetic control of social status in a cichlid fish | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Modular genetic control of social status in a cichlid fish View ORCID Profile Beau A. Alward , Vibhav Laud , Christopher J. Skalnik , Ryan A. York , View ORCID Profile Scott Juntti , View ORCID Profile Russell D. Fernald doi: https://doi.org/10.1101/2020.04.03.024190 Beau A. Alward 1 University of Houston, Department of Psychology 2 University of Houston, Department of Biology 3 Stanford University, Department of Biology Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Beau A. Alward For correspondence: balward{at}uh.edu Vibhav Laud 4 Lynbrook High School Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher J. Skalnik 3 Stanford University, Department of Biology Find this author on Google Scholar Find this author on PubMed Search for this author on this site Ryan A. York 3 Stanford University, Department of Biology Find this author on Google Scholar Find this author on PubMed Search for this author on this site Scott Juntti 3 Stanford University, Department of Biology 4 Lynbrook High School Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Scott Juntti Russell D. Fernald 3 Stanford University, Department of Biology Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Russell D. Fernald Abstract Full Text Info/History Metrics Preview PDF Abstract Social hierarchies are ubiquitous in social species and profoundly influence physiology and behavior. Androgens like testosterone have been strongly linked to social status, yet the molecular mechanisms regulating social status are not known. The African cichlid fish Astatotilapia burtoni is a powerful model species for elucidating the role of androgens in social status given their rich social hierarchy and genetic tractability. Dominant A. burtoni males possess large testes, bright coloration, and perform aggressive and reproductive behaviors while non-dominant males do not. Social status in A. burtoni is in flux, however, as males alter their status depending on the social environment. Due to a teleost-specific whole-genome duplication, A. burtoni possess two androgen receptor (AR) paralogs, ARα and ARβ , providing a unique opportunity to disentangle the role of gene duplication in the evolution of social systems. Here, we used CRISPR/Cas9 gene editing to generate AR mutant A. burtoni and performed a suite of experiments to interrogate the mechanistic basis of social dominance. We find that ARβ , but not ARα , is required for testes growth and bright coloration, while ARα , but not ARβ , is required for the performance of reproductive behavior and aggressive displays. Both receptors are required to reduce flees from females and either AR is sufficient for attacking males. Thus, social status in A. burtoni is inordinately dissociable and under the modular control of two AR paralogs. This type of non-redundancy may be important in facilitating social plasticity in A. burtoni and other species whose social status relies on social experience. Significance Statement Social rank along a hierarchy determines physiological state and behavioral performance. A ubiquitous feature of social hierarchies is the communication of rank through non-physical signaling systems (e.g., coloration) and aggression, traits that correlate with the reproductive status of an individual. Despite the links identified between social status, physiology, and behavior, the molecular basis of social status is not known. Here, we genetically dissect social status in the African cichlid fish Astatotilapia burtoni using CRISPR/Cas9 gene editing. We show that two distinct androgen receptor (AR) genes control social status in a highly modular manner. This type of coordination of social status may be fundamental across species that rely on social information to optimally guide physiology and behavior. Introduction Social animals often organize into hierarchies, wherein social status or rank determines many physiological and behavioral traits ( 1 ). Successful navigation through a social hierarchy requires the constant integration of social cues to optimize chances of survival and reproductive opportunities ( 2 ). Within these social hierarchies dominant and non-dominant individuals exist ( 1 ). Dominant individuals typically behave more aggressively and have more mating opportunities than non-dominant individuals. Dominant animals may also express conspicuous signals that show their status to others. This can take the form of bright coloration or body size. Dominant individuals have an activated reproductive system as indicated by their large gonads. On the other hand, non-dominant individuals are not aggressive and have very few, if any, chances to mate. Non-dominant individuals may appear inconspicuous to avoid confrontations from higher ranking individuals and possess small gonads. For some species, social hierarchies are in flux as non-dominant animals can ascend to dominant rank given the social opportunity ( 3 ). Despite what is known about the importance of social hierarchies in controlling traits that relate to reproduction, the molecular mechanisms underlying social status are unclear. One candidate molecular substrate for regulating social status is the androgen signaling system. Dominant animals tend to have higher levels of androgens like testosterone compared to non-dominant animals. Pharmacological manipulations across species suggest that androgen signaling is required to enhance the motivation to seek higher social status ( 4 – 6 ). However, results of studies using pharmacology to tease apart the molecular mechanisms of social status are limited. For instance, pharmacological agents have off-target effects that are difficult if not impossible to control for ( 7 ). For this reason, genetic manipulations are typically preferred over pharmacological ones to dissect the molecular basis of complex physiological and behavioral functions. However, genetic models of social status have until recently not been available for species in which rich social hierarchies can be controlled in the laboratory. The African cichlid fish Astatotilapia burtoni is a powerful model species for the genetic dissection of social status ( 3 , 8 , 8 ). In the laboratory, as in nature, male A. burtoni exist as either non-dominant or dominant, exhibiting clear variation in testes mass, coloration, and behavior ( Fig. 1A-B ). Pharmacological studies suggest AR signaling enhances reproductive but not aggressive behavior associated with social dominance in A. burtoni ( 5 , 10 ). Additionally, due to a whole-genome duplication (WGD) event specific to teleost fish ( 11 ), A. burtoni possess two AR paralogs, ARα and ARβ (Table S1), providing a unique opportunity to disentangle the role of gene duplication in the evolution of social systems ( 12 ). Finally, recent work used CRISPR/Cas9 gene editing to generate mutant A. burtoni . With this in mind, we used gene editing to produce novel A. burtoni AR mutants and performed a suite of experiments