Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways

Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways Zhihong Liao, Xuanshu He, Anqi Chen, Jian Zhong, Sihan Lin, Yucai Guo, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4337374/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Sep, 2024 Read the published version in Cell & Bioscience → Version 1 posted 5 You are reading this latest preprint version Abstract Background Astaxanthin (ASX) has been documented to exert beneficial influence on various processes in fish. Largemouth bass serves as a common model for studying glucose-induced liver disease, making it imperative to investigate the regulatory mechanisms underlying its liver health. Methods Largemouth bass were fed with a control diet (CON), a high carbohydrate diet (HC), or a HC diet supplemented astaxanthin (HCA) for 8-weeks, followed by the glucose tolerance test (GTT). Primary hepatocytes were treated with low glucose and high glucose combined with different concentrations of astaxanthin for 48 h. The histopathology, enzymology, transcriptomics, molecular biology and cell biology were combined to investigate the mechanism of liver injury. Results This study provides evidence for the protective effects of ASX against growth performance reduction and hepatic liver injure in largemouth bass fed HC diet. In GTT, HCA diet exhibited an improvement in glucose tolerance following glucose loading. Although HCA diet did not restore the expression of insulin resistance-related genes in livers at different time during the GTT, the addition of ASX in the long-term diet did improve the insulin resistance pathway by regulating the PTP1B/PI3K/Akt signaling pathway. Hepatic transcriptome analyses showed that ASX plays an essential role in the modulation of glucose homeostasis in response to treatment with HC diet. In in vitro study, the treatment with ASX resulted in an exaltation in cell viability and a reduction in the rate of cell apoptosis and reactive oxygen species (ROS). Additionally, astaxanthin was observed to improve apoptosis induced by high-glucose via p38MAPK/bcl-2/caspase-3 signaling pathway. Conclusions Astaxanthin exhibited a protective effect against apoptosis by regulating p38MAPK/bcl-2/caspase-3 pathway, and ameliorated insulin resistance by activating the PTP1B/PI3K/Akt pathway. This study elucidated the mechanism of astaxanthin in the liver injury of largemouth bass from a new perspective and provided a new target for the treatment of insulin resistance. Astaxanthin largemouth bass liver injury Apoptosis insulin resistance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Carbohydrates are commonly incorporated into aquafeed due to their cost-effectiveness and their ability to enhance feed expansion properties [ 1 , 2 ]. However, different fish species have different capacities for utilizing carbohydrates, with carnivorous fish exhibiting lower utilization rates compared to herbivorous counterparts. Consequently, excessive dietary carbohydrate intake can lead to various detrimental effects in carnivorous fish. There is a wide cultivation of the largemouth bass ( Micropterus salmoides ) worldwide for its role as a representative carnivorous fish. Multiple studies have indicated that the commercial diet of largemouth bass contains a maximum of 10% starch [ 3 , 4 ]. In order to investigate glucose-induced liver disease, largemouth bass have been used as a representative model. The glucose tolerance test (GTT) is widely used to assess the ability of fish to utilize glucose [ 5 , 6 ]. Carnivorous fish exhibit a notable resistance to insulin and glucose in relation to carbohydrate metabolism, resulting in an elevation of blood glucose concentration with higher starch consumption [ 7 ]. Insulin has an essential part in the maintenance glucose of homeostasis in mammals. Numerous studies have indicated that inadequate insulin secretion is the major cause of such glucose intolerance in fish [ 8 ]. Nevertheless, the available data on the relationship between a GTT and the regulatory process of insulin and glucose metabolism in carnivorous fish is scarce. Astaxanthin exhibits potent antioxidant properties and has the ability to modulate AMPK and MAPK signaling pathways, thereby ameliorating liver insulin resistance [ 9 ]. Arunkumar et al. [ 10 ] demonstrated that astaxanthin enhances post-receptor insulin signaling events by promoting IR-β/PI3K/Akt signal pathway. Nevertheless, the specific mechanisms through which astaxanthin improves insulin sensitivity remain unexplored at the molecular level in carnivorous fish. The liver serves multiple functions, including nutrient metabolism, detoxification, deposition, and immunity [ 11 , 12 , 13 ]. Excessive nutrient intake can consequently result in liver damage. Further examination of the relationship between liver disorders and dietary starch in fish species is of utmost importance. In largemouth bass aquaculture, dietary starch levels have been found to significantly impact the structure of largemouth bass livers [ 4 ]. Feeding commercial feed containing 10% starch level to largemouth bass resulted in hepatocyte vacuolation and fibrosis, which further increased the level of inflammation and apoptosis [ 14 ]. Although there has been extensive research on the effects of consuming a large amount of carbohydrates on largemouth bass, the majority of these studies have focused on factors such as growth, damage to liver tissue, and the metabolism of glycolipids in the liver [ 15 , 16 ]. Until now, the precise molecular mechanisms underlying liver damage resulting from high carbohydrate consumption remain unclear. Therefore, it is imperative to investigate dietary approaches that can mitigate the adverse influences of high-starch diets, particularly on the liver well-being of largemouth bass. In aquaculture, astaxanthin has been widely adopted for use for its antioxidant properties and for enhancing pigmentation and stress resilience. Studies have demonstrated the ability of astaxanthin to mitigate liver inflammation and fibrosis caused by nonalcoholic steatohepatitis in mice [ 17 ]. Furthermore, astaxanthin has been found to relieve liver endoplasmic reticulum stress and inflammation in mice fed a diet containing high fructose and high fat [ 18 ]. Studies have shown that astaxanthin may be useful in preventing diabetic complications and reversing hepatotoxicity in adult rats [ 19 ]. Consequently, astaxanthin may be an effective way to treat liver oxidative damage, improve metabolism, and reduce liver inflammation. In a prior investigation, we exhibited that astaxanthin enhanced the ability to counteract oxidation, performance in growth, and immune reaction in largemouth bass that were fed a high-fat diet [ 20 ]. Building upon these findings, the objective of this research is to investigate the effects of astaxanthin on high carbohydrate induced insulin resistant and liver damage in largemouth bass. Furthermore, we will delve deeper into the anti-apoptotic properties of astaxanthin on the protein level, which would be helpful to the understanding of its regulation mechanism in vivo and give a new direction for studies on astaxanthin in aquatic feed. Materials and methods Experimental diets Astaxanthin abundance in high-carbohydrate diets was determined from previous studies [ 14 ]. As shown in Table 1 , three purified isonitrogenous and isolipidic diets were designed and formulated: including a control (CON) diet, a high-carbohydrate (HC) diet and a HC supplemented with 0.1% Lucantin Pink CWD (BASF, Shanghai, China) containing 10% (w/w) astaxanthin (HCA) diet. In all diets, the main source of carbohydrate was corn starch. Bone meal was used for eliminating the difference of quantity caused by corn starch. The experimental diets were conducted using the previously reported method [ 21 ]. Further details can be found in Supplemental Methods. Table 1 Ingredients and nutrient composition of the experimental diets (% dry matter) Ingredients CON HC HCA Corn starch 0 20 20 Fish meal 45 45 45 Krill meal 3 3 3 Beer yeast 5 5 5 Soybean meal 10.3 10.3 10.2 Wheat gluten 10 10 10 Fish oil 1 1 1 Soy oil 1 1 1 Soya lecithin 1 1 1 Mineral premix 1 1 1 1 Vitamin premix 2 1 1 1 Choline chloride (50%) 0.5 0.5 0.5 Monocalcium phosphate 1 1 1 Vitamin C 0.2 0.2 0.2 Bone meal 20 0 0 Lucantin Pink CWD 3 0 0 0.1 Sum 100 100 100 Nutrient composition Crude protein 47.92 48.66 47.90 Crude lipid 6.66 6.68 6.71 1 Mineral premix provides the following per kg of diet: MgSO 4 ∙7H 2 O, 1090 mg; KH 2 PO 4 , 932 mg; NaH 2 PO 4 ∙2H 2 O, 432 mg; FeC 6 H 5 O 7 ∙5H 2 O, 181 mg; ZnCl 2 , 80 mg; CuSO 4 ∙5H 2 O, 63 mg; AlCl 3 ∙6H 2 O, 51 mg; MnSO 4 ∙H 2 O, 31mg; KI, 28 mg; CoCl 2 ∙6H 2 O, 6 mg; Na 2 SeO 3 ∙H 2 O, 0.8 mg. 2 Vitamin premix provides the following per kg of diet: Vitamin B1, 30 mg; Vitamin B2, 60 mg; Vitamin B6, 60 mg; Nicotinic acid, 200 mg; Calcium pantothenate, 100 mg; Inositol, 100 mg; Biotin, 2.5 mg; Folic acid, 10 mg; Vitamin B12, 0.1 mg; Vitamin K3, 40 mg; Vitamin A, 10000IU, Vitamin, 160 IU. 3 Lucantin Pink CWD of 10% (w/w) astaxanthin content provided from BASF, Shanghai, China. Sample collection Juvenile largemouth bass were obtained from Shunye Fishery Company (Foshan, China). More details of experiment design and feeding management can be found in Supplemental Methods. Sampling was performed after 8-week feeding trial, all fish were fasted for 24 h prior to sampling. 12 fish from each diet (4 fish per tank) were randomly chosen and measured the body length and weight. In order to prepare serum, caudal vertebral vein blood was sampled using a sterile syringe, then centrifuged at 4000 g for 10 min at 4°C. The serum was immediately stored at -80°C to preserve it for future use. For future analyses, the dissected tissues (liver, heart, brain, intestine, head kidney) were also immediately frozen in liquid nitrogen and then kept at -80°C. For more details on growth performance and morphology parameters, see Supplemental Methods. Glucose tolerance test (GTT) The GTT method described by Chen et al. [ 22 ], blood of largemouth bass from three diet treatment was separately collected from the caudal vein. More details of glucose tolerance test can be found in Supplemental Methods. Transcriptomic analysis Nine liver samples of largemouth bass fed with CON, HC and HCA diets were prepared for transcriptomic analysis. RNA integrity was measured by using the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). More details of transcriptomic analysis can be found in Supplemental Methods. Histopathological studies Liver tissues were fixed in neutral 4% formalin (Servicebio, China) and embedded in paraffin wax. Hematoxylin and eosin (H&E) staining and periodic acid-schiff (PAS) staining were conducted according to the standard protocol. Light microscopy was used to observe and photograph histopathological lesions (NikonNi–U, Nikon Corporation, Tokyo, Japan). For the transmission electron microscopy observations, livers were fixed in 2.5% glutaraldehyde (AAPR46) and rinsed with buffer. To observe the various structures within stained cells, a transmission electron microscope (JEM-1400 Flash, Japan) was used. Biochemical analysis Measurements of serum glucose were performed using glucose oxidase kit (A154-1-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The corresponding reagent kits (C009-2-1 and C010-2-1, respectively; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were utilized for measuring serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT). The measurement of serum insulin level was conducted with a commercially available Elisa kit (ml0258550; Shanghai Enzyme-linked Biotechnology Co., Ltd., China). Western blot and quantitative real-time PCR (RT-PCR) The livers and cells were used to harvest and extract total protein by utilizing RIPA lysis buffer (FD009; Fdbio science, Hangzhou, China) along with a mixture of protease inhibitor and phosphatase inhibitor cocktail (FD1002; Fdbio science, Hangzhou, China). To measure the amount of total protein, a BCA assay (KS134848; Thermo, Scientific, Waltham, MA, USA) was employed. All details of primary antibodies can be found in Supplemental Methods. The PVDF filters were rinsed and treated with anti-rabbit (SA00001-2; Proteintech, United States, diluted 1:10000) secondary antibody for 1 h at ambient temperature. The Azure 300 ultra-sensitive chemiluminescence imager was utilized to visualize the protein bands. The levels of protein were standardized by β-actin and measured using the Image-Pro Plus software. The extraction of total RNA and the synthesis of cDNA were performed following the previously described protocol [ 23 ]. A gene responsible for maintaining the cleanliness of a house, known as elongation factor 1a ( ef-1α ; GenBank accession no. KT827794), was normalized as an internal reference. Table 2 displays the gene-specific primers utilized for largemouth bass mRNA. The qPCR examination was conducted in a 10 µL reaction volume using a Light Cycler 480II Real-Time System from Roche, located in IN, USA. The qPCR protocol started with a 10 min incubation at 95°C, followed by 40 cycles consisting of 5 sec at 95°C, 30 sec at 60°C, and 30 sec at 72°C. Additionally, the reaction quality was assessed by analyzing standard melting curves. The 2 −ΔΔCt method was used to calculate qPCR data for each sample. Table 2 Sequences of primers used in this study Genes Forward primers (5’ to 3’) Reverse primers (5’ to 3’) Sources/GenBank No. tnf-α CTTCGTCTACAGCCAGGCATCG TTTGGCACACCGACCTCACC [ 50 ] il-6 GACCAGCAGCCAGGAGGA GGAGGTTGTACACGATGCTG [ 50 ] il-8 CGTTGAACAGACTGGGAGAGATG AGTGGGATGGCTTCATTATCTTGT [ 50 ] il-10 CGGCACAGAAATCCCAGAGC CAGCAGGCTCACAAAATAAACATCT [ 50 ] cat ATCCCTGTGGGCAAAATGGT CGGTGACGATGTGTGTCTGG XM_038704976.1 gsh-px GGGGCTCCACCTGCTTCTTG ACCCCTCTGCTCAGGCATTT MK614713.1 sod1 TGGCAAGAACAAGAACCACA CCTCTGATTTCTCCTGTCACC XM_038708943.1 caspase-3 GCTTCATTCGTCTGTGTTC CGAAAAAGTGATGTGAGGTA [ 50 ] caspase-8 GAGACAGACAGCAGACAACCA TTCCATTTCAGCAAACACATC [ 50 ] caspase-9 CTGGAATGCCTTCAGGAGACGGG GGGAGGGGCAAGACAACAGGGTG [ 50 ] bcl-2 TGCCTTTGTGGAGCTGTATG GGAAGAGGAGGAGGAGGATG [ 50 ] bax TCTTCACTCAGTCCCACAAA ATACCCTCCCAGCCACC XM_038704178.1 bad CACATTTCGGATGCCACTAT TTCTGCTCTTCTGCGATTGA XM_038730645.1 ir CATTTTGAGGGAACTGGGTC CTTGATGATGTCTTTAGCGA [ 50 ] irs1 TAGTGGTGGTGTCAGCGGT GGAGGTGGAAGTAAAGGAT MT431531 pi3kr1 AAGACCTTCCTCATCACGAC CCTTCCACTACAACACTGCA Cluster-21914.23096 ef-1α TGCTGCTGGTGTTGGTGAGTT TTCTGGCTGTAAGGGGGCTC KT827794.1 Culture of largemouth bass primary hepatocytes Largemouth bass primary hepatocytes were isolated and cultured as follows: briefly, the livers were minced as small as possible with surgical scissors under sterile conditions, and washed thoroughly with pre-warmed phosphate-buffered saline (PBS) to remove the blood and other components. The rinsed livers were enzymatically digested using trypsin (25200072; Thermo Fisher Scientific, Waltham, MA, USA) at 28°C for 40 min. Centrifuge the cells after 6 min at 1000 rpm, discard supernatant, and resuspend harvested cell pellet in low-glucose medium containing 20% FBS and 1% penicillin-streptomycin. The isolated hepatocytes were seeded at a density of 1×10 6 cells/mL and cultured in a humidified 28°C incubator with 5% CO 2 . When the confluence reached 70–80%, the treated cells were divide into six groups: (1) LG, treated with low-glucose for 48 h; (2) HG, treated with high-glucose for 48 h; (3) HG + 10 µM ASX, treated with 10 µM astaxanthin and high-glucose for 48 h; (4) HG + 20 µM ASX, treated with 20 µM astaxanthin and high-glucose for 48 h; (5) HG + 30 µM ASX, treated with 30 µM astaxanthin and high-glucose for 48 h; (6) HG + 50 µM ASX, treated with 50 µM astaxanthin and high-glucose for 48 h. Astaxanthin (S3834; Selleck Chemicals, Houston, Texas, USA) was added at the start of low or high glucose culture and remained present throughout the experiment. The cells were pretreated with various concentrations of SB203580 (p38 MAPK pathway inhibitor; S1076, Selleck Chemicals, Houston, Texas, USA) for 2 h, then treated with low or high glucose culture for 48 h. CCK8 assay Six replicates of primary hepatocytes were seeded in a 96-well culture plate at a density of 1×10 4 cells/mL. Subsequently, the cells were exposed to different concentrations of astaxanthin in combination with a glucose solution. Cell viability was assessed after incubating for either 24 or 48 h using a CCK8 assay (FD3788; Fdbio science, Hangzhou, China), following the guidelines provided by the manufacturer. Annexin V-FITC/PI staining Flow cytometry was used to examine apoptosis by employing annexin V-FITC/PI staining (BL110A; Biosharp life science, Beijing, China). Cells (1×10 6 ) were seeded in 6-well plates and exposed to glucose and astaxanthin for 48 h. Afterward, the cells were digested by trypsin without EDTA and washed twice with chilled PBS. Finally, they were suspended in 100 µL of binding buffer. The cells were stained with Annexin V-FITC (5 µL) for 10 min at room temperature, followed by 10 µL PI for 5 min in the dark. Flow cytometry (Backman cytoflex) was used to analyze the cells. ROS detection ROS formation within the cell was identified by utilizing the H2DCF-DA probe (C-2938; Invitrogen™, Waltham, MA, USA), which is a 6-carboxy-2’, 7’-dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester). After being pretreated with LG, HG, and astaxanthin for 48 h, the primary hepatocytes (1×10 6 ) were collected and resuspended in serum-free DMEM with 15 µM H2DCF-DA. The harvested primary liver cells were incubated at a temperature of 28°C for a duration of 30 min and subsequently analyzed using flow cytometry (Backman cytoflex). Immunofluorescence analysis Cells were seeded in a 20-mm laser confocal culture dish (cat. no. BDD012035) and treated with LG, HG and HGA for 48 h. More details of immunofluorescence analysis can be found in Supplemental Methods. Statistical analysis To analyze data on serum parameters in the GTT, a two-way ANOVA was employed to examine variations in treatment means considering sampling time, dietary