The cholesterol 24-hydroxylase enzyme, CYP46A1, reduces overexpressed alpha-synuclein proteins in human cellular models of Parkinson’s disease.

The cholesterol 24-hydroxylase enzyme, CYP46A1, reduces overexpressed alpha-synuclein proteins in human cellular models of Parkinson’s disease. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The cholesterol 24-hydroxylase enzyme, CYP46A1, reduces overexpressed alpha-synuclein proteins in human cellular models of Parkinson’s disease. Corinne Besnard-Guérin, Lisa Rousselot, Emilie Audouard, Farah Chali, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4580957/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract A growing body of evidence suggests a correlation between cholesterol metabolism and the pathogenesis of Parkinson's disease (PD). We and others have demonstrated that the activation of the cholesterol 24-hydroxylase enzyme, CYP46A1, responsible for converting cholesterol to 24S-hydroxycholesterol (24-OHC) in the brain, is an effective therapeutic strategy for several neurodegenerative diseases as Alzheimer's disease, Huntington’s disease, spinocerebellar ataxia type 3. This approach has demonstrated that overexpression of CYP46A1 can reduce aggregated protein levels, enhance memory and cognitive performance, and improve motor phenotype in animal models. Nevertheless, there is still much to be illuminated regarding the role of CYP46A1 in PD. Alpha-synuclein (alpha-syn), the hallmark pathological protein of PD, exhibits a pronounced affinity for binding to lipid membranes, especially in cholesterol-rich regions and contains a high-affinity cholesterol-binding motif in the 67–78 aa region. In this study, we demonstrate that overexpression of human CYP46A1 leads to a decreased expression of wild-type alpha-syn proteins in human neuroblastoma SH-SY5Y cells through the autophagy-lysosomal pathway. Additionally, our findings suggest that CYP46A1 may also decrease the levels of alpha-syn proteins overexpressed with mutations in the cholesterol-binding domain or at the residue A53T, which is associated with familial pathology. Moreover, CYP46A1 retains its functionality in a cellular model of PD associated with GBA1. The gene GBA1 is involved in lipid metabolism, and its deficiency represents the most prevalent genetic factor associated with an elevated risk of PD. These results provide insights into disease pathogenesis and potential therapeutic pathways that could benefit patients with PD. Parkinson’s disease CYP46A1 alpha-synuclein autophagy human neuroblastoma cells (SH-SY5Y) Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Alpha-synuclein (alpha-syn) plays a central role in the development of Parkinson's disease (PD) (Devine et al., 2011 ). A key characteristic of PD is the degeneration of dopaminergic neurons in the substantia nigra pars compacta. The remaining neurons display an accumulation of alpha-syn proteins, forming aggregates in Lewy bodies. The SNCA gene encodes a 14.5-kDa protein, alpha-syn, which has been implicated as a crucial factor in synaptic vesicle trafficking and dopamine release. However, its physiological function remains not completely understood. Overexpression of the alpha-syn protein, resulting from duplications or triplications of the SNCA locus, or point mutations in the SNCA gene, is associated with familial forms of PD (Polymeropoulos et al., 1997 ; Krüger et al., 1998 ; Singleton AB et al., 2003 ). While many of these genetic alterations are either rare or confer a variable risk for developing PD, they highlight that the exclusive overexpression of alpha-syn can contribute to the onset of the disease. The spread of aggregated alpha-syn from cell to cell is currently considered as a mechanism explaining the pathological progression of the disease. Due to the aberrant assembly of alpha-syn being a common feature in the development of PD, significant efforts have been dedicated to understanding and inhibiting this phenomenon. Recent findings indicate that Lewy bodies in addition of the high level of alpha-syn proteins are also characterized by a high lipid content and degenerated organelles suggesting that lipids, which are the main constituents of cell membranes, may contribute to the development of the disease (Shahmoradian et al., 2019 ; Mahul-Mellier et al., 2020 ). Over the last two decades, accumulating evidence suggests a transient binding of alpha-syn to lipid membranes particularly in cholesterol-rich regions (Fortin et al., 2004 ; van Maarschalkerweerd et al., 2015 ; Kachappilly et al., 2022 ; Qi et al., 2023 ). Cholesterol may affect the binding of alpha-syn to the membrane and its abnormal aggregation (Man et al., 2020 ; Jakubec et al., 2021 ; Qi et al., 2023 ). Studies have also demonstrated that alpha-syn significantly stimulates cholesterol efflux (Hsiao et al., 2017 ). The brain, being the highest cholesterol-rich organ in mammals, maintains a crucial balance of cholesterols levels through a precisely regulated process called brain cholesterol homeostasis. Cholesterol, is an integral component of membranes, contributing to their structure and function and acts as a precursor of metabolites involved in various metabolic pathways. The cholesterol is mainly found in the myelin sheaths of the oligodendrocytes, as well as in the membranes of glial cells and neurons. Astrocytes synthesize cholesterol and export it through ATP-binding cassette transporters, primarily via ABCA1 transporter. The transportation of cholesterol to neurons is facilitated by Apo E, which is also synthesized by astrocytes (Mahley, 2016 ). Studies have shown disruptions in this balance during neurodegenerative diseases such as Alzheimer's disease (AD) (Bogdanovic et al., 2001 ; Desai et al., 2002 ; Brown et al., 2004 ), Huntington’s disease (HD) (del Toro et al., 2010 ; Kreilaus et al., 2016), spinocerebellar ataxia type 3 (SCA3) and amyotrophic lateral sclerosis (ALS)(Abdel-Khalik et al., 2017 ) as well as in brain disorders such as epilepsy (Chali et al., 2015 ). Previous research has demonstrated that regulating cholesterol homeostasis through the overexpression of CYP46A1, a brain-specific enzyme that converts cholesterol into 24-hydroxycholesterol (24-OHC), has protective effects against AD (Hudry et al., 2010 ; Burlot et al. 2015 ), HD (Boussicault et al. 2016 ; Kacher et al., 2019 ), SCA3 (Nobrega et al., 2019) and Rett syndrome (Audouard et al., 2024 ). The role of CYP46A1, primarily located in neurons, is crucial because cholesterol itself cannot cross the blood- brain barrier (BBB), whereas 24-OHC can pass through BBB into the systemic circulation. Acting as a ligand for liver X receptors (LXR), 24-OHC subsequently regulates the transcription of cholesterol transport proteins such as ABCA1, which are located on the plasma membrane. Consequently, this process effectively regulates cholesterol efflux. However, these studies have revealed that the effects of CYP46A1 activity extend beyond cholesterol maintenance, leading to a reduction in aggregated proteins implicated in these diseases (Moutinho et al., 2016 ). These findings underscore the pivotal role of cholesterol turnover and 24-OHC in neurological disorders. Despite this, only a few studies investigated the role of CYP46A1 in PD. Recent research has revealed reduced levels of CYP46A1 proteins in induced pluripotent stem cell (iPSC)-derived dopaminergic neurons from patients carrying the SNCA triplication or the A53T SNCA mutation, both associated with familial PD onset (Zambon et al., 2019 ). Notably, CYP46A1 overexpression has been observed to elevate levels of 24-OHC and 24(S),25-epoxycholesterol (24, 25-EC) in the developing midbrain. This process has been proposed as a potential mechanism for preventing dopaminergic loss in PD (Theofilopoulos et al., 2019 ). These data suggested that CYP46A1 could be an important factor in PD. The aim of our study was to investigate whether the overexpression of CYP46A1 could also be beneficial for PD and lead to a decrease in overexpressed alpha-syn. In the present study, we aimed to investigate whether the expression of CYP46A1 could reduce the levels of overexpressed alpha-syn proteins in neuroblastoma SH-SY5Y cells. To deepen our comprehension of CYP46A1’s actions, we evaluated not only the expression of wild-type alpha-syn but also the expression of A53T alpha-syn mutant associated with the familial form of the disease (Polymeropoulous et al., 1997), as well as mutants lacking presumed cholesterol-binding sites, all in the presence of CYP46A1. Additionally, we investigated the impact of CYP46A1 on alpha-syn overexpression by inhibiting autophagic-lysosome functions using autophagic inhibitors and by reducing the expression of the lysosomal enzyme encoded by the GBA1 gene, which are among the most common genetic factors associated with an increased risk of PD (Neumann et al., 2009 ; Brockmann et al., 2015 ). Methods Generation of untagged alpha-synuclein constructs Human alpha-synuclein (WT or A53T) cDNA was amplified by PCR from previously described vectors kindly provided by Addgene (plasmids #102361 and 105727). The PCR products were cloned in the HindIII/XbaI sites of the pcDNA3.1 vector using primers described in Table S2. Cell Culture and co-transfections Human SH-SY5Y neuroblastoma cells (ATCC:CRL-266), were cultured in DMEM with Glutamax (Gibco), supplemented with 4,5g/L D-glucose and sodium pyruvate, 10% heat-inactivated fetal bovine serum (Gibco), 100 U/ml penicillin, and 100 µg/ml streptomycin (Gibco), in a 5% CO2 atmosphere at 37°C. Cells were transiently transfected with plasmids using Lipofectamine 2000 (Invitrogen), following to the manufacturer’s instructions. The pcDNA3-EGFP plasmid was obtained from Addgene (plasmid #13031) while pAAV-HA-CYP46A1 or pCMV-CYP46A1-Flag plasmids were provided by Askbio France. For autophagy inhibition, treatments were initiated either 6 hours or 24 hours post-transfection with 3-MA or BafA1, respectively. Cells were then incubated with 3-MA for 42 hours or with BafA1 for 24 hours. 3-MA (189–490, Millipore) was prepared at a concentration of 50 mM in Opti-MEM(Gibco), sterilized by filtration through a syringe filter with a 0,2µM pore size and added to a final concentration of 5 mM in the cell medium. BafA1 (B1793, Sigma) was dissolved as a 10uM solution in DMSO and added to the cell medium to achieve a final concentration of 50 nM. For proteasome inhibition, MG132 (474790, Sigma) was prepared as a 20 mM solution in DMSO. Cells were treated with 20 µM MG132 42 hours post-transfection for 6 hours. The concentrations of these inhibitors were selected based on data from other studies and preliminary experiments. Protein extraction and western-blot analysis Cell pellets were homogenized in RIPA buffer (150 mM NaCl, 50 mM Tris pH 8, 1% Triton X-100, 0,5% sodium deoxycholate, 0,1%SDS) supplemented with protease inhibitors for 30 min at 4°C. Whole lysates were clarified by centrifugation at 10,000 rpm for 15 min. Protein concentrations were quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) with bovine serum albumin (BSA) standards for comparison. Equal volumes of each sample were separated by SDS-PAGE. Protein samples were denatured for 3 min at 95°C and separated into 4–20% SDS-polyacrylamide gels, then transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked with 5% BSA in Tris-buffered saline (TBS) pH 8 for 1 h, followed by overnight incubation with primary antibodies (dilution 1:1000) at 4°C. After washing three times for 10 min each in TBS with 0.1% Tween-20, membranes were incubated with Li-COR fluorescent secondary antibodies (dilution 1:6000) for 1 h at room temperature and washed three more times with TBS with 0.1% Tween-20. Finally, images of the membranes were captured using a Li-COR Odyssey fluorescence scanner. The protein ladder used was Precision Plus Protein standards Kaleidoscope ladder, 10 to 250 kD (Bio-Rad). Immunofluorescence microscopy For immunostaining, SH-SY5Y cells were cultured on glass coverslips. Twenty-four hours post-transfection, cells were washed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde in PBS, quenched for 10 min with 0.1 M glycine in PBS and permeabilized for 30 min at room temperature with 0.05% saponin, PBS, 0.5% bovine serum albumin. The coverslips were incubated for 2 h at room temperature with the primary antibodies (see below) at dilution 1:250 in PBS containing 0.5% BSA, 0.05% saponin. After washing, cells were subsequently incubated for 2 h at room temperature with the secondary antibodies (see below) at dilution 1:500, covered from light. Cells were washed three times with PBS and mounted using Vectashield with DAPI or without (Vector Laboratories). Fluorescent images of cells were captured with a 60x objective using a Zeiss Apotome 2 microscope with the structured illumination system equipped of a Zeiss Axiocam Camera. Image acquisition was performed with the ZEN 2 (Zeiss) software. The images were merged and analyzed using Image J. Antibodies The following primary antibodies were used: rabbit anti-actin (Sigma, A2066), rabbit anti-GFP (Sigma, SAB301138), rabbit anti-HA (Cell Signaling, 3724), mouse anti-alpha-synuclein antibody (Invitrogen, AHB0261), mouse anti-Flag (Sigma, F3165), mouse anti-ubiquitin (Invitrogen, 14-6078-82), mouse anti-Lamp2A (Abcam, Ab25631), rabbit anti-LC3B (Abcam, 51520), rabbit anti-GBA1 (Sigma, G4171). Secondary antibodies for immunoblotting were appropriate goat anti-mouse or anti-rabbit IRDye 680RD or 800CW IgG (Odyssey LI-COR). For immunofluorescence labelling Alexa-488 or Alexa 555 -conjugated donkey anti -mouse or anti-Rabbit, (Life technologies) were used. RNA isolation and quantitative PCR Total RNA was extracted from cells using TRIzol reagent (Invitrogen), treated with DNase I and reverse-transcribed using the Onescript qPCR RT Kit (Ozyme). cDNA was amplified using SYBR Green on the Roche Light Cycler 480 for quantification. The relative expression levels of mRNA were normalized to S18 ribosomal RNA levels (RibS18). The following primers were used: Human CYP46A1 forward (5’CGAGTCCTGAGTCGGTTAAGAAGTT3’) and reverse (5‘AGTCTGGAGCGCACGGTACAT3’), human alpha-syn forward (5’ACCAAACAGGGTGTGGCAGAAG3’) and reverse (5’CTTGCTCTTTGGTCTTCTCAGCC3’) and human Ribs18 forward (5’GAGGATGAGGTGGAACGTGT3’) and reverse (5’GGACCTGGCTGTATTTTCCA3’). The program consisted of an initial hot start cycle at 95°C for 2min, followed by 45 cycles at 95°C for 10 s, 65°C for 20 s and 72°C for 20s with a final extension at 72°C for 10 min. Each sample was assayed in triplicate. Site-direct mutagenesis The human alpha-syn-pcDNA3.1 plasmid was subjected to site-directed mutagenesis to introduce specific amino acid changes within the domain spanning residues 67 to 78, as listed in Table S1. Various plasmids were generated including: plasmid 38 with mutations A69G, V70L, T72S, G73R; plasmid 39 with mutations A69T, V70R, G73Y, V74W, A76S; plasmid 40 with mutations V71S, T72A, T75A, A76S and plasmid 42 with mutation A69K. Forward and reverse primers, each of 25–40 nucleotides long, were designed to introduce the desired mutations (see Table S2). Additional primers were necessary for cloning into the HindIII/XbaI sites of the pcDNA3.1 vector (see Table S2). PCR was performed using the mutation primers (forward or reverse), cloning primers (HindIII or XbaI primers) and the alpha-syn-pcDNA3.1 plasmid as a template, along with a high-fidelity thermostable Taq DNA polymerase (Thermo Fisher, Master Mix Dream Taq Green PCR). The PCR conditions involved an initial denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 66°C for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 7 min. For each construct, a final PCR was conducted using the two PCR fragments isolated on agarose gels with a gel extraction kit (Qiagen), along with the two HindIII and XbaI primers. The resulting PCR product was isolated using the Qiaquick PCR purification kit (Qiagen), digested with HindIII and XbaI, and then ligated into the pcDNA3.1 plasmid, which had been previously digested with HindIII and XbaI. The plasmids were transformed into competent bacteria via heat shock. Single colonies were selected, grown overnight, and plasmid DNA was isolated using a miniprep kit (Qiagen). Sequencing of the plasmids was conducted to confirm the introduced base changes. Reduction of Lamp2A or GBA1 expression by RNA silencing To downregulate the levels of glucocerebrosidase (GCase) encoded by the GBA1 gene or Lamp2A proteins, siRNAs were purchased from Thermo Fisher Scientific (Ambion by Life technologies). Three siRNAS targeting human GBA1 (GBA1a (GBA-s501316), GBA1b (GBA-s534767) and GBA1c (GBA-s534768)) were tested. The siRNA targeting human Lamp2A is Lamp2-s8086. As a negative control, siRNA s18483 obtained from Thermofisher was used. The specific siRNAs, at a concentration of 50nM, were co-transfected with Lipofectamine 2000 (Invitrogen) along with alpha-syn and GFP or CYP46A1 plasmids for 48 hours into SH-SY5Y cells. Statistical analysis Statistical analyses were conducted using GraphPad Prism. The specific statistical tests used are indicated in the figure legends. Values are presented as means ± SEM. A p-value of less than 0.05 was considered statistically significant. Results Decrease in alpha-syn expression following co-transfection with CYP46A1 in neuroblastoma SH-SY5Y cells To explore the impact of CYP46A1 on alpha-syn in PD, we generated a plasmid harboring human wild-type (WT) alpha-syn cDNA. This construct was then co-transfected with a plasmid expressing either CYP46A1 or GFP into human neuroblastoma SH-SY5Y cells. Forty-eight hours post-transfection, the presence of CYP46A1 led to a significant threefold reduction in the levels of alpha-syn proteins (Fig. 1 a-b). Immunofluorescence analysis of CYP46A1 and alpha-syn conducted 48 hours post-transfection revealed cytoplasm localization for alpha-syn, characterized by a vesicular pattern. CYP46A1 predominantly exhibited localization around the nuclear membrane and within the cytoplasm, likely associated with the membrane of the endoplasmic reticulum, as previously demonstrated (Russell et al., 2009 ) (Fig. 1 c). Next, we investigated whether the reduction in alpha-syn expression occurred at the transcriptional level by performing real-time RT-QPCR analysis. Analysis of alpha-syn mRNA levels from cells co-transfected with alpha-syn and either CYP46A1 or GFP showed no significant difference. These findings suggest that the difference in alpha-syn levels is not attributable to transcriptional regulation by CYP46A1 (Fig. 1 d). In conclusion, we have demonstrated that while CYP46A1 does not reduce the level of alpha-syn transcripts, it does affect the level of alpha-syn proteins. Impact of CYP46A1 overexpression on A53T alpha-syn mutant and mutants devoid of presumed putative cholesterol-binding sites Some findings underscore the crucial role of cholesterol in mediating interactions between physiologically relevant membranes and alpha-syn in neurological diseases. Disruption of this association redistributes alpha-syn away from the synapse and impairs its cellular function (Fortin et al., 2004 ). Furthermore, alpha-syn extracellular has been discovered to significantly enhance cholesterol efflux from neuronal cells (Hsiao et al., 2017 ). We investigated whether interaction of alpha-syn and cholesterol is a prerequisite for the reduction of alpha-syn expression mediated by CYP46A1. Through the utilization of a panel of recombinant fragments and synthetic peptides, it has been discovered that alpha-syn interacts with cholesterol with high affinity through a binding domain called the « titled domain » (Crowet et al., 2007 ; Fantini et al., 2011 ). To disrupt the interaction between cholesterol and alpha-syn, we engineered mutants within the titled domain (residues 67–78) and assessed the resulting reduction in alpha-syn expression. The amino acid residues of wild-type human alpha-syn involved in cholesterol binding are indicated in bold in the sequence GG AV V TG VT A VA Q (Fantini et al., 2011 and 2016 ) (Table S1). Four mutants (Syn 38, Syn39, Syn40, Syn42) were designed by site-directed mutagenesis. Among these mutants, Syn40, was specifically engineered based on the peptide mutant SynuM53 of alpha syn, as devised by Crowet and colleagues ( 2007 ) using molecular modeling methodologies. This mutant is suggested to adopt a parallel orientation to the lipid layer rather than a tilted orientation. Its sequence is GGAV SA GV AS VTQ. The other three mutants were designed to alter the essential amino acids identified in these interactions by Fantini et al. ( 2011 ) (Table S1). We also included the A53T mutation linked to familial parkinsonism, which has been shown in in vitro studies to have no effect on lipid binding (Perrin et al., 2000 ; Jo et al., 2002 ; Fortin et al., 2004 ). SH-SY5Y cells were co-transfected with each alpha-syn mutant along with either GFP or CYP46A1, or with wild-type alpha-syn or the A53T alpha-syn mutant along with either GFP or CYP46A1 (Fig. 2 A). Forty-eight hours post-transfection, we compared the level of alpha-syn protein levels by western blot analysis between the cells co-transfected GFP or CYP46A1. We observed a significant reduction in alpha-syn levels for wild-type or each mutant alpha-syn in the presence of CYP46A1 compared to the presence of GFP (Fig. 2 B). In conclusion, our study revealed that the decrease of alpha-syn protein levels in cells overexpressing CYP46A1 is not dependent on the interaction between cholesterol and the region 67–78 of alpha-syn. Indeed, CYP46A1 significantly reduced the expression level of alpha-syn mutants at potential cholesterol-binding sites compared to cells co-transfected with GFP. Furthermore, we observed that CYP46A1 can decrease the expression not only of wild-type alpha-syn but also the A53T alpha-syn mutant associated with the familial form of the disease. CYP46A1 facilitates the reduction of wild-type alpha-syn (WT) protein levels via the macroautophagy pathway Evidence suggests that dysfunction in the autophagy pathway is prevalent in numerous neurodegenerative diseases (Ravikumar et al., 2004 ; Nixon et al., 2005 ; Sarkar et al., 2007 ; Pan et al., 2008 ). In PD, alpha-syn has been demonstrated to undergo degradation through macroautophagy, chaperone-mediated autophagy or the proteasome (Webb et al., 2003 ; Cuervo et al., 2004 , Vogiatzi et al., 2008 ). We investigated whether CYP46A1 could enhance macroautophagy, chaperone-mediated autophagy or the proteasome to reduce the expression of alpha-syn proteins in SH-SY5Y cells. Macroautophagy is a common form of autophagy characterized by the formation of autophagosome and is effective in removing abnormal proteins and protein aggregates (Glick et al., 2010 ). To investigate the impact of macroautophagy on alpha-syn clearance mediated by CYP46A1, we treated the co-transfected cells with autophagy inhibitors, 3-Methyladenine (3-MA) and Bafilomycin A1 (BafA1) (Fig. 3A). As expected, when cells are co-transfected with alpha-syn and GFP, the presence of these autophagy inhibitors resulted in increased alpha-syn levels. This finding is consistent with the established knowledge that alpha-syn is regulated by macroautophagy. Furthermore, when alpha-syn and CYP46A1 were co-expressed, an increase of alpha-syn proteins was observed in the presence of 3-MA or BafA1. However, this increase in alpha-syn levels was notably lower compared to when alpha-syn and GFP were co-expressed in the presence of the inhibitors. This suggests that CYP46A1 retains its ability to reduce alpha-syn levels even in the presence of autophagy inhibitors. These results were further supported by the quantitative analysis of western blot data from 11 independent experiments (Fig. 3B). By inhibiting the fusion of the autophagosome and the lysosome, BafA1 affects LC3 formation. Through western blot analysis, we observed a significant increase in the LC3B-II/LC3B-I ratio in cells co-expressing alpha-syn and CYP46A1 compared to those co-expressing alpha-syn and GFP, as illustrated in the representative western blot (Fig. 3A) and the data obtained from 11 western blots (Fig. 3C). These findings strongly suggest that CYP46A1 enhances the induction of macroautophagy of alpha-syn. Figure 3 CYP46A1 reduces alpha-syn proteins levels through the macroautophagy pathway. a) Evaluation of alpha-syn and LC3B protein levels in cells co-transfected cells with wild-type alpha-syn and either GFP or CYP46A1 by western blot analysis. The co-transfected cells were either left untreated for 48 hours or treated with 3-MA for 42 hours, starting 6 hours post-transfection or treated with BafA1 for 24 hours, starting 24 hours post-transfection. b ) Quantification of alpha-syn protein levels normalized to actin protein levels (N = 11). Error bars represent +/- SEM. Statistical significance was determined as follows: ***p < 0.001, ****p < 0.0001 compared CYP46A1 with GFP by Sidak’s multiple comparisons test. c) Quantification of LC3B-II proteins levels were normalized to LC3B-I protein levels (Left part) or to actin protein levels (Right part) (N = 11). Error bars indicate +/- SEM. Statistical significance was determined as follows: *** indicates p < 0.001; **** indicates p < 0.0001 by unpaired t test We also examined whether CYP46A1 could influence alpha-syn expression through the chaperone mediated autophagy (CMA) pathway. CMA is a distinctive pathway by which cytosolic protein aggregates are selectively directed to lysosomes for degradation. Wild-type alpha-syn, containing a CMA-targeting motif within its sequence, can undergo degradation in lysosomes via the CMA pathway (Cuervo et al., 2004 ). The substrate-chaperone complex is then transported to lysosomal membranes, where interactions with Lamp2A receptors facilitate CMA activities (Cuervo and Dice, 2000 ). To examine whether CYP46A1 can induce the CMA pathway to degrade alpha-syn, SH-SY5Y cells were co-transfected with Lamp2A siRNA or scrambled control siRNA along with alpha-syn accompanied by either GFP or CYP46A1. The reduction of Lamp2A by siRNA is directly related to CMA activity. Lamp2A protein levels were determined by western blotting (Fig. S1). The protein levels of alpha-syn detected with GFP or with CYP46A1 did not change in cells where Lamp2A protein levels were reduced by 2.5-fold with siRNA compared to cells co-transfected with siRNA control. These results suggest that CYP46A1 enhances alpha-syn degradation through the macroautophagy pathway independently of CMA autophagy (Fig. S1). To explore the impact of CYP46A1 on proteasomal activity in the alpha-syn clearance, SH-SY5Y cells were co-transfected with alpha-syn and either GFP or CYP46A1 and subsequently, treated with the proteasome inhibitor MG132 at 20 µM for 6 hours. Our observations revealed an increase in alpha-syn protein levels following MG132 treatment, regardless of the presence of GFP or CYP46A1. This finding is consistent with established knowledge that alpha-syn is degraded not only by autophagy but also by the proteasome (Webb et al., 2003 ). However, the ratio of alpha-syn protein levels in the presence of CYP46A1 compared to those detected with GFP remains unchanged with or without MG132, indicating that CYP46A1 reduces the levels of alpha-syn protein independently of proteasome inhibition (Fig. S2). Impact of CYP46A1 on alpha-syn expression in glucocerebrosidase-deficient cells Mutations in the GBA1 gene constitute the most significant genetic risk factor numerically for the development of PD, increasing the risk by approximately fourfold (Neumann et al., 2009 ; Sidransky et al., 2009 ). GBA1 gene encodes the lysosomal enzyme glucocerebrosidase (GCase), which plays a crucial role in converting glucosylceramide into glucose and ceramide within the lysosome. GCase-deficient cells display disrupted lysosomal recycling and the accumulation of dysfunctional lysosomes. Given that lysosomes serve as the principal degradative compartment within the cell, their biogenesis and recycling are essential for cellular function and the autophagy-lysosomal pathway. The loss of GCase activity exacerbates autophagy impairment and facilitates the accumulation of alpha-syn (Murphy et al., 2014 ; Magalhaes et al., 2016 ; Gundner et al., 2019 ). As the overexpression of CYP46A1 has been shown to decrease alpha-syn protein levels through the macroautophagy pathway, we aimed to investigate whether CYP46A1 could still reduce alpha-syn expression in PD pathological conditions where the expression of the lysosomal enzyme GCase, which regulates autophagy, is diminished. In this study, SH-SY5Y cells were co-transfected with GBA1 siRNAs or scrambled control siRNAs along with alpha-syn and either GFP or CYP46A1 for 48 hours. Two out of three GBA1 siRNAs (siGBA1b and 1c) inhibited the GBA1 gene by factors of 4 and 3, respectively, compared to both scrambled control siRNAs (siCrtl1 and siCrtl2), or siGBA1a, as indicated by western blot analysis (Fig. 4 ). The expression levels of alpha-syn detected using CYP46A1 were observed to decrease compared to those detected using GFP. However, no change in alpha-syn expression was noted in cells with GBA1 deficiency using siRNA siGBA1b or siGBA1c compared to cells with control siRNA. Our experiments demonstrate that CYP46A1 can still effectively reduce alpha-syn expression through the autophagic pathway, even when the expression of the lysosomal enzyme GCase is reduced. Discussion Considerable evidence suggests that increased expression of alpha-syn is involved in the pathogenesis of both sporadic and familial Parkinson's disease (PD), indicating that the observed changes likely represent some of the earliest events in the progression of PD. Defects in cholesterol metabolism have been associated with neurodegenerative diseases (Liu et al., 2010 ; Dai et al., 2021 ). Cholesterol's impact on the membrane binding of alpha-syn may facilitate the formation of beta-sheet structures in alpha-syn, thus promoting the generation of abnormal alpha-syn fibrils (Jakubec et al., 2019; Man et al., 2020 ; Qi et al., 2023 ). Several studies have emphasized a close association between alpha-synuclein (alpha-syn) and cholesterol, both intracellularly and extracellularly. Notably, research has identified a high-affinity cholesterol binding domain in the 67–78 amino acid region of alpha-syn (Crowet et al., 2007 ; Fantini et al., 2011 ). While the majority of alpha-syn remains intracellular, extracellular forms of this protein also exist, as it can propagate from cell to cell in a "prion-like" manner (Vargas et al., 2019 ). Extracellular alpha-syn has been demonstrated to decrease membrane cholesterol levels and stimulate cholesterol efflux from cells (Ronzitti et al., 2014 ; Hsiao et al., 2017 ). We and others have shown that the activation of CYP46A1 in various brain disease models leads to a decrease in aggregated proteins and improved performance in motor, memory and/or cognitive tests (Hudry et al., 2010 ; Burlot et al. 2015 ; Djelti et al., 2015 , Chali et al., 2015 ; Boussicault et al. 2016 ; Kacher et al., 2019 , Nobrega et al., 2019, Wurtz et al., 2024) . However, much less is known about the role of CYP46A1 in PD (reviewed in Moutinho et al., 2016 and Alavi et al., 2023 ). In our study, we demonstrate that heightened expression of the enzyme CYP46A1, responsible for converting cholesterol into 24S-OHC, results in decreased levels of both wild-type and mutant A53T human alpha-syn proteins in neuroblastoma SH-SY5Y cells (Fig. 1 and Fig. 4 ). Additionally, we explored various mutations within the amino acids 67–78, which were hypothesized to influence interactions between cholesterol and alpha-syn based on the findings of Crowet et al. ( 2007 ) and Fantini et al. ( 2011 ). However, our results indicate that these mutations in the alpha-syn sequence had no discernible impact. CYP46A1 continued to induce a significant reduction in alpha-syn levels, regardless of whether the alpha-syn variant was wild-type or mutant (Fig. 2 ). These findings suggest that the interplay between alpha-syn and cholesterol, particularly within the 67–78 region, is not essential for CYP46A1's ability to diminish alpha-syn protein levels. The degradation of alpha-syn is believed to occur through multiple pathways, including macroautophagy, chaperone-mediated autophagy, and the proteasome-ubiquitin system (Webb et al., 2003 ; Cuervo et al., 2004 ; Vogiatzi et al., 2008 ). Our study reveals