interrogating the molecular basis of social dominance. Download figure Open in new tab Figure 1. Understanding the control of social dominance by androgen receptors in Astatotilapia burtoni . (A) Non-dominant and (B) dominant male A. burtoni differ in terms of a variety of traits that reflect their social status. (C) We used CRISPR/Cas9 gene editing to generate A. burtoni that possess frameshift ARα or ARβ alleles. ( D to G ) Experimental strategy for testing the functions of ARα and ARβ in the control of social dominance. Predicted Cas9 cleavage sites are located to the left of letters highlighted in gray. Bolded 3-letter sequences indicate a PAM sequence. PAM=Protospacer Adjacent Motif. +=wild-type. d=deletion. (N # ) indicate the number of bases not shown in actual gene sequence for clarity. Results Genetic dissection of social dominance in A. burtoni using CRISPR/Cas9 gene editing We generated mutant fish possessing frameshift ARα or ARβ alleles using CRISPR/Cas9 gene editing ( 13 ). Two single-guide RNAs against ARα or ARβ and Cas9 mRNA ( 14 , 15 ) were injected into embryos at the single-cell stage ( 16 ) after which frameshift mutant alleles were identified for both genes. ARα mutants possessed a total deletion of 50 basepairs (bp) ( AR α Δ ) and ARβ mutants possessed a deletion of 5 bp ( ARβ Δ ) ( Fig. 1C ). For the wild-type and mutant alleles we determined the predicted amino acid sequences and protein tertiary structure ( Fig. S1 ) ( 17 ). Both mutant alleles contained premature stop codons that yielded predicted truncated amino acid sequences compared to wild-types ( Fig. S1A-B ). Analysis of the predicted tertiary structure of wild-type and mutant AR α and AR β revealed profound differences, with mutant versions of each protein totally lacking the complex tertiary structure observed in the wild-type versions ( Fig. S1C-D ). Thus, the frameshift alleles we generated for AR α and ARβ are highly likely to be completely non-functional. G 0 injected fish were outcrossed with wild-type fish to generate heterozygous mutants (that were subsequently intercrossed). Heterozygous mutants of either genotype ( ARα Δ/+ or ARβ Δ/+ ) were crossed to yield offspring of homozygous wild-types ( ARα +/+ or ARβ +/+ ), heterozygous mutants ( ARα Δ/+ or ARβ Δ/+ ), and homozygous mutants ( ARα Δ/Δ or ARβ Δ/Δ ). Do AR mutants display altered patterns of social dominance? To address this, we housed adult male fish from each cross for 4-12 weeks in stable dominant tanks ( Fig. 1D ), a housing environment that has been shown previously to reliably permit the full suite of social dominance traits ( 5 , 18 , 18 ). Fish were then assayed for three key traits related to social dominance: testes mass, coloration, and behavior ( 3 ) ( Fig. 1E-G ). First, individuals were removed and photographed ( Fig. 1E ) followed by fin-clip removal (for subsequent genotyping). Each fish was then placed into a dyad assay tank ( Fig. 1E-F ). In a dyad assay a focal fish (in this case, a fish from the stable dominant tank) is housed with a smaller stimulus male, three females, and a terra cotta pot simulating a potential mating site ( 20 ) ( Fig. 1F ). For the next two days fish were recorded from 8am-2pm. At 2 pm on the second day, focal fish were removed from the dyad assay tank and standard length, body mass, and testes mass were recorded. Blood was also collected for analysis of androgen levels. There was no effect of AR α or ARβ genotype on standard length or body mass ( Fig. S2 ). ARα and ARβ are necessary for distinct aspects of social dominance Variation in testes mass was measured first. We found that ARα and ARβ are required for normal testes mass, but in different directions. For instance, ARα Δ/Δ males had testes that were larger than those seen in ARα +/+ males ( Fig. 2A ). On the other hand, ARβ Δ/Δ and ARβ Δ/+ males had smaller testes than ARβ +/+ males and ARβ Δ/+ males had larger testes than ARβ Δ/Δ males ( Fig. 2B ). Based on these findings, we predicted that ARβ mutants would lack dominant-typical coloration ( 16 ). Download figure Open in new tab Figure 2. AR α and AR β play distinct roles in the control of testes mass and coloration. (A) AR α +/+ males have smaller testes than AR α Δ/Δ males, while AR α Δ/+ males were not different than either group. (B) ARβ +/+ males have larger testes than ARβ Δ/+ males, which have larger testes than ARβ Δ/Δ males. (C) ARα mutant males do not look different than AR α +/+ males (D) while ARβ mutant males lack the dominant-typical yellow coloration seen in ARβ +/+ males. (E) ARβ +/+ males possessed more “very dark yellow” (#55551C) pixels than ARβ Δ/+ males, which had more dark yellow pixels than ARβ Δ/Δ males, (F) while ARβ Δ/Δ males had more “dark grayish yellow” (#80806A) pixels than both ARβ Δ/+ and ARβ Δ/Δ males. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. **** P <0.0001; ** P < 0.01; * P < 0.05. Dominant male A. burtoni typically express bright yellow or blue coloration while non-dominant males appear drab ( 3 ) ( Fig. 1A-B ). Visual inspection showed that, while ARα Δ/+ and ARα Δ/Δ males looked no different than ARα +/+ males ( Fig. 2C ), ARβ mutant males looked profoundly different than ARβ +/+ males, which possessed dominant-typical yellow coloration ( 3 ) ( Fig. 2D ). Hierarchical clustering confirmed these observations ( Fig. S3 and Fig. S4 ). To determine what specific colors were different between ARβ mutant males and ARβ +/+ males, we performed quantitative analysis on images of each fish. ARβ +/+ males differed significantly from ARβ mutant males for several colors ( Fig. 2E-F ; Fig. S5 ). For example, ARβ +/+ males possessed more “very dark yellow” (hex: #55551C) pixels than ARβ Δ/+ males, which had more dark yellow pixels than ARβ Δ/Δ males ( Fig. 2E ), while ARβ Δ/Δ males had more “dark grayish yellow” (#80806A) pixels than both ARβ Δ/+ and ARβ Δ/Δ males ( Fig. 2F ). Therefore, ARβ is required for dominant coloration, while ARα is not. Given the above observations we formed several hypotheses for what to expect from the behavior analysis of mutant fish. Specifically, we anticipated that ARα Δ/Δ and ARα Δ/+ males should exhibit normal levels of dominant behavior, while ARβ Δ/+ and ARβ Δ/Δ fish should exhibit decreased levels of dominant behavior ( 3 ). Strikingly, the exact opposite was true. All reproductive behaviors in ARα mutant males were virtually abolished ( Fig. 3A ; Fig. S6A-D ). ARα mutant males performed significantly fewer aggressive displays than ARα +/+ males ( Fig. 3B ), while attacks directed towards males were unaffected in ARα mutant males ( Fig. S6E-F ). ARα mutant males did not differ from ARα +/+ males in the number of times they fled from the stimulus male ( Fig. S6G ); however, ARα Δ/Δ males fled significantly more from females compared to ARα +/+ males ( Fig. 3C ). Importantly, there was no effect of ARα genotype on how often the stimulus females bit the focal male ( Fig. 3D ), suggesting the effects on fleeing from females were not due to higher aggression