Mutations in PLA2G6 impair ER–mitochondria contacts and ceramide homeostasis via GRP75 in Parkinson’s disease

Mutations in PLA2G6 impair ER–mitochondria contacts and ceramide homeostasis via GRP75 in Parkinson’s disease | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mutations in PLA2G6 impair ER–mitochondria contacts and ceramide homeostasis via GRP75 in Parkinson’s disease Jiabin Liu, Qiao Yin, Rong Gao, Taole Li, Zuyan Xie, Xiurong Huang, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7426255/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Loss-of-function mutations in PLA2G6 cause mitochondrial abnormalities that contribute to Parkinson’s disease (PD), yet the precise mechanisms remain elusive. Methods We combined genetic, cellular, and pharmacological approaches to investigate the role of PLA2G6 in Parkinson’s disease. The PLA2G6 D331Y knock-in mouse model, PLA2G6 knockout cell lines, and patient-derived dopaminergic neurons were used to assess neuronal and mitochondrial phenotypes. ER–mitochondria contacts and protein interactions were examined by Focused Ion Beam-Scanning Electron Microscope, subcellular fractionation, and biochemical assays. Lipidomic profiling and immunofluorescence were applied to quantified ceramide distribution, while mitochondrial respiration, Ca²⁺ flux, and oxidative stress were evaluated by functional assays. Ceramide-lowering drugs and GRP75 overexpression were tested for therapeutic rescue in vitro and in vivo . Results Our data show that PLA2G6 localized to mitochondria-associated membranes (MAMs) and interacted with the IP3R–GRP75–VDAC1 tether. Loss of PLA2G6 reduced GRP75 levels, disrupted ER–mitochondria contacts, and weakened IP3R–GRP75–VDAC1 interactions, leading to impaired Ca²⁺ transfer and mitochondrial dysfunction. PLA2G6 deficiency caused caused pronounced accumulation of mitochondrial ceramides, particularly C16 ceramide. GRP75 was identified as a ceramide-binding protein regulating lipid turnover in addition to Ca²⁺ transfer. Restoring GRP75 or pharmacologically lowering ceramides rescues mitochondrial function in cells and alleviates motor deficits and dopaminergic neuron loss in PLA2G6 mutant mice. GRP75 reduction was also observed in peripheral blood cells and substantia nigra tissues from PD patients, supporting its clinical relevance. Conclusions Loss of PLA2G6 destabilizes GRP75, leading to disrupted MAMs and mitochondrial ceramide overload, which drive neurodegeneration. These findings support a PLA2G6–GRP75–ceramide pathway that integrates organelle communication, lipid metabolism, and mitochondrial integrity, highlighting ceramide modulation or GRP75 restoration as therapeutic strategies for PLA2G6 -linked and sporadic PD. PLA2G6 Mitochondria-associated membranes GRP75 Ceramide Mitochondrial dysfunction Parkinson’s disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Background Parkinson’s disease (PD), ranking among the most common neurodegenerative diseases, is characterized by the progressive loss of dopaminergic neurons in the brain [ 1 ]. The prevalence of PD has doubled over the past 25 years, with over 8.5 million people affected globally in 2019, making it an urging international health issue[ 2 ]. Despite significant advances in understanding the pathogenesis of PD, the precise mechanisms that drive neuronal degeneration remain elusive, highlighting the need for further research into its underlying cellular and molecular pathways[ 3 ]. Emerging evidence implicates mitochondrial dysfunction, aberrant lipid metabolism and perturbed inter-organelle signaling as central drivers of PD pathology, yet the mechanistic crosstalk among them is still obscure [ 4 – 7 ]. Loss-of-function mutations in PLA2G6 —encoding calcium-independent phospholipase A2β—cause autosomal-recessive, early-onset PD and related neuroaxonal dystrophies[ 8 , 9 ]. Pathogenic variants such as the recurrent D331Y mutation in Chinese cohorts frequently present as L-dopa–responsive PD, while other biallelic mutations identified in PARK14 families lead to dystonia-parkinsonism, cognitive decline, and axonal spheroids [ 10 , 11 ]. These findings establish PLA2G6 as PD-related gene with a phenotypic spectrum ranging from isolated parkinsonism to widespread neuroaxonal degeneration. However, despite strong genetic evidence, the physiological role and subcellular localization of PLA2G6 remain incompletely understood. Previous studies have elucidated several mechanisms by which PLA2G6 mutations contribute to PD, including neuroinflammation, ferroptosis, disrupted autophagy and ER stress, as observed in PLA2G6-linked PD models[ 12 – 15 ]. Notably, ceramide dysregulation is a critical factor, with loss of PLA2G6 function causing ceramide accumulation that disrupts retromer trafficking, induces lysosomal expansion, and accelerates neurodegeneration[ 16 ]. However, the intracellular compartmentalization of this lipid imbalance and its translation into neuronal vulnerability remain unclear. Furthermore, PLA2G6’s precise subcellular localization—whether predominantly cytosolic or associated with mitochondria or ER—remains contentious[ 17 ], and the mechanisms underlying its impact on mitochondrial integrity require further investigation. Resolving these uncertainties is essential to delineate the pathogenic cascade of PLA2G6 mutations and to identify viable therapeutic targets. Here, we show that PLA2G6 localizes to mitochondria-associated membranes (MAMs)—specialized regions of ER–mitochondria contact that coordinate lipid trafficking and calcium signaling[ 18 , 19 ]. Increasing evidence implicates MAM dysfunction in the pathogenesis of neurodegenerative diseases, including Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), and PD[ 20 ]. Within this microdomain, the canonical IP3R–GRP75–VDAC1 tether funnels Ca²⁺ into mitochondria to sustain oxidative phosphorylation and limit reactive oxygen species (ROS)[ 21 ]. Our data show that PLA2G6 loss impairs MAMs, lowers GRP75, disrupt IP3R–GRP75–VDAC1 tether and drives mitochondria-predominant ceramide accumulation, culminating in cristae collapse and respiratory failure. Targeting this PLA2G6–GRP75–ceramide axis thus emerges as a rational therapeutic strategy for PLA2G6-linked parkinsonism and, potentially, for sporadic PD and other neurodegenerative diseases characterized by mitochondrial stress. 2. Methods Experimental Model and Subject Details Generation of PLA2G6 p.D331Y knock-in mice model using CRISPR/Cas9 and animal care PLA2G6 is located on human chromosome 22q13.1. The PLA2G6 gene is highly conserved between mice and humans, and the two genes encode similar proteins with shared functions. The human PLA2G6 gene encodes a protein with a maximum length of 806 amino acids. The point mutation denoted as p.D331Y is situated within the exon 7 region of the transcript ENST00000332509 (NM_003560). Notably, the mutation site in human PLA2G6, specifically the substitution of aspartic acid (D) with tyrosine (Y) at position 331 (p.D331Y), is observed to be evolutionarily conserved when examining the corresponding region in mice. To achieve CRISPR/Cas9-mediated knock-in into PLA2G6, we selected sgRNA (F: 5’-TAGGCACCATGACACAGTCAAAG − 3’; R: 5’-AAACCTTGACTGTGTCATGGTG − 3’) that targets sequences within exon7, adapted to the homology regions of gene targeting vectors used for embryonic stem (ES) cells that cover sequences up and downstream of this site. We further construct plasmids that can simultaneously express sgRNA and Cas9 targeted at specific loci of the mouse PLA2G6 gene, as well as a Donor plasmid carrying the PLA2G6 D331Y fragment (5’-ACTAGCTCCTCAGGGAACACAGCCCTGCATGTGGCGGTGATGCGCAACCGGTTTTACTGTGTCATGGTGCTGCTGACCTACGGGGCTAATGCAGGTGCCCGCGGA-3’). Inject these two plasmids into super-ovulated mouse zygotes and transplant them into surrogate mouse uteri. After the Cas9 system cuts the DNA strand, the PLA2G6 D331Y fragment is recombined to the target site through homologous recombination. Extract DNA from the mouse tail and amplify it via PCR with specific primers (Exon7-PLA2G6-forward: CGGTCTTCACCTAATTGTTAC; Exon7-PLA2G6-Reverse: AGAAGGCATGTCTGATGTAG). Genotypes are determined by analyzing the number and size of bands after 1.5% agarose gel electrophoresis of PCR products. Sequencing of PCR products further verifies the success of the PLA2G6 D331Y mutation. F1 heterozygous mutant mice were bred from wild-type C57BL/6J mice to generate F2 heterozygous mutant mice. The resultant heterozygous knock-in mice were bred and maintained on C57BL/6J genetic background and intercrossed to generate homozygous PLA2G6 D331Y/D331Y knock-in (KI) mice. All animal experiments were performed according to protocols approved by the Ethics Review Committee for Animal Experimentation of Central South University. Cell culture and transfection MEF cells and Human Embryonic Kidney 293 (HEK293) cell line were grown in DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco, #10099158) and 100U/mL penicillin/streptomycin (Gibco, #15070063). The human neuroblastoma SH-SY5Y cell line was grown in DMEM/F-12 medium (Gibco, #11320033) supplemented with 15% fetal bovine serum (Gibco, #10099158) and 100U/mL penicillin/streptomycin (Gibco, #15070063). All cell lines were maintained in a controlled environment containing 5% CO 2 at 37°C. PLA2G6 knockout HEK293 cell lines (PLA2G6 KO cells) were generated using the CRISPR/Cas9 gene-editing. Two sgRNAs targeting the PLA2G6 gene were designed utilizing the Ensembl website ( https://www.ensembl.org/index.html ). These sgRNAs were subsequently employed to construct the sgRNA-LentiCRISPRv2 recombinant plasmid. Co-transfection of sgRNA-LentiCRISPRv2, pVSV-G (Addgene, #138479, and psPAX2 (Addgene, #12260) into HEK293T cells was performed using Lipofectamine 3000 (at a ratio of sgRNA-lentiCRISPRv2: pVSVg: psPAX2 = 2:1:3). After 24 hours, the culture medium was collected and clarified. The collected medium was then applied to infect normal HEK293 cells. Clonal cell lines were isolated by single-cell culturing in 96-well plates and subsequently screened using western blotting with an anti-PLA2G6 antibody. PLA2G6 knockdown SH-SY5Y cells (PLA2G6 KD cells) were generated using the siRNA. One negative control siRNA and two specific siRNA targeting the PLA2G6 gene were designed and generated. These two siRNA were transfected into SH-SY5Y via Lipofectamine 3000 (Thermo Fisher Scientific, #L3000075). All above cell lines were transfected with plasmids using Lipofectamine 3000 according to the manufacturer’s introductions. Imaging of dopamine transporter (DAT) in mice using PET-CT This study conducted PET-CT experiments on 12-month-old male mice weighing approximately 30–33 grams. Radiotracers were injected via tail veins, and PET imaging was performed using a Mediso nanoScan PET/MRI scanner. After image acquisition, data were processed, and dopamine transporter status was assessed by calculating the striatal-to-cerebellar uptake ratio (SUVR). The study was conducted at the Xiangya Hospital PET Imaging Center of Central South University. Immunohistochemistry (IHC) Mouse brain tissues were dehydrated in sucrose solutions (10%, 20%, 30%). After settling in each solution, they were transferred to the next higher concentration. Complete settling in 30% sucrose indicated successful dehydration. Dehydrated brain tissues from specific regions were embedded in OCT (20% sucrose solution; 1:2 ratio) in disposable molds and stored at -80°C. The cryostat (Leica CM1850, Germany) was pre-cooled to -20°C. Brain tissue samples were equilibrated for at least 1 hour at -20°C. Brain tissues were sectioned to 25µm thickness. Specific substantia nigra sections were chosen using a statistical method, with every 6th section selected. About 5–7 statistical sections were collected from each mouse's substantia nigra and placed in 1×PBS solution. Based on prior experiments, brain tissues from 9, 12, and 15-month-old mice were obtained following perfusion and separation procedures. The collected mouse brain tissues were fixed in a 4% paraformaldehyde solution for a minimum of 24 hours. To obtain paraffin sections: the tissues were then dehydrated with an ethanol gradient and clarified with xylene. Following this, the tissues were infiltrated with paraffin and embedded. Subsequently, sections were cut (Leica RM2255 microtome), starting at 12–16 µm and then transitioning to 4 µm for a more complete tissue cross-section. The sections were flattened in a water bath and mounted on glass slides. The paraffined sections were used for IHC. Deparaffinization is carried out by baking and immersion in xylene, followed by rehydration with ethanol and water. Antigen retrieval is performed to enhance antigen exposure, followed by blocking to reduce nonspecific binding. Primary antibody application, typically incubated overnight, is followed by secondary antibody treatment, with thorough washing steps. DAB and hydrogen peroxide are applied to the tissue. The HRP enzyme on the secondary antibody catalyzes the conversion of DAB into a brown-colored precipitate at the site of the antigen. Optional counterstaining can enhance nuclear visualization. Sections are gradually dehydrated and cleared in xylene for transparency, then mounted on slides and covered with slips for microscopy. The primary antibody used in this part includes mouse anti-TH (1:50; Santa Cruz, #sc-25269). The DAB kits used for IHC can be seen in the Key Resources Table. Immunofluorescence (IF) For cell samples, coat coverslips with Poly-D-Lysine (Themofisher, # 150680) for 20 min at room temperature. Grow cells on 14mm glass coverslips (Biosharp). When the cell density was at about 70%, fix the sample using 4% paraformaldehyde. The cells should be washed three times with ice-cold PBS. Then incubate the samples for 10 min with PBS containing either 0.1 Triton X-100 and Wash cells in PBS three times for 5 min. Incubate cells in the diluted antibody in 3% BSA in PBS in a humidified chamber for 1 h at room temperature. Incubate cells with both primary antibodies in 3% BSA in PBS in a humidified chamber for 1 h at room temperature or overnight at 4°C and wash three times with PBS for 5 mins each in the dark. Incubate cells with first secondary antibody in 3% BSA in PBS for 1 h at room temperature in the dark. Decant the first secondary antibody solution and wash three times with PBS for 10 min each in the dark. Incubate cells on 0.1µg/mL DAPI for 1 min and finally rinse with PBS. Mount coverslip with a drop of mounting medium. Seal coverslip with nail polish to prevent drying and movement under microscope. Store the sample in dark at -20°C. Capture fluorescent microscope images using confocal microscopy (Leica STELLARIS 8 STED, From Biomedical Center, Institute for Advanced Study of Central South University), or store the slides in a -20°C refrigerator if not captured on the same day. Images were analyzed using Fiji software (RRID: SCR_002285). The primary antibodies used in this part include: mouse anti-PLA2G6 (1:50, Santa Cruz, # sc-376563), rabbit anti-GRP75(1:200, Cell Signaling Technology, #3593); mouse anti-IP3R (1;50, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;200, Proteintech, #5259-1-AP), mouse anti-Ceramide (1:100, Sigma-Aldrich, #C8104), rabbit anti-Tom20 (1:200 Proteintech, #11802-1-AP), rat anti-DAT (1:50, Santa Cruz, #sc-32259) The secondary antibodies used for IF were presented in in the Key Resources Table. Mice behavior test Analysis of motor function was performed in age-, sex- and weight-matched KI and WT animals using standard behavior tests. (1) Hanging endurance test was applied to evaluate the gripping power of the mouse limbs. Each animal was placed in the center of a wire grid (35cm×20cm) uniformly procured by the Experimental Animal Center at Central South University. The grid was then tapped to make the mouse grip tight, following which the grid was slowly inverted to horizontal. The time the mouse hung onto the grid (grip time) was recorded. Each experiment is recorded for a maximum of 60 seconds, with excess time counted as 60 seconds. (2) The rotarod test assessed coordination, strength, and balance using an accelerating rotarod apparatus (RWD Life Science Company, LE8205). Each mouse was placed on the rotating rod and the rotation speed was set at 30 rpm. Observe the animal's behavior and record the time it remains on the rods. The test typically ends when the animal falls off the rod or grasps the rod without rotation. Each experiment is recorded for a maximum of 5 minutes. (3) Beam balance test is a common assay used in behavioral neuroscience to assess motor coordination, balance, and gait in rodents. We used a balance beam with specific dimensions (1.2 cm thickness, 80 cm length, 2.5 cm width) to assess mouse motor skills. The beam, elevated 30 cm above the ground, had a black opaque box at one end to leverage the mice's natural scototaxis behavior. During the formal experiment, we measured the time taken to traverse the 80 cm length and recorded the number of hind limbs falls. each mouse underwent three trials, and statistical analysis was based on the average of these trials. For the three described behavioral experiments, each with a requirement of three repetitions per mouse. The average of three repeated experiments was used as the experimental outcome for each mouse. (4) Open field test is designed to assess an animal's exploratory and anxiety-related behaviors in a novel and open environment. The open field test equipment, with chamber dimensions of 80cm×80cm×40cm, was obtained from the Experimental Animal Center of Central South University. Each mouse underwent a 10-minute observation period within the open field chamber. The infrared camera automatically recorded their movements, and data were subsequently analyzed using YH-AVTAS software. Fecal and urinary excretions were noted. Key parameters, including movement distance, speed, and time spent in the central zone, were quantified. The experiment was not repeated. Extraction of protein from mouse brains or cells and Western blot Cells or mouse brain tissues were lysed on ice via RIPA buffer supplemented with protease inhibitors (Thermo Fisher Scientific, #A32965) and phosphatase inhibitors (Selleck, #B15002). Protein concentration was quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, #23227). Add 15 µg of the above prepared cell lysate into SDS Sample Buffer in a volume of total 10–30 µL. Proteins are separated by size through gel electrophoresis, typically on polyacrylamide gels. These separates proteins based on their molecular weight. The Western Blot Molecular Weight Markers were used (Thermo Fisher Scientific, #26616; Epizyme #WJ102; Servicebio #G2058). After separation, they are transferred onto a membrane, which is followed by blocking to prevent non-specific binding. The membrane is then incubated with specific primary antibodies to target proteins. Subsequently, secondary antibodies labeled with detection molecules are applied. Finally, signal detection is performed, using chemiluminescence. The resulting bands or signals on the membrane were further analyzed by Fiji software. The following primary antibodies were used: mouse anti-PLA2G6 (1:500, Santa Cruz, #sc-376563), rabbit anti-GRP75(1:1000, Cell Signaling Technology, #3593); mouse anti-IP3R (1:500, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;2000, Proteintech, #5259-1-AP), mouse anti-β-actin(1;5000, Proteintech, #66009-1-Ig), mouse anti-β-tubulin (1:30000, Abmart, # M20005), mouse anti-GAPDH (1;5000, Proteintech, #60004-1-Ig), rabbit anti-Calnexin (1;2000, Proteintech, #10427-2-AP); rabbit