treatments, and their interaction. If there were significant differences ( P < 0.05) observed in the interaction, each factor was subsequently analyzed individually using one-way analysis of variance (ANOVA). Means ± SEM, calculated from 3–6 replication, were used to present additional data. The comparison of variables between the two treatments was done by the student’s t-test. * P < 0.05, ** P < 0.01 and *** P < 0.001 were established to indicate statistical difference. GraphPad Prism 8.0 (GraphPad, USA) was responsible for creating all visual elements. Results Astaxanthin improved growth performance in high carbohydrate-fed largemouth bass Following an 8-week feeding trial, the impact of astaxanthin on the growth performance of largemouth bass was depicted in Fig. 1 . The HC diet exhibited significantly lower WG, survival, and SGR compared to the CON diet, but the inclusion of astaxanthin considerably increased these 3 parameters ( P < 0.01). In this study, CF, VSI and HSI exhibited a consistent trend, indicating a significant effect of HC diet ( P < 0.01). This suggests that HC diet had an evident effect on the HSI of largemouth bass, resulting in liver damage. Furthermore, the VSI and HSI of largemouth bass fed HCA diet were considerably lower in comparison with those fed the HC diet ( P < 0.01). These findings collectively demonstrate that astaxanthin supplementation improved the growth performance of largemouth bass that were fed a high-carbohydrate diet. Astaxanthin reduced the elevated glucose tolerance in high carbohydrate-fed largemouth bass and alleviated insulin resistance through the PTP1B/PI3K/Akt signaling pathway The findings illustrated in Fig. 2 A indicate that the levels of glucose in the serum were significantly affected by the time of sampling, the treatments given in the diet, and the interaction between them ( P < 0.001). In particular, the introduction of glucose resulted in a notable rise in serum glucose levels, reaching its highest point after 1 h of injection. Afterwards, the levels of glucose in the serum decreased gradually ( P < 0.001) until it reached the initial value after 12 h. The area under the curve (AUC) in different diet could tell the potent of blood glucose tolerance. The HC diet showed a significantly lower AUC value, while the AUC value of HCA diet was higher than HC diet, indicated that astaxanthin improved glucose tolerance. The results (Fig. 2 B and C) showed that HCA diet could lead a reduction in serum glucose level and a rise in serum insulin level compared with the HC diet ( P < 0.001 and P < 0.05). The effects of HCA diet were close to the CON diet, which reduced the serum glucose and increased the serum insulin significantly ( P < 0.001 and P < 0.05). These results proved that astaxanthin could ameliorate the insulin resistance caused by high carbohydrate diet. In this study, we conducted a comparison of the expression of insulin resistance genes at different periods of glucose injection. With the increase in the glucose injection time, it can be seen that ir , irs1 and insulin presented an overall trend of increasing first and then decreasing, while pi3kr1 presented obvious decreasing first and then increasing (Fig. 2 D). To this end, we compared the relative expression of insulin resistance genes in different diets in the same time after glucose injection. After 1 h of injection, the results indicated that HC diet led to a rise in mRNA level of ir and irs1 and a reduction in mRNA level of pi3kr1 , and insulin expression was not affected by diet treatments (Fig. 2 E). After 3 h following glucose injection, pi3kr1 mRNA level was increased in HC diet, while the expression of ir , irs1 and insulin were not altered (Fig. 2 F). At hour 12 after glucose injection, HC diet reduced liver mRNA level of ir , irs1 and pi3kr1 , while promoted liver mRNA level of insulin (Fig. 2 G). Surprisingly, HCA diet did not restore these gene expressions in livers at different time during the GTT. In an 8-week feeding trail, HC diet led to a rise in the protein levels of PTP1B, while simultaneously suppressed the phosphorylation of Akt. On the other hand, HCA diet caused a notable reduction in the protein levels of PTP1B, while leading to an increase in the protein levels of p-Akt/Akt (Fig. 2 H). The results indicate that astaxanthin has a direct impact on the signaling pathway of PTP1B/PI3K/Akt in the liver. Hence, the PTP1B/PI3K/Akt signaling pathway was directly influenced by astaxanthin. Real-time PCR analysis indicated a notable reduction in pi3kr1 and insulin mRNA expression levels in HC diet, whereas a considerable rise was observed in HCA diet. Importantly, we did not observe a significant effect on the expression of ir and irs1 genes among all treatments (Fig. 2 I). Astaxanthin altered the hepatic gene expression pattern of largemouth bass To further elucidate and explain the gene expression patterns of largemouth bass fed with four diets, transcriptome profiles were performed by RNA-seq analysis. In total, 3800 differentially expressed genes (DEGs) were identified between HC and CON diets, including 1329 up-regulated and 2471 down-regulated (Fig. 3 A). 726 DEGs were identified between HCA and HC diets, of which 453 were upregulated and 273 were downregulated (Fig. 3 B). The first 30 enriched Gene Ontology (GO) terms of DEGs between HC and CON diets were shown in Fig. 3 C, the most enriched GO terms of DEGs in HC include cofactor binding, enzyme regulator activity, enzyme inhibitor activity and peptidase regulator activity. When HCA diet compared with HCA (Fig. 3 D), the most enriched GO terms of DEGs in HCA include apoptotic process, cell death programmed cell death and lipid metabolic process. Next, a KEGG enrichment analysis was conducted on the DEGs among CON, ASX, HC and HCA diets. The results revealed that 20 signaling pathways were significantly enriched between HC and CON diets, including those related to carbon metabolism, cytokine-cytokine receptor interaction, oxidative phosphorylation and glycolysis/gluconeogenesis (Fig. 3 E). Furthermore, compared to HC diet, the DEGs were enriched in pathways such as steroid biosynthesis, regulation of actin cytoskeleton, glycolysis/gluconeogenesis and FoxO signaling pathway in HCA diet (Fig. 3 F). Astaxanthin alleviated liver damage by improving apoptosis, inflammation and oxidative stress in high carbohydrate-fed largemouth bass Inflammatory cells, ballooning, and liver vacuolization were observed in the liver of largemouth bass that were fed HC diet, as indicated by H&E staining. However, the inclusion of astaxanthin effectively alleviated these symptoms, as depicted in Fig. 4 A According to the PAS staining results (Fig. 4 B), largemouth bass fed HC diet had a large accumulation of glycogen in livers, which had been reduced by astaxanthin administration. Moreover, the ultramicroscopic characteristics and structure of the livers were further visualized using transmission electron microscopy (TEM). The mitochondria of largemouth bass that were fed CON diet exhibited structural integrity, characterized by well-organized cristae, distinct inner and outer mitochondrial membranes (Fig. 4 C). In contrast, largemouth bass that were given a HC diet showed noticeable harm to their mitochondria, such as enlargement and distortion, and a large glycogen accumulation Notably, the administration of astaxanthin demonstrated a mitigating effect on the mitochondrial damage induced by HC diet. The qPCR was employed to investigate whether HC diet activated apoptotic pathways dependent on death receptors or mitochondria. For this objective, the measurement of gene expression levels in the caspase family was conducted. Compared to CON diet, there was a notable increase in the levels of caspase-3 and caspase-9 , whereas the levels of caspase-8 remained unchanged in HC diet (Fig. 4 D). Afterward, we proceeded to examine the expression of different genes related to the Bcl-2 family. As depicted in Fig. 4 E, HC diet up-regulated bax and bad , while downregulated bcl-2 . Importantly, these effects were effectively reversed by astaxanthin. The findings clearly indicated that astaxanthin effectively shielded largemouth bass from mitochondrial-dependent apoptosis caused by HC diet. The qPCR analysis also revealed that astaxanthin effectively impaired inflammatory factors expression ( tnf-α, il-6 and il-8 ) and increased the expression of il-10 associated with inflammation induced by high carbohydrate intake, as shown in Fig. 4 F. Meanwhile, the HC diet was found to significantly downregulate the expression of antioxidant capacity genes ( cat and sod1 ), importantly, these effects were effectively reversed by HCA diet (Fig. 4 G). In addition, the results indicated that the increase of serum ALT and AST activities induced by HC diet was reduced by HCA diet (Fig. 4 H and I). Astaxanthin suppressed HG-induced apoptosis in largemouth bass primary hepatocytes To further investigate the advantageous mechanism of astaxanthin in largemouth bass, primary hepatocytes were treated with low glucose (LG) or high glucose (HG) conditions, along with varying doses of astaxanthin (10–50 µM). Cell viability was assessed using CCK8 assays (Fig. 5 A), revealing that astaxanthin effectively ameliorated the decline in cell viability caused by HG treatment over a 48-h period, with the most significant improvement observed at concentrations of 30 or 50 µM. The proportion of total injured cells was measured using annexin V-FITC/PI staining, based on this, it was found that primary hepatocytes treated with astaxanthin exhibited a lower proportion of injured cells compared to those not treated ( Fig. 5 B). The results demonstrated that treatment with HG resulted in approximately 22% cell death in primary hepatocytes. Flow cytometry was employed to measure ROS production, which demonstrated that HG treatment led to an increase in ROS levels compared to LG treatment, whereas astaxanthin treatment showed a concentration-dependent decrease in ROS production (Fig. 5 C), with the most pronounced effect observed at a concentration of 50 µM. Nevertheless, the existence of astaxanthin at levels of 30 or 50 µM considerably increased the rate of cell viability. Consequently, further investigation utilized a concentration of 50 µM astaxanthin (named HGA). Astaxanthin improved apoptosis induced by high-glucose via p38MAPK/bcl-2/caspase-3 signaling pathway The significance of the mitogen-activated protein kinase (MAPK) signaling pathway in apoptosis has been highlighted [ 24 ]. This pathway encompasses the ERK, JNK, and p38MAPK pathways, which are known to be crucial in various biological processes such as inflammation, cellular growth, and stress response [ 25 ]. In order to elucidate the impact of astaxanthin treatment on the MAPK pathway, western blotting was conducted in vitro model. The findings of this study indicate that HG treatment leads to the activation of ERK, JNK, and p38MAPK phosphorylation. Conversely, HGA treatment inhibits the phosphorylation of p38 MAPK, but not ERK and JNK. Additionally, HG treatment results in an increase in protein expression of CAS3, whereas HGA treatment blocks this increased expression (Fig. 6 A). The p-p38 fluorometric assay demonstrated that the heightened fluorescent intensity of p-p38 in HG treatment was reversed by treatment with astaxanthin (Fig. 6 B). Thus, we ensured that astaxanthin significantly inhibited the p38MAPK signal pathway. As an inhibitor of the p38MAPK signaling pathway, stimulation with SB203580 significantly inhibited the phosphorylation level of p38MAPK. In this study, pretreatment with SB203580 significantly inhibited CAS3 expression at the gene and protein levels (Fig. 6 C and D). Furthermore, this effect was significantly enhanced by the addition of astaxanthin. The gene expression levels of bcl-2 and bad were significantly altered in cells treated with HG and HGA, in the presence of SB203580, whereas there were no notable differences observed in the expression of bax and caspase-9 . These findings suggest that astaxanthin may hinder apoptosis induced by high glucose through the p38MAPK/bcl-2/caspase-3 signaling pathway, thereby proposing a novel function for p38MAPK in the regulation of astaxanthin-mediated apoptosis. Discussion Earlier studies have successfully shown the limited use of glucose in largemouth bass, where an excessive intake of carbohydrates had a detrimental impact on their growth and overall health [ 26 , 3 , 27 ]. In the present investigation, largemouth bass subjected to excessive carbohydrate intake exhibited a notable decline in WG, survival, and SGR. Recent research has increasingly revealed the multifaceted benefits of astaxanthin in aquatic animals, including growth promotion, antioxidation, stress reduction, immune enhancement, and inflammation alleviation. In this study, the supplementation of astaxanthin led to an improvement of growth performance in largemouth bass fed HC diet. The inclusion of astaxanthin with a concentration of 0.01% had notable beneficial effect on the growth of Trachinotus ovatus when fed a high-fat diet [ 28 ]. Nevertheless, there was no notable disparity in the developmental progress of Oncorhynchus mykiss when exposed to a 0.05% ASX concentration [ 29 ]. A prior investigation has demonstrated that astaxanthin alleviated the obesity caused by a high-fat diet in mice [ 30 ]. CF and VSI were employed as indicators of fish fatness [ 31 , 32 , 33 ], and our findings showed that the inclusion of astaxanthin effectively reduced the increase in CF and VSI in largemouth bass fed with HC diet. Generally speaking, the elevation of serum insulin level was the primary physiological response to a rise in plasma glucose levels during the GTT test [ 34 ]. This study confirmed the phenomenon of glucose intolerance in largemouth bass, characterized by higher levels of serum glucose during a GTT, which consistent with the discoveries of prior research [ 8 , 35 ]. In the present study, HC diet leads to increased serum glucose levels and decreased plasma insulin levels, which indicated a reduced sensitivity to insulin, which may be caused by insufficient insulin secretion or insulin resistance. RNA-seq analysis of largemouth bass indicated that both HC and HCA diets caused significant impacts on glycolysis/gluconeogenesis pathways. This suggests that astaxanthin plays an essential role in the modulation of glucose homeostasis in response to treatment with HC diet. Similar to other vertebrates, insulin plays a crucial role in the regulation of glycolysis and gluconeogenesis processes in fish [ 36 , 22 ]. Our study demonstrated that astaxanthin enhances systemic glucose tolerance and reduces serum insulin levels, but, it did not alter expression of insulin resistance genes in the liver during the GTT. Arguably, astaxanthin is likely to be different in different organs, or perhaps at different time in the same organ. Insulin primarily exerts its metabolic effects in the liver via the PI3K/Akt signaling pathway. Insulin resistance may occur when there is a dysfunction in this communication pathway within liver tissues. Previous research has demonstrated that AST has the ability to mitigate growth, decrease oxidative stress, enhance insulin sensitivity, and activate the IRS/PI3K/Akt signaling pathway in mice fed a high-fat and high-fructose diet [ 9 , 10 ]. Ezzat et al. [ 37 ] have identified PTP1B as a possible treatment target for diabetes, functioning as a suppressor of the insulin signaling pathway. In the current study, we present provide evidence for the initial instance to indicate that astaxanthin upregulated pi3kr1 mRNA expression and downregulated PTP1B protein expression level. Notably, astaxanthin exhibited an enhancement in Akt phosphorylation. Presumably, astaxanthin could potentially assume a crucial role in HC fed largemouth bass by reinstating insulin secretion and insulin sensitivity. Moreover, this research offers the preliminary validation that astaxanthin efficiently controls the PTP1B/PI3K/Akt signaling cascade in the liver. Although insulin promotes glycogen synthesis by suppression of GSK3 kinase, the role of this regulatory pathway is very limited [ 38 ]. Li et al. found a GSK3-independent insulin-stimulated glycogen synthesis pathway in mice [ 39 ]. However, more research is needed to determine the specific mechanism. Histopathological examinations revealed that astaxanthin supplementation effectively ameliorated liver vacuolization, excessive accumulation of liver glycogen and induced by the HC diet, which indicated that inflammation was induced by a high carbohydrate feed in largemouth bass. Additionally, the activities of serum AST and ALT were notably reduced, indicating that astaxanthin indeed alleviated liver injury in largemouth bass subjected to the HC diet. Astaxanthin has been widely studied and acclaimed as a powerful antioxidant and anti-inflammatory agent under certain pathological conditions [ 40 ]. When the liver becomes damaged, hepatocytes secrete excessive amounts of inflammatory factors, such as tnf-α , il-1β , il-6 and il-8 etc. [ 41 ]. In the present study, tnf-α , il-6 and il-8 increased, and il-10 expression decreased in HC diet, whereas, astaxanthin has the ability to improve the high-carbohydrate induced hepatic inflammation. On the other hand, HC diet finally induced a reduction on mRNA levels cat and sod1 in the liver of largemouth bass, which indicated that HC diet would breakdown the antioxidant system, resulting in weak antioxidant capacity of the liver. Similarly, astaxanthin dietary supplementation recovery the liver redox state. In this study, GO analysis showed that astaxanthin plays an important role in regulating the signaling pathways of apoptosis and programmed death. Programmed cell death, also referred to as apoptosis, consists of two primary routes: the intrinsic pathway, which engages the mitochondria, and the extrinsic pathway, which involves death receptors [ 42 ]. Activation of executioner caspase-3 occurs in both pathways [ 43 ]. Upon activation of the intrinsic pathway, the