that CYP46A1 enhances the macroautophagy pathway, thereby reducing the levels of alpha-syn proteins. Specifically, we observed a significant increase in LC3B-II levels in SH-SY5Y cells overexpressing both CYP46A1 and alpha-syn proteins compared to cells overexpressing GFP and alpha-syn proteins when treated with the autophagy inhibitor BafA1 (Fig. 3). These findings are consistent with prior research demonstrating that CYP46A1 promotes autophagy of mutant ataxin-3 or the huntingtin proteins in SCA3 disease and HD respectively (Kacher et al., 2019 ; Nobrega et al., 2019, 2020). Interestingly, even in the presence of autophagy inhibitors such as 3-MA or BafA1, CYP46A1 retains its ability to decrease the expression of alpha-syn. Hence, the upregulation of macroautophagy by CYP46A1 appears to be a promising therapeutic strategy for the treatment of accumulated alpha-syn (Fig. 3). Our study did not find any effect of CYP46A1 on CMA pathway or on the proteasome-ubiquitin system for the alpha-syn degradation (Fig. S1 and Fig. S2). Strikingly, one of the most significant genes in PD is GBA1, which is involved in lipid metabolism. Variants in this gene are present in 5–20% of PD patients across different populations. It is well-documented that mutations in the GBA1 gene can lead to decreased activity of the lysosomal enzyme glucocerebrosidase (GCase) (Neumann et al; 2009 ; Sidransky et al., 2009 ; Gan-Or et al., 2015 ). This phenomenon is believed to result from impaired lysosomal function, leading to the accumulation of alpha-syn (Murphy et al., 2014 ; Magalhaes et al., 2016 ; Gundner et al., 2019 ). We conducted co-transfections of SH-SY5Y cells with GBA1 siRNA, resulting in a fourfold reduction in GBA1 expression, in combination with human alpha-synuclein and either CYP46A1 or GFP. Our observations revealed that CYP46A1 could reduce the level of alpha-synuclein by the same efficacy, regardless of the expression of GBA1. These findings demonstrate that CYP46A1 maintains its ability to suppress alpha-synuclein expression even in the presence of impaired lysosomal function as illustrated in Fig. 4 . This study shows that the role of CYP46A1 extends beyond cholesterol clearance, as it promotes macroautophagy in cases of overexpressed alpha-syn. Our in vitro results demonstrate its effectiveness across various cellular models of Parkinson's disease, including those with overexpression of alpha-synuclein with or without GBA1 deficiency, or overexpression of the A53T mutated alpha-synuclein. This suggests that CYP46A1 holds promise as a therapeutic strategy for PD by mitigating the pathological effects of alpha-syn accumulation. Additional data from Theofilopoulos et al. ( 2019 ) suggest that overexpression of CYP46A1 may prevent dopaminergic loss in PD. Moving forward, it will be crucial to ascertain in in vivo PD models whether CYP46A1 facilitates neuroprotection and symptom reduction in PD. Declarations Acknowledgements The authors would like to express their thanks for laboratory support to Dr. Nathalie Cartier.Cell work was performed at the CELIS platform. and we thank Laetitia Strehl involved in this platform. We also thanks Danny Oberlé for her help in manuscript review. Author Contribution CBG: conceptualization methodology, validation, formal analysis, investigation, writing-original draft, visualization.LR and EA: methodology, validation, formal analysis, investigation, writing, visualization. FC: conceptualization, resources, review. FP: resources, writing, review and editing, supervision, funding acquisition. All authors have read and approved the final manuscript. Funding This work was supported by the Paris Brain Institute (ICM) and by the French National Institute of Health and Medical Research (INSERM). The research leading to these results has received funding from the program “Investissements d’avenir” ANR-10-IAIHU-06 and ANR-11-INBS-0011—NeurATRIS: Translational Research Infrastructure for Biotherapies in Neurosciences. CBG was supported by INSERM, LR, EA and FC by ICM (thanks to Grants obtained by FP). Ethics approval and consent to participate Not applicable. Competing Interests. The authors declare no competing interests. References Abdel-Khalik J, Yutuc E, Crick PJ, Gustafsson J-A, Warner M, Roman G, Talbot K, Gray E, Griffiths WJ, Turner MR, Wang Y (2017) Defective cholesterol metabolism in amyotrophic lateral sclerosis. J Lipid Res 58(2):267–278. https://doi.org/10.1194/jlr.P071639 Alavi MS, Karimi G, Ghanimi HA, Roohbakhsh A (2023) The potential of CYP46A1 as a novel therapeutic target for neurological disorders: An updated review of mechanisms. Eur J Pharmacol 949:17572. https://doi.org/10.1016/j.ejphar.2023.175726 Audouard E, Khefif N, Gillet-Legrand B, Nobilleau F, Bouazizi O, Stanga S, Despres G, Alves S, Lamazière A, Cartier N, Piguet F (2024) Modulation of Brain Cholesterol Metabolism through CYP46A1 Overexpression for Rett Syndrome. Pharmaceutics 2024, 16, 756. https://doi.org/10.3390/pharmaceutics16060756 Bogdanovic N, Bretillon L, Lund EG, Diczfalusy U, Lannfelt L, Winblad B, Russell DW, Björkhem I (2001) On the turnover of brain cholesterol in patients with Alzheimer's disease. Abnormal induction of the cholesterol-catabolic enzyme CYP46 in glial cells. Neuroscience Letters, 314(1–2), 45–48. https://doi.10.1016/s0304-3940(01)02277-7 Boussicault L, Alves S, Lamazière A, Planques A, Heck N, Moumné L, Despres G, Bolte S, Hu A, Pagès C, Galvan L, Piguet F, Aubourg P, Cartier N, Caboche J, Betuing S (2016) CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease. Brain 139(3):953–970. https://doi.org/10.1093/brain/awv384 Brockmann K, Srulijes K, Pflederer S, Hauser A-K, Schulte C, Maetzler W, Gasser T, Berg D (2015) GBA-associated Parkinson's disease: reduced survival and more rapid progression in a prospective longitudinal study. Mov Disord 30(3):407–411. https://doi.org/10.1002/mds.26071 Brown J 3rd, Theisler C, Silberman S, Magnuson D, Gottardi-Littell N, Lee JM, Yager D, Crowley J, Sambamurti K, Rahman MM, Reiss AB, Eckman CB, Wo-lozin B (2004) Differential expression of cholesterol hydroxylases in Alzheimer's disease. J Biol Chem 279(33):34674–34681. https://doi:10.1074/jbc.M402324200 Burlot MA, Braudeau J, Michaelsen-Preusse K, Potier B, Ayciriex S, Varin J, Gautier B, Djelti F, Audrain M, Dauphinot L, Fernandez-Gomez FJ, Caillierez R, Laprévote O, Bièche I, Auzeil N, Potier MC, Dutar P, Korte M, Buée L, Blum D, Cartier N (2015) Cholesterol 24-hydroxylase defect is implicated in memory impairments associated with Alzheimer-like Tau pathology. Hum Molecu-lar Genet 24(20):5965–5976. https://doi:10.1093/hmg/ddv268 Chali F, Djelti F, Eugene E, Valderrama M, Marquer C, Aubourg P, Duykaerts C, Miles R, Cartier N, Navarro V (2015) Inhibiting cholesterol degradation induc-es neuronal sclerosis and epileptic activity in mouse hippocampus. Eur J Neurosci 41(10):1345–1355. https://doi.org/10.1111/ejn.12911 Crowet J-M, Lins L, Dupiereux I, Elmoualija B, Lorin A, Charloteaux B, Stroobant V, Heinen E, Brasseur R (2007) In Silico tilted properties of the 67–78 fragment of alpha-synuclein are responsible for membrane destabilization and neurotoxicity. Proteins, pp. 936–947. https://doi.org/10.1002/prot.21483 Cuervo AM, Dice JF (2000) Unique properties of lamp2a compared to other lamp2 isoforms. J Cell Sci. 2000;113 Pt 24:4441-50. https://doi.org/10.1242/jcs.113.24.4441 Cuervo AM, Stefanis L, Fredenburg R, Lansbury PT, Sulzer D (2004) Impaired degradation of mutant alpha-synuclein by chaperone-mediated autophagy. Science 305:1292–1295. https://doi.org/10.1126/science.1101738 Dai L, Zou L, Meng L, Qiang G, Yan M, Zhang Z (2021) Cholesterol metabolism in neurodegenerative diseases: molecular mechanisms and therapeutic targets. Mol Neurobiol 58(5):2183–2201. https://doi.org/10.1007/s12035-020-02232-6 Del Toro D, Xifró X, Pol A, Humbert S, Saudou F, Canals JM, Alberch J (2010) Altered cholesterol homeostasis contributes to enhanced excitotoxicity in Hunting-ton's disease. J Neurochem 115(6):153–166 Desai P, DeKosky ST, Kamboh MI (2002) Genetic variation in the cholesterol 24-hydroxylase (CYP46) gene and the risk of Alzheimer's disease. Neurosci Lett 328:9–12. https://doi.org/10.1016/s0304-3940(02)00443-3 Devine MJ, Gwinn K, Singleton A, Hardy J (2011) Parkinson's disease and α-synuclein expression. Mov Disord 26(12):2160–2168. https://doi.org/10.1002/mds.23948 Djelti F, Braudeau J, Hudry E, Dhenain M, Varin J, Bièche I, Marquer C, Chali F, Ayciriex S, Auzeil N, Alves S, Langui D, Potier MC, Laprevote O, Vidaud M, Duyckaerts C, Aubourg P, Cartier N (2015) CYP46A1 inhibition, brain choles-terol accumulation and neurodegeneration pave the way for Alzheimer's disease. Brain 138:2383–2398. https://doi.org/10.1093/brain/awv166 Fantini J, Carlus D, Yahi N (2011) The fusogenic tilted peptide (67–78) of α-synuclein is a cholesterol binding domain. Biochim et Biophys Acta (BBA) - Biomembr 1808(10):2343–2351. https://doi.org/10.1016/j.bbamem.2011.06.017 Fantini J, Di Scala C, Baier CJ, Barrantes FJ (2016) Molecular mechanisms of protein-cholesterol interactions in plasma membranes: Functional distinction between topological (tilted) and consensus (CARC/CRAC) domains. Chem Phys Lipids 199:52–60. https://doi.org/10.1016/j.chemphyslip.2016.02.009 Fortin DL, Troyer MD, Nakamura K, Kubo S, Anthony MD, Edwards RH (2004) Lipid rafts mediate the synaptic localization of alpha-synuclein. J Neurosci 24(30):6715–6723. https://doi.org/10.1523/JNEUROSCI.1594-04.2004 Gan-Or Z, Amshalom I, Kilarski LL, Bar-Shira A, Gana-Weisz M, Mirelman A, Marder K, Bressman S, Giladi N, Orr-Urtreger A (2015) Differential effects of severe vs mild GBA mutations on Parkinson disease. Neurology 84(9):880–887. https://doi.org/10.1212/WNL.0000000000001315 Glick D, Barth S, Macleod KF (2010) Autophagy: Cellular and molecular mechanisms. J Pathol 221(1):3–12. https://doi.org/10.1002/path.2697 Gundner AL, Duran-Pacheco G, Zimmermann S, Ruf I, Moors T, Baumann K, Jagasia R, van de Berg WDJ, Kremer T (2019) Path mediation analysis reveals GBA impacts Lewy body disease status by increasing alpha-synuclein levels. Neuro-biology Disease 121:205–213. https://doi:10.1016/j.nbd.2018.09.015 Hsiao JHT, Halliday GM, Kim WS (2017) α-Synuclein regulates neuronal cholesterol efflux. Molecules 22(10):1769. https://doi.org/10.3390/molecules22101769 Hudry E, Van Dam D, Kulik W, De Deyn PP, Stet FS, Ahouansou O, Benraiss A, Delacourte A, Bougneres P, Aubourg P, Cartier N (2010) Adeno-associated virus gene therapy with cholesterol 24-hydroxylase reduces the amyloid pathology before or after the onset of amyloid plaques in mouse models of Alzheimer's disease. Mol Ther 18:44–53. https://doi.org/10.1038/mt.2009.175 Jakubec M, Barias E, Furse S, Govasli ML, George V, Turcu D, Iashchishyn IA, Morozova-Roche LA, Halskau Ø (2021) Cholesterol-containing lipid nanodiscs promote an α-synuclein binding mode that accelerates oligomerization. FEBS J 288(6):1887–1905. https://doi.org/10.1111/febs.15551 Jo E, Fuller N, Rand RP, George-Hyslop S, Fraser P (2002) Defective Membrane Interactions of Familial Parkinson's Disease Mutant A30P α-Synuclein. J Mol Biol 315. https://doi.org/10.1006/jmbi.2001.5269 Kachappilly N, Srivastava J, Swain BP, Thakur P (2022) Interaction of alpha-synuclein with lipids. Methods Cell Biol 169:43–66. https://doi Kacher R, Lamazière A, Heck N, Kappes V, Mounier C, Despres G, Dem-bitskaya Y, Perrin E, Christaller W, Sasidharan Nair S, Messent V, Cartier N, Vanhoutte P, Venance L, Saudou F, Néri C, Caboche J, Betuing S (2019) CYP46A1 gene therapy deciphers the role of brain cholesterol metabolism in Hun-tington's disease. Brain 142:2432–2450. https://doi.org/10.1093/brain/awz174 Kreilaus F, Spiro A, McLean CA, Garner B, Jenner AM Evidence for altered cho-lesterol metabolism in Huntington's disease post mortem brain tissue. Neuropathol Appl Neurobiol, 42, 535–554. https://doi.org/10.1111/nan.12286 Krüger R, Kuhn W, Müller T, Woitalla D, Graeber M, Kösel S, Przuntek H, Epplen JT, Schöls L, Riess O (1998) Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat Genet 18(2):106–108. https://doi.org/10.1038/ng0298-106 Liu JP, Tang Y, Zhou S, Toh BH, McLean C, Li H (2010) Cholesterol involvement in the pathogenesis of neurodegenerative diseases. Mol Cell Neurosci 43:33–42. https://doi.org/10.1016/j.mcn.2009.07.013 Magalhaes J, Gegg ME, Migdalska-Richards A, Doherty MK, Whitfield PD, Schapira AHV (2016) Autophagic lysosome reformation dysfunction in glucocerebrosidase deficient cells: relevance to Parkinson disease. Hum Mol Genet 25(16):3432–3445. https://doi:10.1093/hmg/ddw185 Mahley RW (2016) Central nervous system lipoproteins: ApoE and regulation of cholesterol metabolism. Arterioscler Thromb Vasc Biol 36:1305–1315. https://doi:10.1161/ATVBAHA.116.307023 Mahul-Mellier A-L, Burtscher J, Maharjan N, Weerens L, Croisier M, Kuttler F, Leleu M, Knott GW, Lashuel HA (2020) The process of Lewy body formation, rather than simply α-synuclein fibrillization, is one of the major drivers of neuro-degeneration. Proceedings of the National Academy of Sciences USA, 117(9), 4971–4982 . 10.1073/pnas.1913904117 Man WK, De Simone A, Barritt JD, Vendruscolo M, Dobson CM, Fusco G (2020) A role of cholesterol in modulating the binding of α-Synuclein to synaptic-like vesicles. Front NeuroSci 14:1–11. https://doi:10.3389/fnins.2020.00018 Moutinho M, Nunes MJ, Rodrigues E (2016) Cholesterol 24-hydroxylase: brain cholesterol metabolism and beyond. Biochim Biophys Acta 1861:1911–1920. https://doi:10.1016/j.bbalip.2016.09.011 Murphy KE, Gysbers AM, Abbott SK, Tayebi N, Kim WS, Sidransky E, Cooper A, Garner B, Halliday GM (2014) Reduced glucocerebrosidase is associated with increased α-synuclein in sporadic Parkinson’s disease. Brain 137:834–848. https://doi:10.1093/brain/awt367 Neumann J, Bras J, Deas E, O’Sullivan SS, Parkkinen L, Lachmann RH, Li A, Holton J, Guerreiro R, Paudel R, Segarane B, Singleton A, Lees A, Hardy J, Houlden H, Revesz T, Wood NW (2009) Glucocerebrosidase mutations in clinical and pathologically proven Parkinson's disease. Brain 132 1783 – 179. https://doi:10.1093/brain/awp044 Nixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, Cataldo A, Cuervo AM (2005) Extensive involvement of autophagy in Alzheimer disease: an immuno-electron microscopy study. J Neuropathol Exp Neurol 64:113–122. https://doi 10.1093/jnen/64.2.113 Nóbrega C, Mendonça L, Marcelo A, Lamazière A, Tomé S, Despres G, Matos CA, Mechmet F, Langui D, den Dunnen W, de Almeida LP, Cartier N, Alves S (2019) Restoring brain cholesterol turnover improves autophagy and has therapeutic potential in mouse models of spinocerebellar ataxia. Acta Neuropathol 138:837–858. https://doi 10.1007/s00401-019-02019-7 Nóbrega C, Conceição A, Costa RG, Koppenol R, Sequeira RL, Nunes R, Car-mo-Silva S, Marcelo A, Matos CA, Betuing S, Caboche J, Cartier N, Alves S (2020) The cholesterol 24-hydroxylase activates autophagy and decreases mutant huntingtin build-up in a neuroblastoma culture model of Huntington's disease. BMC Res Notes 13:210. https://doi:10.1186/s13104-020-05053-x Pan T, Kondo S, Le W, Jankovic J (2008) The role of autophagy-lysosome pathway in neurodegeneration associated with Parkinson’s disease. Brain 131:1969–1978. https://doi 10.1093/brain/awm318 Perrin RJ, Woods WS, Clayton DF, George JM (2000) Interaction of Human α-Synuclein and Parkinson’s Disease Variants with Phospholipids. Vol. 275, No. 44, Issue of November 3, pp. 34393–34398. https://doi:10.1074/jbc.M004851200 Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A et al (1997) Mutation in the α-synuclein gene identified in families with Parkinson's dis-ease. Science 276(5321):2045–2047. https://doi:10.1126/science.276.5321.2045 Qi Z, Wan M, Zhang J, Li Z (2023) Influence of Cholesterol on the Membrane Binding and Conformation of α-Synuclein. J. Phys. Chem. B 2023, 127, 9, 1956–1964. https://doi:10.1021/acs.jpcb.2c08077 Ravikumar B, Vacher C, Berger Z, Davies JE, Luo S, Oroz LG, Scaravilli F, EastonDF, Duden R, O’Kane CJ, Rubinsztein DC (2004) Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet 36:585–595. https://doi:10.1038/ng1362 Ronzitti G, Bucci G, Emanuele M, Leo D, Sotnikova TD, Mus LV, Soubrane CH, Dallas ML, Thalhammer A, Cingolani LA, Mochida