anti-COXIV (1;1000, Proteintech, #11242-1-AP) ; mouse anti-CerS6 (1:500, Santa Cruz, #sc-100554). The secondary antibodies used for IF were presented in in the Key Resources Table. Subcellular fractionation Cell and Brain tissue fractionation followed published protocols [ 24 , 25 ]. Briefly, after euthanizing the mouse and removing half of the brain, the tissue is first homogenized in cold Solution A (0.32 M sucrose, 1 mM NaHCO3, 1 mM MgCl2, 0.5 mM CaCl2, and freshly added protease inhibitors) and then subjected to low-speed centrifugations to remove nuclei, unlysed cells, and debris. The resulting supernatants, containing cytosolic and membranous components, are further centrifuged at higher speeds to obtain a crude mitochondrial fraction. This fraction is then purified through a sucrose gradient ultracentrifugation step, producing distinct bands corresponding to various membrane fractions, with crude mitochondria forming the pellet. Following this, MAMs are isolated from the freshly obtained crude mitochondria. The mitochondria are resuspended in Isolation Medium (250 mM mannitol, 5 mM HEPES pH 7.4, 0.5 mM EGTA, 0.1% BSA, plus protease inhibitors), overlaid onto a 30% Percoll gradient prepared with Gradient Buffer (225 mM mannitol, 25 mM HEPES pH 7.5, 1 mM EGTA, 0.1% BSA), and subjected to ultracentrifugation. This step separates heavy (pure mitochondria) and light fractions. The light fraction, containing MAMs, is diluted, centrifuged at 100,000 x g for 1 hour to pellet the MAMs fraction, while the ER and cytosolic fractions can be similarly obtained from previously saved supernatants through a comparable ultracentrifugation step. Differentiation of IPSC into DA neurons Following the modified dual-SMAD-inhibition/midbrain-patterning strategy described previously [ 26 ], induced pluripotent stem cells (iPSCs) are first driven toward a neural-progenitor-cell (NPC) fate and subsequently patterned into midbrain dopaminergic neurons (mDANs); marker expression is assayed on differentiation days 25–30 (D25-D30) iPSCs (≤ passage 15, ≥ 90% confluence) are dissociated to single cells with Accutase, replated 1 : 2 onto Matrigel on day 0, and fed daily with N1 medium (per 50 mL: 41 mL KO-DMEM, 7.5 mL KO serum-replacement, 0.5 mL GlutaMAX [100 ×], 0.5 mL NEAA [100 ×], 0.5 mL penicillin-streptomycin [100 ×]) supplemented with the designated small-molecule inhibitors. The culture is then gradually transitioned to N2 medium (per 50 mL: 23.5 mL DMEM/F-12, 23.5 mL Neurobasal, 0.5 mL GlutaMAX, 0.5 mL NEAA, 0.5 mL N-2 supplement [100 ×], 1 mL SM1 supplement [50 ×], 0.5 mL penicillin-streptomycin), and by days 7–10 characteristic rosette-like NPC morphology becomes evident. On day 11 the NPC layer is passaged in fresh N2 medium containing the same inhibitors, expanded for up to five to seven passages, cryopreserved if necessary, or taken directly into dopaminergic induction. From differentiation day 15 onward, the medium is replaced with a dopaminergic maturation formulation consisting of Neurobasal™ plus 1 × B27, 3 µM CHIR-99021, 20 ng mL⁻¹ BDNF, 20 ng mL⁻¹ GDNF, 0.2 mM L-ascorbic acid, 0.5 mM dbcAMP, and 10 µM DAPT, all prepared from sterile concentrated stocks, adjusted to volume with Neurobasal™, mixed thoroughly, and filter-sterilized. Cultures are refreshed every two to three days at 37°C in 5% CO₂, with all other parameters unchanged; during the initial maturation period most non-dopaminergic neurons undergo apoptosis, yielding a progressively enriched population of mature midbrain dopaminergic neurons whose marker expression is assessed on differentiation days 25–30. Ceramide ELISA Assay The Ceramide ELISA assay follows a competitive ELISA method to quantify ceramide concentrations in various biological samples. The microplate provided in the kit is pre-coated with ceramide, which competes with ceramide in the sample or standard solutions for binding sites on a biotinylated antibody specific to ceramide. This competition-based approach ensures that the intensity of the color development is inversely proportional to the ceramide concentration in the sample.To begin, the standards are prepared by serial dilution from a lyophilized standard to create a concentration range from 2000 pg/mL to 0 pg/mL (blank). Each standard is reconstituted and diluted using the provided sample dilution buffer to achieve this gradient. After sample preparation, 50 µL of standards or samples are added to the corresponding wells on the microplate. Next, 50 µL of a biotinylated detection antibody solution is added to each well. The plate is gently tapped to ensure thorough mixing before being sealed and incubated at 37°C for 45 minutes. During this incubation, the ceramide in the standards or samples competes with the pre-coated ceramide on the plate for binding to the biotinylated antibody. After the incubation, the wells are washed three times using a wash buffer to remove any unbound components. Following the washing step, 100 µL of HRP-Streptavidin Conjugate (SABC) working solution is added to each well. The plate is sealed again and incubated for 30 minutes at 37°C. This step allows the HRP-labeled streptavidin to bind to the biotinylated antibody that is already attached to the plate. Unbound HRP-conjugate is subsequently removed by washing the plate five times. Next, 90 µL of TMB (tetramethylbenzidine) substrate solution is added to each well. The enzyme-substrate reaction produces a blue color, which indicates the activity of HRP. The plate is incubated at 37°C in the dark for 10–20 minutes, allowing the color to develop. The reaction is then stopped by adding 50 µL of stop solution to each well, turning the color from blue to yellow. The optical density (OD) of each well is immediately measured at 450 nm using a microplate reader. If the plate reader has the capability, a correction wavelength (such as 570 nm or 630 nm) can be used to improve accuracy by subtracting background signals. The ceramide concentration in each sample is determined by comparing its OD450 value to a standard curve, which is generated by plotting the OD values of the standards against their known concentrations. A four-parameter logistic (4PL) curve fitting is commonly used for this purpose. The concentrations of diluted samples are adjusted by multiplying the calculated value by the dilution factor. Finally, the concentration should be adjusted by protein concentration of per sample. Transmission Electron Microscopy Study Following rapid brain tissue extraction, it is fixed in 2.5% glutaraldehyde at 4°C for at least 2 hours. The targeted brain region is dissected and rinsed with 0.1M phosphate buffer (PB) for 30 minutes (10 minutes*3 times) at 4°C. Subsequent steps include fixation in 1% osmium tetroxide, dehydration with ethanol and acetone, infiltration with an acetone and resin mixture, and embedding. It is crucial to allow the embedding to be set for a few days for better cohesion. Ultrathin sectioning, uranyl acetate, and lead citrate staining follow. The prepared tissue is then observed and imaged with a transmission electron microscope (Hitachi HT-770). The parameters of MAMs and mitochondria were measured by using Fiji Software. FIB-SEM preparation and image collection. According to the protocols from Li’s Lab [ 27 ], Adult mice were killed by cervical dislocation and the whole brain was immediately transferred to ice-cold electrophysiological solution. A 3 mm coronal brain slice containing the target area was cut using a brain mold and fixed to the base of an Vibratomes (VT1200 S, Leica).. While submerged in continuously oxygenated artificial cerebrospinal fluid (125 mM NaCl, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 25 mM NaHCO₃, 1 mM MgCl₂, 2 mM CaCl₂, 25 mM glucose; pH 7.4; 300 mOsm), the tissue was cut into 500 µm slices, trimmed to ~ 1 × 1 × 0.5 mm blocks, and immersion-fixed for 24 h at 4°C in 2.5% glutaraldehyde (0.1 M phosphate buffer, pH 7.4). On day 1 the blocks were rinsed in 0.1 M PBS, post-fixed for 1.5 h in a 1:1 mixture of 2% osmium tetroxide and 3% potassium ferrocyanide, washed three times in distilled water, incubated for 40 min in 1% thiocarbohydrazide (35°C water-bath in winter), washed again, exposed for 45 min to 2% aqueous OsO₄ in the dark, and stained overnight at 4°C in 1% uranyl acetate. On day 2 the tissue was washed, incubated for 30 min at 65°C in 0.66% lead aspartate, dehydrated through graded ethanol (30%, 50%, 70%, 90%, two × 100%, 10 min each), washed twice for 30 min in 100% acetone, and infiltrated with Epon:acetone (3:7 for 5–8 h, then 7:3 for 8–12 h). On day 3 the medium was replaced with 100% Epon overnight, refreshed on day 4, and the samples were embedded on day 5 in fresh Epon polymerised at 65°C for ≥ 48 h. The hardened blocks were trimmed to the region of interest with an EM TXP (Leica), sputter-coated with 15 nm platinum using an EM ACE200 (Leica), mounted on 45° pre-tilted aluminium stubs, given a second 300 s platinum coat, and loaded into a Helios G3 UC dual-beam FIB-SEM (Thermo Fisher Scientific). Serial Slice-and-View acquisition used a 30 kV, 0.79 nA gallium ion beam that removed 5 nm per milling step; each freshly milled surface was imaged at 2 kV and 0.2 nA in back-scattered electron mode with a 7° stage tilt. Raw TIFF stacks (600–800 images per sample) were imported into Amira v6.5.0 (Thermo Fisher) for alignment and 3D segmentation: mitochondria with long axes of 1–3 µm were reconstructed, every tomographic slice was accessed to label endoplasmic-reticulum membranes within 30 nm of the mitochondrial outer membrane, all qualifying ER segments were merged into a second 3D model rendered blue to depict the MAMs, and Amira’s measurement tools were used to export each mitochondrion’s surface area and volume together with the surface area of its apposed MAMs. Lipidomic Analysis For lipidomic analysis in mouse brain tissue, over 40 mg of tissue per sample was rapidly frozen in liquid nitrogen and used for lipidomic analyses at LipidALL Technologies with Agilent 1290 coupled with Sciex QTRAP 6500 PLUS[ 28 ]. Polar lipid classes were separated by NP-HPLC using a TUP-HB silica column, and MRM transitions enabled comparative analysis. Quantification employed spiked internal standards (Avanti Polar Lipids, Matreya LLC, Sigma-Aldrich, Cayman Chemicals, and CDN isotopes). Glycerol lipids (DAG and TAG) were quantified through reverse phase HPLC/MRM[ 29 ], and neutral lipids were separated on a Phenomenex Kinetex-C18 column. Free cholesterols and cholesteryl esters were analyzed via APCI mode on a Jasper HPLC coupled to Sciex 4500 MD with d6-cholesterol and d6-C18:0 CE (CDN isotopes) as internal standards[ 30 ]. For high-throughput ceramides analysis in cell samples: more than 10 6 cells were harvested and rapidly frozen in liquid nitrogen after washing. High-throughput analysis of ceramides was conducted at LipidALL Technologies. Internal standards including d7-Cer d18:1/24:0 and d7-Cer d18:1/15:0 was added together with extraction solvent comprising ethyl acetate: isopropanol = 2:8 (v/v) into samples. Samples were incubated at 1500 rpm, 4 ℃ for 10 min, and centrifuged at 4 ℃, 3000×g for 10 min. A clean supernatant was used for LC-MS/MS analysis. Samples were analyzed on a Jasper HPLC-coupled to Sciex 4500 MD under electrospray ionization mode. A Waters ACQUITY UPLC BEH C18 column (2.1 × 100 mm, 1.7 µm) (Waters, Dublin, Ireland) was used for the chromatographic separation of individual ceramides. Ion source settings were: Curtain gas, 20; positive ion mode ion spray voltage, 4500 V; temperature, 450°C; ion source gas 1, 80; ion source gas 2, 70. Individual lipids were quantitated by referencing to spiked internal standards[ 31 ]. Drug administration in mice and cell model We initiated treatment in 12-13-month-old mice, a stage post-symptom manifestation, aligning with typical clinical intervention timings. We divided the mice into four groups: WT + DMSO (2.5% DMSO, 500 µL), KI + DMSO (2.5% DMSO, 500 µL), KI + DES (DES at 20 mg/kg/day), and KI + GW (GW at 1.5 mg/kg/day). Groups received intraperitoneal injections of their respective treatments. Each group comprised 7 age- and weight-matched mice and underwent a 6-week treatment regimen to evaluate the impact of the drugs on motor dysfunction. Before drug application, HEK293 or SH-SY5Y cells are plated in complete growth medium and cultured at 37°C with 5% CO₂ until they reach roughly 70% confluence. On the treatment day, the spent medium is aspirated and replaced with pre-warmed medium containing the appropriate compound: HEK293 cultures receive 5 µM DES or 2 µM GW (each a 1:200 dilution), whereas SH-SY5Y and MEF cultures receive 2.5 µM DES or 1 µM GW (1:400 dilutions); parallel vehicle controls are given an equivalent dilution of DMSO. Cells treated with DES are incubated for 24 h, whereas those exposed to GW are incubated for 6 h under the same conditions, after which they are immediately processed for the designated downstream assays. Co-Immunoprecipitation Assays Co-immunoprecipitations (Co-IP) for protein-protein interactions were carried out using protein A/G magnetic bead (Selleck, #B23201). Briefly, 10 6 WT and KO cells were harvested and washed in PBS for two times. Cells were lysed in ice-cold IP Lysis/Wash Buffer. The whole cell lysate was stored on ice for the following steps. Transfer 30 µL bead slurry to a 1.5 mL tube, then wash the slurry in binding buffer. Whole-cell lysates were mixed with primary antibodies for 1 hour at room temperature. Bead slurry was subsequently added and mixed with whole-cell lysates for overnight at 4°C. The beads were washed three times with lysis buffer. Samples were eluted into SDS Loading Buffer and analyzed by western blot. These primary antibodies were used: mouse anti-PLA2G6 (1:10, Santa Cruz, #sc-376563), mouse anti-IP3R (1:10, Santa Cruz, # sc-377518). The normal controls were presented in the Key Resources Table. For the analysis of Ceramide-protein interactions, we employed ceramide beads (Echelon Biosciences, #P-BCER). In brief, gently mix the beads and transfer 50–100 µL of a 50% bead slurry to a 0.5–1.5 mL tube. Pellet the beads at 1,000 x g, carefully removing the supernatant. Wash the beads with a 10X excess of the wash buffer, repeating twice for 1–2 minutes each. Resuspend the beads in whole cell lysates and incubate the protein-bead solution for 2 hours with continuous motion. Pellet the beads, remove the supernatant, and wash the beads two to five times. Elute bound proteins by adding SDS Loading Buffer and heating to 70°C for 10 minutes. Pellet the beads, store the supernatant at -20°C, and discard the beads. Analyze proteins by western blotting. The same procedure was applied to control beads (Echelon Biosciences, # P-B000) following the above steps to serve as a negative control. Proximity ligation assays Proximity ligation assays (PLA) were conducted to examine the proximity and potential interaction of two proteins (within < 40 nm). Duolink® In Situ Red Starter Kit (Sigma-Aldrich, # DUO92102) was employed according to the manufacturer's guidelines. Cells cultured on glass slides underwent fixation, permeabilization, and blocking before overnight incubation with paired primary antibodies (mouse anti-IP3R (1;50, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;200, Proteintech, #5259-1-AP)). Following a buffer wash, paired secondary antibodies (anti-rabbit PLUS and anti-mouse MINUS) conjugated with oligonucleotides were applied. When the distance between the two proteins of interest was less than 40 nm, ligase action connected the oligonucleotides, forming a closed circular DNA. Signal amplification occurred through rolling circle amplification (RCA) under polymerase action, resulting in dot-like PLA signals observable under a fluorescence microscope. Simultaneous negative control PLA experiments were performed, and PLA signals were quantified using the "Particle Analysis" function of ImageJ. CHX protein degeneration experiment Seed NC and KO cells at a 1:4 ratio into eight wells of a 12-well plate. After 18–24 h, confirm cell density at approximately 80%. Pretreated the cells with MG132 for 4h. Prepare 500 µg of CHX in 0.6 mL tubes by adding 10 µL of DMSO and mixing well to achieve a final CHX (Selleck, #S7418) concentration of 50 mg/mL. Slowly introduce 1 µL of CHX into the 1 mL cell culture medium, gently shaking the plate for thorough mixing. As a control, add 1 µL of DMSO into the corresponding well. Treat cells with CHX (50 µg/mL) for designated timepoints (0, 4, 8, 12 hours). Harvest cells and extract cellular proteins for subsequent analysis. Ca 2+ flux analysis Ca 2+ dynamics in three compartments—cytosol, ER lumen and mitochondria—after ATP stimulation were observed via Fluo-4, Mag-Fluo-4 or Rhod-2, respectively. Approximately 1 x 10 5 cells were seeded on 20mm glass bottom cell culture dishes (NEST). The cells were loaded with 2 µM Fluo-4, 2 µM Mag-Fluo-4 or Rhod-2 or 5 µM Rhod-2, AM in HANKs buffer for 30 min at 37°C to monitor mitochondrial Ca 2+ dynamics. After four washes with HANKs buffer, the cells were further incubated at 37°C for 30 min to enhance mitochondrial uptake following de-esterification of the dye. Subsequently, the dishes were bathed in HANKs buffer, and image acquisition was performed using a Zeiss Observer7 laser microscope. Fluo-4, Mag-Fluo-4 or Rhod-2 was excited with a laser of 494 nm, 494 nm, and 555 nm, respectively. Ca 2+ release from the ER-stores was induced using 100 µM ATP (Selleck, #S5260). Each experiment involved imaging about 30 cells, and corresponding mitochondrial calcium uptake was recorded for about 6 min, capturing an image every 10 seconds. Mitochondrial membrane potential (Δψm) assessment To detect the Δψm, cells within one well of a 24-well plate were treated as indicated and incubated with 1 ml TMRE dilution (1:1000, Beyotime, #C2001S) for 30 min at 37°C in the dark. Following the incubation period, the cells underwent centrifugation to eliminate the supernatant, underwent three washes with PBS, and were then prepared for flow cytometric analysis. Each 500 µl fractions were used for flow cytometry (Beckman Coulter, Inc., USA). The PE channel was employed for the observation of the TMRE signal. Flow cytometry analysis was performed using an unstained control to determine appropriate gates required in flow cytometry. Mitochondrial ROS assessment Mitochondrial ROS levels were evaluated using MitoSox (Thermo Fisher Scientific, #M36008), a mitochondrion-specific hydroethidine-derivative fluorescent dye. Experiments were conducted on the same day utilizing a freshly prepared MitoSox stock solution. Approximately 1 x 10 5 cells were plated on 20mm glass-bottom cell culture dishes. After 18–24 hours, the cell density was confirmed to be approximately 70%. After centrifugation to collect the cells, cells were incubated with the MitoSOX Red working solution (1 µM) for 30 minutes, followed by three washes with Hanks' balanced salt solution at 4°C. Following eliminating the supernatant, resuspend the pallet in 500 µl Hanks' balanced salt solution, which were used for flow cytometry (Beckman Coulter, Inc., USA). The PE channel was employed for the observation of the MitoSox signal. Flow cytometry analysis was performed using an unstained control to determine appropriate gates required in flow cytometry. MitoTracker staining We initially seeded cells on well plates following standard protocols to ensure uniform growth. After achieving the desired confluence, we administered transfections or drug interventions. For staining, we prepared a 1 mM MitoTracker (Thermo Fisher