pro-apoptotic proteins Bax and Bad in the Bcl-2 family were increased, while the anti-apoptotic proteins Bcl-2 was decreased, resulting in an imbalance in the Bax to Bcl-2 ratio [ 44 ]. The utilization of RT-PCR analysis revealed that the stimulation of HC diet caused the increase of c aspase-3 , caspase-9 and bad expressions, and concurrently reduced the expression of bcl-2 . However, the administration of astaxanthin effectively restored the expression levels of these genes to their normal levels. These findings unequivocally demonstrate that astaxanthin serves as a protective agent for largemouth bass against HC diet. The existing scholarly investigations pertaining to the impact of excessive carbohydrate consumption on largemouth bass primarily concentrate on transcript levels, enzyme activity, and metabolites at the individual level [ 14 , 45 ]. However, there is a scarcity of literature regarding the examination at the cellular level. Afterwards, we utilized primary hepatocytes cultured in a high glucose setting as a representation to evaluate the changes caused by astaxanthin on cell growth and cell death. Our findings indicate that astaxanthin exhibited a significant ability to enhance cell survival and reduce the rate of apoptosis in a dose-dependent manner. Under typical cellular circumstances, the production and removal of ROS maintain in a balanced and ever-changing state. However, when the body is stimulated by specific factors, an overproduction of ROS can occur [ 46 ]. The overabundance of ROS has the potential to initiate a series of successive responses, which may involve the initiation of the caspase signaling pathway, ultimately leading to cellular apoptosis [ 47 ]. Through the utilization of primary hepatocytes, our study demonstrated that exposure to high glucose levels induced a substantial rise in ROS generation, which may be the reason why high glucose induces apoptosis. It has been demonstrated that MAPK pathway activation is crucial to a wide variety of cellular processes such as cell proliferation, differentiation, and apoptosis [ 48 ]. In the present investigation, the involvement of MAPK signaling in the development of metabolic liver diseases in largemouth bass was examined, and it was found that the phosphorylation of ERK1/2, JNK1/2, and p38MAPK was significantly increased. As a super antioxidant, astaxanthin has been shown to exhibit efficacy in the treatment of diabetic mellitus by activating the NF-κB pathway, suppressing anti-apoptotic activity via modulation of MAPKs and PI3K/Akt pathways [ 49 ]. Our observation that astaxanthin significantly inhibits phosphorylation of p38MAPK, but not ERK1/2 and JNK1/2. This result indicates that the mechanism of astaxanthin-inhibited apoptosis might differ from previous studies. In response to various stressors, p38MAPK plays a vital role in triggering apoptosis. To further explore and confirm the pivotal role of p38MAPK in HG-induced primary hepatocytes apoptosis, a p38MAPK inhibitor, SB203580, was utilized. SB203580 did inhibit the protein expression of CAS3 and affect the gene expression of bcl-2 , bax and caspase-3 , underlining the key role of p38MAPK in promoting cell apoptosis. Moreover, the present study also demonstrated that astaxanthin may hinder apoptosis induced by high glucose by targeting p38MAPK/bcl-2/caspase-3 signaling pathway. Conclusion In a word, astaxanthin can reduce liver injury in diabetic largemouth bass by improving dual regulation of PTP1B/PI3K/Akt and p38 MAPK/bcl-2/caspase-3 pathways. This is the first study on astaxanthin-mediated on the relationship among insulin resistance, p38 MAPK and mitochondrial apoptosis in fish nutritional metabolism. What's more, it is also the first study to elucidate the potential regulatory function of astaxanthin in improving fish sugar utilization through the PTP1B/PI3K/Akt axis. Abbreviations acadm: acyl-CoA dehydrogenase medium AKT: protein kinase B ALT: alanine transaminase AMPK: adenosine 5‘-monophosphate (AMP)-activated protein kinase AST: aspartate transaminase ASX: astaxanthin bcl-2: B-cell lymphoma-2 bad: BCL2 associated agonist of cell death bax: BCL-2-associated X protein BW: body weight cat: catalase CCK8: cell counting kit-8 CF: condition factor CON: control cytb: cytochrome b DMEM: Dulbecco modified Eagle medium EDTA: ethylenediaminetetraacetic acid ef-1α: elongation factor 1α enpp1: phosphodiesterase 1 FBS: fetal bovine serum FITC: fluorescein isothiocyanate gsh-px: glutathione peroxidase GSK3β: glycogen synthase kinase 3 β GTT: glucose tolerance test gys2: glycogen synthase 2 H&E: hematoxylin and eosin HSI: hepatosomatic index ir: insulin receptor ir-β: insulin receptor β irs1: insulin receptor substrate1 il-6: interleukin-6 il-8: interleukin-8 il-10: interleukin-10 MAPK: microtubule-associated protein kinase p-Akt: phosphorylation of protein kinase B PAS: periodic acid-schiff PBS: phosphate-buffered saline PI: propidium iodide PI3K: phosphoinositide 3-kinase PTP1B: protein tyrosine phosphatase-1B PVDF: polyvinylidene fluoride qRT-PCR: quantitative real-time PCR ROS: reactive oxygen species SGR: specific growth rate sod1: superoxide dismutase 1 TEM: transmission electron microscopy VSI: viscerosomatic index WG: weight gain Declarations Availability of data and materials No datasets were generated or analysed during the current study. Funding This research was supported by Project of National Natural Science Foundation of China (32172982), and Project of Science and Technology of Guangdong Province (2021B0202050002), and Project of Science and Technology of Guangdong Province (2019B110209005), and Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams (2019KJ143). Contributions Zhihong Liao: Conceptualization, Methodology, Formal analysis, Writing-original draft. Xuanshu He: Methodology, Data curation, Investigation. Anqi Chen: Conceptualization, Writing-review & editing. Jian Zhong: Writing-review & editing. Sihan Lin: Writing-review & editing. Yucai Guo: Writing-review & editing. Xin Cui: Methodology, Data curation. Baoyang Chen: Methodology. Wei Zhao and Jin Niu: Conceptualization, Supervision, Writing-review & editing. Ethics declarations Competing interests The authors declare that they have no competing interests. Consent for publication No applicable. Ethics approval and consent to participate The National Institutes of Health (NIH) guidelines for laboratory animal care and use were strictly followed during all experimental procedures. The study protocol was approved by Experimental Animal Ethics Committee of Sun Yat-Sen University. The protocol number is SYSU-LS-IACUC-2024-0020. References Ren M, Ai Q, Mai K, Ma H, Wang X. Effect of dietary carbohydrate level on growth performance, body composition, apparent digestibility coefficient and digestive enzyme activities of juvenile cobia, rachycentron canadum l. Aquac Res. 2011;42(10):1467-1475. https://doi.org/10.1111/j.1365-2109.2010.02739.x Zhou C, Ge X, Niu J, Lin H, Huang Z, Tan X. Effect of dietary carbohydrate levels on growth performance, body composition, intestinal and hepatic enzyme activities, and growth hormone gene expression of juvenile golden pompano, trachinotus ovatus . Aquaculture. 2015;437:390-397. https://doi.org/10.1016/j.aquaculture.2014.12.016 Ma H, Mou M, Pu D, Lin S, Chen Y, Luo L. Effect of dietary starch level on growth, metabolism enzyme and oxidative status of juvenile largemouth bass, micropterus salmoides . Aquaculture. 2019;498:482-487. https://doi.org/ 10.1016/j.aquaculture.2018.07.039 Zhang Y, Xie S, Wei H, Zheng L, Liu Z, Fang H, Xie J, Liao S, Tian L, Liu Y, Niu J. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, Micropterus salmoides . Aquac Nutr. 2020;26(4):1083-1095. https://doi.org/ 10.1111/anu.13066 Enes P, Peres H, Pou sã O-Ferreira P, Sanchez-Gurmaches J, Navarro I, Gutiérrez J, Oliva-Teles A. Glycemic and insulin responses in white sea bream diplodus sargus , after intraperitoneal administration of glucose. Fish Physiol Biochem. 2012;38(3):645-652. https://doi.org/ 10.1007/s10695-011-9546-4 10.1007/s10695-011-9546-4 Chen Y, Wang X, Pi R, Feng J, Luo L, Lin S, Wang D. Preproinsulin expression, insulin release, and hepatic glucose metabolism after a glucose load in the omnivorous GIFT tilapia Oreochromis niloticus . Aquaculture. 2017;482:183-192. https://doi.org/ 10.1016/j.aquaculture.2017.10.001 Kamalam B, Medale F, Panserat S. Utilization of dietary carbohydrates in farmed fishes: new insights on influencing factors, biological limitations and future strategies. Aquaculture. 2017;467:3-27. https://doi.org/ 10.1016/j.aquaculture.2016.02.007 Enes P, Peres H, Sanchez-Gurmaches J, Navarro I, GutiérrezJ, Oliva-Teles A. Insulin and igf-i response to a glucose load in european sea bass ( dicentrarchus labrax ) juveniles. Aquaculture. 2011;315 (3-4):321-326. https://doi.org/ 10.1016/j.aquaculture.2011.02.042 Bhuvaneswari S, Arunkumar E, Viswanathan P, Anuradha C. Astaxanthin restricts weight gain, promotes insulin sensitivity, and curtails fatty liver disease in mice fed with obesity promoting diet. Process Biochem. 2010; 45:1406–1414. https://doi.org/ 10.1016/j.procbio.2010.05.016 Arunkumar E, Bhuvaneswari S, Anuradha C. An intervention study in obese mice with astaxanthin, a marine carotenoid-effects on insulin signaling and pro-inflammatory cytokines. Food Funct. 2012;3(2):120-126. https://doi.org/ 10.1039/c1fo10161g Lisette T, Hoekstra W, Graaf D, Geert A, Nibourg G, Heger M, Bennink R. Physiological and biochemical basis of clinical liver function tests: a review clinical liver function tests. Ann Sur. 2013;257(1):p27-36. https://doi.org/ 10.1097/SLA.0b013e31825d5d47 Möller A, Korytá T, Köllner B, Schmidt-Posthaus H, Segner H. The teleostean liver as an immunological organ: intrahepatic immune cells (ihics) in healthy and benzo[a]pyrene challenged rainbow trout ( oncorhynchus mykiss ). Deve Comp Immunol. 2014;46(2):518-529. https://doi.org/10.1016/j.dci.2014.03.020 Sales C, Silva R, Amaral Marília G, Domingos Fabrício F, Ribeiro R, Thomé Ralph G, Santos Hélio B. Comparative histology in the liver and spleen of three species of freshwater teleost. Neotrop Ichthyolo. 2017;15(1):e160041. https://doi.org/ 10.1590/1982-0224-20160041 Zhang W, Liu K, Tan B, Liu H, Dong X, Yang X, Chi S, Zhang S, Wang H. Transcriptome, enzyme activity and histopathology analysis reveal the effects of dietary carbohydrate on glycometabolism in juvenile largemouth bass, micropterus salmoides . Aquaculture. 2019;504:39-51. https://doi.org/ 10.1016/j.aquaculture.2019.01.030 Lin S, Shi C, Mu M, Chen Y, Luo L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, micropterus salmoides . Fish Shellfish Immun. 2018;78:121-126. https://doi.org/ 10.1016/j.fsi.2018.04.046 Qin Y, Zhang L, Chen P, Liang X. Dietary bile acids enhance growth, and alleviate hepatic fibrosis induced by a high starch diet via akt/foxo1 and camp/ampk/srebp1 pathway in micropterus salmoides . Front physiol. 2019;10:1430-1430. https://doi.org/ 10.3389/fphys.2019.01430 Mccarty M. Full-spectrum antioxidant therapy featuring astaxanthin coupled with lipoprivic strategies and salsalate for management of non-alcoholic fatty liver disease. Med Hypotheses. 2011;77(4):550-556. https://doi.org/ 10.1016/j.mehy.2011.06.029 Bhuvaneswari S, Yogalakshmi B. Astaxanthin reduces hepatic endoplasmic reticulum stress and nuclear factor-κb-mediated inflammation in high fructose and high fat diet-fed mice. Cell Stress Chaperon. 2014;19(2):183-191. https://doi.org/ 10.1007/s12192-013-0443-x Sila A, Kamoun Z, Ghlissi Z, Makni M, Nasri M, Sahnoun Z, Nedjar-Arroume N, Bougatef A. Ability of natural astaxanthin from shrimp by-products to attenuate liver oxidative stress in diabetic rats. Pharmacol Rep. 2015;67(2):310-316. https://doi.org/ 10.1016/j.pharep.2014.09.012 Xie S, Yin P, Tian L, Yu Y, Niu J. Dietary supplementation of astaxanthin improved the growth performance, antioxidant ability and immune response of juvenile largemouth bass ( micropterus salmoides ) fed high-fat diet. Mar Drugs. 2020;18(12):642. https://doi.org/ 10.3390/md18120642 He X, Chen A, Liao Z, Zhang Y, Lin G, Zhuang Z, Liu Y, Wei H, Wang Z, Wang Y, Niu J. Diet supplementation of organic zinc positively affects growth, antioxidant capacity, immune response and lipid metabolism in juvenile largemouth bass, Micropterus salmoides . Brit J Nutr. 2023; 1-15. https://doi.org/ 10.1017/S0007114523000909 Chen P, Wu X, Gu X, Han J, Xue M, Liang X. FoxO1 in Micropterus salmoides : Molecular characterization and its roles in glucose metabolism by glucose or insulin-glucose loading. Gen Comp Endocr. 2021;310:1-11. https://doi.org/ 10.1016/j.ygcen.2021.113811 Qin Y, Zhang L, Chen P, Liang X. Dietary bile acids enhance growth, and alleviate hepatic fibrosis induced by a high starch diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 pathway in Micropterus salmoides . Front Physiol. 2019;10:p1430. https://doi.org/ 10.3389/fphys.2019.01430 Wada T, Penninger J. Mitogen-activated protein kinases in apoptosis regulation. Oncogene. 2004;23:2838-2849. https://doi.org/ 10.1038/sj.onc.1207556 Sun J, Nan G. The Mitogen-activated protein kinase (MAPK) signaling pathway as a discovery target in stroke. J Mol Neurosci. 2016;59:90-8. https://doi.org/ 10.1007/s12031-016-0717-8 Gou S, Chen N, Xu X, Liu Z, Yin J. Effects of dietary digestible starch levels on growth performance, body composition, and non- specific immunological index of largemouth bass ( micropterus salmoides ). Journal of Fisheries of China. 2015. Li S, Sang C, Turchini G, Wang A, Chen N. Starch in aquafeeds: the benefits of a high amylose to amylopectin ratio and resistant starch content in diets for the carnivorous fish, largemouth bass ( micropterus salmoides ). Brit J Nutr. 2020;124(11):1-29. https://doi.org/ 10.1017/S0007114520002214 Fang H, Xie J, Zhao W, Liu Z, Liu Y, Tian L, Niu J. Study supplementation of astaxanthin in high-fat diet on growth performance, antioxidant ability, anti-inflammation, non-specific immunity and intestinal structure of juvenile trachinotus ovatus . Aquac Nutr. 2021;27(6):2575-2586. https://doi.org/ 10.1111/anu.13386 Zhao W, Yao R, Wei H, Guo Y, Chen A, Chen B, Niu J. Astaxanthin, bile acid and chlorogenic acid attenuated the negative effects of high-fat diet on the growth, lipid deposition, and liver health of Oncorhynchus mykiss ). Aquaculture. 2023;567:739255. https://doi.org/ 10.1016/j.aquaculture.2023.739255 Boshra S. Astaxanthin attenuates adiponectin, calprotectin, mirna222 and mirna378 in obesity induced by high-fat diet in rats. Curr Pharm Bio. 2021;23(4):pp. 609-618. https://doi.org/ 10.2174/1389201022666210810105804 Li X, Zheng S, Ma X, Cheng K, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass ( micropterus salmoides ). part i: effects of poultry by-product meal and soybean meal on growth, feed utilization, and health. Amino Acids. 2020;53:33-47. https://doi.org/ 10.1007/s00726-020-02920-6 Li X, Zheng S, Cheng K, Ma X, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass ( micropterus salmoides ). part ii: effects of supplementation with methionine or taurine on growth, feed utilization, and health. Amino Acids. 2021; 53: 49-62. https://doi.org/ 10.1007/s00726-020-02920-6 Du Z, Turchini G. Are we actually measuring growth?-an appeal to use a more comprehensive growth index system for advancing aquaculture research. Reviews in Aquaculture. 2021;214(2):525-527. https://doi.org/ 10.1111/raq.12604 Zeng K, Tian L, Sirek A, Shao W, Liu L, Chiang Y, Chernoff J, Dominic S, Weng J, Jin T. Pak1 mediates the stimulatory effect of insulin and curcumin on hepatic ChREBP expression. J Mol Cell Biol. 2017;9(5):384-394. https://doi.org/ 10.1093/jmcb/mjx031 Li X, Han T, Zheng S, Wu G. Hepatic glucose metabolism and its disorders in fish. Adv Exp Med Biol. 2021;1354:pp 207-236. https://doi.org/ 10.1007/978-3-030-85686-1_11 Jin J, Panserat S, Kamalam B, Aguirre P, Véron V, Médale F. Insulin regulates lipid and glucose metabolism similarly in two lines of rainbow trout divergently selected for muscle fat content. Gen Comp Endocri. 2014;204:49-59. https://doi.org/ 10.1016/j.ygcen.2014.04.027 Ezzat S, Bishbishy M, Habtemariam S, Salehi B, Sharifi-Rad J. Looking at marine-derived bioactive molecules as upcoming anti-diabetic agents: a special emphasis on ptp1b inhibitors. Molecules. 2018;23(12):3334. https://doi.org/ 10.3390/molecules23123334 Wan M, Leavens K, Hunter R, Koren S, Wilamowitz-Moellendorff A, Lu M, Satapati S, Chu Q, Sakamoto K, Burgess C, Birnbaum M. GSK3-independent pathway controls postprandial hepatic glycogen deposition. Cell Metab. 2013;18:99-105. https://doi.org/ 10.1016/j.cmet.2013.06.001 Li Q, Zhao Q, Zhang J, Zhou L, Li P. The protein phosphatase 1 complex is a direct target of akt that links insulin signaling to hepatic glycogen deposition. Cell Rep. 2019;28(13):3406-3422.e7. https://doi.org/ 10.1016/j.celrep.2019.08.066 Caruso M, Sheridan M. New insights into the signaling system and function of insulin in fish. Gene Comp Endocr. 2011;173(2):227-247. https://doi.org/10.1016/j.ygcen.2011.06.014 Prisingkorn W, Prathomya P, Liu H, Deng F, Wang W. Transcriptomic and metabolomics analyses show that high carbohydrate induces fatty liver in blunt snout bream ( Megalobrama amblycephala ). BMC Genomics. 2017;18(1):856. https://doi.org/ 0.20944/preprints201701.0117.v1 D'Arcy M. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int. 2019;43(6):582-592. https://doi.org/ 10.1002/cbin.11137 Mcilwain D, Berger T, Mak T. Caspase functions in cell death and disease. Cold Spring Harb Perspect Biol. 2015;7(4):a026716. https://doi.org/ 10.1101/cshperspect.a026716 Pea-Blanco A, Ana J, García-Sáez. Bax, bak and beyond - mitochondrial performance in apoptosis. FEBS J. 2018;285(3):416-431. https://doi.org/ 10.1111/febs.14186 Gao B, Zhang X, Zhang Y, Li S, Lu L, Xu D, Liu X. Effects of dietary carbohydrate levels on the growth, glycometabolism, antioxidant capacity and metabolome of largemouth bass ( micropterus salmoides ). Aquac Res. 2022;53(10):3748-3758. https://doi.org/ 10.1111/are.15878 Choi E, Park C, Hwang H, Hong S, Kim G, Cho E, Kim W, Choi Y. Baicalein induces apoptosis via ros-dependent activation of caspases in human bladder cancer 5637 cells. Int J Oncol. 