from the stimulus female towards the AR mutant focal males. ARβ mutant fish did not differ from ARβ +/+ males for all behaviors ( Fig. 3E-F ; Fig. S6 ) except for one, flee from female. Specifically, ARβ mutants fled from females more than ARβ +/+ males ( Fig. 3G ), coinciding with the findings for this behavior in ARα mutants ( Fig. 3C ). As with ARα , there was no effect of ARβ on how often the stimulus females bit the focal male ( Fig. 3H ). Thus, both ARα and ARβ are required to reduce flees from females. Download figure Open in new tab Figure 3. Dissociable roles of AR α and AR β in the regulation of social behavior. (A) AR α mutant males quivered at females significantly less than AR α +/+ males. (B) AR α mutant males performed lateral displays at males significantly less than AR α +/+ males. (C) AR α Δ/Δ males fled from females significantly more than AR α +/+ males, (D) but there was no effect of AR α genotype on the number of times focal males were bit by females. ( E and F ) There was no effect of ARβ genotype on quiver at female or lateral display at female, (G) but ARβ mutants fled from females more than ARβ +/+ males. (H) There was no effect of ARβ genotype on the number of times focal males were bit by females. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. *** P < 0.001; * P < 0.05. Analysis of AR double mutants reveal either ARα or ARβ is sufficient for attacking males We were surprised that ARα was required for the performance of an aggressive display, but neither it nor ARβ was required for attacking other males. This suggests 1) either AR is sufficient for attacking other males, or 2) an AR-independent mechanism controls attacks directed towards males. We were able to test the first hypothesis by generating AR double mutants through breeding strategies. Given that some ARα mutant males were severely injured in the dyad assay (see Supplementary Results), we used a modified dyad assay in which the focal fish was isolated physically from the three females and stimulus male using two transparent, perforated plastic barriers on either side ( Fig. S7A ). This approach is sufficient for testing our hypothesis about the role of either AR in controlling aggression specifically given previous work ( 5 , 18 ) showing males perform aggressive displays at males on the other side of a barrier and also attack the stimulus male through the barrier ( Fig. S7B-C ). We assayed four AR double wild-type ( ARα +/+ ;ARβ +/+ ) males and six AR double mutant ( ARα Δ/Δ ;ARβ Δ/Δ ) fish. Three of the ARα Δ/Δ ;ARβ Δ/Δ fish were found to be female, which was not determined until dissection where the presence of ovaries was confirmed. ARα +/+ ;ARβ +/+ males weighed more than ARα Δ/Δ ;ARβ Δ/Δ males and females ( Fig. S8A ) and were greater in standard length than ARα Δ/Δ ;ARβ Δ/Δ males ( Fig. S8B ), suggesting that AR regulates body size in line with findings in AR mutant mice ( 18 ). Like ARβ mutant males, ARα Δ/Δ ;ARβ Δ/Δ males had extremely small testes compared to ARα +/+ ;ARβ +/+ males ( Fig. 4A ). As with ARβ mutants, ARα Δ/Δ ;ARβ Δ/Δ males lacked the dominant-typical coloration seen in ARα +/+ ;ARβ +/+ males and were indistinguishable from ARα Δ/Δ ;ARβ Δ/Δ females ( Fig. 4B ). Hierarchical clustering confirmed this observation ( Fig. S9 ). Quantitative image analysis revealed that ARα +/+ ;ARβ +/+ males differed from ARα Δ/Δ ;ARβ Δ/Δ males and females for several colors ( Fig. 4C-D ; Fig. S10 ). For example, ARα +/+ ;ARβ +/+ males possessed more “very dark grayish lime green” (#475547) and “dark grayish lime green” (#6A806A) pixels than ARα Δ/Δ ;ARβ Δ/Δ males and females, which were indistinguishable from one another ( Fig. 4C-D ). Download figure Open in new tab Figure 4. Analysis of AR double mutants highlights the modular control of social dominance by ARα and ARβ . (A) ARα Δ/Δ ;ARβ Δ/Δ males had smaller testes than ARα +/+ ;ARβ +/+ males. (B) ARα Δ/Δ ;ARβ Δ/Δ males and females lacked the dominant-typical coloration observed in ARα +/+ ;ARβ +/+ males. (C) ARα +/+ ;ARβ +/+ males possessed more “very dark grayish lime green” (#475547) (D) and “dark grayish lime green” (#6A806A) pixels than ARα Δ/Δ ;ARβ Δ/Δ males and females, which were indistinguishable from one another. (E) ARα +/+ ;ARβ +/+ males performed more lateral displays (F) and border fights directed towards the stimulus male than ARα Δ/Δ ;ARβ Δ/Δ males and females. (G) A summary of the current findings in the form of a working model. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. ** P < 0.01; * P < 0.05. In addition to the effects described above, we observed striking differences in aggressive behavior between ARα +/+ ;ARβ +/+ and ARα Δ/Δ ;ARβ Δ/Δ fish ( Fig. 3E-H ). ARα +/+ ;ARβ +/+ males performed significantly higher levels of aggressive displays and attacks directed towards the stimulus male compared to ARα Δ/Δ ;ARβ Δ/Δ males and females ( Fig. 4H-I ). Indeed, none of the ARα Δ/Δ ;ARβ Δ/Δ fish performed these behaviors. Surprisingly, both ARα Δ/Δ ;ARβ Δ/Δ males and females performed lateral displays directed towards females , while none of the ARα +/+ ;ARβ +/+ males performed this behavior ( Fig. S11A ). ARα Δ/Δ ;ARβ Δ/Δ males also directed attacks towards females more than ARα +/+ ;ARβ +/+ males ( Fig. S11B ), but this difference did not reach statistical significance ( P =0.06). Previous work has shown that female A. burtoni perform these acts of aggression towards one another ( 21 ). Indeed, the stimulus females in our assays were seen attacking and performing lateral displays at one another (data not shown). Therefore, the aggressive behaviors performed by ARα Δ/Δ ;ARβ Δ/Δ males and females appear to be female-typical. Our findings support our first hypothesis that either AR is sufficient for male-directed attacks, demonstrating further evidence for highly modular control of social dominance traits by AR genes. Observed effects on social dominance are not due to the absence of circulating androgens To determine whether observed effects on dominance traits in AR mutant A. burtoni could have been be due to abnormally low levels of androgens ( 22 , 23 ), we measured levels of testosterone and 11-ketotestosterone (11-KT) in all fish. ARα Δ/Δ and ARα Δ/+ males had levels of testosterone and 11-KT that were indistinguishable from ARα + /+ males ( Fig. S12A-B ). ARα Δ/Δ and ARα Δ/+ males had levels of testosterone that were not different from ARα +/+ males ( Fig. S12C ). ARβ Δ/Δ males possessed higher levels of 11-KT compared to ARβ Δ/+ and ARβ +/+ males ( Fig. S12D ), which is in line with previous work in AR mutant female mice that have intact gonads and significantly higher levels of 5-alpha dihydrotestosterone, the functionally similar metabolite of testosterone found in mammals, compared to wild-types ( 24 ). ARα Δ/Δ ;ARβ Δ/Δ males and females had levels of testosterone that were not different from ARα +/+ ;ARβ +/+ males ( Fig. S12E ). Like ARβ Δ/Δ males, ARα Δ/Δ ;ARβ Δ/Δ males had significantly higher levels of 11-KT compared to ARα +/+ ;ARβ +/+ males, while ARα Δ/Δ ;ARβ Δ/Δ females were not different from either group ( Fig. S12F ). These findings collectively indicate that the observed perturbations in dominance traits in AR mutants are not due to abnormally low levels of androgens. Discussion These data present coherent evidence for remarkable modularity in the control of social status in male A. burtoni . We show a stark double dissociation in the regulation of social status, wherein ARα is required for most dominant behaviors and testes regression but not dominant coloration, while ARβ is required for dominant coloration and testes growth, but not dominant behaviors. At the same time, both ARα and ARβ are required for reducing flees from females and either AR is sufficient for males to attack other males (results summarized in Fig. 4J ). Our findings have important implications for understanding social status and social behavior across species. Like other species, male A. burtoni constantly survey the social environment waiting for an opportunity to achieve social dominance ( 2 ). Previous work in A. burtoni has shown males can uncouple specific dominance traits as a function of variation in social information ( 2 , 3 ). For instance, non-dominant males will turn on bright colors and perform dominant behaviors in the absence of large testes when larger dominant males cannot see them, but immediately turn off their colors and cease dominant behaviors when the dominant male can see them ( 25 ). Dominant males are also able to uncouple coloration and behavior from physiological state in order to deceive neighboring males that are larger than them ( 26 ). The ability to dissociate coloration, physiology, and behavior depending on the social environment reflects a sophisticated social calculus that optimizes chances of survival and reproduction ( 2 ). Our results suggest that this social calculus may be controlled by distinct AR genes. Moreover, the current findings provide further support for theories stating that androgen signaling mediates complex suites of physiological and behavioral responses that contribute to successful social interactions ( 5 , 6 , 27 , 28 ). Through genetic dissection using CRISPR/Cas9 gene editing, we provide compelling evidence that ARα and ARβ have been subfunctionalized, the process by which each duplicated gene retains a subset of ancestral functions ( 12 ). For example, in zebrafish ( Danio rerio ), which possess a single AR gene, mutation of AR produces male fish that possess small testes, reduced color, and perform fewer courtship behaviors compared to wild-types ( 29 , 30 ). The results in zebrafish parallel those found in AR mutant mice, which also possess a single AR gene ( 22 ). In A. burtoni , we have shown that the control of these classes of traits is distributed over AR paralogs. An intriguing follow-up question to our findings is whether the subfunctionalization of AR genes across different cichlid fish contributes to the rich array of social dynamics seen in this clade ( 11 , 31 ). Given the ascent of genome editing tools like CRISPR/Cas9 gene editing, this question can now be tested in species with a range of different social systems and evolutionary trajectories to discover the fundamental molecular mechanisms of social status. Based on our findings, we propose a working framework where the type of dissociable control of social status observed here occurs in other species that rely on social and environmental information to optimize physiology and behavior. In this framework, independent mechanisms integrate social cues and regulate distinct aspects of traits that relate to reproduction. This regulation may begin with androgen signaling, which acts on separate molecular and neural pathways that govern distinct dominance traits in a non-overlapping manner. In this way, our framework is fundamentally similar to the hormonal control of courtship birdsong, wherein discrete steroid-sensitive molecular and neural pathways that regulate different features of song are activated by androgen signaling during the breeding season ( 27 ). This framework can be usefully applied to studies aiming to understand how non-dominant and dominant animals rapidly alter social behavior in way that is seemingly disconnected from their reproductive state and vice-versa ( 1 , 2 ). By performing rich mechanistic studies in a genetically-tractable model species of social status, we have yielded fundamental insights into the nature of social behavior. Materials and Methods Generation of frameshift alleles for ARα and ARβ using CRISPR/Cas9 gene editing Fish were bred and used at Stanford University from a colony derived from Lake Tanganyika ( 32 ) in accordance with AAALAC standards. We generated fish with mutant ARα or ARβ alleles using an approach similar to that of Juntti et al ( 16 ). Mutations of either gene were induced by injection of two single-guide RNAs (sgRNA) simultaneously targeting regions upstream from the DNA binding domain (DBD) and ligand-binding domain (LBD) within exon 1 for ARα and exon 2 for ARβ . For ARα , we designed sgRNAs targeting sequence ARα- A, 5’-ACTGTGGCGGATACTTCTCG-3’, and sequence ARα- B, 5’-GGTGCGCAAACTGTGACGCG-3’, whose cut sites were separated by 178 basepairs (bp). For ARβ , we designed sgRNAs targeting sequence ARβ- A, 5’-GGGAAACATGTGTTCTCTAC-3’, and ARβ - B, 5’-GGGGGAAAGAAGAACTCCAT-3’ whose cut sites were separated by 21 bp. We generated each sgRNA using cloning-free sgRNA synthesis ( 33 ). For instance, to synthesize sgRNA targeting ARα- A (g ARα -A) we annealed oligonucleotide- ARα- A (oligo- ARα- A), which contained the ARα- A target sequence, and oligo-2, a generic oligo that we used for all sgRNA synthesis reactions (see Table S2 for all oligo sequences). g ARα -B, g ARβ -A, and g ARβ -B were synthesized in the same manner. We waited for 30 min of fertilization and then injected single-cell embryos with the two sgRNA targeting ARα or ARβ . We delivered ∼1 nl of each sgRNA, 60 ng/ml nls-zCas9-nls mRNA, and 0.3% Texas-Red-conjugated dextran (3,000 MW; Life Technologies). In ∼5-week embryos injected with g ARα -A and g ARα -B, we PCR amplified a 536-bp amplicon spanning the ARα- A and ARα- B target sites with the primers AR α FlankF, 5’-CCCAGTGCACTCTAACTCCG -3’ and AR α FlankR, 5’ - TTTAAGGGTACGACCTCGGC -3’, and Sanger sequenced the product with AR α FlankR (MCLabs). We performed the same procedure for embryos injected with g ARβ -A and g ARβ -B by PCR amplifying a 642-bp amplicon with the primers ARbFlankF, 5’ - CCATCCCACCTCCAAGAGTC -3’ and AR β FlankR, 5’ - GAGGACAGGCCGATGATGAA -3’, and Sanger sequenced the product with AR β FlankF (MCLabs). We saved fish showing evidence of mutations in ARα or ARβ and crossed these fish to wild-types. These G1 offspring carried a variety of indel alleles, so we selectively propagated an allele for each gene predicted to result in a loss of function (i.e., a 50-bp deletion for ARα and a 5-bp deletion for ARβ ). We intercrossed G1 fish from different founders to obtain biallelic ARα mutants ( ARα Δ / Δ ), heterozygous ARα mutants ( ARα Δ /+ ), and ARα wild-types ( ARα +/+ ) or biallelic ARβ mutants ( ARβ Δ / Δ ), heterozygous ARβ mutants ( ARβ Δ /+ ), and ARβ wild-types ( ARβ +/+ ). Establishing stable dominant tanks Social dominance is reliably induced when males have ample opportunity to establish a territory and access to females to mate with ( 5 , 34 ). This social opportunity can be established using stable dominant tanks, wherein 5-8 size-matched males are housed in a 32-gallon tank with 10-15 females and 5 potential mating sites that are represented by halved terra cotta pots. We housed males from either cross in separate stable dominant tanks for 4-12 weeks. Each stable dominant tank contained males that were matched by the particular cross they arose from. The age of males included in the dyad assays ranged from 6-10 months. 