Scientific Scientific, #M7513) stock solution, diluting it 1:1000 under light-protected conditions immediately before use. At 70–80% confluence, we washed the cells with pre-warmed PBS and added fresh medium infused with MitoTracker, incubating them for 15 to 45 minutes based on cell type and dye specifics. Post-staining, the cells were washed with PBS to eliminate unbound dye, followed by staining for additional markers or nuclear staining, fixation, and mounting. Finally, we visualized the mitochondria using a fluorescence microscope at 576 nm and analyzed the images with Fiji software to evaluate mitochondrial morphology. ATP assay Seeded adherent cells are rinsed, then 200 µL of ice-cold lysis buffer is added per well of a six-well plate and repeatedly pipetted to ensure complete lysis. Lysates are spun at 12 000 g for 5 min at 4°C and the supernatant is kept on ice for ATP measurement. ATP standards are prepared on ice by serially diluting the stock with the same lysis buffer to 0.01–10 µM (adjust this range to match sample levels).The detection reagent is made fresh by diluting luciferase substrate 1 : 9 with its buffer and kept on ice. To each assay well 100 µL of detection reagent is dispensed and left at room temperature for 3–5 min to deplete background ATP. Next, 20 µL of sample or standard is added, mixed quickly, and after a 2-s delay the relative light units are recorded with a multimode microplate reader. Sample volumes can be varied between 10 and 100 µL provided standards are run at the same volume; highly concentrated samples are diluted with lysis buffer to keep readings within the linear range. ATP concentrations are interpolated from the standard curve and, if desired, expressed as nmol mg⁻¹ protein after normalizing to protein content measured by a BCA assay. Isolation of PBMCs Blood is collected from healthy donors or patients. The enrolled subjects were consecutively recruited from Xiangya Hospital of Central South University (Changsha, China) and collaborative institutions through the Parkinson's Disease & Movement Disorders Multicenter Database and Collaborative Network in China (PD-MDCNC, http://www.pd-mdcnc.com ). All subjects or their guardians completed written informed consent and the study protocol was approved by the Medical Ethics Committee of Xiangya Hospital, Central South University. The amount of blood collected depends on the required number of PBMCs for the experiment. Before the processes, warm the PBS and Histopaque (Sigma-Aldrich, #11191) to room temperature. Next, dilute the anticoagulated blood with an equal volume of PBS to decrease its density, which helps in layering over the Histopaque. Carefully layer the diluted blood over the Histopaque in a centrifuge tube. For a 15 mL centrifuge tube, we can use 7.5 mL of diluted blood and 7.5 mL of Histopaque. Ensure to layer the blood slowly to prevent mixing with the medium. Centrifuge the tubes at 400–450 g for 30–40 minutes at 18–20°C, with the brake off to avoid disturbing the layers. After centrifugation, you'll see distinct layers in the tube. The PBMCs form a thin layer at the interface between the plasma and the Histopaque. Carefully aspirate this layer using a pipette, taking care to minimize contamination with other layers. Transfer the collected PBMC layer to a new conical tube and add PBS up to 50 mL to wash the cells. Centrifuge at 300 g for 10 minutes at 18–20°C. Discard the supernatant carefully. Resuspend the pellet in 10 mL of PBS and repeat the washing step if necessary. For cryopreservation, resuspend PBMCs at 1–10 × 10 6 cells/mL in cryopreservation medium (usually 90% fetal bovine serum + 10% DMSO) and transfer to cryovials. Freeze the vials at -80°C for 24 hours before transferring to liquid nitrogen for long-term storage. mRNA expression data of the GRP75 gene in different tissues Bulk-tissue mRNA expression data of the GRP75 gene in whole blood were extracted from the Parkinson’s Progression Marker Initiative (PPMI) cohort [ 38 ], which included 4,871 longitudinally collected whole blood samples from 1,570 clinically phenotypic individuals. The cohort obtained a high-quality transcriptome with an average of 100 million read pairs per sample. Differential expression of RNA species was examined between PPMI participants with and without a PD diagnosis. Besides, bulk-tissue mRNA expression data of the GRP75 gene in six brain regions (cerebellum, frontal cortex, medulla, striatum, substantia nigra, and superior frontal gyrus) were extracted from BrainEXPNPD database ( http://brainexpnpd.org:8088/BrainEXPNPD/ ), which is an updated database of BrainEXP [ 39 ]. The BrainEXPNPD database collected 8,317 human brain samples across 21 brain regions from 48 datasets on microarrays or RNA-seq platforms, which contain six complex neuropsychiatric disorders, including 163 PDs and 6,378 healthy controls (not neuropsychiatric-affected). Quantification and Statistical Analysis All datasets were organized and analyzed in GraphPad Prism v8.0 (GraphPad Software, CA, USA); heat-maps and volcano plots were produced in R v4.2.2. Animal sample sizes are reported in the figure legends. Cell-based assays were performed in parallel with vehicle-treated wells on the same plate and repeated in at least three independent biological replicates; technical replicates within a replicate were averaged before statistical testing. Before any comparison, residuals were inspected for normality with the Shapiro–Wilk test and for homogeneity of variance with an F- or Levene test. When both assumptions were met, differences between two groups were assessed with an unpaired two-tailed Student’s t-test; if variances were unequal, Welch’s correction was applied, and if normality was not satisfied, a Mann–Whitney test was used. For three or more groups involving a single independent variable, one-way ANOVA followed by Tukey’s post-hoc test was employed; if variances were heterogeneous, Brown–Forsythe and Welch ANOVA with Games–Howell correction replaced the classical test. Two-way ANOVA with Šidák adjustment was used when two variables were present. For experiments executed in multiple independent batches (e.g., ATP assay), raw values were first divided by the batch-matched vehicle mean to remove inter-batch effects. And for omics data, further corrected with the ComBat algorithm before differential analysis. Error bars represent the standard error of the mean (SEM). The criteria for significance are: ns (not significant) p > 0.05; ∗ p < 0.05; ∗∗ p < 0.01 and ∗∗∗ p < 0.001. 3. Results 3.1. PLA2G6 D331Y/D331Y KI mice exhibit a notable decrease in ER-mitochondria association A previously reported PLA2G6 D331Y/D331Y KI mouse model, created in 2019 using the LoxP-Cre system, demonstrated reduced PLA2G6 enzymatic activity but no detectable changes in protein levels[ 32 ]. In this study, we generated the PLA2G6 D331Y/D331Y KI mice using CRISPR/Cas9 to further elucidate the molecular mechanisms underlying PLA2G6-associated parkinsonism (Figure.1A). In our model, the mutation reduced both PLA2G6 protein levels and enzymatic activity in the substantia nigra (SN) (Figure.1B-D), resulting in age-dependent dopaminergic neuron loss (Figure.1E, F), decreased striatal DAT levels (Figure.1G, H), and progressive motor deficits (Figure.1I-L). Notably, the onset of neurodegeneration and motor dysfunction in our model occurred later than in the previous model [ 32 ]. These results indicate that our PLA2G6 D331Y/D331Y KI mice develop PD-like neurodegeneration and motor impairments. To further explore the structural changes underlying these phenotypes, we performed focused Ion Beam-Scanning Electron Microscope (FIB-SEM) on the SN region of WT and KI mice [ 33 , 34 ]. Besides mitochondrial impairment, we also observed significant disruptions in ER-mitochondria contacts (Figure.1M). 3D reconstructions revealed a markedly reduced MAMs area in the SN of KI mice (Figure.1N). As the results, the average area of MAMs in the SN of KI was reduced compared to WT (Figure.1O). And in WT mice, a substantial portion of the mitochondrial surface was in close contact with the ER, whereas this contact was significantly reduced in KI mice (Figure.1P). To further validate these findings in vitro , we established PLA2G6 knockout (KO) HEK293 cell lines. We also observed a significant reduction in short ER-mitochondria contacts (≈ 8–10 nm, marked by a specific probe, SPLICS Mt-ER Short P2A[ 22 ]) in KO cells (Figure.1Q, R), further confirming PLA2G6 deficiency also cause MAMs impairment. 3.2. Identification of PLA2G6 in MAMs Based on these observations, we next aimed to determine the precise role of PLA2G6 in MAMs. Given the observed structural changes, we hypothesized that PLA2G6 might directly localize to MAMs and contribute to their integrity. Because no reliable antibody is available for staining endogenous PLA2G6, we transiently expressed an N-terminal HA tagged PLA2G6 and, in the same cells, co-expressed EGFP-Sec61β to mark the ER membranes; TOM20 immunostaining was used to label the mitochondrial outer membrane. Confocal imaging revealed that PLA2G6 forms discrete puncta precisely at the narrow interface between EGFP-Sec61β–positive ER and TOM20-positive mitochondria (Figure.1S). To validate this observation, we employed Percoll-based subcellular fractionation and probed each fraction by Western blot for β-tubulin, IP3R, calnexin, VDAC1 and COX IV. Consistent with our microscopy data, PLA2G6 was found to be in the MAMs and ER fractions (Figure.1T), confirming its direct association with MAMs. 3.3. PLA2G6 deficiency impairs the IP3R-GRP75-VDAC1 complex in MAMs Further, we conducted analysis of several MAMs-related proteins in both total lysate and isolated MAMs fractions from PLA2G6 WT and KI mice. Our results revealed that the levels of GRP75 and IP3R proteins were significantly changed in both the total cellular fractions and the MAMs fractions. Although GRP75, VDAC1, and IP3R form a key complex in MAMs, changes in their levels varied: compared to WT mice, a significant decrease in GRP75 levels and an increase in IP3R levels was observed in both the whole lysate and MAMs fractions from the brains of KI mice, while VDAC1 and other MAMs-relate proteins remained unchanged (Figure.2A-G). Moreover, the PLA2G6 KO cells also exhibited reduced GRP75 levels and increased IP3R levels, aligning with our findings in KI mice (Figure.2H-K). Additionally, we also detected significant higher mRNA level of IP3R in KO cells while GRP75 remained unchanged (Figure.S1 A, B). The reduction of GRP75 and the increase of IP3R were also replicated in SH-SY5Y cells treated with PLA2G6 -targeting siRNAs (Figure.S1C-E), and in KI Mouse Embryonic Fibroblast (MEF) cells (Figure.S1F-H). Given the different trends of GRP75 and IP3R changes with PLA2G6 loss, we further elucidated the effect of PLA2G6 protein deficiency on the IP3R-GRP75-VDAC1 complex. We applied in-situ proximity ligation assays (PLA) to evaluate the contact sites between IP3R and VDAC1 in HEK293, which indicates diminished IP3R-GRP75-VDAC1 complex in the absence of PLA2G6 (Figure.2L, M). To extend these findings to disease-relevant neurons, we differentiated induced pluripotent stem cells (iPSCs) from a healthy donor and from two patients carrying the PLA2G6 D331Y mutation into dopaminergic (DA) neurons (Figure.S2). IP3R–VDAC1 proximity signals were likewise diminished in patients-derived DAs, particularly within the soma (Figure.2N, O). Similar defects were observed in SH-SY5Y cell lines (Figure.S3A, B) and MEFs (Figure.S3C, D). Next, we assessed how PLA2G6 affects the function of the IP3R-GRP75-VDAC1 complex, we measured mitochondrial Ca²⁺ uptake from the ER in HEK293 cells. The ATP-induced Ca 2+ flux peak was significantly lower in KO cells compared to normal control (NC) cells, suggesting impaired ER-mitochondrial Ca 2+ transport due to PLA2G6 loss (Figure.2P). Meanwhile, Co-IP analysis demonstrated a significantly reduced interaction between GRP75 and IP3R in KO cells, indicating PLA2G6 deficiency impairs the complex (Figure.2Q, R). 3.4. PLA2G6 interacts with IP3R-GRP75-VDAC1 To further identify the relationship between PLA2G6 and IP3R-GRP75-VDAC1 complex, we immunoprecipitated endogenous PLA2G6 from whole-brain lysates and MAMs fractions of WT mice. The results showed that these three proteins could be identified among PLA2G6-interacting proteins in both whole lysate and MAMs fraction, suggesting that these interactions occur in the MAMs fraction under physiological conditions (Figure.3A). Consistent with this, confocal imaging of HA-PLA2G6–expressing HEK293 cells demonstrated co-localization of PLA2G6 with IP3R, GRP75 and VDAC1. (Figure.3B). 3.5. PLA2G6 regulates IP3R-GRP75-VDAC1 complex via GRP75 Given that PLA2G6 deficiency reduces GRP75 without changing mRNA levels, we propose PLA2G6 regulates the complex via GRP75. Since PLA2G6 directly interacts with GRP75, we hypothesized that its deficiency destabilizes GRP75, accelerating its degradation. To ensure that differences in GRP75 degradation were not confounded by unequal baseline abundance, both control and KO cells were pre-treated with the proteasome inhibitor MG132 (10µM for 4h) before cycloheximide (CHX, 50 µg/mL) chase. Once MG132 was removed and CHX applied, GRP75 decayed much faster in KO cells, confirming that PLA2G6 loss accelerates proteasome-dependent degradation (Figure.3C-D). We next examined whether overexpressing PLA2G6 and its mutant would restore GRP75 levels. As the result, re-expression of WT PLA2G6 and GRP75 but not D331Y-mutant PLA2G6 restored GRP75 abundance (Figure.3E-G). Pull-down result showed that WT PLA2G6 robustly co-precipitated IP3R, GRP75 and VDAC1, but the D331Y mutant displayed markedly weaker binding to all three partners, confirming a pathogenic defect in interaction (Figure.3H, I). The reduction of IP3R-VDAC1 contacts in KO cells was also rescued WT PLA2G6 or by GRP75 but not by PLA2G6 D331Y mutant (Figure.3J–K). Furthermore, we also quantified Ca²⁺ dynamics in three compartments—cytosol, mitochondria and ER lumen—after ATP stimulation (Fluo-4, Rhod-2 and Mag-Fluo-4, respectively). We found that ATP-evoked cytosolic spike and mitochondrial uptake was significantly lower and delayed in KO cells, with the ER release recovered more slowly than that in controls. Re-expression of WT PLA2G6 WT restored all three profiles, whereas GRP75 over-expression produced its strongest rescue in the mitochondrial trace—normalizing the Rhod-2 peak while only partially correcting the cytosolic and ER kinetics—underscoring that GRP75 primarily reinstates ER-to-mitochondria Ca²⁺ transfer. In contrast, the pathogenic D331Y variant achieved moderate recovery, leaving mitochondrial uptake still below normal. (Figure.3L) 3.6. PLA2G6 deficiency increases ceramide levels both in vivo and in vitro Previous studies showed that PLA2G6 deficiency impair multiple lipid metabolism pathways. Thus, we conducted a lipidomic analysis to compare the lipid profiles of midbrain tissues from WT and KI mice (Figure.S4). Surprisingly, among nearly 500 lipid species, a significant accumulation was observed in ceramides, particularly Ceramide d18:1/16:0 (C16 ceramide), which showed the most evident changes (Figure.4A-B, and Figure.S5). The C16 ceramide could integrate into the mitochondrial outer membrane, affecting its permeability [ 35 ]. High-throughput ceramide analysis further confirmed elevated ceramide levels in KO cells, compared to NC cells (Figure.4C). Notably, the elevation in ceramide level in KO cells was reduced by Desipramine (DES) and GW4869 (GW), which target acid and neutral sphingomyelinases, respectively (Figure.4C). Intriguingly, similar to what was observed in the animal models, C16 ceramide also become the most prominently altered ceramide in KO cells (Figure.S6). Consistent findings were obtained in immunofluorescence analyses using a ceramide antibody across different groups, supporting the ceramide accumulation and confirming the antibody's specificity (Figure.4D, E). The ceramide ELISA assay also confirmed the finding in both HEK293 cell lines and SH-SY5Y cell lines (Figure.4F and Figure.S7). Further we conducted the immunofluorescence analyses of ceramide in DA neurons. The ceramides also accumulated in DA neurons derived from patients carrying D331Y mutation (Figure.4H, G). 3.7. PLA2G6 deficiency alters mitochondrial ceramide level To further elucidate the effect of PLA2G6 deficiency on ceramide, we measured ceramide concentration in different subcellular compartments of both HEK293 cells and mice brain via ELISA. Interestingly, ceramide concentrations were significantly elevated in the crude mitochondrial fractions of both HEK293 cells and mouse brain (Figure.4I, J). Additionally, we observed increased ceramide levels in whole-cell lysates and ER fractions; however, the elevation of ceramide in mitochondria was substantially greater than in other cellular compartments. These findings indicate that PLA2G6 deficiency predominantly disrupts ceramide homeostasis in mitochondria. To visualize subcellular ceramide changes, we conducted immunofluorescence analysis in HEK293 and U2OS cells to present the colocalization of mitochondria and ceramides (Figure.S7 A, B, H). Immunostaining revealed increased ceramide accumulation and stronger overlap between ceramide and mitochondria signals in PLA2G6-deficient cells (Figure.S7 C-G, I-M). 3.8. PLA2G6 regulates ceramide via GRP75 Considering the lipid regulatory functions of PLA2G6, along with its critical involvement in mitochondrial lipid homeostasis, we next sought to determine if mitochondrial ceramide accumulation was associated with GRP75 dysfunction due to PLA2G6 deficiency. Immunofluorescence revealed extensive co-localization of ceramide with GRP75 and VDAC1 in both HEK293 cells (Figure.5A) and DA neurons (Figure.5B), indicating interactions between ceramides and them. Pulldown with ceramide-coated beads confirmed that GRP75 and VDAC1 bind ceramide in whole-cell lysates and in isolated MAMs fractions (Figure.5C), suggesting these interactions occur in MAMs. Given the interaction between GRP75 and ceramide, along with the altered GRP75 levels in PLA2G6-deficient models, we explored the regulatory relationship between GRP75 and ceramide. We first examined whether reducing ceramide levels could restore the conformation and stability of the IP3R-GRP75-VDAC1 complex. To this end, PLA2G6-deficient cells were treated with DES and GW to lower ceramide levels, followed by assessment of GRP75 protein recovery and IP3R-VDAC1 interaction using the PLA technique. Our results indicated that lowering ceramide did not restore GRP75 levels (Figure.S9A, B) nor increase the number of IP3R-GRP75-VDAC1 complexes (Figure.S9C, D). These findings suggest that ceramide does not directly regulate the stability or conformation of these proteins under the tested conditions. Conversely, overexpression of PLA2G6 WT or GRP75 significantly decreased total ceramide as measured by ELISA, whereas the pathogenic the pathological variants D331Y only lead to a modest reduction (Figure.5D). To further confirmed the relationship between GRP75 and ceramide, we conducted high-throughput LC/MS/MS (Ceramide species targeted) in KO cells, comparing ceramide levels between cells transfected with an empty vector and those overexpressing GRP75. Consistently, GRP75 overexpression resulted in a significant reduction in ceramide levels (Figure.5E). And the immunofluorescence analyses corroborated the biochemical data, showing visibly fewer ceramide-positive puncta after GRP75 expression (Figure.S10). 