2016;49(3):1009-1018. https://doi.org/ 10.3892/ijo.2016.3606 Zhang Y, Wang G, Wang T, Cao W, Zhang L, Chen X. Nrf2-keap1 pathway-mediated effects of resveratrol on oxidative stress and apoptosis in hydrogen peroxide-treated rheumatoid arthritis fibroblast‐like synoviocytes. Ann NY Acad Sci. 2019;1457(1):166-178. https://doi.org/10.1111/nyas.14196 Su Y, Zong S, Wei C, Song F, Feng H, Qin A, Lian Z, Fu F, Shao S, Fang F, et al. Salidroside promotes rat spinal cord injury recovery by inhibiting inflammatory cytokine expression and NF-κB and MAPK signaling pathways. J Cell Physiol. 2019;234(8):14259-14269. https://doi.org 10.1002/jcp.28124. Landon R, Gueguen V, Petite H, Letourneur D, Pavon-Djavid G, Anagnostou F. Impact of astaxanthin on diabetes pathogenesis and chronic complications. Mar. Drugs. 2020;18:p. 357. https://doi.org 10.3390/md18070357 Yu L, Yu H, Liang X, Li N, Wang X, Li F, Wu X, Zheng Y, Xue M, Liang X. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass ( Micropterus salmoides ). Fish Shellfish Immunolo.2018;72:220-229. https://doi.org/ 10.1016/j.fsi.2017.10.054 Supplementary Files Graphicalabstract.docx Highlights.docx SupplementalMethods.docx supplementarywesterndata.pdf Cite Share Download PDF Status: Published Journal Publication published 19 Sep, 2024 Read the published version in Cell & Bioscience → Version 1 posted Editorial decision: Major revision 04 Jul, 2024 Reviewers agreed at journal 20 May, 2024 Reviewers invited by journal 05 May, 2024 Editor assigned by journal 30 Apr, 2024 First submitted to journal 28 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4337374","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":298923289,"identity":"07c070f0-db0a-45ab-91b5-88fae6fe1fb3","order_by":0,"name":"Zhihong Liao","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Zhihong","middleName":"","lastName":"Liao","suffix":""},{"id":298923290,"identity":"9ab1e5d3-f3c5-4f6f-b168-0ac2240b9cc7","order_by":1,"name":"Xuanshu He","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Xuanshu","middleName":"","lastName":"He","suffix":""},{"id":298923291,"identity":"dc63ca95-f401-47b0-9f7c-16aa488a9b2d","order_by":2,"name":"Anqi Chen","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Anqi","middleName":"","lastName":"Chen","suffix":""},{"id":298923292,"identity":"9ff86b6e-82bb-4405-88ce-6164966e46ae","order_by":3,"name":"Jian Zhong","email":"","orcid":"","institution":"Zhanjiang Customs","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Zhong","suffix":""},{"id":298923293,"identity":"0d0a0280-b0dc-4c6f-97da-596bcd74a427","order_by":4,"name":"Sihan Lin","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Sihan","middleName":"","lastName":"Lin","suffix":""},{"id":298923294,"identity":"b5db85b7-2d65-4238-b5d4-a77bb995085f","order_by":5,"name":"Yucai Guo","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Yucai","middleName":"","lastName":"Guo","suffix":""},{"id":298923295,"identity":"0e8b03ca-fd83-4432-aa6e-6aed9a3a28ee","order_by":6,"name":"Xin Cui","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Cui","suffix":""},{"id":298923296,"identity":"b347dab5-9114-46ec-9001-1681d96c27e0","order_by":7,"name":"Baoyang Chen","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Baoyang","middleName":"","lastName":"Chen","suffix":""},{"id":298923297,"identity":"a68db63c-2131-4579-82cb-760cfffce43a","order_by":8,"name":"Wei Zhao","email":"","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhao","suffix":""},{"id":298923298,"identity":"f959ee91-8ff7-439b-b8cd-16a5a54f22d3","order_by":9,"name":"jin niu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIiWNgGAWjYDACZgYGww8VDAxs7HChBMJajCXOALUwE60FBHjbIHqJ02LOzmNQIDlvmzwfMwPzZ54/hxn42XMMGH7uwK3FspnHwKBw223DNmYGNmnetsMMkj1vDBh7z+DWYnAYqEVy221GkBZm3obDDAY3cgyYGdsIaOGdc9u+DeYwe+K0NNxOBGphkOZhA9oiQVALW4GxxLHbyW1AZZJz29J5JM48KzjYi0/L+cPbDD/U3Lad3958+MObP9Zy/O3JGx/8xKMFCNgMIDRjAxMPAwMPiHkArwZgHD6AsRh/EFA6CkbBKBgFIxMAAMahRztghM6jAAAAAElFTkSuQmCC","orcid":"","institution":"Sun Yat-Sen University","correspondingAuthor":true,"prefix":"","firstName":"jin","middleName":"","lastName":"niu","suffix":""}],"badges":[],"createdAt":"2024-04-28 10:01:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4337374/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4337374/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13578-024-01304-7","type":"published","date":"2024-09-19T15:57:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56252125,"identity":"4ebbea3d-6ce8-4a69-86cb-a5b914de22e3","added_by":"auto","created_at":"2024-05-10 12:44:30","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":117501,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin improved growth performance in high carbohydrate-fed largemouth bass. Values were mean ± SEM of four replicates. WG, weigh gain; SGR, specific growth rate; CF, condition factor; VSI, Viscerosomatic index; HSI, hepatosomatic index. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001; \u003cem\u003ens\u003c/em\u003e, no significant difference.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/be2393a6575a568e9fe9ecdf.png"},{"id":56252149,"identity":"ce7bbeb6-c5c0-4c96-879c-dbf7027d4aad","added_by":"auto","created_at":"2024-05-10 12:44:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":138735,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin reduced the elevated glucose tolerance in high carbohydrate-fed largemouth bass and alleviated insulin resistance through the PTP1B/PI3K/Akt signaling pathway. \u003cstrong\u003eA\u003c/strong\u003e Serum glucose concentration in GTT (n=6). \u003cstrong\u003eB\u003c/strong\u003e The serum glucose level in different diets. \u003cstrong\u003eC\u003c/strong\u003e The serum insulin level in different diets. \u003cstrong\u003eD \u003c/strong\u003eHepatic mRNA fold change of insulin resistance related genes at 0 h, 1 h, 3 h and 12 h after glucose injection (n=6). \u003cstrong\u003eE\u003c/strong\u003e The expression of liver insulin resistance genes (\u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e, \u003cem\u003epi3kr1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e) of largemouth bass after 1 h of glucose injection. \u003cstrong\u003eF\u003c/strong\u003e The expression of liver insulin resistance genes (\u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e, \u003cem\u003epi3kr1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e) of largemouth bass after 3 h of glucose injection. \u003cstrong\u003eG\u003c/strong\u003e The expression of liver insulin resistance gene (\u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e, \u003cem\u003epi3kr1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e) of largemouth bass after 12 h of glucose injection. G-CON: control diet during the GTT; G-HC: high-carbohydrate diet during the GTT; G-HCA: high-carbohydrate diet supplemented with astaxanthin during the GTT. \u003cstrong\u003eH\u003c/strong\u003e The expression of insulin resistance proteins (PTP1B, p-Akt\u003cem\u003e, \u003c/em\u003eand Akt) in different diets. \u003cstrong\u003eI \u003c/strong\u003eThe expression of liver insulin resistance genes (\u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1, pi3kr1 \u003c/em\u003eand \u003cem\u003einsulin\u003c/em\u003e) in different diets. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001; \u003cem\u003ens\u003c/em\u003e, no significant difference.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/aa9937002d931cfb8584f67d.png"},{"id":56252150,"identity":"1f93ad47-e426-4994-a298-b84a797d5747","added_by":"auto","created_at":"2024-05-10 12:44:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":260291,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin altered the hepatic gene expression pattern of largemouth bass. \u003cstrong\u003eA \u003c/strong\u003eVolcano plot of differentially expressed genes in HC diet compared with CON diet. Red dots represent upregulated genes and green dots represent downregulated genes. \u003cstrong\u003eB\u003c/strong\u003e Volcano plot of differentially expressed genes in HCA diet compared with HC diet. Red dots represent upregulated genes and green dots represent downregulated genes. \u003cstrong\u003eC\u003c/strong\u003e Bubble plot of Gene Ontology (GO) terms between HC and CON diet. \u003cstrong\u003eD\u003c/strong\u003e Bubble plot of GO terms between HCA and HC diet. \u003cstrong\u003eE\u003c/strong\u003e Bubble plot of KEGG pathways between HC and CON diet. \u003cstrong\u003eF \u003c/strong\u003eBubble plot of KEGG pathways between HCA and HC diet; CON: control; HC: high-carbohydrate; HCA: high-carbohydrate diet supplemented with astaxanthin.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/88f85f508fdfe7d6e338b214.png"},{"id":56252143,"identity":"e7e9b78b-5d4f-4540-8ed4-0de3f732d7bf","added_by":"auto","created_at":"2024-05-10 12:44:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":676846,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin alleviated liver damage by improving apoptosis, inflammation and oxidative stress in high carbohydrate-fed largemouth bass. \u003cstrong\u003eA\u003c/strong\u003e H\u0026amp;E staining, Scale bar, 100 μm, original magnification×4. \u003cstrong\u003eB\u003c/strong\u003e PAS staining. \u003cstrong\u003eC\u003c/strong\u003e The structure of the ultramicroscopic characteristics and structure in the livers under electron microscopy. \u003cstrong\u003eD\u003c/strong\u003e Relative expression of Caspase family genes (\u003cem\u003ecaspase-3\u003c/em\u003e, \u003cem\u003ecaspase-8 \u003c/em\u003eand \u003cem\u003ecaspase-9\u003c/em\u003e). \u003cstrong\u003eE\u003c/strong\u003e Relative expression of bcl-2 family genes (\u003cem\u003ebcl-2\u003c/em\u003e, \u003cem\u003ebax \u003c/em\u003eand \u003cem\u003ebad\u003c/em\u003e). \u003cstrong\u003eF\u003c/strong\u003e Relative expression of inflammatory factor genes (\u003cem\u003etnf-α\u003c/em\u003e, \u003cem\u003eil-6\u003c/em\u003e,\u003cem\u003e il-8 \u003c/em\u003eand \u003cem\u003eil-10\u003c/em\u003e). \u003cstrong\u003eG\u003c/strong\u003e Relative expression of antioxidant genes (\u003cem\u003ecat\u003c/em\u003e, \u003cem\u003egsh-px \u003c/em\u003eand \u003cem\u003esod1\u003c/em\u003e). \u003cstrong\u003eH \u003c/strong\u003eand \u003cstrong\u003eI\u003c/strong\u003e, The activities of serum ALT and AST. Values were mean ± SEM of three replicates. AST, aspartate aminotransferase; ALT, alanine aminotransferase. CON: control; HC: high-carbohydrate; HCA: high-carbohydrate diet supplemented with astaxanthin. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001; \u003cem\u003ens\u003c/em\u003e, no significant difference.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/a4db4196041d3d1194ad1cf3.png"},{"id":56252110,"identity":"19376a6f-d8aa-4d9a-abb6-f099639db05c","added_by":"auto","created_at":"2024-05-10 12:44:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":246863,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin suppressed HG-induced apoptosis in largemouth bass primary hepatocytes. \u003cstrong\u003eA \u003c/strong\u003eCell counting kit-8 test. \u003cstrong\u003eB\u003c/strong\u003e Flow cytometry for apoptosis, LL: live cells; LR: early apoptotic cells; UR: late apoptotic cells; UL: mechanically damaged cells. \u003cstrong\u003eC\u003c/strong\u003e ROS production analysed by flow cytometry. \u003cstrong\u003eC’\u003c/strong\u003e The proportion of intracellular ROS in primary hepatocytes. Values were mean ± SEM of three replicates. LG: low-glucose; HG: high-glucose. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001; \u003cem\u003ens\u003c/em\u003e, no significant difference.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/7e31ee459748c2bad49b7d5c.png"},{"id":56252174,"identity":"1936607c-1c88-4774-a903-bcf3d8ea7708","added_by":"auto","created_at":"2024-05-10 12:44:41","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":311659,"visible":true,"origin":"","legend":"\u003cp\u003eAstaxanthin improved apoptosis induced by high-glucose via p38MAPK/bcl-2/caspase-3 signaling pathway. \u003cstrong\u003eA\u003c/strong\u003e The expression of levels of p-ERK, ERK, p-p38, p38, p-JNK, JNK and CAS3 proteins of primary hepatocytes cultured with three treatments. \u003cstrong\u003eB\u003c/strong\u003e immunofluorescence for p-p38. \u003cstrong\u003eC \u003c/strong\u003eand \u003cstrong\u003eD\u003c/strong\u003e, primary hepatocytes were pretreated with SB203580 for 2 h, inhibitors of the p38MAPK pathways, and treated with HG and HGA for 48 h, respectively. Expression levels of p-p38, p38 and CAS3 were analyzed using western blotting, expression levels of \u003cem\u003ebcl-2\u003c/em\u003e, \u003cem\u003ebax, bad, caspase-3 \u003c/em\u003eand \u003cem\u003ecaspase-9\u003c/em\u003ewere analyzed using RT-PCR. Values were mean ± SEM of three replicates. LG: low-glucose; HG: high-glucose; HGA, treated with 50 μM astaxanthin and high-glucose. *\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001; \u003cem\u003ens\u003c/em\u003e, no significant difference.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/d1d0acf14503fb517a0828ed.png"},{"id":65103930,"identity":"ad928b65-6df1-4138-b802-4ae74844ab70","added_by":"auto","created_at":"2024-09-23 16:09:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2649722,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/13140cfd-f98d-431f-8b12-c25bf312423c.pdf"},{"id":56252108,"identity":"5b78ab6f-27d6-4196-ac59-d106f2cfda4f","added_by":"auto","created_at":"2024-05-10 12:44:24","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":455645,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/5dc6f858921e72e00ef7d487.docx"},{"id":56252104,"identity":"8cd01355-6d33-4f2f-9b2b-de73358348c5","added_by":"auto","created_at":"2024-05-10 12:44:17","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":15926,"visible":true,"origin":"","legend":"","description":"","filename":"Highlights.docx","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/9ea87d4391bd6c899b12cc0a.docx"},{"id":56252115,"identity":"c97cc91a-643c-46f2-af92-b660679f6111","added_by":"auto","created_at":"2024-05-10 12:44:27","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":18330,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalMethods.docx","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/399486345fe6bf0dcc1ef8f3.docx"},{"id":56252136,"identity":"d5648a1c-b425-4fec-861c-49a9fb13d712","added_by":"auto","created_at":"2024-05-10 12:44:35","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":781903,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarywesterndata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4337374/v1/78f28bb946779cc8c2b38f09.pdf"}],"financialInterests":"","formattedTitle":"Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCarbohydrates are commonly incorporated into aquafeed due to their cost-effectiveness and their ability to enhance feed expansion properties [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, different fish species have different capacities for utilizing carbohydrates, with carnivorous fish exhibiting lower utilization rates compared to herbivorous counterparts. Consequently, excessive dietary carbohydrate intake can lead to various detrimental effects in carnivorous fish. There is a wide cultivation of the largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e) worldwide for its role as a representative carnivorous fish. Multiple studies have indicated that the commercial diet of largemouth bass contains a maximum of 10% starch [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In order to investigate glucose-induced liver disease, largemouth bass have been used as a representative model.\u003c/p\u003e \u003cp\u003eThe glucose tolerance test (GTT) is widely used to assess the ability of fish to utilize glucose [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Carnivorous fish exhibit a notable resistance to insulin and glucose in relation to carbohydrate metabolism, resulting in an elevation of blood glucose concentration with higher starch consumption [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Insulin has an essential part in the maintenance glucose of homeostasis in mammals. Numerous studies have indicated that inadequate insulin secretion is the major cause of such glucose intolerance in fish [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Nevertheless, the available data on the relationship between a GTT and the regulatory process of insulin and glucose metabolism in carnivorous fish is scarce. Astaxanthin exhibits potent antioxidant properties and has the ability to modulate AMPK and MAPK signaling pathways, thereby ameliorating liver insulin resistance [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Arunkumar et al. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] demonstrated that astaxanthin enhances post-receptor insulin signaling events by promoting IR-β/PI3K/Akt signal pathway. Nevertheless, the specific mechanisms through which astaxanthin improves insulin sensitivity remain unexplored at the molecular level in carnivorous fish.\u003c/p\u003e \u003cp\u003eThe liver serves multiple functions, including nutrient metabolism, detoxification, deposition, and immunity [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Excessive nutrient intake can consequently result in liver damage. Further examination of the relationship between liver disorders and dietary starch in fish species is of utmost importance. In largemouth bass aquaculture, dietary starch levels have been found to significantly impact the structure of largemouth bass livers [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Feeding commercial feed containing 10% starch level to largemouth bass resulted in hepatocyte vacuolation and fibrosis, which further increased the level of inflammation and apoptosis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Although there has been extensive research on the effects of consuming a large amount of carbohydrates on largemouth bass, the majority of these studies have focused on factors such as growth, damage to liver tissue, and the metabolism of glycolipids in the liver [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Until now, the precise molecular mechanisms underlying liver damage resulting from high carbohydrate consumption remain unclear. Therefore, it is imperative to investigate dietary approaches that can mitigate the adverse influences of high-starch diets, particularly on the liver well-being of largemouth bass.