S, Gainetdinov RR, Stephens GJ, Chieregatti E (2014) Exogenous α-synuclein decreases raft partitioning of Cav2.2 channels inducing dopamine release. J Neurosci 34(32):10603–10615. https://doi Russell DW, Halford RW, Ramirez DM, Shah R, Kotti T (2009) Cholesterol 24-hydroxylase: an enzyme of cholesterol turnover in the brain. Annu Rev Biochem 78:1017–1040. https://doi:10.1146/annurev.biochem.78.072407.103859 Sarkar S, Perlstein EO, Imarisio S, Pineau S, Cordenier A, Maglathlin RL, Webster JA, Lewis TA, O’Kane CJ, Schreiber SL, Rubinsztein DC (2007) Small molecules enhance autophagy and reduce toxicity in Huntington’sdisease models. Nat Chem Biol 3:331–338. https://doi:10.1038/nchembio883 Shahmoradian SH, Lewis AJ, Genoud C, Hench J, Moors TE, Navarro PP, Castaño-Díez D, Schweighauser G, Graff-Meyer A, Goldie KN, Sütterlin R, Huisman E, Ingrassia A, de Gier Y, Rozemuller AJM, Wang J, De Paepe A, Erny J, Staempfli A, Lauer ME (2019) Lewy pathology in Parkinson's disease consists of crowded organelles and lipid membranes. Nat Neurosci 22(7):1099–1109. https://doi.org/10.1038/s41593-019-0423-2 Sidransky E, Nalls MA, Aasly JO, Aharon-Peretz J, Annesi G, Barbosa ER, Bar-Shira A, Berg D, Bras J, Brice A, Ziegler SG (2009) Multicenter analysis of glucocerebrosidase mutations in Parkinson’s disease. N Eng J Med 361:1651–1661. https://doi.org/10.1056/NEJMoa0901281 Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication causes Parkinson's disease. Science 302(5646):841. https://doi.org/10.1126/science.1090278 Theofilopoulos S, Abreu de Oliveira WA, Yang S, Yutuc E, Saeed A, Abdel-Khalik J, Ullgren A, Cedazo-Minguez A, Björkhem I, Wang Y, Griffiths WJ, Arenas E (2019) 24(S),25-Epoxycholesterol and cholesterol 24S-hydroxylase (CYP46A1) overexpression promote midbrain dopaminergic neurogenesis in vivo. J Biol Chem 294(11):4169–4176. https://doi.org/10.1074/jbc.RA118.005639 van Maarschalkerweerd A, Vetri V, Vestergaard B (2015) Cholesterol facilitates interactions between α-synuclein oligomers and charge-neutral membranes. FEBS Lett 589(19):2661–2667. https://doi.org/10.1016/j.febslet.2015.08.013 Vargas JY, Grudina C, Zurzolo C (2019) The prion-like spreading of alpha-synuclein: from in vitro to in vivo models of Parkinson’s disease. Ageing Res Rev 50:89–101. https://doi.org/10.1016/j.arr.2019.01.012 Vogiatzi T, Xilouri M, Vekrellis K, Stefanis L (2008) Wild type alpha-synuclein is degraded by chaperone-mediated autophagy and macroautophagy in neuronal cells. J Biol Chem 283(35):23542–23556. https://doi.org/10.1074/jbc.M801992200 Webb JL, Ravikumar B, Atkins J, Skepper JN, Rubinsztein DC (2003) Alpha-Synuclein is degraded by both autophagy and the proteasome. J Biol Chem 278(27):25009–25013. https://doi.org/10.1074/jbc.M300227200 Zambon F, Cherubini M, Fernandes HJR, Lang C, Ryan BJ, Volpato V, Bengoa-Vergniory N, Vingill S, Attar M, Booth HDE, Haenseler W, Vowles J, Bowden R, Webber C, Cowley SA, Wade-Martins R (2019) Cellular α-synuclein pathology is associated with bioenergetic dysfunction in Parkinson's iPSC-derived dopamine neurons. Hum Mol Genet 28(12):2001–2013. https://doi.org/10.1093/hmg/ddz038 Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4580957","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":317681232,"identity":"5a89c71e-50a9-4524-a027-f70c0a05a853","order_by":0,"name":"Corinne Besnard-Guérin","email":"","orcid":"","institution":"INSERM U1127, CNRS UMR 7225, Sorbonne University, Hospital Pitié Salpêtrière","correspondingAuthor":false,"prefix":"","firstName":"Corinne","middleName":"","lastName":"Besnard-Guérin","suffix":""},{"id":317681234,"identity":"7596a3b2-2968-4e62-8446-7e29fc50ac82","order_by":1,"name":"Lisa Rousselot","email":"","orcid":"","institution":"TIDU GENOV","correspondingAuthor":false,"prefix":"","firstName":"Lisa","middleName":"","lastName":"Rousselot","suffix":""},{"id":317681236,"identity":"02c18afb-4a65-4efe-960a-b3669418c266","order_by":2,"name":"Emilie Audouard","email":"","orcid":"","institution":"TIDU GENOV","correspondingAuthor":false,"prefix":"","firstName":"Emilie","middleName":"","lastName":"Audouard","suffix":""},{"id":317681238,"identity":"127058cb-2d45-493b-9107-d1a3803319a0","order_by":3,"name":"Farah Chali","email":"","orcid":"","institution":"INSERM U1127, CNRS UMR 7225, Sorbonne University, Hospital Pitié Salpêtrière","correspondingAuthor":false,"prefix":"","firstName":"Farah","middleName":"","lastName":"Chali","suffix":""},{"id":317681239,"identity":"b1bbef81-cd05-4337-8d57-9c54a6f910f2","order_by":4,"name":"Françoise Piguet","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABRklEQVRIie2RMUvDQBSALxwky7O3vlD1N5wE2g7F+ysJQmenkkFKoBCXSte6+RM6OSc8qEtxDuhQBzvbQclQ1Lukoq3pLpiPu3dwx3fvvTvGamr+IE5ULFjExATBTZR68moFkh0F3eFGAc43t1Qq36D82gG2R2nScpGHHSXYQZq+xt2Bd8efp+z8USlHzJovITtuj2+2lEavfTKaY3AdNXw6invYIruVMbkMRpzbmMyZd5gtfioKWKtpxejLBCS5MWkF7Ie1JB+MksYsmOBWeQDOm1GUKpUP9IZg6yykSuW9QoEiizVlINNVnKDkpWIVhaWRVkS0o/Rd08uEdC/s/sydlL1QMCLudeYz9BC3XwycW8zDgRKXV7TK+6dCjGmZsTUpZ5w+ZeFF9xhFxVMbOJjxG50C/WpFf52VV5/sy1JTU1PzT/gEV65sHboTLncAAAAASUVORK5CYII=","orcid":"","institution":"TIDU GENOV","correspondingAuthor":true,"prefix":"","firstName":"Françoise","middleName":"","lastName":"Piguet","suffix":""}],"badges":[],"createdAt":"2024-06-14 09:21:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4580957/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4580957/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59597699,"identity":"f81f39f2-3fae-4347-8cf9-5177246e4271","added_by":"auto","created_at":"2024-07-03 16:15:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":130482,"visible":true,"origin":"","legend":"\u003cp\u003eCYP46 overexpression inhibits alpha-syn expression in SH-SY5Y cells\u003cstrong\u003e. a)\u003c/strong\u003e Levels of CYP46A1 and alpha-syn proteins from cells co-transfected cells with wild-type alpha-syn and either GFP or CYP46A1 were analyzed by western blot analysis. \u003cstrong\u003eb)\u003c/strong\u003e Quantification of CYP46A1 and alpha-syn protein levels from western blots (N=15). Alpha-syn proteins levels were normalized to actin protein levels. The results are presented as means ± standard error of the mean (SEM). Statistical significance was determined as follows: ****p \u0026lt; 0.0001 compared CYP46A1 to GFP by Sidak’s multiple comparisons test.\u003cstrong\u003ec)\u003c/strong\u003e Representative pictures showing the localization of CYP46A1 and alpha-syn expression following co-transfection in SH-SY5Y cells were analyzed using fluorescent microscopy. CYP46A1 was identified through immunostaining with a HA antibody while alpha-syn was detected using an alpha-syn antibody. Additionally, nuclear visualization was achieved by staining the cells with DAPI, resulting in blue fluorescence under microscopy, whereas HA-CYP46A fluorescence appeared green and alpha-syn fluorescence appeared red. Scale bar in white, 10 mM. \u003cstrong\u003ed)\u003c/strong\u003eQuantification of CYP46A1 and alpha-syn mRNAs in extracts from co-transfected cells. The mRNA levels of CYP46A1 and alpha-syn\u003cem\u003e \u003c/em\u003ewere determined and plotted as fold changes relative to the average mRNA levels detected in non-transfected SH-SY5Y cell samples. A high level of CYP46A1 mRNA was detected in cells transfected with CYP46A1 and alpha-syn but not in cells transfected with GFP and alpha-syn or in non transfected cells (left part) The analysis suggests that CYP46A1 does not influence the mRNA levels of alpha-syn, as the mRNA levels of alpha-syn detected in the presence of CYP46A1 were slightly higher compared to those detected with GFP (right part). The results are presented as means ± standard error of the mean (SEM) experiments. Statistical significance was determined as follows: ***p \u0026lt; 0.001 ****p \u0026lt;0.0001 compared CYP46A1 with GFP by one-way ANOVA with Tukey’s multiple comparisons test\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/07b4c8fa99a88ede2f3bd0d5.png"},{"id":59597696,"identity":"c3eb4021-60c6-4bb4-acd1-f6c590ee791d","added_by":"auto","created_at":"2024-07-03 16:15:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":80490,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of CYP46A1 on the expression of the A53T alpha-syn mutant and mutants lacking putative cholesterol-binding sites. \u003cstrong\u003ea)\u003c/strong\u003eEvaluation of CYP46A1 and alpha-syn protein levels in SH-SY5Y cells co-transfected with wild-type alpha-syn or mutant alpha-syn, along with either GFP or CYP46A1, suggests that the interaction of alpha-syn and cholesterol in the tilted region of alpha-syn is not essential for the reduction of alpha-syn expression mediated by CYP46A1. Additionally, the A53T alpha-syn mutant is also targeted by CYP46A1.\u003cstrong\u003eb)\u003c/strong\u003eQuantification of alpha-syn protein levels (N=3) as described in A. Actin was used as a loading control for normalization purposes. The values obtained from cells co-transfected with alpha-syn and GFP were used as the reference value and considered as 1 for normalization purposes. All other values obtained from cells co-transfected with alpha-syn and CYP46A1 are expressed relative to this reference value as the means + /- SEM. Statistical significance was determined as follows: *p \u0026lt;0.05, **p \u0026lt; 0.001, ****p \u0026lt; 0.0001 compared to GFP using one-way ANOVA with Dunnett’s multiple comparisons test. The observed variations in the levels of alpha-syn proteins relative to the level of actin proteins are attributed to the variability in transfections in a limited number of experiments (N=3)\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/e322e07bf7bc99a6af66822d.png"},{"id":59599326,"identity":"60495ae5-7322-4417-b0f9-400951435bc9","added_by":"auto","created_at":"2024-07-03 16:31:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":73048,"visible":true,"origin":"","legend":"\u003cp\u003eCYP46A1 reduces alpha-syn proteins levels through the macroautophagy pathway. \u003cstrong\u003ea)\u003c/strong\u003e Evaluation of alpha-syn and LC3B protein levels in cells co-transfected cells with wild-type alpha-syn and either GFP or CYP46A1 by western blot analysis. The co-transfected cells were either left untreated for 48 hours or treated with 3-MA for 42 hours, starting 6 hours post-transfection or treated with BafA1 for 24 hours, starting 24 hours post-transfection. \u003cstrong\u003eb\u003c/strong\u003e) Quantification of alpha-syn protein levels normalized to actin protein levels (N =11). Error bars represent +/- SEM. Statistical significance was determined as follows: ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001 compared CYP46A1 with GFP by Sidak’s multiple comparisons test. \u003cstrong\u003ec) \u003c/strong\u003eQuantification of LC3B-II proteins levels were normalized to LC3B-I protein levels (Left part) or to actin protein levels (Right part) (N =11). Error bars indicate +/- SEM. Statistical significance was determined as follows: *** indicates p \u0026lt;0.001; **** indicates p \u0026lt; 0.0001 by unpaired t test\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/24bc5c160d5d5b0874a1d2c7.png"},{"id":59597700,"identity":"b683f9e3-dff3-428f-8c75-b2d104bdcbc3","added_by":"auto","created_at":"2024-07-03 16:15:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":96837,"visible":true,"origin":"","legend":"\u003cp\u003eCYP46A1 retains its functionality to reduce alpha-syn expression even when the GBA1 gene is knocked down in co-transfected SH-SY5Y cells.SH-SY5Y cells were co-transfected with either siRNAs targeting GBA1 (siGBA1a, siGBA1b, or siGBA1c) or two different scrambled control siRNAs (siCtrtl1, siCtrtl2), along with wild-type alpha-syn and either GFP (left panel) or CYP46A1 (right panel) for 48 hours. Cell extracts (20ug) were subjected to western blot analysis using antibodies specific to human GBA1, HA for CYP46A1-HA, actin, GFP and human alpha-syn. The western blot analysis revealed a reduction in GBA1 expression following transfection with GBA1 siRNA1b and 1c (lanes 3 and 4) compared to cells transfected with control siRNA (lanes 1 and 5) or GBA1 siRNA 1 (lane 2). The presence of CYP46A1 leads to a decrease in alpha-syn protein levels, regardless of the specific siRNA used (right panel), compared to GFP (left panel). These findings suggest that the deficiency in GCase does not impede CYP46A1 from inducing the degradation of alpha-syn\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/52a1187147f664c86a8367e8.png"},{"id":61584624,"identity":"9ea1235c-b066-45b4-bda4-e9bc68b8f94c","added_by":"auto","created_at":"2024-08-01 14:05:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":980195,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/66e321be-25c3-4b9c-ab27-2a5727b523f1.pdf"},{"id":59598510,"identity":"b31e9791-374a-477f-8c61-4a01ae3bf180","added_by":"auto","created_at":"2024-07-03 16:23:31","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":177690,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4580957/v1/13091e658614f3a9a489e782.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"The cholesterol 24-hydroxylase enzyme, CYP46A1, reduces overexpressed alpha-synuclein proteins in human cellular models of Parkinson’s disease.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlpha-synuclein (alpha-syn) plays a central role in the development of Parkinson's disease (PD) (Devine et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). A key characteristic of PD is the degeneration of dopaminergic neurons in the substantia nigra pars compacta. The remaining neurons display an accumulation of alpha-syn proteins, forming aggregates in Lewy bodies. The SNCA gene encodes a 14.5-kDa protein, alpha-syn, which has been implicated as a crucial factor in synaptic vesicle trafficking and dopamine release.\u003c/p\u003e \u003cp\u003eHowever, its physiological function remains not completely understood. Overexpression of the alpha-syn protein, resulting from duplications or triplications of the SNCA locus, or point mutations in the SNCA gene, is associated with familial forms of PD (Polymeropoulos et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Kr\u0026uuml;ger et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Singleton AB et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). While many of these genetic alterations are either rare or confer a variable risk for developing PD, they highlight that the exclusive overexpression of alpha-syn can contribute to the onset of the disease. The spread of aggregated alpha-syn from cell to cell is currently considered as a mechanism explaining the pathological progression of the disease. Due to the aberrant assembly of alpha-syn being a common feature in the development of PD, significant efforts have been dedicated to understanding and inhibiting this phenomenon.