3.9. Targeting ceramides and GRP75 could address mitochondrial dysfunction caused by PLA2G6 deficiency Previous studies have shown that PLA2G6 can impair mitochondrial integrity in Drosophila models [ 36 ]. To investigate whether similar effects occur in mammals, we performed ultrastructural analysis of the SNpc in PLA2G6 WT and KI mice (Figure.6A). TEM revealed significant mitochondrial damage in KI mice, characterized by reduced mitochondrial area, increased circularity, and disrupted cristae according to quantification methods descried in [ 37 ]) (Figure.6B-D). TOM20 immunostaining and MitoTracker labelling further showed pronounced mitochondrial fragmentation in PLA2G6 -deficient HEK293(Figure.6E, F and S11 A, B), SH-SY5Y (Figure.S11 C, D) and MEF cells (Figure.S11 E, F). Mitochondrial function was assessed next. We used TMRE dyes to assess mitochondrial membrane potential in vitro . As a positive control, we used Carbonyl cyanide m-chlorophenyl hydrazone (CCCP), a known inhibitor of mitochondrial oxidative phosphorylation, which significantly reduced membrane potential. Flow cytometry analysis revealed a decrease in mitochondrial membrane potential in KO cells compared to the WT cells. Membrane potential was restored by the overexpression of GRP75 or PLA2G6 WT(Figure.6G-J), partially improved by reducing ceramide levels (Figure.6K, L) and only slightly increase by the overexpression of PLA2G6 D331Y (Figure.6J). Flow-cytometric MitoSox measurements showed a parallel rise in mitochondrial ROS in KO cells that was reversed by PLA2G6 overexpressing GRP75 or PLA2G6 WT, whereas only slightly decreased by overexpression of PLA2G6 D331Y (Figure.6M, N). And reducing ceramides with DES and GW effectively alleviated mitochondrial oxidative stress in KO cells (Figure.6O, P). Finally, luciferase ATP assays revealed that both overexpression of GRP75 or PLA2G6 WT and ceramide depletion each increased cellular ATP content in KO cells, whereas PLA2G6 D331Y failed to rescue (FigureS12A, B). Comparable bioenergetic deficits were observed in PLA2G6 -KD SH-SY5Y cells, which displayed lower ATP levels (FigureS12C) reduced TMRE fluorescence (Figure S12D, E), and elevated MitoSOX level (Figure S12F, G); all three parameters were partially rescued by DES or GW, mirroring the responses seen in HEK293 models. Collectively, above findings emphasize the deleterious effects of PLA2G6 deficiency on mitochondrial function and suggest that targeting ceramides and GRP75 could alleviate mitochondrial dysfunctions, thereby offering potential therapeutic benefits. 3.10. Reducing ceramides exerts therapeutic effects on KI mice Based on our encouraging in vitro results, we hypothesized that reducing ceramides could alleviate mitochondrial dysfunctions and mitigate PLA2G6-associated neuronal defects in mice. We initiated treatment in 12-13-month-old mice, a stage post-symptom manifestation, aligning with typical clinical intervention timings. We divided the mice into four groups: WT + DMSO (2.5% DMSO, 500 µL), KI + DMSO (2.5% DMSO, 500 µL), KI + DES (DES at 20 mg/kg/day), and KI + GW (GW at 1.5 mg/kg/day). Each group comprised 7 age- and weight-matched mice and underwent a 6-week treatment regimen to evaluate the impact of the drugs on motor dysfunction (Figure.7A). Comprehensive behavioral assessments were performed on all four groups, both before and after the treatment. At baseline, all three KI groups exhibited motor deficits compared to the WT group, with no notable weight differences (Figure.S13). Post the 6-week treatment, both the DES-treated and GW-treated groups showed significant behavioral improvements. Specifically, compared to the KI + DMSO group, the drug-treated KI mice showed increased endurance on wire grids (Figure.7B) and rotarod rods (Figure.7C), reduced time crossing the balance beam (Figure.7D), and fewer foot slips (Figure.7E). Post-treatment, TH + neuron counts in the SNpc were also assessed. The KI + DMSO group showed a significant loss of TH + neurons, compared with the other groups (Figure.7F, G), suggesting that DES and GW effectively prevent further dopaminergic neuron loss in KI mice. Consistently, both DES and GW increased TH levels in the midbrain of KI mice (Figure.7H, I). Next, we performed the quantitative TEM analysis to assess the treatments' impact on mitochondria, also focusing on the average area, circularity index, and cristae scores of mitochondria across the four groups. The analysis demonstrated that DES and GW efficiently increased the average area and cristae scores of mitochondria in KI mice and decreased the circularity index (Figure.7J-M). These results collectively suggest that reducing ceramide is crucial in inhibiting mitochondrial fragmentation and enhancing overall mitochondrial integrity. In conclusion, our i n vivo findings highlight the therapeutic potential of ceramide reduction, specifically through DES and GW, in repairing mitochondrial dysfunction, preventing dopaminergic neuron loss, and ultimately alleviating motor dysfunction in aging mice with PLA2G6 deficiency. 3.11. Altered GRP75 expression in peripheral blood mononuclear cells (PBMCs) of PLA2G6 mutant PD patients According to the data in Human Protein Atlas, GRP75 exhibits relatively high expression in human PBMCs. Previous studies have linked mitochondrial dysfunction in PBMCs to PD, reflecting similar pathological alterations in the brain [ 38 ]. Consequently, we isolated PBMC proteins from three PD patients harboring homozygous PLA2G6 mutations and compared them to six age-matched healthy controls. The results demonstrated a significant reduction in GRP75 levels in the PLA2G6 mutant PD patient samples (Figure.S14A-B). 3.12. Altered GRP75 expression level in the whole blood and different brain regions of PD patients In addition to PBMCs, we analyzed GRP75 mRNA expression in whole blood samples from the Parkinson's Progression Markers Initiative (PPMI) cohort, which comprises 6441 individuals. Our analysis showed a significant decrease in GRP75 mRNA expression in PD patients compared to healthy controls (Figure.S14 C), suggesting a potential role for GRP75 in the pathogenesis of PD. Furthermore, we assessed GRP75 expression across various brain regions in PD patients, utilizing data from the Brain Expression Database for Neurological Diseases (BrainEXP-NPD) ( http://brainexpnpd.org:8088/index.html ) [ 39 ]. This database includes information from six different brain tissues, allowing for a comparative study between PD patients and controls. The meta-analysis integrating data from eight distinct PD cohorts within the BrainEXP-NPD revealed a decrease in GRP75 expression in the SN region of patients (Figure.S14 D). Since SN region is critically implicated in PD pathology, the significant decline in GRP75 expression in this specific area provides compelling evidence of its association with PD. 4. Discussion This study provides new insights into the localization and function of PLA2G6 in MAMs, revealing its critical role in maintaining the integrity of the IP3R-GRP75-VDAC1 complex. Our findings demonstrate that PLA2G6 deficiency reduces GRP75 levels, leading to disrupted MAMs function and a specific pattern of ceramide accumulation, particularly in mitochondria. These changes result in mitochondrial fragmentation, oxidative stress, and dopaminergic neuronal loss. By showing that pharmacological reduction of ceramides or overexpression of GRP75 can alleviate these deficits, we position the PLA2G6–GRP75–ceramide axis as a unified mechanism and highlight ceramide modulation or GRP75 restoration as tractable therapeutic strategies for neurodegeneration. 4.1. PLA2G6 in MAMs Our study provides new insights into the localization and function of PLA2G6 in the mouse brain, expanding upon the current understanding that PLA2G6 is primarily found in the cytosol and mitochondria [ 40 ]. We have revealed that a subset of PLA2G6 is located at the MAMs and ER fraction, which was further confirmed by the interaction between PLA2G6 and IP3R, GRP75, and VDAC1. Notably, PLA2G6 deficiency destabilizes GRP75 and impairs MAMs integrity, while overexpression of GRP75 partially rescues this phenotype, underscoring their critical interplay. Unlike GRP75, IP3R upregulation is linked to increased mRNA levels, suggesting transcriptional regulation. Given that elevated IP3R transcription is often associated with ER stress [ 41 ], this finding aligns with the known link between PLA2G6 deficiency and ER stress[ 26 ]. Elucidating the precise mechanism driving IP3R elevation lies beyond the scope of this work but represents an intriguing direction for future investigation. Additionally, the upstream-downstream relationship between MAMs dysfunction and ER stress remains unresolved. Our data suggest that IP3R elevation may reflect a complex interplay between these processes in the context of PLA2G6 deficiency. Although MAMs impairment has been repeatedly reported in neurodegenerative diseases, we also noticed that emerging studies found enhanced MAMs under pathological conditions. Enhanced ER-mitochondria connection have been extensively reported in AD models, linking it to excessive ROS production, calcium overload even Aβ aggregation[ 42 ]. However, it should be mentioned that ER-mitochondria coupling might be also enhanced as adaptative response to mitochondria or ER impairment[ 36 , 43 , 44 ]. Whether such compensatory MAMs remodeling occurs early in PLAN—and if it ultimately fails—remains an important question. Dissecting these temporal dynamics and the molecular “switches” that determine adaptive versus maladaptive MAMs alterations will be critical for designing therapies that rebalance ER–mitochondria communication in PLAN and other neurodegenerative diseases. Currently, a growing body of evidence identifies the MAMs as a common pathological platform for multiple neurodegenerative diseases. These disease-related proteins (such as α-synuclein, Aβ, TDP-43 etc.) converge on the MAMs [ 5 , 45 , 46 ], triggering neuronal death by disrupting its core functions in calcium signaling, lipid metabolism, organelle dynamics, and quality control. This creates a vicious cycle: protein misfolding causes MAMs dysfunction, and MAMs dysfunction in turn exacerbates protein misfolding and aggregation. And emerging factors have been identified to regulate such pathways. Therefore, targeting the MAMs as a unified therapeutic hub by developing drugs[ 47 , 48 ] that can stabilize its structure and function may offer a novel and powerful strategy to combat a wide range of neurodegenerative diseases. 4.2. PLA2G6 regulate ceramides via GRP75 It is widely reported that PLA2G6 selectively hydrolyzes the ester bond at the sn-2 position of phospholipids, which is a key step in the Lands cycle. Previous studies have detected alterations of PC and PE in PLA2G6 KO mice [ 49 , 50 ]. However, others, including our study, have not observed significant phospholipid changes following PLA2G6 loss [ 16 ]. This suggests that PLA2G6 mutations may have a limited impact on the Lands cycle, potentially due to compensatory mechanisms within phospholipid metabolism. Furthermore, we observed a significant increase of ceramides in PLA2G6 KI mice and KO cells. Pharmacological inhibition of ceramide synthesis mitigated mitochondrial dysfunction caused by PLA2G6 loss, thereby connecting ceramide accumulation with neuronal degeneration. Contrary to previous studies that suggested an altered Ceramide/sphingomyelin (SM) ratio[ 16 ], our study observed no significant changes in SM levels. This finding points to different pathways of ceramide dysregulation in PLA2G6 deficiency models. Our study also uncovers a more specific pattern of ceramide accumulation in different cellular compartments. By comparing the ceramide distribution across subcellular fractions, we identified a particularly pronounced increase in ceramide levels in the crude mitochondrial fraction of PLA2G6 KO cells. This suggests that mitochondria could serve as an early site of pathological ceramide elevation, preceding global cellular changes. In our exploration of the mechanisms underlying ceramide dyregulation, we identified an intriguing relationship between GRP75 and ceramide metabolism. Our results suggest that GRP75 could combine with ceramides and its impairment significant cause ceramide accumulations. To be noted, a recent clinical study also reported that inhibiting GRP75 could significantly increases ceramide levels, which is consistent with our data[ 51 ]. Given the close connection between GRP75 and ceramide, we propose that GRP75 binds ceramide within the MAMs “buffer pool” to regulate its steady-state distribution between the ER, MAMs, and mitochondria. Consistent with prior reports[ 52 – 54 ], our ELISA data showed that ceramide levels in MAMs appeared enriched in ceramide compared with other fractions. We therefore proposed ceramide‐binding proteins such as VDAC1 and GRP75 could coordinate bidirectional lipid transport and metabolism within MAMs, maintaining ceramide concentrations within a narrow physiological window in both organelles. When GRP75 is impaired and MAMs integrity collapses, this buffering capacity is lost: ceramide can no longer be shuttled into the MAMs pool and instead accumulates excessively in the ER and, most prominently, within the mitochondrial. Although our findings highlight mitochondria as the major site of ceramide overload, confirming this model will require further experiments—such as real-time lipid flux assays and rescue with MAMs-targeted GRP75 variants—to establish causality and dissect the underlying molecular machinery. 4.3. Restoring mitochondrial function by targeting GRP75 and ceramides Our study provides compelling evidence that targeting ceramides and GRP75 can alleviate mitochondrial dysfunction caused by PLA2G6 deficiency. We observed that PLA2G6-deficient mice and cells exhibit significant mitochondrial degeneration, characterized by reduced mitochondrial area, increased fragmentation, disrupted cristae, elevated ROS, and decreased mitochondrial membrane potential. These abnormalities have been noted in several PLA2G6-deficient models[ 55 , 56 ]. Prior work in Drosophila linked PLA2G6-related mitochondrial damage to cardiolipin imbalance [ 56 ], yet cardiolipin levels were unaltered in our mouse model, implying a distinct, ceramide-centered mechanism. By reducing ceramide levels using DES and GW, we were able to mitigate these mitochondrial abnormalities both in vitro and in vivo. Treatment with these agents improved mitochondrial morphology, decreased oxidative stress, and restored membrane potential. GRP75 over-expression produced similar benefits, underscoring its protective role. Importantly, ceramide reduction in PLA2G6-deficient mice not only preserved mitochondrial integrity but also improved motor performance and prevented further dopaminergic neuron loss in the SNpc. However, the impact of ceramide on other mitochondrial quality-control pathways—such as mitophagy—remains unexplored. Addressing these questions will clarify the full spectrum of ceramide-mediated insults. Overall, our findings show that targeting ceramides and GRP75 can reverse the mitochondrial and neuronal deficits caused by PLA2G6 deficiency. These findings have significant implications for developing new treatments for neurodegenerative diseases associated with mitochondrial dysfunction. 4.4. Potential of GRP75 in PD pathology and therapeutic implications Furthermore, our findings extend beyond PLA2G6 mutant PD patients, as we also observed decreased GRP75 levels in the blood, and substantia nigra of other PD patients. This suggests a broader role for GRP75 in various types of PD. Previous studies also have established GRP75 (Mortalin/HSPA9) as a key regulator in PD. For instance, lower GRP75 levels have been documented in post-mortem brains of PD patients[ 57 ]. In toxin-based PD models (6-OHDA), GRP75 down-regulation correlates with mitochondrial fragmentation, increased ROS, and dopaminergic neuron loss, while GRP75 overexpression or HSP70 agonists rescue these defects[ 36 , 58 , 59 ]. GRP75 also interacts with PD-related proteins (α-synuclein, PINK1, DJ-1)[ 59 , 60 ], and its impairment under these genetic factors further disrupts MAMs structure and Ca²⁺ flux. Besides PD, GRP75 also show multiple roles in other neurodegenerative disease. For example, recent studies in ALS showed that GRP75 in MAMs serve as a protective factor under ER stress[ 34 , 48 ]. Conversely, AD related gene, ApoE4 could impaired mitochondria by enhancing MAMs via GRP75, which suggests that GRP75 or MAMs could act as a double-edged sword[ 61 ]. In our work, we expand GRP75’s role by identifying it as a ceramide-binding protein. We found that GRP75 involves in maintaining ceramide homeostasis, and potentially work as a ceramide reservoir within MAMs. This novel function might also occur in other PD models, highlighting sphingolipid metabolism as a new therapeutic axis downstream of GRP75 in PD. Given GRP75’s involvement in protein folding, Ca²⁺ signaling, and now sphingolipid metabolism, it likely exerts diverse, context-dependent functions across PD models. Its consistent perturbation in patient samples and animal models highlights GRP75 as both a promising therapeutic target and a potential biomarker for neurodegeneration, although the precise molecular mechanisms linking its multifaceted roles to disease progression warrant further investigation. 5. Conclusion In summary, our data highlights PLA2G6's localization to MAMs and its interaction with the IP3R-GRP75-VDAC1 complex. Loss of PLA2G6 lowers GRP75 abundance, compromises MAM integrity and leads to a specific pattern of ceramide accumulation in mitochondria. Mechanistically, we demonstrate that GRP75 is a ceramide-binding chaperone whose down-regulation is both necessary and sufficient to drive this lipid imbalance, revealing an unrecognised route by which PLA2G6 deficiency perturbs sphingolipid homeostasis. Additionaly, our study suggests that targeting ceramide synthesis or enhancing GRP75 expression can alleviate mitochondrial dysfunction in PD models, underscoring the therapeutic leverage of the interaction between GRP75 and ceramides. Together, these findings elucidate the PLA2G6–GRP75–ceramide pathway in PD pathogenesis, guiding future efforts to develop small-molecule ceramide modulators and GRP75-targeted interventions for neurodegeneration. Abbreviations AD – Alzheimer’s disease ALS – Amyotrophic lateral sclerosis CCCP – Carbonyl cyanide m-chlorophenyl hydrazone CHX – Cycloheximide DA – Dopaminergic neuron DAT – Dopamine transporter DES – Desipramine ER – Endoplasmic reticulum FIB-SEM – Focused ion beam-scanning electron microscopy GW – GW4869 (neutral sphingomyelinase inhibitor) IP3R – Inositol 1,4,5-trisphosphate receptor iPSC – Induced pluripotent stem cell KI – Knock-in KO – Knockout LC/MS/MS – Liquid chromatography tandem mass spectrometry MAM – Mitochondria-associated membrane MEF – Mouse embryonic fibroblast NC – Normal control NBIA – Neurodegeneration with brain iron accumulation PBMC – Peripheral blood mononuclear cell PD – Parkinson’s disease PLA – Proximity ligation assay PPMI – Parkinson’s Progression Markers Initiative ROS – Reactive oxygen species SH-SY5Y – Human neuroblastoma SH-SY5Y cell line SN – Substantia nigra SNpc – Substantia nigra pars compacta SPLICS – Split-GFP-based contact site sensor TEM – Transmission electron microscopy TMRE – Tetramethylrhodamine ethyl ester WT – Wild type Declarations Supplemental information Figure S1–S14; Ethics approval and consent to participate The mouse protocol was approved by the Animal Care and Use Committee of the Central South University. And human samples were obtained with informed consent and the study protocol was approved by the Medical Ethics Committee of Xiangya Hospital, Central South University. Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests Fundings This work was supported by the National Key R&D Program of China grant 2021YFC2501204 (to G JF), the Technology Major Project of Hunan Provincial Science and Technology Department grant 2021SK1011 (to G JF), the National Natural Science Foundation of China grants 82071439 and 82271281 (to G JF), the National Natural Science Foundation of China grant 82171258, the National Key Research and Development Program of China Grant No. 2021YFC2501204, No. 2021YFA0805200, and Major Program of the National Natural Science Foundation of China (Grant No.22494704 (to T JQ). Authors’ contributions The study was conceptualized by JB L, JF G, and JQ T. The methodology was designed and carried out by JB L, Q Y, R G,TL L, ZY X, YZ L, and XR H. The additional experiments included in this revision were carried out by JB L, Q Y, and R G. Investigation was performed by JB L, JF G, and JQ T. Visualization was done by JB L. Funding acquisition was managed by JF G and JQ T. Project administration was coordinated by JF G, JQ T, L S, H J, XJ W, JD L, J Q, ZT Z, XW Z, and BS T. The supervision of the study was provided by JF G, JQ T, L S, H J, XJ W, JD L, J Q, ZT Z, XW Z, and BS T. The original draft of the manuscript was written by JB L, JF G, and JQ T, while the review and editing of the manuscript were done by JB L, JF G, JQ T, and BS T. Acknowledgments We thank Jiansheng Guo in the Center of Cryo-Electron Microscopy (CCEM), Zhejiang University and Prof. Xia Li in the Institute of Special Environmental Medicine and Medical School, Nantong University for their technical assistance on FIB-SEM. Additionally, we sincerely thank all the members of Guo’s Lab for their great effort and help throughout this study. Special thanks to Dr. Wu Yiming and Yang Yingxuan from ZZ Lab for their technological assistance. We also thank Dr. Junpu Wang for TEM imaging and the LipidALL Technologies Company Limited (Changzhou, China) for lipid analysis. We extend our gratitude to the Biomedical Center, Institute for Advanced Study of Central South University for their invaluable support in providing immunofluorescence imaging and technical assistance, and the Center of Cryo-Electron Microscopy, Zhejiang University for their invaluable support in FIB-SEM. References Rocca WA: The burden of Parkinson's disease: a worldwide perspective. Lancet Neurol 2018, 17: 928-929. Parkinson disease [https://www.who.int/news-room/fact-sheets/detail/parkinson-disease#:~:text=Parkinson%20disease%20,8%20million%20disability] Morris HR, Spillantini MG, Sue CM, Williams-Gray CH: The pathogenesis of Parkinson's disease. Lancet 2024, 403: 293-304. Barbuti PA, Guardia-Laguarta C, Yun T, Chatila ZK, Flowers X, Wong C, Santos BF, Larsen SB, Lotti JS, Hattori N: The role of alpha-synuclein in synucleinopathy: Impact on lipid regulation at mitochondria–ER membranes. npj Parkinson's Disease 2025, 11: 103. Guardia-Laguarta C, Area-Gomez E, Rub C, Liu Y, Magrane J, Becker D, Voos W, Schon EA, Przedborski S: alpha-Synuclein is localized to mitochondria-associated ER membranes. J Neurosci 2014, 34: 249-259. Gautier CA, Erpapazoglou Z, Mouton-Liger F, Muriel MP, Cormier F, Bigou S, Duffaure S, Girard M, Foret B, Iannielli A, et al: The endoplasmic reticulum-mitochondria interface is perturbed in PARK2 knockout mice and patients with PARK2 mutations. Hum Mol Genet 2016, 25: 2972-2984. Liu Y, Ma X, Fujioka H, Liu J, Chen S, Zhu X: DJ-1 regulates the integrity and function of ER-mitochondria association through interaction with IP3R3-Grp75-VDAC1. Proc Natl Acad Sci U S A 2019, 116: 25322-25328. Paisan-Ruiz C, Bhatia KP, Li A, Hernandez D, Davis M, Wood NW, Hardy J, Houlden H, Singleton A, Schneider SA: Characterization of PLA2G6 as a locus for dystonia-parkinsonism. Ann Neurol 2009, 65: 19-23. Shi CH, Tang BS, Wang L, Lv ZY, Wang J, Luo LZ, Shen L, Jiang H, Yan XX, Pan Q, et al: PLA2G6 gene mutation in autosomal recessive early-onset parkinsonism in a Chinese cohort. Neurology 2011, 77: 75-81. Yoshino H, Tomiyama H, Tachibana N, Ogaki K, Li Y, Funayama M, Hashimoto T, Takashima S, Hattori N: Phenotypic spectrum of patients with PLA2G6 mutation and PARK14-linked parkinsonism. Neurology 2010, 75: 1356-1361. Magrinelli F, Mehta S, Di Lazzaro G, Latorre A, Edwards MJ, Balint B, Basu P, Kobylecki C, Groppa S, Hegde A: Dissecting the phenotype and genotype of PLA2G6‐related parkinsonism. Movement Disorders 2022, 37: 148-161. Villalón-García I, Álvarez-Córdoba M, Povea-Cabello S, Talaverón-Rey M, Villanueva-Paz M, Luzón-Hidalgo R, Suárez-Rivero JM, Suárez-Carrillo A, Munuera-Cabeza M, Salas JJ: Vitamin E prevents lipid peroxidation and iron accumulation in PLA2G6-Associated Neurodegeneration. Neurobiology of disease 2022, 165: 105649. Li T, Liu J, Huang X, Xie Y, Hu Y, Xu Q, Tang B, Tan J, Guo J: Deficiency of PLA2G6 Induces Ferroptosis in Dopaminergic Neurons and Contributes to Parkinson’s Disease Pathogenesis via Disruption of PRDX6/FTH1/GPX4 Axis. Molecular Neurobiology 2025 : 1-12. Chiu C-C, Lu C-S, Weng Y-H, Chen Y-L, Huang Y-Z, Chen R-S, Cheng Y-C, Huang Y-C, Liu Y-C, Lai S-C: PARK14 (D331Y) PLA2G6 causes early-onset degeneration of substantia nigra dopaminergic neurons by inducing mitochondrial dysfunction, ER stress, mitophagy impairment and transcriptional dysregulation in a knockin mouse model. Molecular neurobiology 2019, 56: 3835-3853. Zhou Q, Yen A, Rymarczyk G, Asai H, Trengrove C, Aziz N, Kirber MT, Mostoslavsky G, Ikezu T, Wolozin B: Impairment of PARK14-dependent Ca2+ signalling is a novel determinant of Parkinson’s disease. Nature communications 2016, 7: 10332. Lin G, Lee PT, Chen K, Mao D, Tan KL, Zuo Z, Lin WW, Wang L, Bellen HJ: Phospholipase PLA2G6, a Parkinsonism-Associated Gene, Affects Vps26 and Vps35, Retromer Function, and Ceramide Levels, Similar to alpha-Synuclein Gain. Cell Metab 2018, 28: 605-618 e606. Chiu C-C, Yeh T-H, Lu C-S, Huang Y-C, Cheng Y-C, Huang Y-Z, Weng Y-H, Liu Y-C, Lai S-C, Chen Y-L: PARK14 PLA2G6 mutants are defective in preventing rotenone-induced mitochondrial dysfunction, ROS generation and activation of mitochondrial apoptotic pathway. Oncotarget 2017, 8: 79046. Phospholipid synthesis in a membrane fraction associated with mitochondria. Journal of Biological Chemistry 1990, 265: 7248-7256. Herrera-Cruz MS, Simmen T: Over six decades of discovery and characterization of the architecture at mitochondria-associated membranes (MAMs). organelle contact sites: from molecular mechanism to disease 2017 : 13-31. Paillusson S, Stoica R, Gomez-Suaga P, Lau DH, Mueller S, Miller T, Miller CC: There's something wrong with my MAM; the ER–mitochondria axis and neurodegenerative diseases. Trends in neurosciences 2016, 39: 146-157. Szabadkai G, Bianchi K, Varnai P, De Stefani D, Wieckowski MR, Cavagna D, Nagy AI, Balla T, Rizzuto R: Chaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels. J Cell Biol 2006, 175: 901-911. Vallese F, Catoni C, Cieri D, Barazzuol L, Ramirez O, Calore V, Bonora M, Giamogante F, Pinton P, Brini M, Cali T: An expanded palette of improved SPLICS reporters detects multiple organelle contacts in vitro and in vivo. Nat Commun 2020, 11: 6069. Sanjana NE, Shalem O, Zhang F: Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods 2014, 11: 783-784. Wieckowski MR, Giorgi C, Lebiedzinska M, Duszynski J, Pinton P: Isolation of mitochondria-associated membranes and mitochondria from animal tissues and cells. Nat Protoc 2009, 4: 1582-1590. Annunziata I, Patterson A, d'Azzo A: Mitochondria-associated ER membranes (MAMs) and glycosphingolipid enriched microdomains (GEMs): isolation from mouse brain. J Vis Exp 2013 : e50215. Ke M, Chong CM, Zeng H, Huang M, Huang Z, Zhang K, Cen X, Lu JH, Yao X, Qin D, Su H: Azoramide protects iPSC-derived dopaminergic neurons with PLA2G6 D331Y mutation through restoring ER function and CREB signaling. Cell Death Dis 2020, 11: 130. Li X, Qiao F, Guo J, Jiang T, Lou H, Li H, Xie G, Wu H, Wang W, Pei R, et al: In situ architecture of the intercellular organelle reservoir between epididymal epithelial cells by volume electron microscopy. Nat Commun 2025, 16: 1664. Lam SM, Zhang C, Wang Z, Ni Z, Zhang S, Yang S, Huang X, Mo L, Li J, Lee B, et al: A multi-omics investigation of the composition and function of extracellular vesicles along the temporal trajectory of COVID-19. Nat Metab 2021, 3: 909-922. Shui G, Guan XL, Low CP, Chua GH, Goh JS, Yang H, Wenk MR: Toward one step analysis of cellular lipidomes using liquid chromatography coupled with mass spectrometry: application to Saccharomyces cerevisiae and Schizosaccharomyces pombe lipidomics. Mol Biosyst 2010, 6: 1008-1017. Shui G, Cheong WF, Jappar IA, Hoi A, Xue Y, Fernandis AZ, Tan BK, Wenk MR: Derivatization-independent cholesterol analysis in crude lipid extracts by liquid chromatography/mass spectrometry: applications to a rabbit model for atherosclerosis. J Chromatogr A 2011, 1218: 4357-4365. Miao H, Li B, Wang Z, Mu J, Tian Y, Jiang B, Zhang S, Gong X, Shui G, Lam SM: Erratum to "Lipidome Atlas of the Developing Heart Uncovers Dynamic Membrane Lipid Attributes Underlying Cardiac Structural and Metabolic Maturation". Research (Wash D C) 2023, 6: 0185. Chiu CC, Lu CS, Weng YH, Chen YL, Huang YZ, Chen RS, Cheng YC, Huang YC, Liu YC, Lai SC, et al: PARK14 (D331Y) PLA2G6 Causes Early-Onset Degeneration of Substantia Nigra Dopaminergic Neurons by Inducing Mitochondrial Dysfunction, ER Stress, Mitophagy Impairment and Transcriptional Dysregulation in a Knockin Mouse Model. Mol Neurobiol 2019, 56: 3835-3853. Nakamura K, Aoyama-Ishiwatari S, Nagao T, Paaran M, Obara CJ, Sakurai-Saito Y, Johnston J, Du Y, Suga S, Tsuboi M: Mitochondrial complexity is regulated at ER-mitochondria contact sites via PDZD8-FKBP8 tethering. Nature Communications 2025, 16: 3401. Pilotto F, Schmitz A, Maharjan N, Diab R, Odriozola A, Tripathi P, Yamoah A, Scheidegger O, Oestmann A, Dennys CN, et al: PolyGA targets the ER stress-adaptive response by impairing GRP75 function at the MAM in C9ORF72-ALS/FTD. Acta Neuropathol 2022, 144: 939-966. Vaena S, Chakraborty P, Lee HG, Janneh AH, Kassir MF, Beeson G, Hedley Z, Yalcinkaya A, Sofi MH, Li H, et al: Aging-dependent mitochondrial dysfunction mediated by ceramide signaling inhibits antitumor T cell response. Cell Rep 2021, 35: 109076. Baba M, Nakajo S, Tu PH, Tomita T, Nakaya K, Lee VM, Trojanowski JQ, Iwatsubo T: Aggregation of alpha-synuclein in Lewy bodies of sporadic Parkinson's disease and dementia with Lewy bodies. Am J Pathol 1998, 152: 879-884. Lam J, Katti P, Biete M, Mungai M, AshShareef S, Neikirk K, Garza Lopez E, Vue Z, Christensen TA, Beasley HK, et al: A Universal Approach to Analyzing Transmission Electron Microscopy with ImageJ. Cells 2021, 10 . Smith AM, Depp C, Ryan BJ, Johnston GI, Alegre-Abarrategui J, Evetts S, Rolinski M, Baig F, Ruffmann C, Simon AK, et al: Mitochondrial dysfunction and increased glycolysis in prodromal and early Parkinson's blood cells. Mov Disord 2018, 33: 1580-1590. Xia C, Ma T, Jiao C, Chen C, Liu C: BrainEXP-NPD: a database of transcriptomic profiles of human brains of six neuropsychiatric disorders. bioRxiv 2021 : 2021.2005.2030.446363. Chiu CC, Yeh TH, Lu CS, Huang YC, Cheng YC, Huang YZ, Weng YH, Liu YC, Lai SC, Chen YL, et al: PARK14 PLA2G6 mutants are defective in preventing rotenone-induced mitochondrial dysfunction, ROS generation and activation of mitochondrial apoptotic pathway. Oncotarget 2017, 8: 79046-79060. Higo T, Hamada K, Hisatsune C, Nukina N, Hashikawa T, Hattori M, Nakamura T, Mikoshiba K: Mechanism of ER stress-induced brain damage by IP(3) receptor. Neuron 2010, 68: 865-878. Zellmer JC, Tarantino MB, Kim M, Lomoio S, Maesako M, Hajnóczky G, Bhattacharyya R: Stabilization of mitochondria‐associated endoplasmic reticulum membranes regulates Aβ generation in a three‐dimensional neural model of Alzheimer's disease. Alzheimer's & Dementia 2025, 21: e14417. Li X, Yang Y, Shi X, Zhang Z, Ding S: Mitochondria-Associated Membranes as Key Regulators in Cellular Homeostasis and the Potential Impact of Exercise on Insulin Resistance. Int J Mol Sci 2024, 25 . Bravo R, Vicencio JM, Parra V, Troncoso R, Munoz JP, Bui M, Quiroga C, Rodriguez AE, Verdejo HE, Ferreira J: Increased ER–mitochondrial coupling promotes mitochondrial respiration and bioenergetics during early phases of ER stress. Journal of cell science 2011, 124: 2143-2152. Stoica R, De Vos KJ, Paillusson S, Mueller S, Sancho RM, Lau KF, Vizcay-Barrena G, Lin WL, Xu YF, Lewis J, et al: ER-mitochondria associations are regulated by the VAPB-PTPIP51 interaction and are disrupted by ALS/FTD-associated TDP-43. Nat Commun 2014, 5: 3996. Choi GE, Park JY, Park MR, Yoon JH, Han HJ: Glucocorticoid enhances presenilin1-dependent Aβ production at ER’s mitochondrial-associated membrane by downregulating Rer1 in neuronal cells. Redox Biology 2023, 65: 102821. Etxebeste-Mitxeltorena M, Flores-Romero H, Ramos-Inza S, Masiá E, Nenchova M, Montesinos J, Martinez-Gonzalez L, Porras G, Orzáez M, Vicent MJ: Modulation of Mitochondria–Endoplasmic Reticulum Contacts (MERCs) by Small Molecules as a New Strategy for Restoring Lipid Metabolism in an Amyotrophic Lateral Sclerosis Model. Journal of Medicinal Chemistry 2025. Pilotto F, Smeele PH, Scheidegger O, Diab R, Schobesberger M, Sierra-Delgado JA, Saxena S: Kaempferol enhances ER-mitochondria coupling and protects motor neurons from mitochondrial dysfunction and ER stress in C9ORF72-ALS. Acta Neuropathologica Communications 2025, 13: 21. Mori A, Hatano T, Inoshita T, Shiba-Fukushima K, Koinuma T, Meng H, Kubo SI, Spratt S, Cui C, Yamashita C, et al: Parkinson's disease-associated iPLA2-VIA/PLA2G6 regulates neuronal functions and alpha-synuclein stability through membrane remodeling. Proc Natl Acad Sci U S A 2019, 116: 20689-20699. Deng X, Wang J, Jiao L, Utaipan T, Tuma-Kellner S, Schmitz G, Liebisch G, Stremmel W, Chamulitrat W: iPLA2beta deficiency attenuates obesity and hepatic steatosis in ob/ob mice through hepatic fatty-acyl phospholipid remodeling. Biochim Biophys Acta 2016, 1861: 449-461. Liu X, Xu F, Zhao K, Liu Y, Ye G, Zhang X, Qu Y: Comprehending the cuproptosis and cancer-immunity cycle network: delving into the immune landscape and its predictive role in breast cancer immunotherapy responses and clinical endpoints. Front Immunol 2024, 15: 1344023. Mignard V, Dubois N, Lanoe D, Joalland MP, Oliver L, Pecqueur C, Heymann D, Paris F, Vallette FM, Lalier L: Sphingolipid distribution at mitochondria-associated membranes (MAMs) upon induction of apoptosis. J Lipid Res 2020, 61: 1025-1037. Bionda C, Portoukalian J, Schmitt D, Rodriguez-Lafrasse C, Ardail D: Subcellular compartmentalization of ceramide metabolism: MAM (mitochondria-associated membrane) and/or mitochondria? Biochemical journal 2004, 382: 527-533. Hayashi T, Fujimoto M: Detergent-resistant microdomains determine the localization of σ-1 receptors to the endoplasmic reticulum-mitochondria junction. Molecular pharmacology 2010, 77: 517-528. Musthafa T, Nizami SK, Mishra A, Hasan G, Gopurappilly R: Altered Mitochondrial Bioenergetics and Calcium Kinetics in Young‐Onset PLA2G6 Parkinson's Disease iPSCs. Journal of Neurochemistry 2025, 169: e70059. Kinghorn KJ, Castillo-Quan JI, Bartolome F, Angelova PR, Li L, Pope S, Cocheme HM, Khan S, Asghari S, Bhatia KP: Loss of PLA2G6 leads to elevated mitochondrial lipid peroxidation and mitochondrial dysfunction. Brain 2015, 138: 1801-1816. Jin J, Hulette C, Wang Y, Zhang T, Pan C, Wadhwa R, Zhang J: Proteomic identification of a stress protein, mortalin/mthsp70/GRP75: relevance to Parkinson disease. Mol Cell Proteomics 2006, 5: 1193-1204. Magalingam KB, Somanath SD, Ramdas P, Haleagrahara N, Radhakrishnan AK: 6-Hydroxydopamine Induces Neurodegeneration in Terminally Differentiated SH-SY5Y Neuroblastoma Cells via Enrichment of the Nucleosomal Degradation Pathway: a Global Proteomics Approach. J Mol Neurosci 2022, 72: 1026-1046. Rakovic A, Grunewald A, Voges L, Hofmann S, Orolicki S, Lohmann K, Klein C: PINK1-Interacting Proteins: Proteomic Analysis of Overexpressed PINK1. Parkinsons Dis 2011, 2011: 153979. Jin J, Li GJ, Davis J, Zhu D, Wang Y, Pan C, Zhang J: Identification of novel proteins associated with both alpha-synuclein and DJ-1. Mol Cell Proteomics 2007, 6: 845-859. Liang T, Hang W, Chen J, Wu Y, Wen B, Xu K, Ding B, Chen J: ApoE4 (Delta272-299) induces mitochondrial-associated membrane formation and mitochondrial impairment by enhancing GRP75-modulated mitochondrial calcium overload in neuron. Cell Biosci 2021, 11: 50. Key Resources Table Key Resources Table is available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.docx KeyResourcesTable.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7426255","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":503669615,"identity":"80bd7458-c7ab-474d-9e98-5fbc0d6fa3da","order_by":0,"name":"Jiabin Liu","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jiabin","middleName":"","lastName":"Liu","suffix":""},{"id":503669616,"identity":"986f7514-4c28-477c-a012-700974a26b5b","order_by":1,"name":"Qiao Yin","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Qiao","middleName":"","lastName":"Yin","suffix":""},{"id":503669617,"identity":"b97c892f-21e4-4533-9718-c9ed19a6ca7c","order_by":2,"name":"Rong Gao","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Gao","suffix":""},{"id":503669618,"identity":"f7bd5762-cb63-4c71-af10-64305d0398a9","order_by":3,"name":"Taole Li","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Taole","middleName":"","lastName":"Li","suffix":""},{"id":503669620,"identity":"48826004-0260-4c10-bf39-3da24b548a9a","order_by":4,"name":"Zuyan Xie","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Zuyan","middleName":"","lastName":"Xie","suffix":""},{"id":503669622,"identity":"9a0e78e8-b6fe-4b00-b288-4a74c042d3f8","order_by":5,"name":"Xiurong Huang","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Xiurong","middleName":"","lastName":"Huang","suffix":""},{"id":503669624,"identity":"817b4844-d5e7-4e3a-b48f-6188d8856b0b","order_by":6,"name":"Yuzhong Liu","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Yuzhong","middleName":"","lastName":"Liu","suffix":""},{"id":503669625,"identity":"6e8e786d-aafb-4107-bbbd-185ab9c85f56","order_by":7,"name":"Lu Shen","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Shen","suffix":""},{"id":503669626,"identity":"dfa57ac9-1fc9-4d34-891e-ee678cc117c6","order_by":8,"name":"Hong Jiang","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Jiang","suffix":""},{"id":503669627,"identity":"f8fa7683-96c4-4e20-acd5-119cbfec437d","order_by":9,"name":"Jiada Li","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jiada","middleName":"","lastName":"Li","suffix":""},{"id":503669628,"identity":"25c00775-d3c8-4dbd-b8cb-9a4a9fe1164f","order_by":10,"name":"Jian Qiu","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Qiu","suffix":""},{"id":503669629,"identity":"11dfa830-34cd-49a1-8c48-0976180f998f","order_by":11,"name":"Xuejing Wang","email":"","orcid":"","institution":"The First Affiliated Hospital of Zhengzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xuejing","middleName":"","lastName":"Wang","suffix":""},{"id":503669630,"identity":"3a984dc9-cd94-43dc-b6f1-209b6c7e072f","order_by":12,"name":"Zhentao Zhang","email":"","orcid":"","institution":"Renmin Hospital of Wuhan University","correspondingAuthor":false,"prefix":"","firstName":"Zhentao","middleName":"","lastName":"Zhang","suffix":""},{"id":503669631,"identity":"00afec31-82e3-48db-a3c4-0695dee445f6","order_by":13,"name":"Xiongwei Zhu","email":"","orcid":"","institution":"Case Western Reserve University","correspondingAuthor":false,"prefix":"","firstName":"Xiongwei","middleName":"","lastName":"Zhu","suffix":""},{"id":503669632,"identity":"d0c1a31f-d7e6-433c-b256-838addec0370","order_by":14,"name":"Beisha Tang","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Beisha","middleName":"","lastName":"Tang","suffix":""},{"id":503669633,"identity":"b7c89e79-3a08-4e85-99fc-5dee325f100a","order_by":15,"name":"Jieqiong Tan","email":"","orcid":"","institution":"Central South University","correspondingAuthor":false,"prefix":"","firstName":"Jieqiong","middleName":"","lastName":"Tan","suffix":""},{"id":503669634,"identity":"6076fdba-2d89-4435-88a6-d2b793cbf01e","order_by":16,"name":"Jifeng Guo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYJACgwQbIMneAOYwNhCnJQ1I8hwgQQsDA0iLRAKRWuQjkg8UPEiwyZOPfPz4Mw+DjeyGA8zPHuDTYngjLcEgISGt2PB2mpk0D0Oa8YYDbOYGeLXMyDEwSPxxOHHj7Bw2Zh6Gw4kbDvCwSRDUkpDwP3HjzDPMQIf9J6xFXgKs5UDifAkeBqDDDhDWYsDzDOSX5MQNPGlmknMMko1nHmYzw29Le/Ixwx8Jdonz2w8//vCmwk6273jzM/y2HGBgM4AyQCQQM+NTD7KlgYH5AZQxCkbBKBgFowA7AAAzb0lvs9JndgAAAABJRU5ErkJggg==","orcid":"","institution":"Central South University","correspondingAuthor":true,"prefix":"","firstName":"Jifeng","middleName":"","lastName":"Guo","suffix":""}],"badges":[],"createdAt":"2025-08-21 12:38:16","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-7426255/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7426255/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89657396,"identity":"8a2ae354-489a-45c1-9fba-c0c5336c5b7e","added_by":"auto","created_at":"2025-08-22 10:33:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":464707,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003ePLA2G6\u003c/em\u003e\u003csup\u003eD331Y/D331Y\u003c/sup\u003e KI mice exhibit PD halkmarks and impaired ER-mitochondria associations, with PLA2G6 identified as a MAMs protein\u003c/p\u003e\n\u003cp\u003e(A) Sanger sequencing of cDNA synthesized from the SN of WT and KI mice. The (G991 →T991) nucleotide mutation at the residue D331 (D331 (GAC) → Y331 (TAC) of PLA2G6.