\u003c/p\u003e \u003cp\u003eIn aquaculture, astaxanthin has been widely adopted for use for its antioxidant properties and for enhancing pigmentation and stress resilience. Studies have demonstrated the ability of astaxanthin to mitigate liver inflammation and fibrosis caused by nonalcoholic steatohepatitis in mice [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Furthermore, astaxanthin has been found to relieve liver endoplasmic reticulum stress and inflammation in mice fed a diet containing high fructose and high fat [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Studies have shown that astaxanthin may be useful in preventing diabetic complications and reversing hepatotoxicity in adult rats [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Consequently, astaxanthin may be an effective way to treat liver oxidative damage, improve metabolism, and reduce liver inflammation. In a prior investigation, we exhibited that astaxanthin enhanced the ability to counteract oxidation, performance in growth, and immune reaction in largemouth bass that were fed a high-fat diet [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBuilding upon these findings, the objective of this research is to investigate the effects of astaxanthin on high carbohydrate induced insulin resistant and liver damage in largemouth bass. Furthermore, we will delve deeper into the anti-apoptotic properties of astaxanthin on the protein level, which would be helpful to the understanding of its regulation mechanism in vivo and give a new direction for studies on astaxanthin in aquatic feed.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental diets\u003c/h2\u003e \u003cp\u003eAstaxanthin abundance in high-carbohydrate diets was determined from previous studies [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. As shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, three purified isonitrogenous and isolipidic diets were designed and formulated: including a control (CON) diet, a high-carbohydrate (HC) diet and a HC supplemented with 0.1% Lucantin Pink CWD (BASF, Shanghai, China) containing 10% (w/w) astaxanthin (HCA) diet. In all diets, the main source of carbohydrate was corn starch. Bone meal was used for eliminating the difference of quantity caused by corn starch. The experimental diets were conducted using the previously reported method [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Further details can be found in Supplemental Methods.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eIngredients and nutrient composition of the experimental diets (% dry matter)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIngredients\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCON\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eHC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHCA\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCorn starch\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKrill meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBeer yeast\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoybean meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWheat gluten\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoy oil\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSoya lecithin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMineral premix\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin premix\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholine chloride (50%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMonocalcium phosphate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVitamin C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBone meal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLucantin Pink CWD\u003csup\u003e3\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSum\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNutrient composition\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e47.90\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude lipid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e1\u003c/sup\u003eMineral premix provides the following per kg of diet: MgSO\u003csub\u003e4\u003c/sub\u003e∙7H\u003csub\u003e2\u003c/sub\u003eO, 1090 mg; KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 932 mg; NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e∙2H\u003csub\u003e2\u003c/sub\u003eO, 432 mg; FeC\u003csub\u003e6\u003c/sub\u003eH\u003csub\u003e5\u003c/sub\u003eO\u003csub\u003e7\u003c/sub\u003e∙5H\u003csub\u003e2\u003c/sub\u003eO, 181 mg; ZnCl\u003csub\u003e2\u003c/sub\u003e, 80 mg; CuSO\u003csub\u003e4\u003c/sub\u003e∙5H\u003csub\u003e2\u003c/sub\u003eO, 63 mg; AlCl\u003csub\u003e3\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, 51 mg; MnSO\u003csub\u003e4\u003c/sub\u003e∙H\u003csub\u003e2\u003c/sub\u003eO, 31mg; KI, 28 mg; CoCl\u003csub\u003e2\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, 6 mg; Na\u003csub\u003e2\u003c/sub\u003eSeO\u003csub\u003e3\u003c/sub\u003e∙H\u003csub\u003e2\u003c/sub\u003eO, 0.8 mg.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e2\u003c/sup\u003eVitamin premix provides the following per kg of diet: Vitamin B1, 30 mg; Vitamin B2, 60 mg; Vitamin B6, 60 mg; Nicotinic acid, 200 mg; Calcium pantothenate, 100 mg; Inositol, 100 mg; Biotin, 2.5 mg; Folic acid, 10 mg; Vitamin B12, 0.1 mg; Vitamin K3, 40 mg; Vitamin A, 10000IU, Vitamin, 160 IU.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003e3\u003c/sup\u003eLucantin Pink CWD of 10% (w/w) astaxanthin content provided from BASF, Shanghai, China.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003eJuvenile largemouth bass were obtained from Shunye Fishery Company (Foshan, China). More details of experiment design and feeding management can be found in Supplemental Methods. Sampling was performed after 8-week feeding trial, all fish were fasted for 24 h prior to sampling. 12 fish from each diet (4 fish per tank) were randomly chosen and measured the body length and weight. In order to prepare serum, caudal vertebral vein blood was sampled using a sterile syringe, then centrifuged at 4000 g for 10 min at 4\u0026deg;C. The serum was immediately stored at -80\u0026deg;C to preserve it for future use. For future analyses, the dissected tissues (liver, heart, brain, intestine, head kidney) were also immediately frozen in liquid nitrogen and then kept at -80\u0026deg;C. For more details on growth performance and morphology parameters, see Supplemental Methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGlucose tolerance test (GTT)\u003c/h2\u003e \u003cp\u003eThe GTT method described by Chen et al. [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], blood of largemouth bass from three diet treatment was separately collected from the caudal vein. More details of glucose tolerance test can be found in Supplemental Methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptomic analysis\u003c/h2\u003e \u003cp\u003eNine liver samples of largemouth bass fed with CON, HC and HCA diets were prepared for transcriptomic analysis. RNA integrity was measured by using the RNA Nano 6000 Assay Kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). More details of transcriptomic analysis can be found in Supplemental Methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eHistopathological studies\u003c/h2\u003e \u003cp\u003eLiver tissues were fixed in neutral 4% formalin (Servicebio, China) and embedded in paraffin wax. Hematoxylin and eosin (H\u0026amp;E) staining and periodic acid-schiff (PAS) staining were conducted according to the standard protocol. Light microscopy was used to observe and photograph histopathological lesions (NikonNi\u0026ndash;U, Nikon Corporation, Tokyo, Japan). For the transmission electron microscopy observations, livers were fixed in 2.5% glutaraldehyde (AAPR46) and rinsed with buffer. To observe the various structures within stained cells, a transmission electron microscope (JEM-1400 Flash, Japan) was used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBiochemical analysis\u003c/h2\u003e \u003cp\u003eMeasurements of serum glucose were performed using glucose oxidase kit (A154-1-1; Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The corresponding reagent kits (C009-2-1 and C010-2-1, respectively; Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were utilized for measuring serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT). The measurement of serum insulin level was conducted with a commercially available Elisa kit (ml0258550; Shanghai Enzyme-linked Biotechnology Co., Ltd., China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot and quantitative real-time PCR (RT-PCR)\u003c/h2\u003e \u003cp\u003eThe livers and cells were used to harvest and extract total protein by utilizing RIPA lysis buffer (FD009; Fdbio science, Hangzhou, China) along with a mixture of protease inhibitor and phosphatase inhibitor cocktail (FD1002; Fdbio science, Hangzhou, China). To measure the amount of total protein, a BCA assay (KS134848; Thermo, Scientific, Waltham, MA, USA) was employed. All details of primary antibodies can be found in Supplemental Methods. The PVDF filters were rinsed and treated with anti-rabbit (SA00001-2; Proteintech, United States, diluted 1:10000) secondary antibody for 1 h at ambient temperature. The Azure 300 ultra-sensitive chemiluminescence imager was utilized to visualize the protein bands. The levels of protein were standardized by β-actin and measured using the Image-Pro Plus software.\u003c/p\u003e \u003cp\u003eThe extraction of total RNA and the synthesis of cDNA were performed following the previously described protocol [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A gene responsible for maintaining the cleanliness of a house, known as elongation factor 1a (\u003cem\u003eef-1α\u003c/em\u003e; GenBank accession no. KT827794), was normalized as an internal reference. Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e displays the gene-specific primers utilized for largemouth bass mRNA. The qPCR examination was conducted in a 10 \u0026micro;L reaction volume using a Light Cycler 480II Real-Time System from Roche, located in IN, USA. The qPCR protocol started with a 10 min incubation at 95\u0026deg;C, followed by 40 cycles consisting of 5 sec at 95\u0026deg;C, 30 sec at 60\u0026deg;C, and 30 sec at 72\u0026deg;C. Additionally, the reaction quality was assessed by analyzing standard melting curves. The 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method was used to calculate qPCR data for each sample.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of primers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primers (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primers (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSources/GenBank No.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etnf-α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTCGTCTACAGCCAGGCATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTTGGCACACCGACCTCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCAGCAGCCAGGAGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGTTGTACACGATGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil-8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTTGAACAGACTGGGAGAGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGGGATGGCTTCATTATCTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eil-10\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGCACAGAAATCCCAGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCAGGCTCACAAAATAAACATCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCCCTGTGGGCAAAATGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTGACGATGTGTGTCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038704976.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003egsh-px\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGGGCTCCACCTGCTTCTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCCTCTGCTCAGGCATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMK614713.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003esod1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGCAAGAACAAGAACCACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCTGATTTCTCCTGTCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038708943.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecaspase-3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTTCATTCGTCTGTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAAAAAGTGATGTGAGGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecaspase-8\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGACAGACAGCAGACAACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCCATTTCAGCAAACACATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecaspase-9\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGAATGCCTTCAGGAGACGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGAGGGGCAAGACAACAGGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebcl-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCCTTTGTGGAGCTGTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAGAGGAGGAGGAGGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebax\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTCACTCAGTCCCACAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATACCCTCCCAGCCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038704178.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebad\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACATTTCGGATGCCACTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGCTCTTCTGCGATTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eXM_038730645.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eir\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTTTGAGGGAACTGGGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTGATGATGTCTTTAGCGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eirs1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGTGGTGGTGTCAGCGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGTGGAAGTAAAGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMT431531\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epi3kr1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGACCTTCCTCATCACGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTTCCACTACAACACTGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCluster-21914.23096\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eef-1α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTGCTGGTGTTGGTGAGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTGGCTGTAAGGGGGCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKT827794.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eCulture of largemouth bass primary hepatocytes\u003c/h2\u003e \u003cp\u003eLargemouth bass primary hepatocytes were isolated and cultured as follows: briefly, the livers were minced as small as possible with surgical scissors under sterile conditions, and washed thoroughly with pre-warmed phosphate-buffered saline (PBS) to remove the blood and other components. The rinsed livers were enzymatically digested using trypsin (25200072; Thermo Fisher Scientific, Waltham, MA, USA) at 28\u0026deg;C for 40 min. Centrifuge the cells after 6 min at 1000 rpm, discard supernatant, and resuspend harvested cell pellet in low-glucose medium containing 20% FBS and 1% penicillin-streptomycin. The isolated hepatocytes were seeded at a density of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells/mL and cultured in a humidified 28\u0026deg;C incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. When the confluence reached 70\u0026ndash;80%, the treated cells were divide into six groups: (1) LG, treated with low-glucose for 48 h; (2) HG, treated with high-glucose for 48 h; (3) HG\u0026thinsp;+\u0026thinsp;10 \u0026micro;M ASX, treated with 10 \u0026micro;M astaxanthin and high-glucose for 48 h; (4) HG\u0026thinsp;+\u0026thinsp;20 \u0026micro;M ASX, treated with 20 \u0026micro;M astaxanthin and high-glucose for 48 h; (5) HG\u0026thinsp;+\u0026thinsp;30 \u0026micro;M ASX, treated with 30 \u0026micro;M astaxanthin and high-glucose for 48 h; (6) HG\u0026thinsp;+\u0026thinsp;50 \u0026micro;M ASX, treated with 50 \u0026micro;M astaxanthin and high-glucose for 48 h. Astaxanthin (S3834; Selleck Chemicals, Houston, Texas, USA) was added at the start of low or high glucose culture and remained present throughout the experiment. The cells were pretreated with various concentrations of SB203580 (p38 MAPK pathway inhibitor; S1076, Selleck Chemicals, Houston, Texas, USA) for 2 h, then treated with low or high glucose culture for 48 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCCK8 assay\u003c/h2\u003e \u003cp\u003eSix replicates of primary hepatocytes were seeded in a 96-well culture plate at a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/mL. Subsequently, the cells were exposed to different concentrations of astaxanthin in combination with a glucose solution. Cell viability was assessed after incubating for either 24 or 48 h using a CCK8 assay (FD3788; Fdbio science, Hangzhou, China), following the guidelines provided by the manufacturer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eAnnexin V-FITC/PI staining\u003c/h2\u003e \u003cp\u003eFlow cytometry was used to examine apoptosis by employing annexin V-FITC/PI staining (BL110A; Biosharp life science, Beijing, China). Cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were seeded in 6-well plates and exposed to glucose and astaxanthin for 48 h. Afterward, the cells were digested by trypsin without EDTA and washed twice with chilled PBS. Finally, they were suspended in 100 \u0026micro;L of binding buffer. The cells were stained with Annexin V-FITC (5 \u0026micro;L) for 10 min at room temperature, followed by 10 \u0026micro;L PI for 5 min in the dark. Flow cytometry (Backman cytoflex) was used to analyze the cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eROS detection\u003c/h2\u003e \u003cp\u003eROS formation within the cell was identified by utilizing the H2DCF-DA probe (C-2938; Invitrogen\u0026trade;, Waltham, MA, USA), which is a 6-carboxy-2\u0026rsquo;, 7\u0026rsquo;-dichlorodihydrofluorescein diacetate, di (acetoxymethyl ester). After being pretreated with LG, HG, and astaxanthin for 48 h, the primary hepatocytes (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were collected and resuspended in serum-free DMEM with 15 \u0026micro;M H2DCF-DA. The harvested primary liver cells were incubated at a temperature of 28\u0026deg;C for a duration of 30 min and subsequently analyzed using flow cytometry (Backman cytoflex).