2-3 age- and size-matched males from a given stable dominant tank were ran through separate dyad assays simultaneously. Photography Fish were removed from their tank and placed for ∼20 seconds on a white paper towel to dry them off. Then, fish were immediately placed onto a white paper towel within a light chamber that contained a ruler for scale and photographed using a Sony camera (Sony Alpha NEX-C3 16 MP; shutter speed=1/80; aperture=4.5; white balance=+0.0) mounted on a tripod. 6-10 photos were taken to increase the likelihood of capturing an image during which the fish were not operculating. Fish were fin-clipped (see “Genotyping”) and immediately moved to their dyad assay tank. This whole process took ∼45 seconds. Images were transferred from the camera SD card to a computer (Mac). We were unable to take photos of one ARβ +/+ fish, two ARβ Δ /+ fish, and one ARβ Δ / Δ fish. Quantitative image analysis JPEG images with the highest resolution and where the fish was not operculating were chosen for analyses. To perform quantitative analysis of photos, we first cropped the fish out of the rest of the image using the Lasso Selection tool in Preview. Cropped images were then analyzed using R code (colordistance package: https://CRAN.R-project.org/package=colordistance ), which computes the proportion of pixels in an image occupied by each color. For ARα fish, if 15 or more fish (two-thirds of fish analyzed) had a zero value for a given color, this color was not considered for further analysis. For ARβ fish, if 16 or more fish had a zero value for a given color, this color was not considered for further analysis. For ARα ; ARβ fish, if 7 or more fish had a zero value for a given color, this color was not considered for further analysis. We measured the proportion of pixels occupied by 84 colors for ARα fish, 83 colors for ARβ fish, and 76 colors for ARα ; ARβ fish. Fin-clipping and DNA extraction After photographing the fish, they were immediately fin-clipped. Using ethanol-cleaned scissors, a 1-2 mm portion of the anal fin was excised and placed into an individual PCR tube. This was repeated for the rest of the fish ran on a given day and the scissors were cleaned thoroughly with ethanol between each fin-clipping. To extract DNA, 180 ml of NaOH (50 mM) was added to the sample, which was incubated at 94 C for 15 minutes. Then, 20 ml of Tris-HCL (ph=8) was added directly into the sample, which was then vortexed and spun down using a minicentrifuge for 5 seconds. The samples were then placed at -20C for at least 15 minutes before PCR amplification of mutated regions of ARα or ARβ (see “Generation of frameshift alleles for ARa and ARb using CRISPR/Cas9 gene editing”). Dyad assay setup Each dyad assay was conducted in 8-gallon tanks with enough gravel spread evenly to cover the bottom of the tank and a half terra cotta pot (simulating a potential mating site) in the middle. An air stone supplying oxygen to the water was present in each tank. Each dyad assay tank was visually isolated from nearby tanks using black plastic barriers between and behind tanks. After fish were photographed and fin-clipped (see Fin-clipping and DNA extraction) they were immediately transferred to the tank. Three stimulus females and one stimulus male were collected from community tanks and then added to the dyad assay tank. We aimed to always include gravid females but if this could not be accomplished 1-2 females who were obviously not brooding were included. Stimulus males were chosen based on being smaller than the focal male based on visual inspection. The standard length of the stimulus male was measured after each assay and ranged from being 8-25% smaller than the focal male. Notably, before the assay the stimulus females had never interacted visually, chemically, or physically with the stimulus or focal males and neither had the focal and stimulus male interacted with each other. This process was then repeated for all the other males for which dyad assays were ran. 2-3 dyad assays were ran simultaneously. A Wifi-enabled camcorder (Canon VIXIA HF R80) was then mounted on tripod placed in front of each tank. Recording began the next day (day 1) at 9am and was started remotely using the Wifi function, preventing any disturbance from the experimenter to start recording. Recordings were stopped remotely at 2pm when the fish were fed. The day after (day 2), recording commenced in the same fashion except at 2pm focal fish were removed and tissue was harvested for physiological measurements and blood was collected. Scoring behavior Behavior was scored during 30-minute intervals on day 1 and day 2. The first 30 minutes of scoring for day 1 and day 2 started from the first observation of behavior performed by the focal male after lights on. If an hour elapsed and the fish did not perform a behavior, scoring in the morning was stopped and zero occurrences was recorded for all behaviors for that time point. On day 1 and day 2, the final 30 minutes before lights on—from 1:30 to 2:00 pm—were also scored. Based on previous work, multiple types of behavior were quantified ( 32 ): subordinate behavior (flee from male or flee from female); territorial or agonistic behaviors (lateral display, chase male, bite male, and bite female); and reproductive behaviors (chase female, quiver, lead swim, pot entry, and dig). Fleeing was defined as a rapid retreat swim from an approaching fish. Lateral displays are aggressive displays classified as presentations of the side of the body to another fish with erect fins, flared opercula, and trembling of the body. Biting was defined as the male lunging a short distance towards a fish and biting it on its side and floating backwards a short distance. Chase was defined as a rapid swim directed towards a fish. Chase male, bite male, and bite female are considered attack behaviors. Chase female was grouped with reproductive behaviors because they are a normal component of the courtship repertoire. Quiver was defined as a rapid vibration of the body by the male with presentation of the anal fin egg spots to a female, and lead swim was defined as swimming towards the shelter accompanied