\u003c/p\u003e \u003cp\u003eRecent findings indicate that Lewy bodies in addition of the high level of alpha-syn proteins are also characterized by a high lipid content and degenerated organelles suggesting that lipids, which are the main constituents of cell membranes, may contribute to the development of the disease (Shahmoradian et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Mahul-Mellier et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Over the last two decades, accumulating evidence suggests a transient binding of alpha-syn to lipid membranes particularly in cholesterol-rich regions (Fortin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; van Maarschalkerweerd et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Kachappilly et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Qi et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Cholesterol may affect the binding of alpha-syn to the membrane and its abnormal aggregation (Man et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Jakubec et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Qi et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Studies have also demonstrated that alpha-syn significantly stimulates cholesterol efflux (Hsiao et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe brain, being the highest cholesterol-rich organ in mammals, maintains a crucial balance of cholesterols levels through a precisely regulated process called brain cholesterol homeostasis. Cholesterol, is an integral component of membranes, contributing to their structure and function and acts as a precursor of metabolites involved in various metabolic pathways. The cholesterol is mainly found in the myelin sheaths of the oligodendrocytes, as well as in the membranes of glial cells and neurons. Astrocytes synthesize cholesterol and export it through ATP-binding cassette transporters, primarily via ABCA1 transporter. The transportation of cholesterol to neurons is facilitated by Apo E, which is also synthesized by astrocytes (Mahley, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudies have shown disruptions in this balance during neurodegenerative diseases such as Alzheimer's disease (AD) (Bogdanovic et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Desai et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Brown et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2004\u003c/span\u003e), Huntington\u0026rsquo;s disease (HD) (del Toro et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Kreilaus et al., 2016), spinocerebellar ataxia type 3 (SCA3) and amyotrophic lateral sclerosis (ALS)(Abdel-Khalik et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) as well as in brain disorders such as epilepsy (Chali et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Previous research has demonstrated that regulating cholesterol homeostasis through the overexpression of CYP46A1, a brain-specific enzyme that converts cholesterol into 24-hydroxycholesterol (24-OHC), has protective effects against AD (Hudry et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Burlot et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), HD (Boussicault et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kacher et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), SCA3 (Nobrega et al., 2019) and Rett syndrome (Audouard et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The role of CYP46A1, primarily located in neurons, is crucial because cholesterol itself cannot cross the blood- brain barrier (BBB), whereas 24-OHC can pass through BBB into the systemic circulation. Acting as a ligand for liver X receptors (LXR), 24-OHC subsequently regulates the transcription of cholesterol transport proteins such as ABCA1, which are located on the plasma membrane. Consequently, this process effectively regulates cholesterol efflux. However, these studies have revealed that the effects of CYP46A1 activity extend beyond cholesterol maintenance, leading to a reduction in aggregated proteins implicated in these diseases (Moutinho et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). These findings underscore the pivotal role of cholesterol turnover and 24-OHC in neurological disorders.\u003c/p\u003e \u003cp\u003eDespite this, only a few studies investigated the role of CYP46A1 in PD. Recent research has revealed reduced levels of CYP46A1 proteins in induced pluripotent stem cell (iPSC)-derived dopaminergic neurons from patients carrying the SNCA triplication or the A53T SNCA mutation, both associated with familial PD onset (Zambon et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Notably, CYP46A1 overexpression has been observed to elevate levels of 24-OHC and 24(S),25-epoxycholesterol (24, 25-EC) in the developing midbrain. This process has been proposed as a potential mechanism for preventing dopaminergic loss in PD (Theofilopoulos et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). These data suggested that CYP46A1 could be an important factor in PD.\u003c/p\u003e \u003cp\u003eThe aim of our study was to investigate whether the overexpression of CYP46A1 could also be beneficial for PD and lead to a decrease in overexpressed alpha-syn. In the present study, we aimed to investigate whether the expression of CYP46A1 could reduce the levels of overexpressed alpha-syn proteins in neuroblastoma SH-SY5Y cells. To deepen our comprehension of CYP46A1\u0026rsquo;s actions, we evaluated not only the expression of wild-type alpha-syn but also the expression of A53T alpha-syn mutant associated with the familial form of the disease (Polymeropoulous et al., 1997), as well as mutants lacking presumed cholesterol-binding sites, all in the presence of CYP46A1. Additionally, we investigated the impact of CYP46A1 on alpha-syn overexpression by inhibiting autophagic-lysosome functions using autophagic inhibitors and by reducing the expression of the lysosomal enzyme encoded by the GBA1 gene, which are among the most common genetic factors associated with an increased risk of PD (Neumann et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Brockmann et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of untagged alpha-synuclein constructs\u003c/h2\u003e \u003cp\u003eHuman alpha-synuclein (WT or A53T) cDNA was amplified by PCR from previously described vectors kindly provided by Addgene (plasmids #102361 and 105727). The PCR products were cloned in the HindIII/XbaI sites of the pcDNA3.1 vector using primers described in Table S2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture and co-transfections\u003c/h2\u003e \u003cp\u003eHuman SH-SY5Y neuroblastoma cells (ATCC:CRL-266), were cultured in DMEM with Glutamax (Gibco), supplemented with 4,5g/L D-glucose and sodium pyruvate, 10% heat-inactivated fetal bovine serum (Gibco), 100 U/ml penicillin, and 100 \u0026micro;g/ml streptomycin (Gibco), in a 5% CO2 atmosphere at 37\u0026deg;C. Cells were transiently transfected with plasmids using Lipofectamine 2000 (Invitrogen), following to the manufacturer\u0026rsquo;s instructions. The pcDNA3-EGFP plasmid was obtained from Addgene (plasmid #13031) while pAAV-HA-CYP46A1 or pCMV-CYP46A1-Flag plasmids were provided by Askbio France. For autophagy inhibition, treatments were initiated either 6 hours or 24 hours post-transfection with 3-MA or BafA1, respectively. Cells were then incubated with 3-MA for 42 hours or with BafA1 for 24 hours. 3-MA (189\u0026ndash;490, Millipore) was prepared at a concentration of 50 mM in Opti-MEM(Gibco), sterilized by filtration through a syringe filter with a 0,2\u0026micro;M pore size and added to a final concentration of 5 mM in the cell medium. BafA1 (B1793, Sigma) was dissolved as a 10uM solution in DMSO and added to the cell medium to achieve a final concentration of 50 nM. For proteasome inhibition, MG132 (474790, Sigma) was prepared as a 20 mM solution in DMSO. Cells were treated with 20 \u0026micro;M MG132 42 hours post-transfection for 6 hours. The concentrations of these inhibitors were selected based on data from other studies and preliminary experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and western-blot analysis\u003c/h2\u003e \u003cp\u003eCell pellets were homogenized in RIPA buffer (150 mM NaCl, 50 mM Tris pH 8, 1% Triton X-100, 0,5% sodium deoxycholate, 0,1%SDS) supplemented with protease inhibitors for 30 min at 4\u0026deg;C. Whole lysates were clarified by centrifugation at 10,000 rpm for 15 min. Protein concentrations were quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) with bovine serum albumin (BSA) standards for comparison. Equal volumes of each sample were separated by SDS-PAGE. Protein samples were denatured for 3 min at 95\u0026deg;C and separated into 4\u0026ndash;20% SDS-polyacrylamide gels, then transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked with 5% BSA in Tris-buffered saline (TBS) pH 8 for 1 h, followed by overnight incubation with primary antibodies (dilution 1:1000) at 4\u0026deg;C. After washing three times for 10 min each in TBS with 0.1% Tween-20, membranes were incubated with Li-COR fluorescent secondary antibodies (dilution 1:6000) for 1 h at room temperature and washed three more times with TBS with 0.1% Tween-20. Finally, images of the membranes were captured using a Li-COR Odyssey fluorescence scanner. The protein ladder used was Precision Plus Protein standards Kaleidoscope ladder, 10 to 250 kD (Bio-Rad).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence microscopy\u003c/h2\u003e \u003cp\u003eFor immunostaining, SH-SY5Y cells were cultured on glass coverslips. Twenty-four hours post-transfection, cells were washed twice with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde in PBS, quenched for 10 min with 0.1 M glycine in PBS and permeabilized for 30 min at room temperature with 0.05% saponin, PBS, 0.5% bovine serum albumin. The coverslips were incubated for 2 h at room temperature with the primary antibodies (see below) at dilution 1:250 in PBS containing 0.5% BSA, 0.05% saponin. After washing, cells were subsequently incubated for 2 h at room temperature with the secondary antibodies (see below) at dilution 1:500, covered from light. Cells were washed three times with PBS and mounted using Vectashield with DAPI or without (Vector Laboratories). Fluorescent images of cells were captured with a 60x objective using a Zeiss Apotome 2 microscope with the structured illumination system equipped of a Zeiss Axiocam Camera. Image acquisition was performed with the ZEN 2 (Zeiss) software. The images were merged and analyzed using Image J.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAntibodies\u003c/h2\u003e \u003cp\u003eThe following primary antibodies were used: rabbit anti-actin (Sigma, A2066), rabbit anti-GFP (Sigma, SAB301138), rabbit anti-HA (Cell Signaling, 3724), mouse anti-alpha-synuclein antibody (Invitrogen, AHB0261), mouse anti-Flag (Sigma, F3165), mouse anti-ubiquitin (Invitrogen, 14-6078-82), mouse anti-Lamp2A (Abcam, Ab25631), rabbit anti-LC3B (Abcam, 51520), rabbit anti-GBA1 (Sigma, G4171). Secondary antibodies for immunoblotting were appropriate goat anti-mouse or anti-rabbit IRDye 680RD or 800CW IgG (Odyssey LI-COR). For immunofluorescence labelling Alexa-488 or Alexa 555 -conjugated donkey anti -mouse or anti-Rabbit, (Life technologies) were used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and quantitative PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cells using TRIzol reagent (Invitrogen), treated with DNase I\u003c/p\u003e \u003cp\u003eand reverse-transcribed using the Onescript qPCR RT Kit (Ozyme). cDNA was amplified\u003c/p\u003e \u003cp\u003eusing SYBR Green on the Roche Light Cycler 480 for quantification. The relative expression levels of mRNA were normalized to S18 ribosomal RNA levels (RibS18). The following primers were used: Human CYP46A1 forward (5\u0026rsquo;CGAGTCCTGAGTCGGTTAAGAAGTT3\u0026rsquo;) and reverse (5\u0026lsquo;AGTCTGGAGCGCACGGTACAT3\u0026rsquo;), human alpha-syn forward (5\u0026rsquo;ACCAAACAGGGTGTGGCAGAAG3\u0026rsquo;) and reverse (5\u0026rsquo;CTTGCTCTTTGGTCTTCTCAGCC3\u0026rsquo;) and human Ribs18 forward (5\u0026rsquo;GAGGATGAGGTGGAACGTGT3\u0026rsquo;) and reverse (5\u0026rsquo;GGACCTGGCTGTATTTTCCA3\u0026rsquo;). The program consisted of an initial hot start cycle at 95\u0026deg;C for 2min, followed by 45 cycles at 95\u0026deg;C for 10 s, 65\u0026deg;C for 20 s and 72\u0026deg;C for 20s with a final extension at 72\u0026deg;C for 10 min. Each sample was assayed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSite-direct mutagenesis\u003c/h2\u003e \u003cp\u003eThe human alpha-syn-pcDNA3.1 plasmid was subjected to site-directed mutagenesis to introduce specific amino acid changes within the domain spanning residues 67 to 78, as listed in Table S1. Various plasmids were generated including: plasmid 38 with mutations A69G, V70L, T72S, G73R; plasmid 39 with mutations A69T, V70R, G73Y, V74W, A76S; plasmid 40 with mutations V71S, T72A, T75A, A76S and plasmid 42 with mutation A69K. Forward and reverse primers, each of 25\u0026ndash;40 nucleotides long, were designed to introduce the desired mutations (see Table S2). Additional primers were necessary for cloning into the HindIII/XbaI sites of the pcDNA3.1 vector (see Table S2). PCR was performed using the mutation primers (forward or reverse), cloning primers (HindIII or XbaI primers) and the alpha-syn-pcDNA3.1 plasmid as a template, along with a high-fidelity thermostable Taq DNA polymerase (Thermo Fisher, Master Mix Dream Taq Green PCR). The PCR conditions involved an initial denaturation at 94\u0026deg;C for 3 min, followed by 30 cycles of denaturation at 94\u0026deg;C for 30 s, annealing at 66\u0026deg;C for 30 s, and extension at 72\u0026deg;C for 30 s, with a final extension step at 72\u0026deg;C for 7 min. For each construct, a final PCR was conducted using the two PCR fragments isolated on agarose gels with a gel extraction kit (Qiagen), along with the two HindIII and XbaI primers. The resulting PCR product was isolated using the Qiaquick PCR purification kit (Qiagen), digested with HindIII and XbaI, and then ligated into the pcDNA3.1 plasmid, which had been previously digested with HindIII and XbaI. The plasmids were transformed into competent bacteria via heat shock. Single colonies were selected, grown overnight, and plasmid DNA was isolated using a miniprep kit (Qiagen). Sequencing of the plasmids was conducted to confirm the introduced base changes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eReduction of Lamp2A or GBA1 expression by RNA silencing\u003c/h2\u003e \u003cp\u003eTo downregulate the levels of glucocerebrosidase (GCase) encoded by the GBA1 gene or Lamp2A proteins, siRNAs were purchased from Thermo Fisher Scientific (Ambion by Life technologies). Three siRNAS targeting human GBA1 (GBA1a (GBA-s501316), GBA1b (GBA-s534767) and GBA1c (GBA-s534768)) were tested. The siRNA targeting human Lamp2A is Lamp2-s8086. As a negative control, siRNA s18483 obtained from Thermofisher was used. The specific siRNAs, at a concentration of 50nM, were co-transfected with Lipofectamine 2000 (Invitrogen) along with alpha-syn and GFP or CYP46A1 plasmids for 48 hours into SH-SY5Y cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted using GraphPad Prism. The specific statistical tests used are indicated in the figure legends. Values are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. A p-value of less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eDecrease in alpha-syn expression following co-transfection with CYP46A1 in neuroblastoma SH-SY5Y cells\u003c/h2\u003e \u003cp\u003eTo explore the impact of CYP46A1 on alpha-syn in PD, we generated a plasmid harboring human wild-type (WT) alpha-syn cDNA. This construct was then co-transfected with a plasmid expressing either CYP46A1 or GFP into human neuroblastoma SH-SY5Y cells. Forty-eight hours post-transfection, the presence of CYP46A1 led to a significant threefold reduction in the levels of alpha-syn proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea-b). Immunofluorescence analysis of CYP46A1 and alpha-syn conducted 48 hours post-transfection revealed cytoplasm localization for alpha-syn, characterized by a vesicular pattern. CYP46A1 predominantly exhibited localization around the nuclear membrane and within the cytoplasm, likely associated with the membrane of the endoplasmic reticulum, as previously demonstrated (Russell et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Next, we investigated whether the reduction in alpha-syn expression occurred at the transcriptional level by performing real-time RT-QPCR analysis. Analysis of alpha-syn mRNA levels from cells co-transfected with alpha-syn and either CYP46A1 or GFP showed no significant difference. These findings suggest that the difference in alpha-syn levels is not attributable to transcriptional regulation by CYP46A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). In conclusion, we have demonstrated that while CYP46A1 does not reduce the level of alpha-syn transcripts, it does affect the level of alpha-syn proteins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eImpact of CYP46A1 overexpression on A53T alpha-syn mutant and mutants devoid of presumed putative cholesterol-binding sites\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSome findings underscore the crucial role of cholesterol in mediating interactions between physiologically relevant membranes and alpha-syn in neurological diseases. Disruption of this association redistributes alpha-syn away from the synapse and impairs its cellular function (Fortin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Furthermore, alpha-syn extracellular has been