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence analysis\u003c/h2\u003e \u003cp\u003eCells were seeded in a 20-mm laser confocal culture dish (cat. no. BDD012035) and treated with LG, HG and HGA for 48 h. More details of immunofluorescence analysis can be found in Supplemental Methods.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eTo analyze data on serum parameters in the GTT, a two-way ANOVA was employed to examine variations in treatment means considering sampling time, dietary treatments, and their interaction. If there were significant differences (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) observed in the interaction, each factor was subsequently analyzed individually using one-way analysis of variance (ANOVA). Means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM, calculated from 3\u0026ndash;6 replication, were used to present additional data. The comparison of variables between the two treatments was done by the student\u0026rsquo;s t-test. *\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and ***\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 were established to indicate statistical difference. GraphPad Prism 8.0 (GraphPad, USA) was responsible for creating all visual elements.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAstaxanthin improved growth performance in high carbohydrate-fed largemouth bass\u003c/h2\u003e \u003cp\u003eFollowing an 8-week feeding trial, the impact of astaxanthin on the growth performance of largemouth bass was depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The HC diet exhibited significantly lower WG, survival, and SGR compared to the CON diet, but the inclusion of astaxanthin considerably increased these 3 parameters (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). In this study, CF, VSI and HSI exhibited a consistent trend, indicating a significant effect of HC diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). This suggests that HC diet had an evident effect on the HSI of largemouth bass, resulting in liver damage. Furthermore, the VSI and HSI of largemouth bass fed HCA diet were considerably lower in comparison with those fed the HC diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These findings collectively demonstrate that astaxanthin supplementation improved the growth performance of largemouth bass that were fed a high-carbohydrate diet.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAstaxanthin reduced the elevated glucose tolerance in high carbohydrate-fed largemouth bass and alleviated insulin resistance through the PTP1B/PI3K/Akt signaling pathway\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe findings illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eA indicate that the levels of glucose in the serum were significantly affected by the time of sampling, the treatments given in the diet, and the interaction between them (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001). In particular, the introduction of glucose resulted in a notable rise in serum glucose levels, reaching its highest point after 1 h of injection. Afterwards, the levels of glucose in the serum decreased gradually (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001) until it reached the initial value after 12 h. The area under the curve (AUC) in different diet could tell the potent of blood glucose tolerance. The HC diet showed a significantly lower AUC value, while the AUC value of HCA diet was higher than HC diet, indicated that astaxanthin improved glucose tolerance. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and C) showed that HCA diet could lead a reduction in serum glucose level and a rise in serum insulin level compared with the HC diet (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The effects of HCA diet were close to the CON diet, which reduced the serum glucose and increased the serum insulin significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These results proved that astaxanthin could ameliorate the insulin resistance caused by high carbohydrate diet.\u003c/p\u003e \u003cp\u003eIn this study, we conducted a comparison of the expression of insulin resistance genes at different periods of glucose injection. With the increase in the glucose injection time, it can be seen that \u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e presented an overall trend of increasing first and then decreasing, while \u003cem\u003epi3kr1\u003c/em\u003e presented obvious decreasing first and then increasing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). To this end, we compared the relative expression of insulin resistance genes in different diets in the same time after glucose injection. After 1 h of injection, the results indicated that HC diet led to a rise in mRNA level of \u003cem\u003eir\u003c/em\u003e and \u003cem\u003eirs1\u003c/em\u003e and a reduction in mRNA level of \u003cem\u003epi3kr1\u003c/em\u003e, and \u003cem\u003einsulin\u003c/em\u003e expression was not affected by diet treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). After 3 h following glucose injection, \u003cem\u003epi3kr1\u003c/em\u003e mRNA level was increased in HC diet, while the expression of \u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e were not altered (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). At hour 12 after glucose injection, HC diet reduced liver mRNA level of \u003cem\u003eir\u003c/em\u003e, \u003cem\u003eirs1\u003c/em\u003e and \u003cem\u003epi3kr1\u003c/em\u003e, while promoted liver mRNA level of \u003cem\u003einsulin\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Surprisingly, HCA diet did not restore these gene expressions in livers at different time during the GTT.\u003c/p\u003e \u003cp\u003eIn an 8-week feeding trail, HC diet led to a rise in the protein levels of PTP1B, while simultaneously suppressed the phosphorylation of Akt. On the other hand, HCA diet caused a notable reduction in the protein levels of PTP1B, while leading to an increase in the protein levels of p-Akt/Akt (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). The results indicate that astaxanthin has a direct impact on the signaling pathway of PTP1B/PI3K/Akt in the liver. Hence, the PTP1B/PI3K/Akt signaling pathway was directly influenced by astaxanthin. Real-time PCR analysis indicated a notable reduction in \u003cem\u003epi3kr1\u003c/em\u003e and \u003cem\u003einsulin\u003c/em\u003e mRNA expression levels in HC diet, whereas a considerable rise was observed in HCA diet. Importantly, we did not observe a significant effect on the expression of \u003cem\u003eir\u003c/em\u003e and \u003cem\u003eirs1\u003c/em\u003e genes among all treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e2\u003c/span\u003eI).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eAstaxanthin altered the hepatic gene expression pattern of largemouth bass\u003c/h2\u003e \u003cp\u003eTo further elucidate and explain the gene expression patterns of largemouth bass fed with four diets, transcriptome profiles were performed by RNA-seq analysis. In total, 3800 differentially expressed genes (DEGs) were identified between HC and CON diets, including 1329 up-regulated and 2471 down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). 726 DEGs were identified between HCA and HC diets, of which 453 were upregulated and 273 were downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The first 30 enriched Gene Ontology (GO) terms of DEGs between HC and CON diets were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, the most enriched GO terms of DEGs in HC include cofactor binding, enzyme regulator activity, enzyme inhibitor activity and peptidase regulator activity. When HCA diet compared with HCA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), the most enriched GO terms of DEGs in HCA include apoptotic process, cell death programmed cell death and lipid metabolic process. Next, a KEGG enrichment analysis was conducted on the DEGs among CON, ASX, HC and HCA diets. The results revealed that 20 signaling pathways were significantly enriched between HC and CON diets, including those related to carbon metabolism, cytokine-cytokine receptor interaction, oxidative phosphorylation and glycolysis/gluconeogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Furthermore, compared to HC diet, the DEGs were enriched in pathways such as steroid biosynthesis, regulation of actin cytoskeleton, glycolysis/gluconeogenesis and FoxO signaling pathway in HCA diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e3\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003cb\u003eAstaxanthin alleviated liver damage by improving apoptosis, inflammation and oxidative stress in high carbohydrate-fed largemouth bass\u003c/b\u003e \u003c/p\u003e \u003cp\u003eInflammatory cells, ballooning, and liver vacuolization were observed in the liver of largemouth bass that were fed HC diet, as indicated by H\u0026amp;E staining. However, the inclusion of astaxanthin effectively alleviated these symptoms, as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eA According to the PAS staining results (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), largemouth bass fed HC diet had a large accumulation of glycogen in livers, which had been reduced by astaxanthin administration. Moreover, the ultramicroscopic characteristics and structure of the livers were further visualized using transmission electron microscopy (TEM). The mitochondria of largemouth bass that were fed CON diet exhibited structural integrity, characterized by well-organized cristae, distinct inner and outer mitochondrial membranes (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In contrast, largemouth bass that were given a HC diet showed noticeable harm to their mitochondria, such as enlargement and distortion, and a large glycogen accumulation Notably, the administration of astaxanthin demonstrated a mitigating effect on the mitochondrial damage induced by HC diet.\u003c/p\u003e \u003cp\u003eThe qPCR was employed to investigate whether HC diet activated apoptotic pathways dependent on death receptors or mitochondria. For this objective, the measurement of gene expression levels in the caspase family was conducted. Compared to CON diet, there was a notable increase in the levels of \u003cem\u003ecaspase-3\u003c/em\u003e and \u003cem\u003ecaspase-9\u003c/em\u003e, whereas the levels of \u003cem\u003ecaspase-8\u003c/em\u003e remained unchanged in HC diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Afterward, we proceeded to examine the expression of different genes related to the Bcl-2 family. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, HC diet up-regulated \u003cem\u003ebax\u003c/em\u003e and \u003cem\u003ebad\u003c/em\u003e, while downregulated \u003cem\u003ebcl-2\u003c/em\u003e. Importantly, these effects were effectively reversed by astaxanthin. The findings clearly indicated that astaxanthin effectively shielded largemouth bass from mitochondrial-dependent apoptosis caused by HC diet. The qPCR analysis also revealed that astaxanthin effectively impaired inflammatory factors expression (\u003cem\u003etnf-α, il-6\u003c/em\u003e and \u003cem\u003eil-8\u003c/em\u003e) and increased the expression of \u003cem\u003eil-10\u003c/em\u003e associated with inflammation induced by high carbohydrate intake, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eF. Meanwhile, the HC diet was found to significantly downregulate the expression of antioxidant capacity genes (\u003cem\u003ecat\u003c/em\u003e and \u003cem\u003esod1\u003c/em\u003e), importantly, these effects were effectively reversed by HCA diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). In addition, the results indicated that the increase of serum ALT and AST activities induced by HC diet was reduced by HCA diet (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e4\u003c/span\u003eH and I).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAstaxanthin suppressed HG-induced apoptosis in largemouth bass primary hepatocytes\u003c/h2\u003e \u003cp\u003eTo further investigate the advantageous mechanism of astaxanthin in largemouth bass, primary hepatocytes were treated with low glucose (LG) or high glucose (HG) conditions, along with varying doses of astaxanthin (10\u0026ndash;50 \u0026micro;M). Cell viability was assessed using CCK8 assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003eA), revealing that astaxanthin effectively ameliorated the decline in cell viability caused by HG treatment over a 48-h period, with the most significant improvement observed at concentrations of 30 or 50 \u0026micro;M. The proportion of total injured cells was measured using annexin V-FITC/PI staining, based on this, it was found that primary hepatocytes treated with astaxanthin exhibited a lower proportion of injured cells compared to those not treated \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). The results demonstrated that treatment with HG resulted in approximately 22% cell death in primary hepatocytes. Flow cytometry was employed to measure ROS production, which demonstrated that HG treatment led to an increase in ROS levels compared to LG treatment, whereas astaxanthin treatment showed a concentration-dependent decrease in ROS production (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e5\u003c/span\u003eC), with the most pronounced effect observed at a concentration of 50 \u0026micro;M. Nevertheless, the existence of astaxanthin at levels of 30 or 50 \u0026micro;M considerably increased the rate of cell viability. Consequently, further investigation utilized a concentration of 50 \u0026micro;M astaxanthin (named HGA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eAstaxanthin improved apoptosis induced by high-glucose via p38MAPK/bcl-2/caspase-3 signaling pathway\u003c/h2\u003e \u003cp\u003eThe significance of the mitogen-activated protein kinase (MAPK) signaling pathway in apoptosis has been highlighted [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This pathway encompasses the ERK, JNK, and p38MAPK pathways, which are known to be crucial in various biological processes such as inflammation, cellular growth, and stress response [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In order to elucidate the impact of astaxanthin treatment on the MAPK pathway, western blotting was conducted in vitro model. The findings of this study indicate that HG treatment leads to the activation of ERK, JNK, and p38MAPK phosphorylation. Conversely, HGA treatment inhibits the phosphorylation of p38 MAPK, but not ERK and JNK. Additionally, HG treatment results in an increase in protein expression of CAS3, whereas HGA treatment blocks this increased expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The p-p38 fluorometric assay demonstrated that the heightened fluorescent intensity of p-p38 in HG treatment was reversed by treatment with astaxanthin (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Thus, we ensured that astaxanthin significantly inhibited the p38MAPK signal pathway. As an inhibitor of the p38MAPK signaling pathway, stimulation with SB203580 significantly inhibited the phosphorylation level of p38MAPK. In this study, pretreatment with SB203580 significantly inhibited CAS3 expression at the gene and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and D). Furthermore, this effect was significantly enhanced by the addition of astaxanthin. The gene expression levels of \u003cem\u003ebcl-2\u003c/em\u003e and \u003cem\u003ebad\u003c/em\u003e were significantly altered in cells treated with HG and HGA, in the presence of SB203580, whereas there were no notable differences observed in the expression of \u003cem\u003ebax\u003c/em\u003e and \u003cem\u003ecaspase-9\u003c/em\u003e. These findings suggest that astaxanthin may hinder apoptosis induced by high glucose through the p38MAPK/bcl-2/caspase-3 signaling pathway, thereby proposing a novel function for p38MAPK in the regulation of astaxanthin-mediated apoptosis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEarlier studies have successfully shown the limited use of glucose in largemouth bass, where an excessive intake of carbohydrates had a detrimental impact on their growth and overall health [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In the present investigation, largemouth bass subjected to excessive carbohydrate intake exhibited a notable decline in WG, survival, and SGR. Recent research has increasingly revealed the multifaceted benefits of astaxanthin in aquatic animals, including growth promotion, antioxidation, stress reduction, immune enhancement, and inflammation alleviation. In this study, the supplementation of astaxanthin led to an improvement of growth performance in largemouth bass fed HC diet. The inclusion of astaxanthin with a concentration of 0.01% had notable beneficial effect on the growth of \u003cem\u003eTrachinotus ovatus\u003c/em\u003e when fed a high-fat diet [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Nevertheless, there was no notable disparity in the developmental progress of \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e when exposed to a 0.05% ASX concentration [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. A prior investigation has demonstrated that astaxanthin alleviated the obesity caused by a high-fat diet in mice [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. CF and VSI were employed as indicators of fish fatness [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and our findings showed that the inclusion of astaxanthin effectively reduced the increase in CF and VSI in largemouth bass fed with HC diet.