by back-and-forth motions of the tail (waggles) as the male attempted to lead a female towards the pot. We defined pot entry as any time the focal male entered the half terra cotta pot and digging as any time the male scooped gravel from inside its pot or around its pot into its mouth and subsequently released it around its pot. Videos were scored in Scorevideo (Matlab). The results of scoring videos were saved into log files that were subjected to a variety of analyses using custom R software. Behaviors across the four 30-minute intervals were averaged (average # of behavior/30 minutes) and statistical analyses were performed on these values. Modified dyad assay setup and scoring Fish included in the modified dyad assay setup were handled in the same way as in the normal dyad assay setup in terms of photography and fin-clipping. The tanks were setup differently, however. Two perforated, transparent, acrylic barriers were placed in the 8-gallon tank to separate the focal fish from three females on one side and one stimulus male on the other. We scored multiple aggressive behaviors in this setup. As with the normal dyad assay setup, we scored aggressive displays: lateral displays that directed at the stimulus male or the stimulus females. We also scored attack behaviors called border fights, which involved the focal fish attacking the stimulus fish across the acrylic barrier and is typified by head-on lunges and rams against the barrier with an open mouth. Morphological and steroid hormone analyses Focal fish were assessed for standard length, body mass, and testes mass (corrected for body mass). Blood samples were also collected with capillary tubes from the caudal vein, centrifuged for 10 min at 5200g, and the plasma was removed and stored at –80 °C until assayed. Immediately after blood collection fish were killed by cervical transection. Testes were removed and weighed. Testes mass could not be recorded for one AR α Δ/+ and one AR α Δ/Δ male that died before the end of the assay. SL, BM, and testes mass were not recorded for two ARβ Δ/+ males. Plasma testosterone and 11-ketotestosterone (11-KT) levels were measured using commercially available enzyme immunoassay (EIA) kits (Cayman Chemical Company, Ann Arbor, MI, USA) as previously described and validated for this species (Maruska and Fernald, 2010b). Briefly, for testosterone and 11-KT assays, a 1-5 μl sample of plasma from each subject was extracted three times using 200 μl of ethyl ether and evaporated under a fume hood before re-constitution in EIA assay buffer. EIA kit protocols were then strictly followed, plates were read at 405 nm using a microplate reader (UVmax Microplate Reader; Molecular Devices, Sunnyvale, CA, USA) and steroid concentrations were determined based on standard curves. All samples were assayed in duplicate. Two ARβ Δ/Δ males could not be assayed for testosterone or 11-KT due to possible contamination and blood was not collected for one ARβ Δ/+ male. One AR α Δ/+ and one AR α Δ/Δ male could not be assayed for testosterone or 11-KT because they died before the end of the assay (see Main Text). One AR α +/+ and one AR α Δ/Δ male could not be assayed for testosterone or 11-KT because their plasma was mistakenly discarded. Statistics and clustering All statistical tests were performed in the R statistical computing environment or Prism 8.3. We used One-Way ANOVAs for all traits tested. Following a significant main effect for an ANOVA, Tukey’s post-hoc tests were used for pairwise comparisons. An individual t-test was used to compare testes mass between ARα +/+ ;ARβ +/+ males and ARα Δ/Δ ;ARβ Δ/Δ males. Differences were considered significant at p≤0.05. To cluster fish based on their coloration, we computed the Euclidean distances between all animals using the R function dist . We input these distances into the R function hclust . Complete linkages were used to build the hierarchical dendrograms in Fig. S3 , Fig. S4 , and Fig. S10 . Funding This work was supported by an Arnold O. Beckman Fellowship to B.A.A., a University of Houston-National Research University Fund (NRUF: R0503962) to B.A.A., an NIH NS034950, NIH MH101373, and NIH MH 096220 to R.D.F., and S.A.J. is supported by an EDGE grant (NSF IOS-1825723). Supplementary Information Supplementary Results Injuries to focal males We found that 2 AR α Δ/wt males and 1 AR α Δ/Δ had damaged fins; 1 injured fish from each of these respective groups died on day 2 before the extractions. Injuries to these fish were likely caused by attacks from the stimulus male as these males fled at high levels from males compared to fish that were not injured (average flee from male±SEM= 74.4±43.29 and 12.16±5.72 for injured and uninjured fish, respectively) and fled from females at levels similar to uninjured fish (average flee from female±SEM= 0.83±0.60 and 1.41±0.26 for injured and uninjured fish, respectively. No AR α +/+ males exhibited injuries and all survived the assay. No injuries were observed in ARβ +/+ , ARβ Δ/wt , or ARβ Δ/Δ fish. Supplementary Figures and Legends Download figure Open in new tab Fig. S1. Predicted amino acid sequence and tertiary structure of wild-type and mutant forms of AR α and ARβ . (A) Amino acid sequence for the wild-type version of AR α ( AR α + ) and the mutant version of AR α ( AR α Δ ), with the latter containing a premature stop sequence (indicated by the red asterisk) induced by a frameshift mutation. (B) Amino acid sequence for the wild-type version of ARβ ( ARβ + ) and the mutant version of ARβ ( ARβ Δ ), with the latter containing incorrect amino acids (indicated in red font) and a premature stop sequence (indicated by the red asterisk) induced by a frameshift mutation. (C) Computer modeling (Phyre2( 17 )) predicts from the ARα + amino acid sequence extensive tertiary structure in the ARα + protein that is absent from that predicted from the ARα Δ amino acid sequence. (D) Computer modeling (Phyre2( 17 )) predicts from the AR β + amino acid sequence extensive tertiary structure in the ARα + protein that is absent from that predicted from the AR β Δ amino acid sequence. (N # ) indicate the number of bases not shown in actual gene sequence for clarity. +=wild-type. Δ =frameshift deletion. Download figure Open in new tab Fig. S2. No effects of AR genotype on body mass and standard length. There was no effect of ARα ( A and B ) or ARβ ( C and D ) genotype on body size or standard length. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. ns=not significant. Download figure Open in new tab Fig. S3. Results of hierarchical clustering of ARα fish by color. Each branch with a distinct colored circle at the tip represents a fish from a given genotype. Fish form clusters that are unrelated to genotype, confirming visual qualitative observations that ARα mutant males do not look different than ARα +/+ males. Download figure Open in new tab Fig. S4. Results of hierarchical clustering of ARβ fish by color. Each branch with a distinct colored circle at the tip represents a fish from a given genotype. ARβ Δ/Δ and ARβ +/+ males fall into two distinct clusters, while ARβ Δ/+ males are split nearly equally between those two clusters, confirming visual qualitative observations that ARβ Δ/Δ males look different than ARβ +/+ males and reflecting an intermediate coloration pattern in ARβ D/+ males. Download figure Open in new tab Fig. S5. ARβ is necessary for the normal expression of numerous colors. ( A to J ) ARβ +/+ males exhibit a larger proportion of pixels for several colors compared to ARβ mutant males. ( K and L ) ARβ mutant males show a greater proportion of pixels for two colors compared to ARβ Δ/Δ males. (M to O ) ARβ +/+ males show a greater proportion of pixels for three colors compared to ARβ Δ/Δ males but ARβ Δ/+ males were not different from either group for these colors. ( P and Q ) For two colors, ARβ Δ/+ males had a greater proportion of pixels than ARβ Δ/Δ males but not ARβ +/+ males. (R) For one color, ARβ Δ/Δ males had more pixels than ARβ +/+ males, (S to T) while for two colors ARβ Δ/Δ males had a greater proportion of pixels compared to both groups. (V) ARβ Δ/+ males had more pixels for one color. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. **** P <0.0001; *** P <0.001; ** P < 0.01; * P < 0.05. Download figure Open in new tab Fig. S6. Effects of AR genotype on different social behaviors. ( A to D ) AR α is required for the performance of numerous reproductive behaviors. (E and F) AR α is not required for attacking the stimulus male. (G) AR α genotype does not affect the number of times males flee from the stimulus male. (H and I) AR α genotype does not affect the number of times males bite females or are bit by the stimulus male. ( J to M ) ARβ is not required for reproductive behaviors or ( N and O ) attacking the stimulus male. ( P ) ARβ genotype does not affect the number of times males flee from the stimulus male. ( Q and R ) ARβ genotype does not affect the number of times males bite females or are bit by the stimulus male. wt=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. ns=not significant. * P < 0.05. Download figure Open in new tab Fig. S7. Scoring behavior during modified dyad assays. (A) A modified dyad assay was used to assess aggression. The focal fish was separated physically from the stimulus male and females by a transparent, perforated, acrylic barrier. ( B and C ) A. burtoni will perform border fights at either sex and perform lateral displays at either sex during modified dyad assays. Download figure Open in new tab Fig. S8. ARα;ARβ genotype affects body mass and standard length. (A) ARα +/+ ;ARβ +/+ males weighed more than ARα Δ/Δ ;ARβ Δ/Δ males and females (B) and were greater in standard length than ARα Δ/Δ ;ARβ Δ/Δ males. +=wild-type. Δ =frameshift deletion in both ARα and ARβ alleles. Circles represent data points for individual fish. Crosses represent Mean±SEM. ** P < 0.01; * P < 0.05. Download figure Open in new tab Fig. S9. Results of hierarchical clustering of ARα;ARβ fish by color. Each branch with a distinct colored circle at the tip represents a fish from a given genotype. ARα +/+ ;ARβ +/+ males form a cluster that is distinct from ARα Δ/Δ ;ARβ Δ/Δ males and females, confirming visual qualitative observations that ARα +/+ ;ARβ +/+ males look different from ARα Δ/Δ ;ARβ Δ/Δ males and females ARα Δ/Δ ;ARβ Δ/Δ . Download figure Open in new tab Fig. S10. ARα;ARβ genotype affects whole-body coloration. (A) ARα +/+ ;ARβ +/+ males had a greater proportion of pixels for one color compared to than ARα Δ/Δ ;ARβ Δ/Δ males and females. (B and C) ARα Δ/Δ ;ARβ Δ/Δ males expressed more pixels for two colors than ARα +/+ ;ARβ +/+ males and ARα Δ/Δ ;ARβ Δ/Δ females. (D) ARα Δ/Δ ;ARβ Δ/Δ females expressed more pixels for one color compared to ARα +/+ ;ARβ +/+ males. +=wild-type. m=male. f=female. Δ =frameshift deletion in both ARα and ARβ alleles. Circles represent data points for individual fish. Crosses represent Mean±SEM. *** P <0.001; ** P < 0.01; * P < 0.05. Download figure Open in new tab Fig. S11. Effects on female-directed aggression. (A) ARα Δ/Δ ;ARβ Δ/Δ males performed more lateral displays directed towards females than ARα +/+ ;ARβ +/+ males. (B) There was a statistical trend (omnibus ANOVA P =0.06) for an effect of ARα;ARβ genotype on attacks directed towards females. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. * P < 0.05. Download figure Open in new tab Fig. S12. Effects on AR genotype on testosterone and 11-ketotestosterone levels. (A and B) ARα genotype has no effect on testosterone or 11-ketotestosterone (11-KT) levels. ( C ) ARβ genotype has no effect on testosterone levels, (D) but ARβ Δ/Δ males have higher levels of 11-KT than ARβ Δ/+ and ARβ +/+ males. (E) ARα;ARβ genotype had no effect on testosterone levels, (F) but ARα Δ/Δ ;ARβ Δ/Δ had higher levels of 11-KT than ARα +/+ ;ARβ +/+ males. +=wild-type. Δ =frameshift deletion. Circles represent data points for individual fish. Crosses represent Mean±SEM. * P < 0.05. Supplementary Tables and Legends View this table: View inline View popup Download powerpoint Table S1. Gene information. Information was gathered from NCBI ( https://www.ncbi.nlm.nih.gov/gene/?term=androgen+receptor+burtoni ) on A. burtoni ARs. View this table: View inline View popup Download powerpoint Table S2. Oligonucleotides used to synthesize single-guide RNA (sgRNA). We synthesized sgRNA by annealing oligo-1, which was specific to each target site, to oligo-2, a generic oligo that allows for amplification of the sgRNAs. g=guide. AR=androgen receptor. Acknowledgments We thank Danielle Blakkan for assistance with the experimental set-up and Andrew Hoadley for assistance with hormone extractions and EIAs and providing feedback on an earlier version of this manuscript. References 1. ↵ R. M. Sapolsky , The influence of social hierarchy on primate health . 308 , 648 – 653 ( 2005 ). OpenUrl 2. ↵ R. D. Fernald , Cognitive skills needed for social hierarchies . Cold Spring Harb. Symp. Quant. Biol . 79 , 229 – 236 ( 2014 ). OpenUrl Abstract / FREE Full Text 3. ↵ R. D. Fernald , K. P. Maruska , Social information changes the brain . Proc. Natl. Acad. Sci . 109 , 17194 – 17199 ( 2012 ). OpenUrl Abstract / FREE Full Text 4. ↵ J. Dreher , S. Dunne , A. Pazderska , T. Frodl , J. J. Nolan , Testosterone causes both prosocial and antisocial status-enhancing behaviors in human males . Proc. Natl. Acad. Sci . 113 , 11633 – 11638 ( 2016 ). OpenUrl Abstract / FREE Full Text 5. ↵ B. A. Alward , A. T. Hilliard , R. A. York , R. D. Fernald , Hormonal regulation of social ascent and temporal patterns of behavior in an African cichlid . Horm. Behav . 107 , 83 – 95 ( 2019 ). OpenUrl 6. ↵ C. Eisenegger , J. Haushofer , E. Fehr , The role of testosterone in social interaction . Trends Cogn. Sci . 15 , 263 – 271 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ Z. A. Knight , K. M. Shokat , Chemical Genetics: Where Genetics and Pharmacology Meet . Cell 128 , 425 – 430 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 8. ↵ T. J. Stevenson , et al. , The value of comparative animal research: Krogh’s Principle facilitates scientific discoveries . Policy Insights from Behav. Brain Sci . 