\u003c/p\u003e\n\u003cp\u003e(B) Western blot of PLA2G6 expression in the SN of WT and KI mice.\u003c/p\u003e\n\u003cp\u003e(C) Quantitative analysis of PLA2G6 protein level in SN (n=11). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(D) Reduced enzyme activity of PLA2G6 in the SN of KI mice compared to WT mice (n=3). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(E) TH immunostaining images of the TH\u003csup\u003e+\u003c/sup\u003e dopaminergic neurons in the SN of 12-month-old WT and KI mice. The inner circle area represents the SNpc. (Scale bar, 250 μm)\u003c/p\u003e\n\u003cp\u003e(F) Quantitative analysis of TH\u003csup\u003e+\u003c/sup\u003e neurons in mice at the age of 9 to 15 months (n≥3). **\u003cem\u003ep\u003c/em\u003e=0.0042, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, **\u003cem\u003ep\u003c/em\u003e=0.0017\u003c/p\u003e\n\u003cp\u003e(G) Images of \u003cem\u003ein vivo\u003c/em\u003e \u003csup\u003e11\u003c/sup\u003eC-CFT micro-PET showing Dopamine transporter (DAT) uptake in the brains of 12-month-old KI mice compared to age-matched WT mice, with standardized uptake value ratio (SUVR) scales indicating DAT density. L and R denote the left and right hemispheres of the brain, respectively.\u003c/p\u003e\n\u003cp\u003e(H) Quantitative analysis of DAT levels presented as SUVR in WT and KI mice. The data show a significant decrease in DAT uptake in KI mice compared to WT (n=3). ***\u003cem\u003ep\u003c/em\u003e=0.0001\u003c/p\u003e\n\u003cp\u003e(I) Hanging endurance test durations for WT and KI mice at 9, 12, and 15 months. KI mice displayed shorter endurance times across all age groups compared to WT mice (n≥10). ***\u003cem\u003ep\u003c/em\u003e=0.0009, ***\u003cem\u003ep\u003c/em\u003e=0.0001 and ***\u003cem\u003ep\u003c/em\u003e=0.0003\u003c/p\u003e\n\u003cp\u003e(J and K) Significantly prolonged beam traversal (J) and increased foot slips (K) on the balance beam of 12- to 15-month-old KI mice compared to age-matched WT mice (n≥10). *\u003cem\u003ep\u003c/em\u003e=0.0495, **\u003cem\u003ep\u003c/em\u003e=0.009; **\u003cem\u003ep\u003c/em\u003e=0.001, *\u003cem\u003ep\u003c/em\u003e=0.04, ***\u003cem\u003ep\u003c/em\u003e=0.0001, ***\u003cem\u003ep\u003c/em\u003e=0.0009\u003c/p\u003e\n\u003cp\u003e(L) Significantly reduced latency to fall off the rotarod of 12- to 15-month-old KI mice compared to age-matched WT mice (n≥10). *\u003cem\u003ep\u003c/em\u003e=0.04, ***\u003cem\u003ep\u003c/em\u003e=0.0001, ***\u003cem\u003ep\u003c/em\u003e=0.0009\u003c/p\u003e\n\u003cp\u003e(M) TEM images of ER-mitochondria association in 12-month-old WT and KI mice. Mito, mitochondria, ER, endoplasmic reticulum. (Scale bar, 1 μm) *\u003cem\u003ep\u003c/em\u003e=0.03, ***\u003cem\u003ep\u003c/em\u003e=0.0006, ***\u003cem\u003ep\u003c/em\u003e=0.0006\u003c/p\u003e\n\u003cp\u003e(N) FIB-SEM reconstructions of mitochondria(red) and arounded MAMs (blue) in WT and KI SN. (Scale bar, 2 μm)\u003c/p\u003e\n\u003cp\u003e(O-P) Quantitative analysis of ER-mitochondria association in WT and KI mice includes Mean MAMs area per mitochondrion (O), and fraction of mitochondrial surface in close apposition (\u0026lt;30 nm) to the ER(P). (n≥9) **\u003cem\u003ep\u003c/em\u003e=0.003, **\u003cem\u003ep\u003c/em\u003e=0.002\u003c/p\u003e\n\u003cp\u003e(Q) Immunofluorescence image of mitochondria-ER contact (green, measured by SPLICS Mt-ER Short P2A probes) in NC and KO cells. (Scale bars, 5μm)\u003c/p\u003e\n\u003cp\u003e(R) Quantitative analysis of the signals of MT-ER contacts to DAPI-stained nuclei in NC and KO cells, indicating a significant reduction in KO cells (n\u0026gt;30). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(S) Representative immunofluorescence images colocalisation of HA-PLA2G6 (blue) with the ER marker EGFP-Sec61β (green) and the mitochondrial marker TOM20 (red) in HEK293 cells; right-hand panel is a magnified view. (Scale bar, 5 μm.)\u003c/p\u003e\n\u003cp\u003e(T) Subcellular distribution of PLA2G6 analyzed by western blot of mice brain. T, total lysates, C, crude mitochondria, M, mitochondria associated membrane, E, endoplasmic reticulum, CANX, calnexin.\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; by two tailed unpaired Student’s t test ( C-D, H-L) and two tailed Welch’s t test (O-P)\u0026nbsp;\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/71fb936de7d8f7a3a796d074.png"},{"id":89658444,"identity":"1b86bdb5-97e1-4360-871b-50749f6b031e","added_by":"auto","created_at":"2025-08-22 10:41:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":575286,"visible":true,"origin":"","legend":"\u003cp\u003ePLA2G6 deficiency impairs the IP3R-GRP75-VDAC1 complex.\u003c/p\u003e\n\u003cp\u003e(A) Western blot of MAMs-associated proteins in total cell lysates and MAMs fractions from WT and KI mice brains. T, total lysates, C, crude mitochondria, M, mitochondria associated membrane.\u003c/p\u003e\n\u003cp\u003e(B-G) Quantitative analysis of MAMs-associated proteins in total cell lysates and MAMs fractions from WT and KI mice brains. The protein level data in the MAMs fraction is normalized to the CANX levels. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, *\u003cem\u003ep\u003c/em\u003e=0.0304, ***\u003cem\u003ep\u003c/em\u003e=0.0001, *\u003cem\u003ep\u003c/em\u003e=0.0342, ns: not significant\u003c/p\u003e\n\u003cp\u003e(H) Western blot of PLA2G6, IP3R, GRP75, and VDAC1 in total cell lysates from control and \u003cem\u003ePLA2G6\u003c/em\u003e KO HEK293 cells. NC, normal control.\u003c/p\u003e\n\u003cp\u003e(I-K) Quantitative analysis of GRP75 and IP3R in total cell lysates from control and \u003cem\u003ePLA2G6\u003c/em\u003e KO HEK293 cells. *\u003cem\u003ep\u003c/em\u003e=0.0143, * \u003cem\u003ep\u003c/em\u003e=0.0381, **\u003cem\u003ep\u003c/em\u003e=0.0084, *\u003cem\u003ep\u003c/em\u003e=0.0132, ns: not significant\u003c/p\u003e\n\u003cp\u003e(I) Images of in situ PLA (red) monitoring of IP3R-VDAC1 interaction in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO cells. (Scale bar, 10 μm.)\u003c/p\u003e\n\u003cp\u003e(M) Quantitative analysis of IP3R/VDAC1 PLA signals in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO cells (n=50 for each group). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(N) Images of in situ PLA (red) monitoring of IP3R-VDAC1 interaction in DAs derived from healthy control and two patients carrying the \u003cem\u003ePLA2G6\u003c/em\u003e D331Y mutation. (Scale bar, 10 μm.)\u003c/p\u003e\n\u003cp\u003e(O) Quantitative analysis of IP3R/VDAC1 PLA signals DAs derived from healthy control (HC) and two patients carrying D331Y mutant (P1 and P2) carrying the \u003cem\u003ePLA2G6\u003c/em\u003e D331Y mutation. (n=50). ***\u003cem\u003ep\u003c/em\u003e=0.0003, ***\u003cem\u003ep\u003c/em\u003e=0.0006\u003c/p\u003e\n\u003cp\u003e(P) Time-course of calcium transients in response to 100 µM ATP stimulation in NC and KO cells, measured by Rhod-2 AM fluorescence intensity ratio (F/F0).\u003c/p\u003e\n\u003cp\u003e(Q) Immunoblot analysis of GRP75 coimmunoprecipitated with IP3R antibody in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO cells\u003c/p\u003e\n\u003cp\u003e(R) Quantitative analysis of GRP75 coimmunoprecipitated with IP3R antibody in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO cells. *\u003cem\u003ep\u003c/em\u003e=0.0473\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; by two-tailed paired Student’s t test (B-G, R), RM one-way ANOVA with Dunnett's multiple comparisons test (I-K), Brown-Forsythe and Welch ANOVA tests with Dunnett's multiple comparisons test (M), one-way ANOVA with Dunnett's multiple comparisons test (O).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/36a08224eab16287bf944c6b.png"},{"id":89657400,"identity":"e0e58487-6267-4cdf-a514-24cc7ca18838","added_by":"auto","created_at":"2025-08-22 10:33:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":578762,"visible":true,"origin":"","legend":"\u003cp\u003eGRP75 overexpression can repair the defects of the IP3R-GRP75-VDAC1 complex.\u003c/p\u003e\n\u003cp\u003e(A) Immunoblot analysis of IP3R, GRP75, and VDAC1 in the PLA2G6 immunoprecipitants of whole brain lysates and MAMs fractions from WT mice. T, total lysates; M, MAMs.\u003c/p\u003e\n\u003cp\u003e(B) Representative Immunofluorescence of colocalization between IP3R1, GRP75, VDAC1 (green) and HA-PLA2G6 (red) in PLA2G6-overexpressed HEK293 cells. (Scale bar, 10 μm)\u003c/p\u003e\n\u003cp\u003e(C) Western blot of time-dependent degradation of GRP75 after treatment of CHX in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO HEK293 cells. Cells were pre-equilibrated with MG132 (10 µM, 4 h) to equalize baseline GRP75 before CHX treatment. NC, normal control.\u003c/p\u003e\n\u003cp\u003e(D) Quantitative analysis of time-dependent degradation of GRP75 after treatment of CHX in control and \u003cem\u003ePLA2G6\u003c/em\u003e KO HEK293 cells. *\u003cem\u003ep\u003c/em\u003e=0.0487\u003c/p\u003e\n\u003cp\u003e(E) Western blot of over-expression of wild-type (WT) or D331Y-mutant PLA2G6 in KO cells.\u003c/p\u003e\n\u003cp\u003e(F) Quantitative analysis of GRP75 levels after re-expression of wild-type (WT) or D331Y-mutant \u003cem\u003ePLA2G6\u003c/em\u003e in KO cells. *\u003cem\u003ep\u003c/em\u003e=0.0122, ns: not significant\u003c/p\u003e\n\u003cp\u003e(G) Western blot of over-expression of pcDNA3.1_GRP75 in KO cells.\u003c/p\u003e\n\u003cp\u003e(H) HA pull-down from lysates of KO cells re-expressing HA-\u003cem\u003ePLA2G6\u003c/em\u003e WT or HA-\u003cem\u003ePLA2G6\u003c/em\u003e D331Y; immunoblots probed for IP3R, GRP75 and VDAC1; 5 % input shown.\u003c/p\u003e\n\u003cp\u003e(I) Quantitative analysis of co-precipitated protein / HA from three independent pull-downs. *\u003cem\u003ep\u003c/em\u003e=0.0189, *\u003cem\u003ep\u003c/em\u003e=0.0353, **\u003cem\u003ep\u003c/em\u003e=0.0044\u003c/p\u003e\n\u003cp\u003e(J) Representative in-situ PLAimages detecting IP3R–VDAC1 contacts (red puncta) in NC, KO+vector, KO+HA-\u003cem\u003ePLA2G6\u003c/em\u003eWT, KO+HA-\u003cem\u003ePLA2G6\u003c/em\u003e D331Y and KO+GRP75 cells; nuclei, DAPI (blue). (Scale bar, 10 μm)\u003c/p\u003e\n\u003cp\u003e(K) Quantitative analysis of IP3R/VDAC1 PLA signals in above four groups (n \u0026gt;25) ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, ns: not significant, ***\u003cem\u003ep\u003c/em\u003e=0.0009\u003c/p\u003e\n\u003cp\u003e(L) Time scan curves of ATP-evoked Ca²⁺ signals recorded with Fluo-4 (cytosol), Mag-Fluo-4 (ER lumen) and Rhod-2 (mitochondria) in NC, KO+vector, KO+HA-PLA2G6 WT, KO+HA-PLA2G6 D331Y and KO+GRP75 cells.\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; by two-tailed multiple paired t tests (D) one-way ANOVA test with Dunnett's multiple comparisons test (F), Brown-Forsythe and Welch ANOVA tests with Dunnett's multiple comparisons test (K)\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/63d37a562ff7fcc3d2ec08dd.png"},{"id":89658445,"identity":"6df8d209-73f1-437d-af81-9f2c93b46082","added_by":"auto","created_at":"2025-08-22 10:41:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":621155,"visible":true,"origin":"","legend":"\u003cp\u003ePLA2G6 deficiency leads to ceramide accumulation, especially in mitochondria\u003c/p\u003e\n\u003cp\u003e(A) Volcano plot of untargeted lipidomic illustrating lipids differing between midbrains from WT and KI mice (n=5). Each dot represents one lipid. The x-axis represents log2 (Fold change), and the y-axis represents -log10 (P-value). The two lines parallel to the y-axis are x = −0.585 and x = 0.585. The points to the left of x = −0.585 and to the right of x = 0.585 are lipids with differences \u0026gt;1.5-fold. The line parallel to the x-axis is y = 1.30. Dots above the broken line indicate a significant difference. Red points represent lipids differing significantly, based on fold-change \u0026gt; 1.5 and P \u0026lt; 0.05. Cer: ceramide.\u003c/p\u003e\n\u003cp\u003e(B) Heatmap representation of ceramide changes of midbrains from WT and KI mice (n=5). The colors in the heat map indicated the deviation from the mean values of each metabolite. The heatmap's color bar shows the values, representing the number of standard deviations from the average.\u003c/p\u003e\n\u003cp\u003e(C) Heatmap representation of high-throughput ceramide analysis in four groups of HEK293 cells. The genotypes and treatment of each group are shown on the right and each group included 4 batches of cells.\u003c/p\u003e\n\u003cp\u003e(D) Representative immunocytochemistry of ceramide (green) in NC and KO cells, as well as KO cells treated with DES or GW, using anti-ceramide antibody(green). (Scale bar, 25 μm)\u003c/p\u003e\n\u003cp\u003e(E) Quantitative analysis of immunofluorescent intensity for ceramides in different groups of cells (n\u0026gt;30). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(F) ELISA analysis of ceramide fold-change under the different treatments on HEK293 cell lines. *\u003cem\u003ep\u003c/em\u003e=0.0406, *\u003cem\u003ep\u003c/em\u003e=0.0397, ***\u003cem\u003ep\u003c/em\u003e=0.0001\u003c/p\u003e\n\u003cp\u003e(G) Representative immunostaining of ceramides (green) and DAT (red) in DA neurons from healthy control (HC) and two patients carrying D331Y mutant (P1 and P2). (Scale bar, 10 μm)\u003c/p\u003e\n\u003cp\u003e(H) Quantitative analysis of immunofluorescent intensity for ceramides in different groups of DAs (n = 20). **\u003cem\u003ep\u003c/em\u003e=0.0032, *\u003cem\u003ep\u003c/em\u003e=0.0174\u003c/p\u003e\n\u003cp\u003e(I) ELISA analysis of ceramide levels across different subcellular fractions of WT or KO cell lines. **\u003cem\u003ep\u003c/em\u003e=0.0010, *\u003cem\u003ep\u003c/em\u003e=0.0029, ns: not significant, *\u003cem\u003ep\u003c/em\u003e=0.0102\u003c/p\u003e\n\u003cp\u003e(J) ELISA analysis of ceramide levels across different subcellular fractions of WT and KI mice brain. ***\u003cem\u003ep\u003c/em\u003e=0.0003, *\u003cem\u003ep\u003c/em\u003e=0.0131 ns: not significant, *\u003cem\u003ep\u003c/em\u003e=0.0213\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; by Brown-Forsythe and Welch ANOVA tests with Dunnett's multiple comparisons test (E), RM one-way ANOVA test with Dunnett's multiple comparisons test (F, H) or two tailed multiple paired t tests (I, J))\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/4388e1108e4afba475e2d3c1.png"},{"id":89657405,"identity":"238a0a9d-ba67-40ae-9a58-d12ae462b372","added_by":"auto","created_at":"2025-08-22 10:33:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":303138,"visible":true,"origin":"","legend":"\u003cp\u003ePLA2G6 regulates ceramide level \u003cem\u003evia\u003c/em\u003eGRP75\u003c/p\u003e\n\u003cp\u003e(A) Representative Immunofluorescence of colocalization between GRP75, VDAC1(red) and ceramides (green) in HEK293 cells. Cer, ceramides. (Scale bar, 10 μm)\u003c/p\u003e\n\u003cp\u003e(B) Representative Immunofluorescence of colocalization between GRP75, VDAC1(red) and ceramides (green) in DA neurons. (Scale bar, 10 μm)\u003c/p\u003e\n\u003cp\u003e(C) Immunoblot of GRP75 and VDAC1 using ceramide binded beads to precipitate ceramide-binding proteins from whole lysates and MAMs fractions of mice brain. Cer: ceramides. T, total lysates; M, MAMs, Ctrl: Control beads.\u003c/p\u003e\n\u003cp\u003e(D) ELISA analysis of fold change in ceramide levels across different treatments. *\u003cem\u003ep\u003c/em\u003e=0.0430, ns: not significant, *\u003cem\u003ep\u003c/em\u003e=0.0414\u003c/p\u003e\n\u003cp\u003e(E) Heatmap representation of high-throughput ceramide analysis in \u003cem\u003ePLA2G6\u003c/em\u003e KO cells with and without GRP75 overexpression. The plasmid transfected in each group is shown on the right and each group included 4 batches of cells.\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; ns: not significant, by RM one-way ANOVA test with Bonferroni's multiple comparisons test (D).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/d7846a0f94a199fb5f4a2319.png"},{"id":89658897,"identity":"d56df757-278f-495f-98ce-b64a4d8f5f9c","added_by":"auto","created_at":"2025-08-22 10:49:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":630621,"visible":true,"origin":"","legend":"\u003cp\u003eMitochondrial dysfunction resulting from PLA2G6 deficiency can be mitigated by the overexpression of GRP75 and the reduction of ceramide levels.\u003c/p\u003e\n\u003cp\u003e(A) Representative TEM images of mitochondria in the SN region of WT and KI mice. (Scale bar, 1 μm)\u003c/p\u003e\n\u003cp\u003e(B-D) Quantitative analysis of the average area, the circularity index, and the cristae score of individual mitochondria in the SN region of WT and KI mice. **p=0.0025, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(E) Images of the mitochondrial structure in HEK293 NC and KO cells stained with TOM20 (red). (Scale bar, 5 μm)\u003c/p\u003e\n\u003cp\u003e(F) Quantitative analysis of the average mitochondrial branch length in HEK293 NC and KO cells. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(G) Flow cytometry histograms showing TMRE intensity in cells treated with CCCP and in HEK293 NC cells transfected with pcDNA3.1 (NC+pcDNA3.1), PLA2G6 KO cells with pcDNA3.1 (KO+pcDNA3.1), and PLA2G6 KO cells overexpressing GRP75 (KO+GRP75).\u003c/p\u003e\n\u003cp\u003e(H) Fold-change analysis of TMRE intensity, indicating a significant decrease in mitochondrial membrane potential in KO cells compared to NC, and partial restoration in KO cells overexpressing GRP75. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(I) Flow cytometry histograms showing TMRE intensity in HEK293 NC cells transfected with pcDNA3.1 (NC+pcDNA3.1), PLA2G6 KO cells with pcDNA3.1 (KO+pcDNA3.1), and PLA2G6 KO cells overexpressing WT PLA2G6 (KO+HA-PLA2G6 WT) and overexpressing the pathogenic D331Y variant (KO + HA-PLA2G6 D331Y).\u003c/p\u003e\n\u003cp\u003e(J) Fold-change analysis of TMRE intensity, indicating a significant decrease in mitochondrial membrane potential in KO cells compared to NC, near-complete restoration by PLA2G6 WT and only moderate recovery by the D331Y mutant. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(K) Flow cytometry histograms of TMRE intensity in HEK293 NC cells treated with DMSO (NC+DMSO), KO cells treated with DMSO (KO+DMSO), KO cells treated with DES (KO+DES), and KO cells treated with GW (KO+GW).\u003c/p\u003e\n\u003cp\u003e(L) Fold-change analysis of TMRE intensity in NC, KO cells, and KO cells treated with DES or GW. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(M) Flow cytometry histograms showing MitoSox intensity in HEK293 NC cells transfected with pcDNA3.1 (NC+pcDNA3.1), PLA2G6 KO cells with pcDNA3.1 (KO+pcDNA3.1), KO cells over-expressing GRP75 (KO + GRP75), PLA2G6 KO cells overexpressing WT PLA2G6 (KO+HA-PLA2G6 WT) and KO cells expressing the pathogenic D331Y variant (KO + HA-PLA2G6 D331Y).\u003c/p\u003e\n\u003cp\u003e(N) Fold-change analysis of MitoSox intensity, indicating a significant increase in mitochondrial ROS in KO cells compared to NC, partial rescue by GRP75, near-complete restoration by PLA2G6 WT and only moderate recovery by the D331Y mutant. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003e(O) Flow cytometry histograms of MitoSox intensity in HEK293 NC, KO cells, and KO cells treated with DES or GW.\u003c/p\u003e\n\u003cp\u003e(P) Fold-change analysis of MitoSox intensity in NC, KO cells, and KO cells treated with DES or GW, using MitoSOX dye. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; by two tailed unpaired Student’s t test (B-D), two tailed Welch’s t test (F) or Brown-Forsythe and Welch ANOVA tests with Games-Howell's multiple comparisons test (H, J, L, N, and P).\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/70f1e9ebea6eb93014901425.png"},{"id":89657408,"identity":"0c1ec445-b831-44d9-bb73-e0cabd301558","added_by":"auto","created_at":"2025-08-22 10:33:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":638611,"visible":true,"origin":"","legend":"\u003cp\u003eReducing ceramide levels rescues neurodegeneration and mitochondrial dysfunction in KI mice.\u003c/p\u003e\n\u003cp\u003e(A) The schedule of the experimental and treatment designs of mice.\u003c/p\u003e\n\u003cp\u003e(B-E) Administration of DES or GW could rescue the motor deficit of KI mice, including increasing latency to fall off the wire cage lids (B) ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, *\u003cem\u003ep\u003c/em\u003e=0.0103, *\u003cem\u003ep\u003c/em\u003e=0.0300, reducing latency to fall off the rotarod, (C) **\u003cem\u003ep\u003c/em\u003e=0.0026, ns: not significant, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, **\u003cem\u003ep\u003c/em\u003e=0.0058, **\u003cem\u003ep\u003c/em\u003e=0.0099, and reducing beam traversal (D)\u0026nbsp; **\u003cem\u003ep\u003c/em\u003e=0.0012, ns: not significant, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001,***\u003cem\u003ep\u003c/em\u003e=0.0005, **\u003cem\u003ep\u003c/em\u003e=0.009and foot slips (E) *\u003cem\u003ep\u003c/em\u003e=0.0151, ns: not significant, ***\u003cem\u003ep\u003c/em\u003e=0.0002, *\u003cem\u003ep\u003c/em\u003e=0.0471, **\u003cem\u003ep\u003c/em\u003e=0.0054 on the balance beam (n=7).\u003c/p\u003e\n\u003cp\u003e(F) Representative TH immunostaining images of the TH\u003csup\u003e+ \u003c/sup\u003edopaminergic neurons in the SN of four mice groups. The inner circle area represents the SNpc. (Scale bar, 250 μm)\u003c/p\u003e\n\u003cp\u003e(G) Quantitative analysis of TH\u003csup\u003e+\u003c/sup\u003e neurons in four mice groups (n=4). ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, *\u003cem\u003ep\u003c/em\u003e=0.0276, *\u003cem\u003ep\u003c/em\u003e=0.0342\u003c/p\u003e\n\u003cp\u003e(H) Western blot of TH expression in the SN of four mice groups.\u003c/p\u003e\n\u003cp\u003e(I) Quantitative analysis of TH expression level in SN of four mice groups (n=4). **\u003cem\u003ep\u003c/em\u003e=0.0015, *\u003cem\u003ep\u003c/em\u003e=0.0396, *\u003cem\u003ep\u003c/em\u003e=0.0177\u003c/p\u003e\n\u003cp\u003e(J) Representative TEM images of mitochondria in the SN region of four mice groups. (Scale bar, 1μm)\u003c/p\u003e\n\u003cp\u003e(K-M) Quantitative analysis of the average area, the circularity index, and the cristae score of individual mitochondria in the SN region of four mice groups. ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001, *\u003cem\u003ep\u003c/em\u003e=0.0416, **\u003cem\u003ep\u003c/em\u003e=0.0013, *\u003cem\u003ep\u003c/em\u003e=0.0343, *\u003cem\u003ep\u003c/em\u003e=0.0208, *\u003cem\u003ep\u003c/em\u003e=0.0201, ****\u003cem\u003ep\u003c/em\u003e\u0026lt;0.0001\u003c/p\u003e\n\u003cp\u003eError bars represent SEM; ns: not significant, *p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001 by two-way ANOVA with Dunnett's multiple comparisons test (B-E), one-way ANOVA with Dunnett's multiple comparisons test (G, I, L-M) or Brown-Forsythe and Welch ANOVA tests with Dunnett's multiple comparisons test (K).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/ea14d8ba577dfbd3b56eec70.png"},{"id":91257436,"identity":"9b14a039-71d8-4763-befe-e62a313a5c03","added_by":"auto","created_at":"2025-09-13 23:46:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8015513,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/286d4ff1-2f64-4428-ba58-b86088c0d912.pdf"},{"id":89658447,"identity":"eab39d69-b88c-47bb-bc48-ccbd47133195","added_by":"auto","created_at":"2025-08-22 10:41:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":8114760,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/b672f82a02c1aba8f81f2c55.docx"},{"id":89657397,"identity":"5025da88-fd13-4766-9948-bd531054e59e","added_by":"auto","created_at":"2025-08-22 10:33:49","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":27117,"visible":true,"origin":"","legend":"","description":"","filename":"KeyResourcesTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-7426255/v1/98165bfa4eb865fb5f80652a.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mutations in PLA2G6 impair ER–mitochondria contacts and ceramide homeostasis via GRP75 in Parkinson’s disease","fulltext":[{"header":"1. Background","content":"\u003cp\u003eParkinson\u0026rsquo;s disease (PD), ranking among the most common neurodegenerative diseases, is characterized by the progressive loss of dopaminergic neurons in the brain [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The prevalence of PD has doubled over the past 25 years, with over 8.5\u0026nbsp;million people affected globally in 2019, making it an urging international health issue[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite significant advances in understanding the pathogenesis of PD, the precise mechanisms that drive neuronal degeneration remain elusive, highlighting the need for further research into its underlying cellular and molecular pathways[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Emerging evidence implicates mitochondrial dysfunction, aberrant lipid metabolism and perturbed inter-organelle signaling as central drivers of PD pathology, yet the mechanistic crosstalk among them is still obscure [\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eLoss-of-function mutations in \u003cem\u003ePLA2G6\u003c/em\u003e\u0026mdash;encoding calcium-independent phospholipase A2β\u0026mdash;cause autosomal-recessive, early-onset PD and related neuroaxonal dystrophies[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Pathogenic variants such as the recurrent D331Y mutation in Chinese cohorts frequently present as L-dopa\u0026ndash;responsive PD, while other biallelic mutations identified in PARK14 families lead to dystonia-parkinsonism, cognitive decline, and axonal spheroids [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. These findings establish \u003cem\u003ePLA2G6\u003c/em\u003e as PD-related gene with a phenotypic spectrum ranging from isolated parkinsonism to widespread neuroaxonal degeneration. However, despite strong genetic evidence, the physiological role and subcellular localization of PLA2G6 remain incompletely understood.\u003c/p\u003e\u003cp\u003ePrevious studies have elucidated several mechanisms by which \u003cem\u003ePLA2G6\u003c/em\u003e mutations contribute to PD, including neuroinflammation, ferroptosis, disrupted autophagy and ER stress, as observed in PLA2G6-linked PD models[\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Notably, ceramide dysregulation is a critical factor, with loss of PLA2G6 function causing ceramide accumulation that disrupts retromer trafficking, induces lysosomal expansion, and accelerates neurodegeneration[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, the intracellular compartmentalization of this lipid imbalance and its translation into neuronal vulnerability remain unclear. Furthermore, PLA2G6\u0026rsquo;s precise subcellular localization\u0026mdash;whether predominantly cytosolic or associated with mitochondria or ER\u0026mdash;remains contentious[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and the mechanisms underlying its impact on mitochondrial integrity require further investigation. Resolving these uncertainties is essential to delineate the pathogenic cascade of PLA2G6 mutations and to identify viable therapeutic targets.\u003c/p\u003e\u003cp\u003eHere, we show that PLA2G6 localizes to mitochondria-associated membranes (MAMs)\u0026mdash;specialized regions of ER\u0026ndash;mitochondria contact that coordinate lipid trafficking and calcium signaling[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Increasing evidence implicates MAM dysfunction in the pathogenesis of neurodegenerative diseases, including Alzheimer\u0026rsquo;s disease (AD), amyotrophic lateral sclerosis (ALS), and PD[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Within this microdomain, the canonical IP3R\u0026ndash;GRP75\u0026ndash;VDAC1 tether funnels Ca\u0026sup2;⁺ into mitochondria to sustain oxidative phosphorylation and limit reactive oxygen species (ROS)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Our data show that PLA2G6 loss impairs MAMs, lowers GRP75, disrupt IP3R\u0026ndash;GRP75\u0026ndash;VDAC1 tether and drives mitochondria-predominant ceramide accumulation, culminating in cristae collapse and respiratory failure. Targeting this PLA2G6\u0026ndash;GRP75\u0026ndash;ceramide axis thus emerges as a rational therapeutic strategy for PLA2G6-linked parkinsonism and, potentially, for sporadic PD and other neurodegenerative diseases characterized by mitochondrial stress.\u003c/p\u003e"},{"header":"2. Methods","content":"\u003cp\u003eExperimental Model and Subject Details\u003c/p\u003e\n\u003cp\u003eGeneration of PLA2G6 p.D331Y knock-in mice model using CRISPR/Cas9 and animal care\u003c/p\u003e\n\u003cp\u003ePLA2G6 is located on human chromosome 22q13.1. The PLA2G6 gene is highly conserved between mice and humans, and the two genes encode similar proteins with shared functions. The human PLA2G6 gene encodes a protein with a maximum length of 806 amino acids. The point mutation denoted as p.D331Y is situated within the exon 7 region of the transcript ENST00000332509 (NM_003560). Notably, the mutation site in human PLA2G6, specifically the substitution of aspartic acid (D) with tyrosine (Y) at position 331 (p.D331Y), is observed to be evolutionarily conserved when examining the corresponding region in mice.\u003c/p\u003e\n\u003cp\u003eTo achieve CRISPR/Cas9-mediated knock-in into PLA2G6, we selected sgRNA (F: 5\u0026rsquo;-TAGGCACCATGACACAGTCAAAG \u0026minus;\u0026thinsp;3\u0026rsquo;; R: 5\u0026rsquo;-AAACCTTGACTGTGTCATGGTG \u0026minus;\u0026thinsp;3\u0026rsquo;) that targets sequences within exon7, adapted to the homology regions of gene targeting vectors used for embryonic stem (ES) cells that cover sequences up and downstream of this site. We further construct plasmids that can simultaneously express sgRNA and Cas9 targeted at specific loci of the mouse PLA2G6 gene, as well as a Donor plasmid carrying the PLA2G6 D331Y fragment (5\u0026rsquo;-ACTAGCTCCTCAGGGAACACAGCCCTGCATGTGGCGGTGATGCGCAACCGGTTTTACTGTGTCATGGTGCTGCTGACCTACGGGGCTAATGCAGGTGCCCGCGGA-3\u0026rsquo;). Inject these two plasmids into super-ovulated mouse zygotes and transplant them into surrogate mouse uteri. After the Cas9 system cuts the DNA strand, the PLA2G6 D331Y fragment is recombined to the target site through homologous recombination. Extract DNA from the mouse tail and amplify it \u003cem\u003evia\u003c/em\u003e PCR with specific primers (Exon7-PLA2G6-forward: CGGTCTTCACCTAATTGTTAC; Exon7-PLA2G6-Reverse: AGAAGGCATGTCTGATGTAG). Genotypes are determined by analyzing the number and size of bands after 1.5% agarose gel electrophoresis of PCR products. Sequencing of PCR products further verifies the success of the PLA2G6 D331Y mutation. F1 heterozygous mutant mice were bred from wild-type C57BL/6J mice to generate F2 heterozygous mutant mice. The resultant heterozygous knock-in mice were bred and maintained on C57BL/6J genetic background and intercrossed to generate homozygous PLA2G6\u003csup\u003eD331Y/D331Y\u003c/sup\u003e knock-in (KI) mice. All animal experiments were performed according to protocols approved by the Ethics Review Committee for Animal Experimentation of Central South University.\u003c/p\u003e\n\u003cp\u003eCell culture and transfection\u003c/p\u003e\n\u003cp\u003eMEF cells and Human Embryonic Kidney 293 (HEK293) cell line were grown in DMEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco, #10099158) and 100U/mL penicillin/streptomycin (Gibco, #15070063). The human neuroblastoma SH-SY5Y cell line was grown in DMEM/F-12 medium (Gibco, #11320033) supplemented with 15% fetal bovine serum (Gibco, #10099158) and 100U/mL penicillin/streptomycin (Gibco, #15070063). All cell lines were maintained in a controlled environment containing 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C.\u003c/p\u003e\n\u003cp\u003ePLA2G6 knockout HEK293 cell lines (PLA2G6 KO cells) were generated using the CRISPR/Cas9 gene-editing. Two sgRNAs targeting the PLA2G6 gene were designed utilizing the Ensembl website (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ensembl.org/index.html\u003c/span\u003e\u003c/span\u003e). These sgRNAs were subsequently employed to construct the sgRNA-LentiCRISPRv2 recombinant plasmid. Co-transfection of sgRNA-LentiCRISPRv2, pVSV-G (Addgene, #138479, and psPAX2 (Addgene, #12260) into HEK293T cells was performed using Lipofectamine 3000 (at a ratio of sgRNA-lentiCRISPRv2: pVSVg: psPAX2\u0026thinsp;=\u0026thinsp;2:1:3). After 24 hours, the culture medium was collected and clarified. The collected medium was then applied to infect normal HEK293 cells. Clonal cell lines were isolated by single-cell culturing in 96-well plates and subsequently screened using western blotting with an anti-PLA2G6 antibody.\u003c/p\u003e\n\u003cp\u003ePLA2G6 knockdown SH-SY5Y cells (PLA2G6 KD cells) were generated using the siRNA. One negative control siRNA and two specific siRNA targeting the PLA2G6 gene were designed and generated. These two siRNA were transfected into SH-SY5Y \u003cem\u003evia\u003c/em\u003e Lipofectamine 3000 (Thermo Fisher Scientific, #L3000075). All above cell lines were transfected with plasmids using Lipofectamine 3000 according to the manufacturer\u0026rsquo;s introductions.\u003c/p\u003e\n\u003cp\u003eImaging of dopamine transporter (DAT) in mice using PET-CT\u003c/p\u003e\n\u003cp\u003eThis study conducted PET-CT experiments on 12-month-old male mice weighing approximately 30\u0026ndash;33 grams. Radiotracers were injected via tail veins, and PET imaging was performed using a Mediso nanoScan PET/MRI scanner. After image acquisition, data were processed, and dopamine transporter status was assessed by calculating the striatal-to-cerebellar uptake ratio (SUVR). The study was conducted at the Xiangya Hospital PET Imaging Center of Central South University.\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry (IHC)\u003c/p\u003e\n\u003cp\u003eMouse brain tissues were dehydrated in sucrose solutions (10%, 20%, 30%). After settling in each solution, they were transferred to the next higher concentration. Complete settling in 30% sucrose indicated successful dehydration. Dehydrated brain tissues from specific regions were embedded in OCT (20% sucrose solution; 1:2 ratio) in disposable molds and stored at -80\u0026deg;C. The cryostat (Leica CM1850, Germany) was pre-cooled to -20\u0026deg;C. Brain tissue samples were equilibrated for at least 1 hour at -20\u0026deg;C. Brain tissues were sectioned to 25\u0026micro;m thickness. Specific substantia nigra sections were chosen using a statistical method, with every 6th section selected. About 5\u0026ndash;7 statistical sections were collected from each mouse\u0026apos;s substantia nigra and placed in 1\u0026times;PBS solution. Based on prior experiments, brain tissues from 9, 12, and 15-month-old mice were obtained following perfusion and separation procedures. The collected mouse brain tissues were fixed in a 4% paraformaldehyde solution for a minimum of 24 hours. To obtain paraffin sections: the tissues were then dehydrated with an ethanol gradient and clarified with xylene. Following this, the tissues were infiltrated with paraffin and embedded. Subsequently, sections were cut (Leica RM2255 microtome), starting at 12\u0026ndash;16 \u0026micro;m and then transitioning to 4 \u0026micro;m for a more complete tissue cross-section. The sections were flattened in a water bath and mounted on glass slides. The paraffined sections were used for IHC. Deparaffinization is carried out by baking and immersion in xylene, followed by rehydration with ethanol and water. Antigen retrieval is performed to enhance antigen exposure, followed by blocking to reduce nonspecific binding. Primary antibody application, typically incubated overnight, is followed by secondary antibody treatment, with thorough washing steps. DAB and hydrogen peroxide are applied to the tissue. The HRP enzyme on the secondary antibody catalyzes the conversion of DAB into a brown-colored precipitate at the site of the antigen. Optional counterstaining can enhance nuclear visualization. Sections are gradually dehydrated and cleared in xylene for transparency, then mounted on slides and covered with slips for microscopy. The primary antibody used in this part includes mouse anti-TH (1:50; Santa Cruz, #sc-25269). The DAB kits used for IHC can be seen in the Key Resources Table.