\u003c/p\u003e \u003cp\u003eGenerally speaking, the elevation of serum insulin level was the primary physiological response to a rise in plasma glucose levels during the GTT test [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. This study confirmed the phenomenon of glucose intolerance in largemouth bass, characterized by higher levels of serum glucose during a GTT, which consistent with the discoveries of prior research [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In the present study, HC diet leads to increased serum glucose levels and decreased plasma insulin levels, which indicated a reduced sensitivity to insulin, which may be caused by insufficient insulin secretion or insulin resistance. RNA-seq analysis of largemouth bass indicated that both HC and HCA diets caused significant impacts on glycolysis/gluconeogenesis pathways. This suggests that astaxanthin plays an essential role in the modulation of glucose homeostasis in response to treatment with HC diet. Similar to other vertebrates, insulin plays a crucial role in the regulation of glycolysis and gluconeogenesis processes in fish [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Our study demonstrated that astaxanthin enhances systemic glucose tolerance and reduces serum insulin levels, but, it did not alter expression of insulin resistance genes in the liver during the GTT. Arguably, astaxanthin is likely to be different in different organs, or perhaps at different time in the same organ.\u003c/p\u003e \u003cp\u003eInsulin primarily exerts its metabolic effects in the liver via the PI3K/Akt signaling pathway. Insulin resistance may occur when there is a dysfunction in this communication pathway within liver tissues. Previous research has demonstrated that AST has the ability to mitigate growth, decrease oxidative stress, enhance insulin sensitivity, and activate the IRS/PI3K/Akt signaling pathway in mice fed a high-fat and high-fructose diet [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Ezzat et al. [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] have identified PTP1B as a possible treatment target for diabetes, functioning as a suppressor of the insulin signaling pathway. In the current study, we present provide evidence for the initial instance to indicate that astaxanthin upregulated \u003cem\u003epi3kr1\u003c/em\u003e mRNA expression and downregulated PTP1B protein expression level. Notably, astaxanthin exhibited an enhancement in Akt phosphorylation. Presumably, astaxanthin could potentially assume a crucial role in HC fed largemouth bass by reinstating insulin secretion and insulin sensitivity. Moreover, this research offers the preliminary validation that astaxanthin efficiently controls the PTP1B/PI3K/Akt signaling cascade in the liver. Although insulin promotes glycogen synthesis by suppression of GSK3 kinase, the role of this regulatory pathway is very limited [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Li et al. found a GSK3-independent insulin-stimulated glycogen synthesis pathway in mice [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, more research is needed to determine the specific mechanism.\u003c/p\u003e \u003cp\u003eHistopathological examinations revealed that astaxanthin supplementation effectively ameliorated liver vacuolization, excessive accumulation of liver glycogen and induced by the HC diet, which indicated that inflammation was induced by a high carbohydrate feed in largemouth bass. Additionally, the activities of serum AST and ALT were notably reduced, indicating that astaxanthin indeed alleviated liver injury in largemouth bass subjected to the HC diet. Astaxanthin has been widely studied and acclaimed as a powerful antioxidant and anti-inflammatory agent under certain pathological conditions [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. When the liver becomes damaged, hepatocytes secrete excessive amounts of inflammatory factors, such as \u003cem\u003etnf-α\u003c/em\u003e, \u003cem\u003eil-1β\u003c/em\u003e, \u003cem\u003eil-6\u003c/em\u003e and \u003cem\u003eil-8\u003c/em\u003e etc. [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In the present study, \u003cem\u003etnf-α\u003c/em\u003e, \u003cem\u003eil-6\u003c/em\u003e and \u003cem\u003eil-8\u003c/em\u003e increased, and \u003cem\u003eil-10\u003c/em\u003e expression decreased in HC diet, whereas, astaxanthin has the ability to improve the high-carbohydrate induced hepatic inflammation. On the other hand, HC diet finally induced a reduction on mRNA levels \u003cem\u003ecat\u003c/em\u003e and \u003cem\u003esod1\u003c/em\u003e in the liver of largemouth bass, which indicated that HC diet would breakdown the antioxidant system, resulting in weak antioxidant capacity of the liver. Similarly, astaxanthin dietary supplementation recovery the liver redox state.\u003c/p\u003e \u003cp\u003eIn this study, GO analysis showed that astaxanthin plays an important role in regulating the signaling pathways of apoptosis and programmed death. Programmed cell death, also referred to as apoptosis, consists of two primary routes: the intrinsic pathway, which engages the mitochondria, and the extrinsic pathway, which involves death receptors [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Activation of executioner caspase-3 occurs in both pathways [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Upon activation of the intrinsic pathway, the pro-apoptotic proteins Bax and Bad in the Bcl-2 family were increased, while the anti-apoptotic proteins Bcl-2 was decreased, resulting in an imbalance in the Bax to Bcl-2 ratio [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The utilization of RT-PCR analysis revealed that the stimulation of HC diet caused the increase of c\u003cem\u003easpase-3\u003c/em\u003e, \u003cem\u003ecaspase-9\u003c/em\u003e and \u003cem\u003ebad\u003c/em\u003e expressions, and concurrently reduced the expression of \u003cem\u003ebcl-2\u003c/em\u003e. However, the administration of astaxanthin effectively restored the expression levels of these genes to their normal levels. These findings unequivocally demonstrate that astaxanthin serves as a protective agent for largemouth bass against HC diet. The existing scholarly investigations pertaining to the impact of excessive carbohydrate consumption on largemouth bass primarily concentrate on transcript levels, enzyme activity, and metabolites at the individual level [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. However, there is a scarcity of literature regarding the examination at the cellular level. Afterwards, we utilized primary hepatocytes cultured in a high glucose setting as a representation to evaluate the changes caused by astaxanthin on cell growth and cell death. Our findings indicate that astaxanthin exhibited a significant ability to enhance cell survival and reduce the rate of apoptosis in a dose-dependent manner. Under typical cellular circumstances, the production and removal of ROS maintain in a balanced and ever-changing state. However, when the body is stimulated by specific factors, an overproduction of ROS can occur [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The overabundance of ROS has the potential to initiate a series of successive responses, which may involve the initiation of the caspase signaling pathway, ultimately leading to cellular apoptosis [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Through the utilization of primary hepatocytes, our study demonstrated that exposure to high glucose levels induced a substantial rise in ROS generation, which may be the reason why high glucose induces apoptosis.\u003c/p\u003e \u003cp\u003eIt has been demonstrated that MAPK pathway activation is crucial to a wide variety of cellular processes such as cell proliferation, differentiation, and apoptosis [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. In the present investigation, the involvement of MAPK signaling in the development of metabolic liver diseases in largemouth bass was examined, and it was found that the phosphorylation of ERK1/2, JNK1/2, and p38MAPK was significantly increased. As a super antioxidant, astaxanthin has been shown to exhibit efficacy in the treatment of diabetic mellitus by activating the NF-κB pathway, suppressing anti-apoptotic activity via modulation of MAPKs and PI3K/Akt pathways [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Our observation that astaxanthin significantly inhibits phosphorylation of p38MAPK, but not ERK1/2 and JNK1/2. This result indicates that the mechanism of astaxanthin-inhibited apoptosis might differ from previous studies. In response to various stressors, p38MAPK plays a vital role in triggering apoptosis. To further explore and confirm the pivotal role of p38MAPK in HG-induced primary hepatocytes apoptosis, a p38MAPK inhibitor, SB203580, was utilized. SB203580 did inhibit the protein expression of CAS3 and affect the gene expression of \u003cem\u003ebcl-2\u003c/em\u003e, \u003cem\u003ebax\u003c/em\u003e and \u003cem\u003ecaspase-3\u003c/em\u003e, underlining the key role of p38MAPK in promoting cell apoptosis. Moreover, the present study also demonstrated that astaxanthin may hinder apoptosis induced by high glucose by targeting p38MAPK/bcl-2/caspase-3 signaling pathway.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn a word, astaxanthin can reduce liver injury in diabetic largemouth bass by improving dual regulation of PTP1B/PI3K/Akt and p38 MAPK/bcl-2/caspase-3 pathways. This is the first study on astaxanthin-mediated on the relationship among insulin resistance, p38 MAPK and mitochondrial apoptosis in fish nutritional metabolism. What's more, it is also the first study to elucidate the potential regulatory function of astaxanthin in improving fish sugar utilization through the PTP1B/PI3K/Akt axis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003eacadm:\u003c/strong\u003e acyl-CoA dehydrogenase medium\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAKT: \u003c/strong\u003eprotein kinase B\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eALT: \u003c/strong\u003ealanine transaminase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAMPK: \u003c/strong\u003eadenosine 5\u0026lsquo;-monophosphate (AMP)-activated protein kinase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAST: \u003c/strong\u003easpartate transaminase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eASX:\u003c/strong\u003e astaxanthin\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ebcl-2:\u003c/strong\u003e B-cell lymphoma-2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ebad: \u003c/strong\u003eBCL2 associated agonist of cell death\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ebax: \u003c/strong\u003eBCL-2-associated X protein\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBW:\u003c/strong\u003e body weight\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ecat: \u003c/strong\u003ecatalase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCCK8: \u003c/strong\u003ecell counting kit-8\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCF: \u003c/strong\u003econdition factor\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCON:\u003c/strong\u003e control\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ecytb: \u003c/strong\u003ecytochrome b\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDMEM:\u003c/strong\u003e Dulbecco modified Eagle medium\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEDTA: \u003c/strong\u003eethylenediaminetetraacetic acid\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eef-1\u0026alpha;:\u003c/strong\u003e elongation factor 1\u0026alpha;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eenpp1:\u003c/strong\u003e phosphodiesterase 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFBS: \u003c/strong\u003efetal bovine serum\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFITC:\u003c/strong\u003e fluorescein isothiocyanate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003egsh-px:\u003c/strong\u003e glutathione peroxidase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGSK3\u0026beta;:\u003c/strong\u003e glycogen synthase kinase 3 \u0026beta;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGTT: \u003c/strong\u003eglucose tolerance test\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003egys2:\u003c/strong\u003e glycogen synthase 2\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH\u0026amp;E: \u003c/strong\u003ehematoxylin and eosin\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHSI: \u003c/strong\u003ehepatosomatic index\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eir:\u003c/strong\u003e insulin receptor\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eir-\u0026beta;:\u003c/strong\u003e insulin receptor \u0026beta;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eirs1:\u003c/strong\u003e insulin receptor substrate1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eil-6: \u003c/strong\u003einterleukin-6\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eil-8: \u003c/strong\u003einterleukin-8\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eil-10: \u003c/strong\u003einterleukin-10\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMAPK:\u003c/strong\u003e microtubule-associated protein kinase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ep-Akt:\u003c/strong\u003e phosphorylation of protein kinase B\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePAS: \u003c/strong\u003eperiodic acid-schiff\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBS:\u003c/strong\u003e phosphate-buffered saline\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePI: \u003c/strong\u003epropidium iodide\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePI3K:\u003c/strong\u003e phosphoinositide 3-kinase\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePTP1B: \u003c/strong\u003eprotein tyrosine phosphatase-1B\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePVDF: \u003c/strong\u003epolyvinylidene fluoride\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eqRT-PCR:\u003c/strong\u003e quantitative real-time PCR\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eROS: \u003c/strong\u003ereactive oxygen species\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSGR: \u003c/strong\u003especific growth rate\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003esod1:\u003c/strong\u003e superoxide dismutase 1\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTEM:\u003c/strong\u003e transmission electron microscopy\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVSI:\u003c/strong\u003e viscerosomatic index\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWG:\u003c/strong\u003e weight gain\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo datasets were generated or analysed during the current study.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Project of National Natural Science Foundation of China (32172982), and Project of Science and Technology of Guangdong Province (2021B0202050002), and Project of Science and Technology of Guangdong Province (2019B110209005), and Guangdong Provincial Special Fund for Modern Agriculture Industry Technology Innovation Teams (2019KJ143).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhihong Liao: Conceptualization, Methodology, Formal analysis, Writing-original draft. Xuanshu He: Methodology, Data curation, Investigation. Anqi Chen: Conceptualization, Writing-review \u0026amp; editing. Jian Zhong: Writing-review \u0026amp; editing. Sihan Lin: Writing-review \u0026amp; editing. Yucai Guo: Writing-review \u0026amp; editing. Xin Cui: Methodology, Data curation. Baoyang Chen: Methodology. Wei Zhao and Jin Niu: Conceptualization, Supervision, Writing-review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe National Institutes of Health (NIH) guidelines for laboratory animal care and use were strictly followed during all experimental procedures. The study protocol was approved by Experimental Animal Ethics Committee of Sun Yat-Sen University. The protocol number is SYSU-LS-IACUC-2024-0020.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRen M, Ai Q, Mai K, Ma H, Wang X. Effect of dietary carbohydrate level on growth performance, body composition, apparent digestibility coefficient and digestive enzyme activities of juvenile cobia, rachycentron canadum l. Aquac Res. 2011;42(10):1467-1475. https://doi.org/10.1111/j.1365-2109.2010.02739.x\u003c/li\u003e\n\u003cli\u003eZhou C, Ge X, Niu J, Lin H, Huang Z, Tan X. Effect of dietary carbohydrate levels on growth performance, body composition, intestinal and hepatic enzyme activities, and growth hormone gene expression of juvenile golden pompano, \u003cem\u003etrachinotus ovatus\u003c/em\u003e. Aquaculture. 2015;437:390-397. https://doi.org/10.1016/j.aquaculture.2014.12.016\u003c/li\u003e\n\u003cli\u003eMa H, Mou M, Pu D, Lin S, Chen Y, Luo L. Effect of dietary starch level on growth, metabolism enzyme and oxidative status of juvenile largemouth bass, \u003cem\u003emicropterus salmoides\u003c/em\u003e. Aquaculture. 2019;498:482-487. https://doi.org/ 10.1016/j.aquaculture.2018.07.039\u003c/li\u003e\n\u003cli\u003eZhang Y, Xie S, Wei H, Zheng L, Liu Z, Fang H, Xie J, Liao S, Tian L, Liu Y, Niu J. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Aquac Nutr. 2020;26(4):1083-1095. https://doi.org/ 10.1111/anu.13066\u003c/li\u003e\n\u003cli\u003eEnes P, Peres H, Pou s\u0026atilde; O-Ferreira P, Sanchez-Gurmaches J, Navarro I, Guti\u0026eacute;rrez J, Oliva-Teles A. Glycemic and insulin responses in white sea bream \u003cem\u003ediplodus sargus\u003c/em\u003e, after intraperitoneal administration of glucose. Fish Physiol Biochem. 