5 , 118 – 125 ( 2018 ). OpenUrl 9. G. E. Robinson , R. D. Fernald , D. F. Clayton , Genes and social behavior . Science 322 , 896 – 900 ( 2008 ). OpenUrl Abstract / FREE Full Text 10. ↵ L. A. O’Connell , H. A. Hofmann , Social status predicts how sex steroid receptors regulate complex behavior across levels of biological organization . Endocrinology 153 , 1341 – 1351 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 11. ↵ D. Brawand , et al. , The genomic substrate for adaptive radiation in African cichlid fish . Nature 513 , 375 – 381 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 12. ↵ S. Ohno , Evolution by gene duplication ( Springer , 1970 ). 13. ↵ J. A. Doudna , E. Charpentier , The new frontier of genome engineering with CRISPR-Cas9 . Science 346 , 1 – 9 ( 2014 ). OpenUrl 14. ↵ L. E. Jao , S. R. Wente , W. Chen , Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system . Proc. Natl. Acad. Sci. U. S. A . 110 , 13904 – 13909 ( 2013 ). OpenUrl Abstract / FREE Full Text 15. ↵ G. K. Varshney , et al. , High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9 . Genome Res . 25 , 1030 – 1042 ( 2015 ). OpenUrl Abstract / FREE Full Text 16. ↵ S. A. Juntti , et al. , A neural basis for control of cichlid female reproductive behavior by prostaglandin F2α . Curr. Biol . 26 , 943 – 949 ( 2016 ). OpenUrl CrossRef 17. ↵ L. A. Kelley , S. Mezulis , C.M. Yates , M.N Wass , & M.J. Sternberg , The Phyre2 web portal for protein modeling, prediction and analysis . Nat. Protoc . 10 , 845 – 858 ( 2015 ). OpenUrl CrossRef PubMed 18. ↵ K. P. Maruska , R. D. Fernald , Behavioral and physiological plasticity: Rapid changes during social ascent in an African cichlid fish . Horm. Behav . 58 , 230 – 240 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 19. S. S. Burmeister , E. D. Jarvis , R. D. Fernald , Rapid behavioral and genomic responses to social opportunity . PLoS One 3 , 1 – 9 ( 2005 ). OpenUrl 20. ↵ R. M. Alcazar , L. Becker , A. T. Hilliard , K. R. Kent , R. D. Fernald , Two types of dominant male cichlid fish: behavioral and hormonal characteristics . Biol. Open 5 , 1061 – 1071 ( 2016 ). OpenUrl Abstract / FREE Full Text 21. ↵ S. C. P. Renn , E. J. Fraser , N. Aubin-Horth , B. C. Trainor , H. A. Hofmann , Females of an African cichlid fish display male-typical social dominance behavior and elevated androgens in the absence of males . Horm. Behav . 61 , 496 – 503 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 22. ↵ S. A. Juntti , et al. , The androgen receptor governs the execution, but not programming, of male sexual and territorial behaviors . Neuron 66 , 260 – 72 ( 2010 ). OpenUrl CrossRef PubMed 23. ↵ T. Sato , et al. , Brain masculinization requires androgen receptor function . Proc. Natl. Acad. Sci. U. S. A . 101 , 1673 – 1678 ( 2004 ). OpenUrl Abstract / FREE Full Text 24. ↵ X. B. Cheng , et al. , Characterizing the neuroendocrine and ovarian defects of androgen receptor-knockout female mice . Am. J. Physiol. - Endocrinol. Metab . 305 ( 2013 ). 25. ↵ J. K. Desjardins , H. A. Hofmann , R. D. Fernald , Social context influences aggressive and courtship behavior in a cichlid Fish . PLoS One 7 , 1 – 5 ( 2012 ). OpenUrl CrossRef PubMed 26. ↵ C. C. Chen , R. D. Fernald , Visual information alone changes behavior and physiology during social interactions in a cichlid fish (Astatotilapia burtoni) . PLoS One 6 , 1 – 12 ( 2011 ). OpenUrl CrossRef PubMed 27. ↵ B. A. Alward , C. A. Cornil , J. Balthazart , G. F. Ball , The regulation of birdsong by testosterone: Multiple time-scales and multiple sites of action . Horm. Behav . 104 , 32 – 40 ( 2018 ). OpenUrl 28. ↵ J. M. Carré , J. Archer , Testosterone and human behavior: the role of individual and contextual variables . Curr. Opin. Psychol . 19 , 149 – 153 ( 2018 ). OpenUrl 29. ↵ C. M. Crowder , C. S. Lassiter , D. A. Gorelick , Nuclear Androgen Receptor Regulates Testes Organization and Oocyte Maturation in Zebrafish . Endocrinology 159 , 980 – 993 ( 2018 ). OpenUrl CrossRef 30. ↵ L. Yong , Z. Thet , Y. Zhu , Genetic editing of the androgen receptor contributes to impaired male courtship behavior in zebrafish . J. Exp. Biol . 220 , 3017 – 3021 ( 2017 ). OpenUrl Abstract / FREE Full Text 31. ↵ M.E. Santos , W. Salzburger , How cichlids diversify . Science 338 , 619 – 620 ( 2012 ). OpenUrl Abstract / FREE Full Text 32. ↵ R. D. Fernald , N. R. Hirata , Field study of Haplochromis burtoni: Quantitative behavioural observations . Anim. Behav . 25 , 964 – 975 ( 1977 ). OpenUrl CrossRef Web of Science 33. ↵ G. K. Varshney , et al. , A high-throughput functional genomics workflow based on CRISPR/Cas9-mediated targeted mutagenesis in zebrafish . Nat. Protoc . 11 , 2357 – 2375 ( 2016 ). OpenUrl CrossRef PubMed 34. ↵ H. E. Fox , S. A. White , M. H. Kao , R. D. Fernald , Stress and dominance in a social fish . J. Neurosci . 17 , 6463 – 6469 ( 1997 ). OpenUrl Abstract / FREE Full Text Back to top Previous Next Posted June 24, 2020. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Modular genetic control of social status in a cichlid fish Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Modular genetic control of social status in a cichlid fish Beau A. Alward , Vibhav Laud , Christopher J. Skalnik , Ryan A. York , Scott Juntti , Russell D. Fernald bioRxiv 2020.04.03.024190; doi: https://doi.org/10.1101/2020.04.03.024190 Share This Article: Copy Citation Tools Modular genetic control of social status in a cichlid fish Beau A. Alward , Vibhav Laud , Christopher J. Skalnik , Ryan A. York , Scott Juntti , Russell D. Fernald bioRxiv 2020.04.03.024190; doi: https://doi.org/10.1101/2020.04.03.024190 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Animal Behavior and Cognition Subject Areas All Articles Animal Behavior and Cognition (7969) Biochemistry (18633) Bioengineering (14770) Bioinformatics (44156) Biophysics (22458) Cancer Biology (19591) Cell Biology (26746) Clinical Trials (138) Developmental Biology (13902) Ecology (20890) Epidemiology (2067) Evolutionary Biology (25316) Genetics (16100) Genomics (23400) Immunology (18609) Microbiology (42209) Molecular Biology (17947) Neuroscience (92896) Paleontology (693) Pathology (2969) Pharmacology and Toxicology (5063) Physiology (8066) Plant Biology (15908) Scientific Communication and Education (2091) Synthetic Biology (4538) Systems Biology (10188) Zoology (2376) window.__CF$cv$params={r:'a379a0364d1514e5',t:'MTc4ODgyNTEzMg==',u:'01a07e4965ea76e1a351af12dbde533f',ut:'dYFaXA.eEZZ6GvH7I9LVeEUtJV7Y3pFkNJN.lzXtCss-1788825134-1.2.1.1-WKys1clfsaAhlfF5Bp4TuQRwdH1kHoM6It2XEJFOnZob1uf4tqTmOxLb6tu5RJxkJm0_s3qO1PsZ4RqvNb2_SmK0rvpD8OOWQ16fjC93YiM',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

⚙ Ask this paper AI returns verbatim quotes from the full text · source: preprint-html ⓘ

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-08-12T06:43:03.944938+00:00
License: CC-BY-ND-4.0