discovered to significantly enhance cholesterol efflux from neuronal cells (Hsiao et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). We investigated whether interaction of alpha-syn and cholesterol is a prerequisite for the reduction of alpha-syn expression mediated by CYP46A1. Through the utilization of a panel of recombinant fragments and synthetic peptides, it has been discovered that alpha-syn interacts with cholesterol with high affinity through a binding domain called the \u0026laquo; titled domain \u0026raquo; (Crowet et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Fantini et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). To disrupt the interaction between cholesterol and alpha-syn, we engineered mutants within the titled domain (residues 67\u0026ndash;78) and assessed the resulting reduction in alpha-syn expression. The amino acid residues of wild-type human alpha-syn involved in cholesterol binding are indicated in bold in the sequence GG\u003cb\u003eAV\u003c/b\u003eV\u003cb\u003eTG\u003c/b\u003eVT\u003cb\u003eA\u003c/b\u003eVA\u003cb\u003eQ\u003c/b\u003e (Fantini et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e and \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) (Table S1). Four mutants (Syn 38, Syn39, Syn40, Syn42) were designed by site-directed mutagenesis. Among these mutants, Syn40, was specifically engineered based on the peptide mutant SynuM53 of alpha syn, as devised by Crowet and colleagues (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) using molecular modeling methodologies. This mutant is suggested to adopt a parallel orientation to the lipid layer rather than a tilted orientation. Its sequence is GGAV\u003cb\u003eSA\u003c/b\u003eGV\u003cb\u003eAS\u003c/b\u003eVTQ. The other three mutants were designed to alter the essential amino acids identified in these interactions by Fantini et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) (Table S1). We also included the A53T mutation linked to familial parkinsonism, which has been shown in \u003cem\u003ein vitro\u003c/em\u003e studies to have no effect on lipid binding (Perrin et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Jo et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Fortin et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). SH-SY5Y cells were co-transfected with each alpha-syn mutant along with either GFP or CYP46A1, or with wild-type alpha-syn or the A53T alpha-syn mutant along with either GFP or CYP46A1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Forty-eight hours post-transfection, we compared the level of alpha-syn protein levels by western blot analysis between the cells co-transfected GFP or CYP46A1. We observed a significant reduction in alpha-syn levels for wild-type or each mutant alpha-syn in the presence of CYP46A1 compared to the presence of GFP (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). In conclusion, our study revealed that the decrease of alpha-syn protein levels in cells overexpressing CYP46A1 is not dependent on the interaction between cholesterol and the region 67\u0026ndash;78 of alpha-syn. Indeed, CYP46A1 significantly reduced the expression level of alpha-syn mutants at potential cholesterol-binding sites compared to cells co-transfected with GFP. Furthermore, we observed that CYP46A1 can decrease the expression not only of wild-type alpha-syn but also the A53T alpha-syn mutant associated with the familial form of the disease.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCYP46A1 facilitates the reduction of wild-type alpha-syn (WT) protein levels via the\u003c/h2\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003emacroautophagy pathway\u003c/h2\u003e \u003cp\u003eEvidence suggests that dysfunction in the autophagy pathway is prevalent in numerous neurodegenerative diseases (Ravikumar et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Nixon et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Sarkar et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Pan et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). In PD, alpha-syn has been demonstrated to undergo degradation through macroautophagy, chaperone-mediated autophagy or the proteasome (Webb et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Cuervo et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e, Vogiatzi et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). We investigated whether CYP46A1 could enhance macroautophagy, chaperone-mediated autophagy or the proteasome to reduce the expression of alpha-syn proteins in SH-SY5Y cells.\u003c/p\u003e \u003cp\u003e Macroautophagy is a common form of autophagy characterized by the formation of autophagosome and is effective in removing abnormal proteins and protein aggregates (Glick et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). To investigate the impact of macroautophagy on alpha-syn clearance mediated by CYP46A1, we treated the co-transfected cells with autophagy inhibitors, 3-Methyladenine (3-MA) and Bafilomycin A1 (BafA1) (Fig.\u0026nbsp;3A). As expected, when cells are co-transfected with alpha-syn and GFP, the presence of these autophagy inhibitors resulted in increased alpha-syn levels. This finding is consistent with the established knowledge that alpha-syn is regulated by macroautophagy. Furthermore, when alpha-syn and CYP46A1 were co-expressed, an increase of alpha-syn proteins was observed in the presence of 3-MA or BafA1. However, this increase in alpha-syn levels was notably lower compared to when alpha-syn and GFP were co-expressed in the presence of the inhibitors. This suggests that CYP46A1 retains its ability to reduce alpha-syn levels even in the presence of autophagy inhibitors. These results were further supported by the quantitative analysis of western blot data from 11 independent experiments (Fig.\u0026nbsp;3B).\u003c/p\u003e \u003cp\u003eBy inhibiting the fusion of the autophagosome and the lysosome, BafA1 affects LC3 formation. Through western blot analysis, we observed a significant increase in the LC3B-II/LC3B-I ratio in cells co-expressing alpha-syn and CYP46A1 compared to those co-expressing alpha-syn and GFP, as illustrated in the representative western blot (Fig.\u0026nbsp;3A) and the data obtained from 11 western blots (Fig.\u0026nbsp;3C). These findings strongly suggest that CYP46A1 enhances the induction of macroautophagy of alpha-syn.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure\u0026nbsp;3\u003c/b\u003e CYP46A1 reduces alpha-syn proteins levels through the macroautophagy pathway. \u003cb\u003ea)\u003c/b\u003e Evaluation of alpha-syn and LC3B protein levels in cells co-transfected cells with wild-type alpha-syn and either GFP or CYP46A1 by western blot analysis. The co-transfected cells were either left untreated for 48 hours or treated with 3-MA for 42 hours, starting 6 hours post-transfection or treated with BafA1 for 24 hours, starting 24 hours post-transfection. \u003cb\u003eb\u003c/b\u003e) Quantification of alpha-syn protein levels normalized to actin protein levels (N\u0026thinsp;=\u0026thinsp;11). Error bars represent +/- SEM. Statistical significance was determined as follows: ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 compared CYP46A1 with GFP by Sidak\u0026rsquo;s multiple comparisons test. \u003cb\u003ec)\u003c/b\u003e Quantification of LC3B-II proteins levels were normalized to LC3B-I protein levels (Left part) or to actin protein levels (Right part) (N\u0026thinsp;=\u0026thinsp;11). Error bars indicate +/- SEM. Statistical significance was determined as follows: *** indicates p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; **** indicates p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 by unpaired t test\u003c/p\u003e \u003cp\u003eWe also examined whether CYP46A1 could influence alpha-syn expression through the chaperone mediated autophagy (CMA) pathway. CMA is a distinctive pathway by which cytosolic protein aggregates are selectively directed to lysosomes for degradation. Wild-type alpha-syn, containing a CMA-targeting motif within its sequence, can undergo degradation in lysosomes via the CMA pathway (Cuervo et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The substrate-chaperone complex is then transported to lysosomal membranes, where interactions with Lamp2A receptors facilitate CMA activities (Cuervo and Dice, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). To examine whether CYP46A1 can induce the CMA pathway to degrade alpha-syn, SH-SY5Y cells were co-transfected with Lamp2A siRNA or scrambled control siRNA along with alpha-syn accompanied by either GFP or CYP46A1. The reduction of Lamp2A by siRNA is directly related to CMA activity. Lamp2A protein levels were determined by western blotting (Fig. S1). The protein levels of alpha-syn detected with GFP or with CYP46A1 did not change in cells where Lamp2A protein levels were reduced by 2.5-fold with siRNA compared to cells co-transfected with siRNA control. These results suggest that CYP46A1 enhances alpha-syn degradation through the macroautophagy pathway independently of CMA autophagy (Fig. S1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo explore the impact of CYP46A1 on proteasomal activity in the alpha-syn clearance, SH-SY5Y cells were co-transfected with alpha-syn and either GFP or CYP46A1 and subsequently, treated with the proteasome inhibitor MG132 at 20 \u0026micro;M for 6 hours. Our observations revealed an increase in alpha-syn protein levels following MG132 treatment, regardless of the presence of GFP or CYP46A1. This finding is consistent with established knowledge that alpha-syn is degraded not only by autophagy but also by the proteasome (Webb et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). However, the ratio of alpha-syn protein levels in the presence of CYP46A1 compared to those detected with GFP remains unchanged with or without MG132, indicating that CYP46A1 reduces the levels of alpha-syn protein independently of proteasome inhibition (Fig. S2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eImpact of CYP46A1 on alpha-syn expression in glucocerebrosidase-deficient cells\u003c/h2\u003e \u003cp\u003eMutations in the GBA1 gene constitute the most significant genetic risk factor numerically for the development of PD, increasing the risk by approximately fourfold (Neumann et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Sidransky et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). GBA1 gene encodes the lysosomal enzyme glucocerebrosidase (GCase), which plays a crucial role in converting glucosylceramide into glucose and ceramide within the lysosome. GCase-deficient cells display disrupted lysosomal recycling and the accumulation of dysfunctional lysosomes. Given that lysosomes serve as the principal degradative compartment within the cell, their biogenesis and recycling are essential for cellular function and the autophagy-lysosomal pathway. The loss of GCase activity exacerbates autophagy impairment and facilitates the accumulation of alpha-syn (Murphy et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Magalhaes et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Gundner et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs the overexpression of CYP46A1 has been shown to decrease alpha-syn protein levels through the macroautophagy pathway, we aimed to investigate whether CYP46A1 could still reduce alpha-syn expression in PD pathological conditions where the expression of the lysosomal enzyme GCase, which regulates autophagy, is diminished. In this study, SH-SY5Y cells were co-transfected with GBA1 siRNAs or scrambled control siRNAs along with alpha-syn and either GFP or CYP46A1 for 48 hours. Two out of three GBA1 siRNAs (siGBA1b and 1c) inhibited the GBA1 gene by factors of 4 and 3, respectively, compared to both scrambled control siRNAs (siCrtl1 and siCrtl2), or siGBA1a, as indicated by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The expression levels of alpha-syn detected using CYP46A1 were observed to decrease compared to those detected using GFP. However, no change in alpha-syn expression was noted in cells with GBA1 deficiency using siRNA siGBA1b or siGBA1c compared to cells with control siRNA. Our experiments demonstrate that CYP46A1 can still effectively reduce alpha-syn expression through the autophagic pathway, even when the expression of the lysosomal enzyme GCase is reduced.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eConsiderable evidence suggests that increased expression of alpha-syn is involved in the pathogenesis of both sporadic and familial Parkinson's disease (PD), indicating that the observed changes likely represent some of the earliest events in the progression of PD. Defects in cholesterol metabolism have been associated with neurodegenerative diseases (Liu et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Dai et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Cholesterol's impact on the membrane binding of alpha-syn may facilitate the formation of beta-sheet structures in alpha-syn, thus promoting the generation of abnormal alpha-syn fibrils (Jakubec et al., 2019; Man et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Qi et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Several studies have emphasized a close association between alpha-synuclein (alpha-syn) and cholesterol, both intracellularly and extracellularly. Notably, research has identified a high-affinity cholesterol binding domain in the 67\u0026ndash;78 amino acid region of alpha-syn (Crowet et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Fantini et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). While the majority of alpha-syn remains intracellular, extracellular forms of this protein also exist, as it can propagate from cell to cell in a \"prion-like\" manner (Vargas et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Extracellular alpha-syn has been demonstrated to decrease membrane cholesterol levels and stimulate cholesterol efflux from cells (Ronzitti et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Hsiao et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe and others have shown that the activation of CYP46A1 in various brain disease models leads to a decrease in aggregated proteins and improved performance in motor, memory and/or cognitive tests (Hudry et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Burlot et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Djelti et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e, Chali et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Boussicault et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Kacher et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e, Nobrega et al., 2019, \u003cem\u003eWurtz et al., 2024)\u003c/em\u003e. However, much less is known about the role of CYP46A1 in PD (reviewed in Moutinho et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2016\u003c/span\u003e and Alavi et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In our study, we demonstrate that heightened expression of the enzyme CYP46A1, responsible for converting cholesterol into 24S-OHC, results in decreased levels of both wild-type and mutant A53T human alpha-syn proteins in neuroblastoma SH-SY5Y cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Additionally, we explored various mutations within the amino acids 67\u0026ndash;78, which were hypothesized to influence interactions between cholesterol and alpha-syn based on the findings of Crowet et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and Fantini et al. (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). However, our results indicate that these mutations in the alpha-syn sequence had no discernible impact. CYP46A1 continued to induce a significant reduction in alpha-syn levels, regardless of whether the alpha-syn variant was wild-type or mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThese findings suggest that the interplay between alpha-syn and cholesterol, particularly within the 67\u0026ndash;78 region, is not essential for CYP46A1's ability to diminish alpha-syn protein levels.