2012;38(3):645-652. https://doi.org/ 10.1007/s10695-011-9546-4 10.1007/s10695-011-9546-4\u003c/li\u003e\n\u003cli\u003eChen Y, Wang X, Pi R, Feng J, Luo L, Lin S, Wang D. Preproinsulin expression, insulin release, and hepatic glucose metabolism after a glucose load in the omnivorous GIFT tilapia \u003cem\u003eOreochromis niloticus\u003c/em\u003e. Aquaculture. 2017;482:183-192. https://doi.org/ 10.1016/j.aquaculture.2017.10.001\u003c/li\u003e\n\u003cli\u003eKamalam B, Medale F, Panserat S. Utilization of dietary carbohydrates in farmed fishes: new insights on influencing factors, biological limitations and future strategies. Aquaculture. 2017;467:3-27. https://doi.org/ 10.1016/j.aquaculture.2016.02.007\u003c/li\u003e\n\u003cli\u003eEnes P, Peres H, Sanchez-Gurmaches J, Navarro I, Guti\u0026eacute;rrezJ, Oliva-Teles A. Insulin and igf-i response to a glucose load in european sea bass (\u003cem\u003edicentrarchus labrax\u003c/em\u003e) juveniles. Aquaculture. 2011;315 (3-4):321-326. https://doi.org/ 10.1016/j.aquaculture.2011.02.042\u003c/li\u003e\n\u003cli\u003eBhuvaneswari S, Arunkumar E, Viswanathan P, Anuradha C. Astaxanthin restricts weight gain, promotes insulin sensitivity, and curtails fatty liver disease in mice fed with obesity promoting diet. Process Biochem. 2010; 45:1406\u0026ndash;1414. https://doi.org/ 10.1016/j.procbio.2010.05.016\u003c/li\u003e\n\u003cli\u003eArunkumar E, Bhuvaneswari S, Anuradha C. An intervention study in obese mice with astaxanthin, a marine carotenoid-effects on insulin signaling and pro-inflammatory cytokines. Food Funct. 2012;3(2):120-126. https://doi.org/ 10.1039/c1fo10161g\u003c/li\u003e\n\u003cli\u003eLisette T, Hoekstra W, Graaf D, Geert A, Nibourg G, Heger M, Bennink R. Physiological and biochemical basis of clinical liver function tests: a review clinical liver function tests. Ann Sur. 2013;257(1):p27-36. https://doi.org/ 10.1097/SLA.0b013e31825d5d47\u003c/li\u003e\n\u003cli\u003eM\u0026ouml;ller A, Koryt\u0026aacute; T, K\u0026ouml;llner B, Schmidt-Posthaus H, Segner H. The teleostean liver as an immunological organ: intrahepatic immune cells (ihics) in healthy and benzo[a]pyrene challenged rainbow trout (\u003cem\u003eoncorhynchus mykiss\u003c/em\u003e). Deve Comp Immunol. 2014;46(2):518-529. https://doi.org/10.1016/j.dci.2014.03.020\u003c/li\u003e\n\u003cli\u003eSales C, Silva R, Amaral Mar\u0026iacute;lia G, Domingos Fabr\u0026iacute;cio F, Ribeiro R, Thom\u0026eacute; Ralph G, Santos H\u0026eacute;lio B. Comparative histology in the liver and spleen of three species of freshwater teleost. Neotrop Ichthyolo. 2017;15(1):e160041. https://doi.org/ 10.1590/1982-0224-20160041\u003c/li\u003e\n\u003cli\u003eZhang W, Liu K, Tan B, Liu H, Dong X, Yang X, Chi S, Zhang S, Wang H. Transcriptome, enzyme activity and histopathology analysis reveal the effects of dietary carbohydrate on glycometabolism in juvenile largemouth bass, \u003cem\u003emicropterus salmoides\u003c/em\u003e. Aquaculture. 2019;504:39-51. https://doi.org/ 10.1016/j.aquaculture.2019.01.030\u003c/li\u003e\n\u003cli\u003eLin S, Shi C, Mu M, Chen Y, Luo L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, \u003cem\u003emicropterus salmoides\u003c/em\u003e. Fish Shellfish Immun. 2018;78:121-126. https://doi.org/ 10.1016/j.fsi.2018.04.046\u003c/li\u003e\n\u003cli\u003eQin Y, Zhang L, Chen P, Liang X. Dietary bile acids enhance growth, and alleviate hepatic fibrosis induced by a high starch diet via akt/foxo1 and camp/ampk/srebp1 pathway in \u003cem\u003emicropterus salmoides\u003c/em\u003e. Front physiol. 2019;10:1430-1430. https://doi.org/ 10.3389/fphys.2019.01430\u003c/li\u003e\n\u003cli\u003eMccarty M. Full-spectrum antioxidant therapy featuring astaxanthin coupled with lipoprivic strategies and salsalate for management of non-alcoholic fatty liver disease. Med Hypotheses. 2011;77(4):550-556. https://doi.org/ 10.1016/j.mehy.2011.06.029\u003c/li\u003e\n\u003cli\u003eBhuvaneswari S, Yogalakshmi B. Astaxanthin reduces hepatic endoplasmic reticulum stress and nuclear factor-\u0026kappa;b-mediated inflammation in high fructose and high fat diet-fed mice. Cell Stress Chaperon. 2014;19(2):183-191. https://doi.org/ 10.1007/s12192-013-0443-x\u003c/li\u003e\n\u003cli\u003eSila A, Kamoun Z, Ghlissi Z, Makni M, Nasri M, Sahnoun Z, Nedjar-Arroume N, Bougatef A. Ability of natural astaxanthin from shrimp by-products to attenuate liver oxidative stress in diabetic rats. Pharmacol Rep. 2015;67(2):310-316. https://doi.org/ 10.1016/j.pharep.2014.09.012\u003c/li\u003e\n\u003cli\u003eXie S, Yin P, Tian L, Yu Y, Niu J. Dietary supplementation of astaxanthin improved the growth performance, antioxidant ability and immune response of juvenile largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e) fed high-fat diet. Mar Drugs. 2020;18(12):642. https://doi.org/ 10.3390/md18120642\u003c/li\u003e\n\u003cli\u003eHe X, Chen A, Liao Z, Zhang Y, Lin G, Zhuang Z, Liu Y, Wei H, Wang Z, Wang Y, Niu J. Diet supplementation of organic zinc positively affects growth, antioxidant capacity, immune response and lipid metabolism in juvenile largemouth bass, \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Brit J Nutr. 2023; 1-15. https://doi.org/ 10.1017/S0007114523000909\u003c/li\u003e\n\u003cli\u003eChen P, Wu X, Gu X, Han J, Xue M, Liang X. FoxO1 in \u003cem\u003eMicropterus salmoides\u003c/em\u003e: Molecular characterization and its roles in glucose metabolism by glucose or insulin-glucose loading. Gen Comp Endocr. 2021;310:1-11. https://doi.org/ 10.1016/j.ygcen.2021.113811\u003c/li\u003e\n\u003cli\u003eQin Y, Zhang L, Chen P, Liang X. Dietary bile acids enhance growth, and alleviate hepatic fibrosis induced by a high starch diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 pathway in \u003cem\u003eMicropterus salmoides\u003c/em\u003e. Front Physiol. 2019;10:p1430. https://doi.org/ 10.3389/fphys.2019.01430\u003c/li\u003e\n\u003cli\u003eWada T, Penninger J. Mitogen-activated protein kinases in apoptosis regulation. Oncogene. 2004;23:2838-2849. https://doi.org/ 10.1038/sj.onc.1207556\u003c/li\u003e\n\u003cli\u003eSun J, Nan G. The Mitogen-activated protein kinase (MAPK) signaling pathway as a discovery target in stroke. J Mol Neurosci. 2016;59:90-8. https://doi.org/ 10.1007/s12031-016-0717-8\u003c/li\u003e\n\u003cli\u003eGou S, Chen N, Xu X, Liu Z, Yin J. Effects of dietary digestible starch levels on growth performance, body composition, and non- specific immunological index of largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e). Journal of Fisheries of China. 2015.\u003c/li\u003e\n\u003cli\u003eLi S, Sang C, Turchini G, Wang A, Chen N. Starch in aquafeeds: the benefits of a high amylose to amylopectin ratio and resistant starch content in diets for the carnivorous fish, largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e). Brit J Nutr. 2020;124(11):1-29. https://doi.org/ 10.1017/S0007114520002214\u003c/li\u003e\n\u003cli\u003eFang H, Xie J, Zhao W, Liu Z, Liu Y, Tian L, Niu J. Study supplementation of astaxanthin in high-fat diet on growth performance, antioxidant ability, anti-inflammation, non-specific immunity and intestinal structure of juvenile \u003cem\u003etrachinotus ovatus\u003c/em\u003e. Aquac Nutr. 2021;27(6):2575-2586. https://doi.org/ 10.1111/anu.13386\u003c/li\u003e\n\u003cli\u003eZhao W, Yao R, Wei H, Guo Y, Chen A, Chen B, Niu J. Astaxanthin, bile acid and chlorogenic acid attenuated the negative effects of high-fat diet on the growth, lipid deposition, and liver health of \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). Aquaculture. 2023;567:739255. https://doi.org/ 10.1016/j.aquaculture.2023.739255\u003c/li\u003e\n\u003cli\u003eBoshra S. Astaxanthin attenuates adiponectin, calprotectin, mirna222 and mirna378 in obesity induced by high-fat diet in rats. Curr Pharm Bio. 2021;23(4):pp. 609-618. https://doi.org/ 10.2174/1389201022666210810105804\u003c/li\u003e\n\u003cli\u003eLi X, Zheng S, Ma X, Cheng K, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e). part i: effects of poultry by-product meal and soybean meal on growth, feed utilization, and health. Amino Acids. 2020;53:33-47. https://doi.org/ 10.1007/s00726-020-02920-6\u003c/li\u003e\n\u003cli\u003eLi X, Zheng S, Cheng K, Ma X, Wu G. Use of alternative protein sources for fishmeal replacement in the diet of largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e). part ii: effects of supplementation with methionine or taurine on growth, feed utilization, and health. Amino Acids. 2021; 53: 49-62. https://doi.org/ 10.1007/s00726-020-02920-6\u003c/li\u003e\n\u003cli\u003eDu Z, Turchini G. Are we actually measuring growth?-an appeal to use a more comprehensive growth index system for advancing aquaculture research. Reviews in Aquaculture. 2021;214(2):525-527. https://doi.org/ 10.1111/raq.12604\u003c/li\u003e\n\u003cli\u003eZeng K, Tian L, Sirek A, Shao W, Liu L, Chiang Y, Chernoff J, Dominic S, Weng J, Jin T. Pak1 mediates the stimulatory effect of insulin and curcumin on hepatic ChREBP expression. J Mol Cell Biol. 2017;9(5):384-394. https://doi.org/ 10.1093/jmcb/mjx031\u003c/li\u003e\n\u003cli\u003eLi X, Han T, Zheng S, Wu G. Hepatic glucose metabolism and its disorders in fish. Adv Exp Med Biol. 2021;1354:pp 207-236. https://doi.org/ 10.1007/978-3-030-85686-1_11\u003c/li\u003e\n\u003cli\u003eJin J, Panserat S, Kamalam B, Aguirre P, V\u0026eacute;ron V, M\u0026eacute;dale F. Insulin regulates lipid and glucose metabolism similarly in two lines of rainbow trout divergently selected for muscle fat content. Gen Comp Endocri. 2014;204:49-59. https://doi.org/ 10.1016/j.ygcen.2014.04.027\u003c/li\u003e\n\u003cli\u003eEzzat S, Bishbishy M, Habtemariam S, Salehi B, Sharifi-Rad J. Looking at marine-derived bioactive molecules as upcoming anti-diabetic agents: a special emphasis on ptp1b inhibitors. Molecules. 2018;23(12):3334. https://doi.org/ 10.3390/molecules23123334\u003c/li\u003e\n\u003cli\u003eWan M, Leavens K, Hunter R, Koren S, Wilamowitz-Moellendorff A, Lu M, Satapati S, Chu Q, Sakamoto K, Burgess C, Birnbaum M. GSK3-independent pathway controls postprandial hepatic glycogen deposition. Cell Metab. 2013;18:99-105. https://doi.org/ 10.1016/j.cmet.2013.06.001\u003c/li\u003e\n\u003cli\u003eLi Q, Zhao Q, Zhang J, Zhou L, Li P. The protein phosphatase 1 complex is a direct target of akt that links insulin signaling to hepatic glycogen deposition. Cell Rep. 2019;28(13):3406-3422.e7. https://doi.org/ 10.1016/j.celrep.2019.08.066\u003c/li\u003e\n\u003cli\u003eCaruso M, Sheridan M. New insights into the signaling system and function of insulin in fish. Gene Comp Endocr. 2011;173(2):227-247. https://doi.org/10.1016/j.ygcen.2011.06.014\u003c/li\u003e\n\u003cli\u003ePrisingkorn W, Prathomya P, Liu H, Deng F, Wang W. Transcriptomic and metabolomics analyses show that high carbohydrate induces fatty liver in blunt snout bream (\u003cem\u003eMegalobrama amblycephala\u003c/em\u003e). BMC Genomics. 2017;18(1):856. https://doi.org/ 0.20944/preprints201701.0117.v1\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Arcy M. Cell death: a review of the major forms of apoptosis, necrosis and autophagy. Cell Biol Int. 2019;43(6):582-592. https://doi.org/ 10.1002/cbin.11137\u003c/li\u003e\n\u003cli\u003eMcilwain D, Berger T, Mak T. Caspase functions in cell death and disease. Cold Spring Harb Perspect Biol. 2015;7(4):a026716. https://doi.org/ 10.1101/cshperspect.a026716\u003c/li\u003e\n\u003cli\u003ePea-Blanco A, Ana J, Garc\u0026iacute;a-S\u0026aacute;ez. Bax, bak and beyond - mitochondrial performance in apoptosis. FEBS J. 2018;285(3):416-431. https://doi.org/ 10.1111/febs.14186\u003c/li\u003e\n\u003cli\u003eGao B, Zhang X, Zhang Y, Li S, Lu L, Xu D, Liu X. Effects of dietary carbohydrate levels on the growth, glycometabolism, antioxidant capacity and metabolome of largemouth bass (\u003cem\u003emicropterus salmoides\u003c/em\u003e). Aquac Res. 2022;53(10):3748-3758. https://doi.org/ 10.1111/are.15878\u003c/li\u003e\n\u003cli\u003eChoi E, Park C, Hwang H, Hong S, Kim G, Cho E, Kim W, Choi Y. Baicalein induces apoptosis via ros-dependent activation of caspases in human bladder cancer 5637 cells. Int J Oncol. 2016;49(3):1009-1018. https://doi.org/ 10.3892/ijo.2016.3606\u003c/li\u003e\n\u003cli\u003eZhang Y, Wang G, Wang T, Cao W, Zhang L, Chen X. Nrf2-keap1 pathway-mediated effects of resveratrol on oxidative stress and apoptosis in hydrogen peroxide-treated rheumatoid arthritis fibroblast‐like synoviocytes. Ann NY Acad Sci. 2019;1457(1):166-178. https://doi.org/10.1111/nyas.14196\u003c/li\u003e\n\u003cli\u003eSu Y, Zong S, Wei C, Song F, Feng H, Qin A, Lian Z, Fu F, Shao S, Fang F, et al. Salidroside promotes rat spinal cord injury recovery by inhibiting inflammatory cytokine expression and NF-\u0026kappa;B and MAPK signaling pathways. J Cell Physiol. 2019;234(8):14259-14269. https://doi.org 10.1002/jcp.28124.\u003c/li\u003e\n\u003cli\u003eLandon R, Gueguen V, Petite H, Letourneur D, Pavon-Djavid G, Anagnostou F. Impact of astaxanthin on diabetes pathogenesis and chronic complications. Mar. Drugs. 2020;18:p. 357. https://doi.org 10.3390/md18070357\u003c/li\u003e\n\u003cli\u003eYu L, Yu H, Liang X, Li N, Wang X, Li F, Wu X, Zheng Y, Xue M, Liang X. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (\u003cem\u003eMicropterus salmoides\u003c/em\u003e). Fish Shellfish Immunolo.2018;72:220-229. https://doi.org/ 10.1016/j.fsi.2017.10.054\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-and-bioscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbio","sideBox":"Learn more about [Cell \u0026 Bioscience](http://cellandbioscience.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cbio/default.aspx","title":"Cell \u0026 Bioscience","twitterHandle":"@OACellBiology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Astaxanthin, largemouth bass, liver injury, Apoptosis, insulin resistance","lastPublishedDoi":"10.21203/rs.3.rs-4337374/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4337374/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAstaxanthin (ASX) has been documented to exert beneficial influence on various processes in fish. Largemouth bass serves as a common model for studying glucose-induced liver disease, making it imperative to investigate the regulatory mechanisms underlying its liver health.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLargemouth bass were fed with a control diet (CON), a high carbohydrate diet (HC), or a HC diet supplemented astaxanthin (HCA) for 8-weeks, followed by the glucose tolerance test (GTT). Primary hepatocytes were treated with low glucose and high glucose combined with different concentrations of astaxanthin for 48 h. The histopathology, enzymology, transcriptomics, molecular biology and cell biology were combined to investigate the mechanism of liver injury.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study provides evidence for the protective effects of ASX against growth performance reduction and hepatic liver injure in largemouth bass fed HC diet. In GTT, HCA diet exhibited an improvement in glucose tolerance following glucose loading. Although HCA diet did not restore the expression of insulin resistance-related genes in livers at different time during the GTT, the addition of ASX in the long-term diet did improve the insulin resistance pathway by regulating the PTP1B/PI3K/Akt signaling pathway. Hepatic transcriptome analyses showed that ASX plays an essential role in the modulation of glucose homeostasis in response to treatment with HC diet. In in vitro study, the treatment with ASX resulted in an exaltation in cell viability and a reduction in the rate of cell apoptosis and reactive oxygen species (ROS). Additionally, astaxanthin was observed to improve apoptosis induced by high-glucose via p38MAPK/bcl-2/caspase-3 signaling pathway.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAstaxanthin exhibited a protective effect against apoptosis by regulating p38MAPK/bcl-2/caspase-3 pathway, and ameliorated insulin resistance by activating the PTP1B/PI3K/Akt pathway. This study elucidated the mechanism of astaxanthin in the liver injury of largemouth bass from a new perspective and provided a new target for the treatment of insulin resistance.\u003c/p\u003e","manuscriptTitle":"Astaxanthin attenuates glucose-induced liver injury in largemouth bass: role of p38MAPK and PI3K/Akt signaling pathways","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-10 12:43:22","doi":"10.21203/rs.3.rs-4337374/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2024-07-04T23:23:05+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2024-05-20T14:42:48+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-05T16:15:38+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-30T07:37:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell \u0026 Bioscience","date":"2024-04-28T06:01:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-and-bioscience","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbio","sideBox":"Learn more about [Cell \u0026 Bioscience](http://cellandbioscience.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cbio/default.aspx","title":"Cell \u0026 Bioscience","twitterHandle":"@OACellBiology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"bf13dd19-2cc5-4803-810b-7915d6c979f9","owner":[],"postedDate":"May 10th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-23T16:00:02+00:00","versionOfRecord":{"articleIdentity":"rs-4337374","link":"https://doi.org/10.1186/s13578-024-01304-7","journal":{"identity":"cell-and-bioscience","isVorOnly":false,"title":"Cell \u0026 Bioscience"},"publishedOn":"2024-09-19 15:57:04","publishedOnDateReadable":"September 19th, 2024"},"versionCreatedAt":"2024-05-10 12:43:22","video":"","vorDoi":"10.1186/s13578-024-01304-7","vorDoiUrl":"https://doi.org/10.1186/s13578-024-01304-7","workflowStages":[]},"version":"v1","identity":"rs-4337374","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4337374","identity":"rs-4337374","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}