\u003c/p\u003e \u003cp\u003eThe degradation of alpha-syn is believed to occur through multiple pathways, including macroautophagy, chaperone-mediated autophagy, and the proteasome-ubiquitin system (Webb et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Cuervo et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Vogiatzi et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Our study reveals that CYP46A1 enhances the macroautophagy pathway, thereby reducing the levels of alpha-syn proteins. Specifically, we observed a significant increase in LC3B-II levels in SH-SY5Y cells overexpressing both CYP46A1 and alpha-syn proteins compared to cells overexpressing GFP and alpha-syn proteins when treated with the autophagy inhibitor BafA1 (Fig.\u0026nbsp;3). These findings are consistent with prior research demonstrating that CYP46A1 promotes autophagy of mutant ataxin-3 or the huntingtin proteins in SCA3 disease and HD respectively (Kacher et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Nobrega et al., 2019, 2020). Interestingly, even in the presence of autophagy inhibitors such as 3-MA or BafA1, CYP46A1 retains its ability to decrease the expression of alpha-syn. Hence, the upregulation of macroautophagy by CYP46A1 appears to be a promising therapeutic strategy for the treatment of accumulated alpha-syn (Fig.\u0026nbsp;3). Our study did not find any effect of CYP46A1 on CMA pathway or on the proteasome-ubiquitin system for the alpha-syn degradation (Fig. S1 and Fig. S2).\u003c/p\u003e \u003cp\u003eStrikingly, one of the most significant genes in PD is GBA1, which is involved in lipid metabolism. Variants in this gene are present in 5\u0026ndash;20% of PD patients across different populations. It is well-documented that mutations in the GBA1 gene can lead to decreased activity of the lysosomal enzyme glucocerebrosidase (GCase) (Neumann et al; \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Sidransky et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Gan-Or et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This phenomenon is believed to result from impaired lysosomal function, leading to the accumulation of alpha-syn (Murphy et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Magalhaes et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Gundner et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). We conducted co-transfections of SH-SY5Y cells with GBA1 siRNA, resulting in a fourfold reduction in GBA1 expression, in combination with human alpha-synuclein and either CYP46A1 or GFP. Our observations revealed that CYP46A1 could reduce the level of alpha-synuclein by the same efficacy, regardless of the expression of GBA1. These findings demonstrate that CYP46A1 maintains its ability to suppress alpha-synuclein expression even in the presence of impaired lysosomal function as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e. This study shows that the role of CYP46A1 extends beyond cholesterol clearance, as it promotes macroautophagy in cases of overexpressed alpha-syn. Our \u003cem\u003ein vitro\u003c/em\u003e results demonstrate its effectiveness across various cellular models of Parkinson's disease, including those with overexpression of alpha-synuclein with or without GBA1 deficiency, or overexpression of the A53T mutated alpha-synuclein. This suggests that CYP46A1 holds promise as a therapeutic strategy for PD by mitigating the pathological effects of alpha-syn accumulation. Additional data from Theofilopoulos et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) suggest that overexpression of CYP46A1 may prevent dopaminergic loss in PD. Moving forward, it will be crucial to ascertain in \u003cem\u003ein vivo\u003c/em\u003e PD models whether CYP46A1 facilitates neuroprotection and symptom reduction in PD.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003eThe authors would like to express their thanks for laboratory support to Dr. Nathalie Cartier.Cell work was performed at the CELIS platform. and we thank Laetitia Strehl involved in this platform. We also thanks Danny Oberl\u0026eacute; for her help in manuscript review.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u0026nbsp;\u003c/strong\u003eCBG: conceptualization methodology, validation, formal analysis, investigation, writing-original draft, visualization.LR and EA:\u0026nbsp;methodology, validation, formal analysis, investigation, writing,\u0026nbsp;visualization. FC: conceptualization, resources, review. FP: resources, writing, review and editing, supervision, funding acquisition. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis work was supported by the Paris Brain Institute (ICM) and by the French National Institute of Health and Medical Research (INSERM).\u0026nbsp;The research leading to these results has received funding from the program \u0026ldquo;Investissements d\u0026rsquo;avenir\u0026rdquo; ANR-10-IAIHU-06 and ANR-11-INBS-0011\u0026mdash;NeurATRIS: Translational Research Infrastructure for Biotherapies in Neurosciences.\u0026nbsp;CBG was supported by INSERM, LR, EA and FC by ICM (thanks to Grants obtained by FP).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate \u0026nbsp; \u0026nbsp;\u003c/strong\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests.\u0026nbsp;\u003c/strong\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbdel-Khalik J, Yutuc E, Crick PJ, Gustafsson J-A, Warner M, Roman G, Talbot K, Gray E, Griffiths WJ, Turner MR, Wang Y (2017) Defective cholesterol metabolism in amyotrophic lateral sclerosis. J Lipid Res 58(2):267\u0026ndash;278. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1194/jlr.P071639\u003c/span\u003e\u003cspan address=\"10.1194/jlr.P071639\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlavi MS, Karimi G, Ghanimi HA, Roohbakhsh A (2023) The potential of CYP46A1 as a novel therapeutic target for neurological disorders: An updated review of mechanisms. Eur J Pharmacol 949:17572. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2023.175726\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2023.175726\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAudouard E, Khefif N, Gillet-Legrand B, Nobilleau F, Bouazizi O, Stanga S, Despres G, Alves S, Lamazi\u0026egrave;re A, Cartier N, Piguet F (2024) Modulation of Brain Cholesterol Metabolism through CYP46A1 Overexpression for Rett Syndrome. Pharmaceutics 2024, 16, 756. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/pharmaceutics16060756\u003c/span\u003e\u003cspan address=\"10.3390/pharmaceutics16060756\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBogdanovic N, Bretillon L, Lund EG, Diczfalusy U, Lannfelt L, Winblad B, Russell DW, Bj\u0026ouml;rkhem I (2001) On the turnover of brain cholesterol in patients with Alzheimer's disease. Abnormal induction of the cholesterol-catabolic enzyme CYP46 in glial cells. Neuroscience Letters, 314(1\u0026ndash;2), 45\u0026ndash;48. https://doi.10.1016/s0304-3940(01)02277-7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoussicault L, Alves S, Lamazi\u0026egrave;re A, Planques A, Heck N, Moumn\u0026eacute; L, Despres G, Bolte S, Hu A, Pag\u0026egrave;s C, Galvan L, Piguet F, Aubourg P, Cartier N, Caboche J, Betuing S (2016) CYP46A1, the rate-limiting enzyme for cholesterol degradation, is neuroprotective in Huntington's disease. Brain 139(3):953\u0026ndash;970. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/brain/awv384\u003c/span\u003e\u003cspan address=\"10.1093/brain/awv384\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrockmann K, Srulijes K, Pflederer S, Hauser A-K, Schulte C, Maetzler W, Gasser T, Berg D (2015) GBA-associated Parkinson's disease: reduced survival and more rapid progression in a prospective longitudinal study. Mov Disord 30(3):407\u0026ndash;411. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/mds.26071\u003c/span\u003e\u003cspan address=\"10.1002/mds.26071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown J 3rd, Theisler C, Silberman S, Magnuson D, Gottardi-Littell N, Lee JM, Yager D, Crowley J, Sambamurti K, Rahman MM, Reiss AB, Eckman CB, Wo-lozin B (2004) Differential expression of cholesterol hydroxylases in Alzheimer's disease. J Biol Chem 279(33):34674\u0026ndash;34681. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1074/jbc.M402324200\u003c/span\u003e\u003cspan address=\"https://doi:10.1074/jbc.M402324200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurlot MA, Braudeau J, Michaelsen-Preusse K, Potier B, Ayciriex S, Varin J, Gautier B, Djelti F, Audrain M, Dauphinot L, Fernandez-Gomez FJ, Caillierez R, Lapr\u0026eacute;vote O, Bi\u0026egrave;che I, Auzeil N, Potier MC, Dutar P, Korte M, Bu\u0026eacute;e L, Blum D, Cartier N (2015) Cholesterol 24-hydroxylase defect is implicated in memory impairments associated with Alzheimer-like Tau pathology. Hum Molecu-lar Genet 24(20):5965\u0026ndash;5976. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1093/hmg/ddv268\u003c/span\u003e\u003cspan address=\"https://doi:10.1093/hmg/ddv268\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChali F, Djelti F, Eugene E, Valderrama M, Marquer C, Aubourg P, Duykaerts C, Miles R, Cartier N, Navarro V (2015) Inhibiting cholesterol degradation induc-es neuronal sclerosis and epileptic activity in mouse hippocampus. Eur J Neurosci 41(10):1345\u0026ndash;1355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ejn.12911\u003c/span\u003e\u003cspan address=\"10.1111/ejn.12911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrowet J-M, Lins L, Dupiereux I, Elmoualija B, Lorin A, Charloteaux B, Stroobant V, Heinen E, Brasseur R (2007) In Silico tilted properties of the 67\u0026ndash;78 fragment of alpha-synuclein are responsible for membrane destabilization and neurotoxicity. Proteins, pp. 936\u0026ndash;947. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/prot.21483\u003c/span\u003e\u003cspan address=\"10.1002/prot.21483\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuervo AM, Dice JF (2000) Unique properties of lamp2a compared to other lamp2 isoforms. J Cell Sci. 2000;113 Pt 24:4441-50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.113.24.4441\u003c/span\u003e\u003cspan address=\"10.1242/jcs.113.24.4441\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuervo AM, Stefanis L, Fredenburg R, Lansbury PT, Sulzer D (2004) Impaired degradation of mutant alpha-synuclein by chaperone-mediated autophagy. Science 305:1292\u0026ndash;1295. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1101738\u003c/span\u003e\u003cspan address=\"10.1126/science.1101738\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai L, Zou L, Meng L, Qiang G, Yan M, Zhang Z (2021) Cholesterol metabolism in neurodegenerative diseases: molecular mechanisms and therapeutic targets. Mol Neurobiol 58(5):2183\u0026ndash;2201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-020-02232-6\u003c/span\u003e\u003cspan address=\"10.1007/s12035-020-02232-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDel Toro D, Xifr\u0026oacute; X, Pol A, Humbert S, Saudou F, Canals JM, Alberch J (2010) Altered cholesterol homeostasis contributes to enhanced excitotoxicity in Hunting-ton's disease. J Neurochem 115(6):153\u0026ndash;166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDesai P, DeKosky ST, Kamboh MI (2002) Genetic variation in the cholesterol 24-hydroxylase (CYP46) gene and the risk of Alzheimer's disease. Neurosci Lett 328:9\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0304-3940(02)00443-3\u003c/span\u003e\u003cspan address=\"10.1016/s0304-3940(02)00443-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDevine MJ, Gwinn K, Singleton A, Hardy J (2011) Parkinson's disease and α-synuclein expression. Mov Disord 26(12):2160\u0026ndash;2168. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/mds.23948\u003c/span\u003e\u003cspan address=\"10.1002/mds.23948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDjelti F, Braudeau J, Hudry E, Dhenain M, Varin J, Bi\u0026egrave;che I, Marquer C, Chali F, Ayciriex S, Auzeil N, Alves S, Langui D, Potier MC, Laprevote O, Vidaud M, Duyckaerts C, Aubourg P, Cartier N (2015) CYP46A1 inhibition, brain choles-terol accumulation and neurodegeneration pave the way for Alzheimer's disease. Brain 138:2383\u0026ndash;2398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/brain/awv166\u003c/span\u003e\u003cspan address=\"10.1093/brain/awv166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFantini J, Carlus D, Yahi N (2011) The fusogenic tilted peptide (67\u0026ndash;78) of α-synuclein is a cholesterol binding domain. Biochim et Biophys Acta (BBA) - Biomembr 1808(10):2343\u0026ndash;2351. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbamem.2011.06.017\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamem.2011.06.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFantini J, Di Scala C, Baier CJ, Barrantes FJ (2016) Molecular mechanisms of protein-cholesterol interactions in plasma membranes: Functional distinction between topological (tilted) and consensus (CARC/CRAC) domains. Chem Phys Lipids 199:52\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chemphyslip.2016.02.009\u003c/span\u003e\u003cspan address=\"10.1016/j.chemphyslip.2016.02.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFortin DL, Troyer MD, Nakamura K, Kubo S, Anthony MD, Edwards RH (2004) Lipid rafts mediate the synaptic localization of alpha-synuclein. J Neurosci 24(30):6715\u0026ndash;6723. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.1594-04.2004\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.1594-04.2004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGan-Or Z, Amshalom I, Kilarski LL, Bar-Shira A, Gana-Weisz M, Mirelman A, Marder K, Bressman S, Giladi N, Orr-Urtreger A (2015) Differential effects of severe vs mild GBA mutations on Parkinson disease. Neurology 84(9):880\u0026ndash;887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1212/WNL.0000000000001315\u003c/span\u003e\u003cspan address=\"10.1212/WNL.0000000000001315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlick D, Barth S, Macleod KF (2010) Autophagy: Cellular and molecular mechanisms. J Pathol 221(1):3\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/path.2697\u003c/span\u003e\u003cspan address=\"10.1002/path.2697\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGundner AL, Duran-Pacheco G, Zimmermann S, Ruf I, Moors T, Baumann K, Jagasia R, van de Berg WDJ, Kremer T (2019) Path mediation analysis reveals GBA impacts Lewy body disease status by increasing alpha-synuclein levels. Neuro-biology Disease 121:205\u0026ndash;213. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.nbd.2018.09.015\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.nbd.2018.09.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsiao JHT, Halliday GM, Kim WS (2017) α-Synuclein regulates neuronal cholesterol efflux. Molecules 22(10):1769. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules22101769\u003c/span\u003e\u003cspan address=\"10.3390/molecules22101769\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHudry E, Van Dam D, Kulik W, De Deyn PP, Stet FS, Ahouansou O, Benraiss A, Delacourte A, Bougneres P, Aubourg P, Cartier N (2010) Adeno-associated virus gene therapy with cholesterol 24-hydroxylase reduces the amyloid pathology before or after the onset of amyloid plaques in mouse models of Alzheimer's disease. Mol Ther 18:44\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/mt.2009.175\u003c/span\u003e\u003cspan address=\"10.1038/mt.2009.175\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJakubec M, Barias E, Furse S, Govasli ML, George V, Turcu D, Iashchishyn IA, Morozova-Roche LA, Halskau \u0026Oslash; (2021) Cholesterol-containing lipid nanodiscs promote an α-synuclein binding mode that accelerates oligomerization. FEBS J 288(6):1887\u0026ndash;1905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/febs.15551\u003c/span\u003e\u003cspan address=\"10.1111/febs.15551\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo E, Fuller N, Rand RP, George-Hyslop S, Fraser P (2002) Defective Membrane Interactions of Familial Parkinson's Disease Mutant A30P α-Synuclein. J Mol Biol 315. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/jmbi.2001.5269\u003c/span\u003e\u003cspan address=\"10.1006/jmbi.2001.5269\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKachappilly N, Srivastava J, Swain BP, Thakur P (2022) Interaction of alpha-synuclein with lipids. Methods Cell Biol 169:43\u0026ndash;66. https://doi\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKacher R, Lamazi\u0026egrave;re A, Heck N, Kappes V, Mounier C, Despres G, Dem-bitskaya Y, Perrin E, Christaller W, Sasidharan Nair S, Messent V, Cartier N, Vanhoutte P, Venance L, Saudou F, N\u0026eacute;ri C, Caboche J, Betuing S (2019) CYP46A1 gene therapy deciphers the role of brain cholesterol metabolism in Hun-tington's disease. Brain 142:2432\u0026ndash;2450. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/brain/awz174\u003c/span\u003e\u003cspan address=\"10.1093/brain/awz174\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKreilaus F, Spiro A, McLean CA, Garner B, Jenner AM Evidence for altered cho-lesterol metabolism in Huntington's disease post mortem brain tissue. Neuropathol Appl Neurobiol, 42, 535\u0026ndash;554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nan.12286\u003c/span\u003e\u003cspan address=\"10.1111/nan.12286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKr\u0026uuml;ger R, Kuhn W, M\u0026uuml;ller T, Woitalla D, Graeber M, K\u0026ouml;sel S, Przuntek H, Epplen JT, Sch\u0026ouml;ls L, Riess O (1998) Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson's disease. Nat Genet 18(2):106\u0026ndash;108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng0298-106\u003c/span\u003e\u003cspan address=\"10.1038/ng0298-106\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu JP, Tang Y, Zhou S, Toh BH, McLean C, Li H (2010) Cholesterol involvement in the pathogenesis of neurodegenerative diseases. Mol Cell Neurosci 43:33\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mcn.2009.07.013\u003c/span\u003e\u003cspan address=\"10.1016/j.mcn.2009.07.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagalhaes J, Gegg ME, Migdalska-Richards A, Doherty MK, Whitfield PD, Schapira AHV (2016) Autophagic lysosome reformation dysfunction in glucocerebrosidase deficient cells: relevance to Parkinson disease. Hum Mol Genet 25(16):3432\u0026ndash;3445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1093/hmg/ddw185\u003c/span\u003e\u003cspan address=\"https://doi:10.1093/hmg/ddw185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahley RW (2016) Central nervous system lipoproteins: ApoE and regulation of cholesterol metabolism. Arterioscler Thromb Vasc Biol 36:1305\u0026ndash;1315. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1161/ATVBAHA.116.307023\u003c/span\u003e\u003cspan address=\"https://doi:10.1161/ATVBAHA.116.307023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahul-Mellier A-L, Burtscher J, Maharjan N, Weerens L, Croisier M, Kuttler F, Leleu M, Knott GW, Lashuel HA (2020) The process of Lewy body formation, rather than simply α-synuclein fibrillization, is one of the major drivers of neuro-degeneration. Proceedings of the National Academy of Sciences USA, 117(9), 4971\u0026ndash;4982 . 10.1073/pnas.1913904117\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMan WK, De Simone A, Barritt JD, Vendruscolo M, Dobson CM, Fusco G (2020) A role of cholesterol in modulating the binding of α-Synuclein to synaptic-like vesicles. Front NeuroSci 14:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.3389/fnins.2020.00018\u003c/span\u003e\u003cspan address=\"https://doi:10.3389/fnins.2020.00018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoutinho M, Nunes MJ, Rodrigues E (2016) Cholesterol 24-hydroxylase: brain cholesterol metabolism and beyond. Biochim Biophys Acta 1861:1911\u0026ndash;1920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1016/j.bbalip.2016.09.011\u003c/span\u003e\u003cspan address=\"https://doi:10.1016/j.bbalip.2016.09.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurphy KE, Gysbers AM, Abbott SK, Tayebi N, Kim WS, Sidransky E, Cooper A, Garner B, Halliday GM (2014) Reduced glucocerebrosidase is associated with increased α-synuclein in sporadic Parkinson\u0026rsquo;s disease. Brain 137:834\u0026ndash;848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1093/brain/awt367\u003c/span\u003e\u003cspan address=\"https://doi:10.1093/brain/awt367\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeumann J, Bras J, Deas E, O\u0026rsquo;Sullivan SS, Parkkinen L, Lachmann RH, Li A, Holton J, Guerreiro R, Paudel R, Segarane B, Singleton A, Lees A, Hardy J, Houlden H, Revesz T, Wood NW (2009) Glucocerebrosidase mutations in clinical and pathologically proven Parkinson's disease. Brain 132 1783\u0026thinsp;\u0026ndash;\u0026thinsp;179. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1093/brain/awp044\u003c/span\u003e\u003cspan address=\"https://doi:10.1093/brain/awp044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNixon RA, Wegiel J, Kumar A, Yu WH, Peterhoff C, Cataldo A, Cuervo AM (2005) Extensive involvement of autophagy in Alzheimer disease: an immuno-electron microscopy study. J Neuropathol Exp Neurol 64:113\u0026ndash;122. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi 10.1093/jnen/64.2.113\u003c/span\u003e\u003cspan address=\"https://doi 10.1093/jnen/64.2.113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eN\u0026oacute;brega C, Mendon\u0026ccedil;a L, Marcelo A, Lamazi\u0026egrave;re A, Tom\u0026eacute; S, Despres G, Matos CA, Mechmet F, Langui D, den Dunnen W, de Almeida LP, Cartier N, Alves S (2019) Restoring brain cholesterol turnover improves autophagy and has therapeutic potential in mouse models of spinocerebellar ataxia. Acta Neuropathol 138:837\u0026ndash;858. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi 10.1007/s00401-019-02019-7\u003c/span\u003e\u003cspan address=\"https://doi 10.1007/s00401-019-02019-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eN\u0026oacute;brega C, Concei\u0026ccedil;\u0026atilde;o A, Costa RG, Koppenol R, Sequeira RL, Nunes R, Car-mo-Silva S, Marcelo A, Matos CA, Betuing S, Caboche J, Cartier N, Alves S (2020) The cholesterol 24-hydroxylase activates autophagy and decreases mutant huntingtin build-up in a neuroblastoma culture model of Huntington's disease. BMC Res Notes 13:210. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1186/s13104-020-05053-x\u003c/span\u003e\u003cspan address=\"https://doi:10.1186/s13104-020-05053-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan T, Kondo S, Le W, Jankovic J (2008) The role of autophagy-lysosome pathway in neurodegeneration associated with Parkinson\u0026rsquo;s disease. Brain 131:1969\u0026ndash;1978. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi\u003c/span\u003e\u003cspan address=\"https://doi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/brain/awm318\u003c/span\u003e\u003cspan address=\"10.1093/brain/awm318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerrin RJ, Woods WS, Clayton DF, George JM (2000) Interaction of Human α-Synuclein and Parkinson\u0026rsquo;s Disease Variants with Phospholipids. Vol. 275, No. 44, Issue of November 3, pp. 34393\u0026ndash;34398. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1074/jbc.M004851200\u003c/span\u003e\u003cspan address=\"https://doi:10.1074/jbc.M004851200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePolymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A et al (1997) Mutation in the α-synuclein gene identified in families with Parkinson's dis-ease. Science 276(5321):2045\u0026ndash;2047. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1126/science.276.5321.2045\u003c/span\u003e\u003cspan address=\"https://doi:10.1126/science.276.5321.2045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi Z, Wan M, Zhang J, Li Z (2023) Influence of Cholesterol on the Membrane Binding and Conformation of α-Synuclein. J. Phys. Chem. B 2023, 127, 9, 1956\u0026ndash;1964. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1021/acs.jpcb.2c08077\u003c/span\u003e\u003cspan address=\"https://doi:10.1021/acs.jpcb.2c08077\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRavikumar B, Vacher C, Berger Z, Davies JE, Luo S, Oroz LG, Scaravilli F, EastonDF, Duden R, O\u0026rsquo;Kane CJ, Rubinsztein DC (2004) Inhibition of mTOR induces autophagy and reduces toxicity of polyglutamine expansions in fly and mouse models of Huntington disease. Nat Genet 36:585\u0026ndash;595. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/ng1362\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/ng1362\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonzitti G, Bucci G, Emanuele M, Leo D, Sotnikova TD, Mus LV, Soubrane CH, Dallas ML, Thalhammer A, Cingolani LA, Mochida S, Gainetdinov RR, Stephens GJ, Chieregatti E (2014) Exogenous α-synuclein decreases raft partitioning of Cav2.2 channels inducing dopamine release. J Neurosci 34(32):10603\u0026ndash;10615. https://doi\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRussell DW, Halford RW, Ramirez DM, Shah R, Kotti T (2009) Cholesterol 24-hydroxylase: an enzyme of cholesterol turnover in the brain. Annu Rev Biochem 78:1017\u0026ndash;1040. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1146/annurev.biochem.78.072407.103859\u003c/span\u003e\u003cspan address=\"https://doi:10.1146/annurev.biochem.78.072407.103859\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarkar S, Perlstein EO, Imarisio S, Pineau S, Cordenier A, Maglathlin RL, Webster JA, Lewis TA, O\u0026rsquo;Kane CJ, Schreiber SL, Rubinsztein DC (2007) Small molecules enhance autophagy and reduce toxicity in Huntington\u0026rsquo;sdisease models. Nat Chem Biol 3:331\u0026ndash;338. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi:10.1038/nchembio883\u003c/span\u003e\u003cspan address=\"https://doi:10.1038/nchembio883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShahmoradian SH, Lewis AJ, Genoud C, Hench J, Moors TE, Navarro PP, Casta\u0026ntilde;o-D\u0026iacute;ez D, Schweighauser G, Graff-Meyer A, Goldie KN, S\u0026uuml;tterlin R, Huisman E, Ingrassia A, de Gier Y, Rozemuller AJM, Wang J, De Paepe A, Erny J, Staempfli A, Lauer ME (2019) Lewy pathology in Parkinson's disease consists of crowded organelles and lipid membranes. Nat Neurosci 22(7):1099\u0026ndash;1109. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41593-019-0423-2\u003c/span\u003e\u003cspan address=\"10.1038/s41593-019-0423-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSidransky E, Nalls MA, Aasly JO, Aharon-Peretz J, Annesi G, Barbosa ER, Bar-Shira A, Berg D, Bras J, Brice A, Ziegler SG (2009) Multicenter analysis of glucocerebrosidase mutations in Parkinson\u0026rsquo;s disease. N Eng J Med 361:1651\u0026ndash;1661. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1056/NEJMoa0901281\u003c/span\u003e\u003cspan address=\"10.1056/NEJMoa0901281\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) alpha-Synuclein locus triplication causes Parkinson's disease. Science 302(5646):841. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1090278\u003c/span\u003e\u003cspan address=\"10.1126/science.1090278\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTheofilopoulos S, Abreu de Oliveira WA, Yang S, Yutuc E, Saeed A, Abdel-Khalik J, Ullgren A, Cedazo-Minguez A, Bj\u0026ouml;rkhem I, Wang Y, Griffiths WJ, Arenas E (2019) 24(S),25-Epoxycholesterol and cholesterol 24S-hydroxylase (CYP46A1) overexpression promote midbrain dopaminergic neurogenesis in vivo. J Biol Chem 294(11):4169\u0026ndash;4176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.RA118.005639\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA118.005639\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Maarschalkerweerd A, Vetri V, Vestergaard B (2015) Cholesterol facilitates interactions between α-synuclein oligomers and charge-neutral membranes. FEBS Lett 589(19):2661\u0026ndash;2667. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2015.08.013\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2015.08.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVargas JY, Grudina C, Zurzolo C (2019) The prion-like spreading of alpha-synuclein: from in vitro to in vivo models of Parkinson\u0026rsquo;s disease. Ageing Res Rev 50:89\u0026ndash;101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.arr.2019.01.012\u003c/span\u003e\u003cspan address=\"10.1016/j.arr.2019.01.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVogiatzi T, Xilouri M, Vekrellis K, Stefanis L (2008) Wild type alpha-synuclein is degraded by chaperone-mediated autophagy and macroautophagy in neuronal cells. J Biol Chem 283(35):23542\u0026ndash;23556. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M801992200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M801992200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWebb JL, Ravikumar B, Atkins J, Skepper JN, Rubinsztein DC (2003) Alpha-Synuclein is degraded by both autophagy and the proteasome. J Biol Chem 278(27):25009\u0026ndash;25013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M300227200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M300227200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZambon F, Cherubini M, Fernandes HJR, Lang C, Ryan BJ, Volpato V, Bengoa-Vergniory N, Vingill S, Attar M, Booth HDE, Haenseler W, Vowles J, Bowden R, Webber C, Cowley SA, Wade-Martins R (2019) Cellular α-synuclein pathology is associated with bioenergetic dysfunction in Parkinson's iPSC-derived dopamine neurons. Hum Mol Genet 28(12):2001\u0026ndash;2013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hmg/ddz038\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddz038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Parkinson’s disease, CYP46A1, alpha-synuclein, autophagy, human neuroblastoma cells (SH-SY5Y)","lastPublishedDoi":"10.21203/rs.3.rs-4580957/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4580957/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA growing body of evidence suggests a correlation between cholesterol metabolism and the pathogenesis of Parkinson's disease (PD). We and others have demonstrated that the activation of the cholesterol 24-hydroxylase enzyme, CYP46A1, responsible for converting cholesterol to 24S-hydroxycholesterol (24-OHC) in the brain, is an effective therapeutic strategy for several neurodegenerative diseases as Alzheimer's disease, Huntington\u0026rsquo;s disease, spinocerebellar ataxia type 3. This approach has demonstrated that overexpression of CYP46A1 can reduce aggregated protein levels, enhance memory and cognitive performance, and improve motor phenotype in animal models. Nevertheless, there is still much to be illuminated regarding the role of CYP46A1 in PD. Alpha-synuclein (alpha-syn), the hallmark pathological protein of PD, exhibits a pronounced affinity for binding to lipid membranes, especially in cholesterol-rich regions and contains a high-affinity cholesterol-binding motif in the 67\u0026ndash;78 aa region. In this study, we demonstrate that overexpression of human CYP46A1 leads to a decreased expression of wild-type alpha-syn proteins in human neuroblastoma SH-SY5Y cells through the autophagy-lysosomal pathway. Additionally, our findings suggest that CYP46A1 may also decrease the levels of alpha-syn proteins overexpressed with mutations in the cholesterol-binding domain or at the residue A53T, which is associated with familial pathology. Moreover, CYP46A1 retains its functionality in a cellular model of PD associated with GBA1. The gene GBA1 is involved in lipid metabolism, and its deficiency represents the most prevalent genetic factor associated with an elevated risk of PD. These results provide insights into disease pathogenesis and potential therapeutic pathways that could benefit patients with PD.\u003c/p\u003e","manuscriptTitle":"The cholesterol 24-hydroxylase enzyme, CYP46A1, reduces overexpressed alpha-synuclein proteins in human cellular models of Parkinson’s disease.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-03 16:15:27","doi":"10.21203/rs.3.rs-4580957/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9b585ebd-e9ee-4cc2-b054-c2d340bab470","owner":[],"postedDate":"July 3rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-01T13:57:51+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-03 16:15:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4580957","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4580957","identity":"rs-4580957","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}