\u003c/p\u003e\n\u003cp\u003eImmunofluorescence (IF)\u003c/p\u003e\n\u003cp\u003eFor cell samples, coat coverslips with Poly-D-Lysine (Themofisher, # 150680) for 20 min at room temperature. Grow cells on 14mm glass coverslips (Biosharp). When the cell density was at about 70%, fix the sample using 4% paraformaldehyde. The cells should be washed three times with ice-cold PBS. Then incubate the samples for 10 min with PBS containing either 0.1 Triton X-100 and Wash cells in PBS three times for 5 min. Incubate cells in the diluted antibody in 3% BSA in PBS in a humidified chamber for 1 h at room temperature. Incubate cells with both primary antibodies in 3% BSA in PBS in a humidified chamber for 1 h at room temperature or overnight at 4\u0026deg;C and wash three times with PBS for 5 mins each in the dark. Incubate cells with first secondary antibody in 3% BSA in PBS for 1 h at room temperature in the dark. Decant the first secondary antibody solution and wash three times with PBS for 10 min each in the dark. Incubate cells on 0.1\u0026micro;g/mL DAPI for 1 min and finally rinse with PBS. Mount coverslip with a drop of mounting medium. Seal coverslip with nail polish to prevent drying and movement under microscope. Store the sample in dark at -20\u0026deg;C. Capture fluorescent microscope images using confocal microscopy (Leica STELLARIS 8 STED, From Biomedical Center, Institute for Advanced Study of Central South University), or store the slides in a -20\u0026deg;C refrigerator if not captured on the same day. Images were analyzed using Fiji software (RRID: SCR_002285). The primary antibodies used in this part include: mouse anti-PLA2G6 (1:50, Santa Cruz, # sc-376563), rabbit anti-GRP75(1:200, Cell Signaling Technology, #3593); mouse anti-IP3R (1;50, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;200, Proteintech, #5259-1-AP), mouse anti-Ceramide (1:100, Sigma-Aldrich, #C8104), rabbit anti-Tom20 (1:200 Proteintech, #11802-1-AP), rat anti-DAT (1:50, Santa Cruz, #sc-32259) The secondary antibodies used for IF were presented in in the Key Resources Table.\u003c/p\u003e\n\u003cp\u003eMice behavior test\u003c/p\u003e\n\u003cp\u003eAnalysis of motor function was performed in age-, sex- and weight-matched KI and WT animals using standard behavior tests.\u003c/p\u003e\n\u003cp\u003e(1) Hanging endurance test was applied to evaluate the gripping power of the mouse limbs. Each animal was placed in the center of a wire grid (35cm\u0026times;20cm) uniformly procured by the Experimental Animal Center at Central South University. The grid was then tapped to make the mouse grip tight, following which the grid was slowly inverted to horizontal. The time the mouse hung onto the grid (grip time) was recorded. Each experiment is recorded for a maximum of 60 seconds, with excess time counted as 60 seconds.\u003c/p\u003e\n\u003cp\u003e(2) The rotarod test assessed coordination, strength, and balance using an accelerating rotarod apparatus (RWD Life Science Company, LE8205). Each mouse was placed on the rotating rod and the rotation speed was set at 30 rpm. Observe the animal\u0026apos;s behavior and record the time it remains on the rods. The test typically ends when the animal falls off the rod or grasps the rod without rotation. Each experiment is recorded for a maximum of 5 minutes.\u003c/p\u003e\n\u003cp\u003e(3) Beam balance test is a common assay used in behavioral neuroscience to assess motor coordination, balance, and gait in rodents. We used a balance beam with specific dimensions (1.2 cm thickness, 80 cm length, 2.5 cm width) to assess mouse motor skills. The beam, elevated 30 cm above the ground, had a black opaque box at one end to leverage the mice\u0026apos;s natural scototaxis behavior. During the formal experiment, we measured the time taken to traverse the 80 cm length and recorded the number of hind limbs falls. each mouse underwent three trials, and statistical analysis was based on the average of these trials.\u003c/p\u003e\n\u003cp\u003eFor the three described behavioral experiments, each with a requirement of three repetitions per mouse. The average of three repeated experiments was used as the experimental outcome for each mouse.\u003c/p\u003e\n\u003cp\u003e(4) Open field test is designed to assess an animal\u0026apos;s exploratory and anxiety-related behaviors in a novel and open environment. The open field test equipment, with chamber dimensions of 80cm\u0026times;80cm\u0026times;40cm, was obtained from the Experimental Animal Center of Central South University. Each mouse underwent a 10-minute observation period within the open field chamber. The infrared camera automatically recorded their movements, and data were subsequently analyzed using YH-AVTAS software. Fecal and urinary excretions were noted. Key parameters, including movement distance, speed, and time spent in the central zone, were quantified. The experiment was not repeated.\u003c/p\u003e\n\u003cp\u003eExtraction of protein from mouse brains or cells and Western blot\u003c/p\u003e\n\u003cp\u003eCells or mouse brain tissues were lysed on ice via RIPA buffer supplemented with protease inhibitors (Thermo Fisher Scientific, #A32965) and phosphatase inhibitors (Selleck, #B15002). Protein concentration was quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, #23227). Add 15 \u0026micro;g of the above prepared cell lysate into SDS Sample Buffer in a volume of total 10\u0026ndash;30 \u0026micro;L. Proteins are separated by size through gel electrophoresis, typically on polyacrylamide gels. These separates proteins based on their molecular weight. The Western Blot Molecular Weight Markers were used (Thermo Fisher Scientific, #26616; Epizyme #WJ102; Servicebio #G2058). After separation, they are transferred onto a membrane, which is followed by blocking to prevent non-specific binding. The membrane is then incubated with specific primary antibodies to target proteins. Subsequently, secondary antibodies labeled with detection molecules are applied. Finally, signal detection is performed, using chemiluminescence. The resulting bands or signals on the membrane were further analyzed by Fiji software. The following primary antibodies were used: mouse anti-PLA2G6 (1:500, Santa Cruz, #sc-376563), rabbit anti-GRP75(1:1000, Cell Signaling Technology, #3593); mouse anti-IP3R (1:500, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;2000, Proteintech, #5259-1-AP), mouse anti-\u0026beta;-actin(1;5000, Proteintech, #66009-1-Ig), mouse anti-\u0026beta;-tubulin (1:30000, Abmart, # M20005), mouse anti-GAPDH (1;5000, Proteintech, #60004-1-Ig), rabbit anti-Calnexin (1;2000, Proteintech, #10427-2-AP); rabbit anti-COXIV (1;1000, Proteintech, #11242-1-AP) ; mouse anti-CerS6 (1:500, Santa Cruz, #sc-100554). The secondary antibodies used for IF were presented in in the Key Resources Table.\u003c/p\u003e\n\u003cp\u003eSubcellular fractionation\u003c/p\u003e\n\u003cp\u003eCell and Brain tissue fractionation followed published protocols [\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]. Briefly, after euthanizing the mouse and removing half of the brain, the tissue is first homogenized in cold Solution A (0.32 M sucrose, 1 mM NaHCO3, 1 mM MgCl2, 0.5 mM CaCl2, and freshly added protease inhibitors) and then subjected to low-speed centrifugations to remove nuclei, unlysed cells, and debris. The resulting supernatants, containing cytosolic and membranous components, are further centrifuged at higher speeds to obtain a crude mitochondrial fraction. This fraction is then purified through a sucrose gradient ultracentrifugation step, producing distinct bands corresponding to various membrane fractions, with crude mitochondria forming the pellet. Following this, MAMs are isolated from the freshly obtained crude mitochondria. The mitochondria are resuspended in Isolation Medium (250 mM mannitol, 5 mM HEPES pH 7.4, 0.5 mM EGTA, 0.1% BSA, plus protease inhibitors), overlaid onto a 30% Percoll gradient prepared with Gradient Buffer (225 mM mannitol, 25 mM HEPES pH 7.5, 1 mM EGTA, 0.1% BSA), and subjected to ultracentrifugation. This step separates heavy (pure mitochondria) and light fractions. The light fraction, containing MAMs, is diluted, centrifuged at 100,000 x g for 1 hour to pellet the MAMs fraction, while the ER and cytosolic fractions can be similarly obtained from previously saved supernatants through a comparable ultracentrifugation step.\u003c/p\u003e\n\u003cp\u003eDifferentiation of IPSC into DA neurons\u003c/p\u003e\n\u003cp\u003eFollowing the modified dual-SMAD-inhibition/midbrain-patterning strategy described previously [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e], induced pluripotent stem cells (iPSCs) are first driven toward a neural-progenitor-cell (NPC) fate and subsequently patterned into midbrain dopaminergic neurons (mDANs); marker expression is assayed on differentiation days 25\u0026ndash;30 (D25-D30) iPSCs (\u0026le;\u0026thinsp;passage 15, \u0026ge; 90% confluence) are dissociated to single cells with Accutase, replated 1 : 2 onto Matrigel on day 0, and fed daily with N1 medium (per 50 mL: 41 mL KO-DMEM, 7.5 mL KO serum-replacement, 0.5 mL GlutaMAX [100 \u0026times;], 0.5 mL NEAA [100 \u0026times;], 0.5 mL penicillin-streptomycin [100 \u0026times;]) supplemented with the designated small-molecule inhibitors. The culture is then gradually transitioned to N2 medium (per 50 mL: 23.5 mL DMEM/F-12, 23.5 mL Neurobasal, 0.5 mL GlutaMAX, 0.5 mL NEAA, 0.5 mL N-2 supplement [100 \u0026times;], 1 mL SM1 supplement [50 \u0026times;], 0.5 mL penicillin-streptomycin), and by days 7\u0026ndash;10 characteristic rosette-like NPC morphology becomes evident. On day 11 the NPC layer is passaged in fresh N2 medium containing the same inhibitors, expanded for up to five to seven passages, cryopreserved if necessary, or taken directly into dopaminergic induction. From differentiation day 15 onward, the medium is replaced with a dopaminergic maturation formulation consisting of Neurobasal\u0026trade; plus 1 \u0026times; B27, 3 \u0026micro;M CHIR-99021, 20 ng mL⁻\u0026sup1; BDNF, 20 ng mL⁻\u0026sup1; GDNF, 0.2 mM L-ascorbic acid, 0.5 mM dbcAMP, and 10 \u0026micro;M DAPT, all prepared from sterile concentrated stocks, adjusted to volume with Neurobasal\u0026trade;, mixed thoroughly, and filter-sterilized. Cultures are refreshed every two to three days at 37\u0026deg;C in 5% CO₂, with all other parameters unchanged; during the initial maturation period most non-dopaminergic neurons undergo apoptosis, yielding a progressively enriched population of mature midbrain dopaminergic neurons whose marker expression is assessed on differentiation days 25\u0026ndash;30.\u003c/p\u003e\n\u003cp\u003eCeramide ELISA Assay\u003c/p\u003e\n\u003cp\u003eThe Ceramide ELISA assay follows a competitive ELISA method to quantify ceramide concentrations in various biological samples. The microplate provided in the kit is pre-coated with ceramide, which competes with ceramide in the sample or standard solutions for binding sites on a biotinylated antibody specific to ceramide. This competition-based approach ensures that the intensity of the color development is inversely proportional to the ceramide concentration in the sample.To begin, the standards are prepared by serial dilution from a lyophilized standard to create a concentration range from 2000 pg/mL to 0 pg/mL (blank). Each standard is reconstituted and diluted using the provided sample dilution buffer to achieve this gradient. After sample preparation, 50 \u0026micro;L of standards or samples are added to the corresponding wells on the microplate. Next, 50 \u0026micro;L of a biotinylated detection antibody solution is added to each well. The plate is gently tapped to ensure thorough mixing before being sealed and incubated at 37\u0026deg;C for 45 minutes. During this incubation, the ceramide in the standards or samples competes with the pre-coated ceramide on the plate for binding to the biotinylated antibody. After the incubation, the wells are washed three times using a wash buffer to remove any unbound components. Following the washing step, 100 \u0026micro;L of HRP-Streptavidin Conjugate (SABC) working solution is added to each well. The plate is sealed again and incubated for 30 minutes at 37\u0026deg;C. This step allows the HRP-labeled streptavidin to bind to the biotinylated antibody that is already attached to the plate. Unbound HRP-conjugate is subsequently removed by washing the plate five times. Next, 90 \u0026micro;L of TMB (tetramethylbenzidine) substrate solution is added to each well. The enzyme-substrate reaction produces a blue color, which indicates the activity of HRP. The plate is incubated at 37\u0026deg;C in the dark for 10\u0026ndash;20 minutes, allowing the color to develop. The reaction is then stopped by adding 50 \u0026micro;L of stop solution to each well, turning the color from blue to yellow. The optical density (OD) of each well is immediately measured at 450 nm using a microplate reader. If the plate reader has the capability, a correction wavelength (such as 570 nm or 630 nm) can be used to improve accuracy by subtracting background signals. The ceramide concentration in each sample is determined by comparing its OD450 value to a standard curve, which is generated by plotting the OD values of the standards against their known concentrations. A four-parameter logistic (4PL) curve fitting is commonly used for this purpose. The concentrations of diluted samples are adjusted by multiplying the calculated value by the dilution factor. Finally, the concentration should be adjusted by protein concentration of per sample.\u003c/p\u003e\n\u003cp\u003eTransmission Electron Microscopy Study\u003c/p\u003e\n\u003cp\u003eFollowing rapid brain tissue extraction, it is fixed in 2.5% glutaraldehyde at 4\u0026deg;C for at least 2 hours. The targeted brain region is dissected and rinsed with 0.1M phosphate buffer (PB) for 30 minutes (10 minutes*3 times) at 4\u0026deg;C. Subsequent steps include fixation in 1% osmium tetroxide, dehydration with ethanol and acetone, infiltration with an acetone and resin mixture, and embedding. It is crucial to allow the embedding to be set for a few days for better cohesion. Ultrathin sectioning, uranyl acetate, and lead citrate staining follow. The prepared tissue is then observed and imaged with a transmission electron microscope (Hitachi HT-770). The parameters of MAMs and mitochondria were measured by using Fiji Software.\u003c/p\u003e\n\u003cp\u003eFIB-SEM preparation and image collection.\u003c/p\u003e\n\u003cp\u003eAccording to the protocols from Li\u0026rsquo;s Lab [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e], Adult mice were killed by cervical dislocation and the whole brain was immediately transferred to ice-cold electrophysiological solution. A 3 mm coronal brain slice containing the target area was cut using a brain mold and fixed to the base of an Vibratomes (VT1200 S, Leica).. While submerged in continuously oxygenated artificial cerebrospinal fluid (125 mM NaCl, 2.5 mM KCl, 1.25 mM NaH₂PO₄, 25 mM NaHCO₃, 1 mM MgCl₂, 2 mM CaCl₂, 25 mM glucose; pH 7.4; 300 mOsm), the tissue was cut into 500 \u0026micro;m slices, trimmed to ~\u0026thinsp;1 \u0026times; 1 \u0026times; 0.5 mm blocks, and immersion-fixed for 24 h at 4\u0026deg;C in 2.5% glutaraldehyde (0.1 M phosphate buffer, pH 7.4). On day 1 the blocks were rinsed in 0.1 M PBS, post-fixed for 1.5 h in a 1:1 mixture of 2% osmium tetroxide and 3% potassium ferrocyanide, washed three times in distilled water, incubated for 40 min in 1% thiocarbohydrazide (35\u0026deg;C water-bath in winter), washed again, exposed for 45 min to 2% aqueous OsO₄ in the dark, and stained overnight at 4\u0026deg;C in 1% uranyl acetate. On day 2 the tissue was washed, incubated for 30 min at 65\u0026deg;C in 0.66% lead aspartate, dehydrated through graded ethanol (30%, 50%, 70%, 90%, two \u0026times; 100%, 10 min each), washed twice for 30 min in 100% acetone, and infiltrated with Epon:acetone (3:7 for 5\u0026ndash;8 h, then 7:3 for 8\u0026ndash;12 h). On day 3 the medium was replaced with 100% Epon overnight, refreshed on day 4, and the samples were embedded on day 5 in fresh Epon polymerised at 65\u0026deg;C for \u0026ge;\u0026thinsp;48 h. The hardened blocks were trimmed to the region of interest with an EM TXP (Leica), sputter-coated with 15 nm platinum using an EM ACE200 (Leica), mounted on 45\u0026deg; pre-tilted aluminium stubs, given a second 300 s platinum coat, and loaded into a Helios G3 UC dual-beam FIB-SEM (Thermo Fisher Scientific). Serial Slice-and-View acquisition used a 30 kV, 0.79 nA gallium ion beam that removed 5 nm per milling step; each freshly milled surface was imaged at 2 kV and 0.2 nA in back-scattered electron mode with a 7\u0026deg; stage tilt. Raw TIFF stacks (600\u0026ndash;800 images per sample) were imported into Amira v6.5.0 (Thermo Fisher) for alignment and 3D segmentation: mitochondria with long axes of 1\u0026ndash;3 \u0026micro;m were reconstructed, every tomographic slice was accessed to label endoplasmic-reticulum membranes within 30 nm of the mitochondrial outer membrane, all qualifying ER segments were merged into a second 3D model rendered blue to depict the MAMs, and Amira\u0026rsquo;s measurement tools were used to export each mitochondrion\u0026rsquo;s surface area and volume together with the surface area of its apposed MAMs.\u003c/p\u003e\n\u003cp\u003eLipidomic Analysis\u003c/p\u003e\n\u003cp\u003eFor lipidomic analysis in mouse brain tissue, over 40 mg of tissue per sample was rapidly frozen in liquid nitrogen and used for lipidomic analyses at LipidALL Technologies with Agilent 1290 coupled with Sciex QTRAP 6500 PLUS[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. Polar lipid classes were separated by NP-HPLC using a TUP-HB silica column, and MRM transitions enabled comparative analysis. Quantification employed spiked internal standards (Avanti Polar Lipids, Matreya LLC, Sigma-Aldrich, Cayman Chemicals, and CDN isotopes). Glycerol lipids (DAG and TAG) were quantified through reverse phase HPLC/MRM[\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e], and neutral lipids were separated on a Phenomenex Kinetex-C18 column. Free cholesterols and cholesteryl esters were analyzed via APCI mode on a Jasper HPLC coupled to Sciex 4500 MD with d6-cholesterol and d6-C18:0 CE (CDN isotopes) as internal standards[\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. For high-throughput ceramides analysis in cell samples: more than 10\u003csup\u003e6\u003c/sup\u003e cells were harvested and rapidly frozen in liquid nitrogen after washing. High-throughput analysis of ceramides was conducted at LipidALL Technologies. Internal standards including d7-Cer d18:1/24:0 and d7-Cer d18:1/15:0 was added together with extraction solvent comprising ethyl acetate: isopropanol\u0026thinsp;=\u0026thinsp;2:8 (v/v) into samples. Samples were incubated at 1500 rpm, 4 ℃ for 10 min, and centrifuged at 4 ℃, 3000\u0026times;g for 10 min. A clean supernatant was used for LC-MS/MS analysis. Samples were analyzed on a Jasper HPLC-coupled to Sciex 4500 MD under electrospray ionization mode. A Waters ACQUITY UPLC BEH C18 column (2.1 \u0026times; 100 mm, 1.7 \u0026micro;m) (Waters, Dublin, Ireland) was used for the chromatographic separation of individual ceramides. Ion source settings were: Curtain gas, 20; positive ion mode ion spray voltage, 4500 V; temperature, 450\u0026deg;C; ion source gas 1, 80; ion source gas 2, 70. Individual lipids were quantitated by referencing to spiked internal standards[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eDrug administration in mice and cell model\u003c/p\u003e\n\u003cp\u003eWe initiated treatment in 12-13-month-old mice, a stage post-symptom manifestation, aligning with typical clinical intervention timings. We divided the mice into four groups: WT\u0026thinsp;+\u0026thinsp;DMSO (2.5% DMSO, 500 \u0026micro;L), KI\u0026thinsp;+\u0026thinsp;DMSO (2.5% DMSO, 500 \u0026micro;L), KI\u0026thinsp;+\u0026thinsp;DES (DES at 20 mg/kg/day), and KI\u0026thinsp;+\u0026thinsp;GW (GW at 1.5 mg/kg/day). Groups received intraperitoneal injections of their respective treatments. Each group comprised 7 age- and weight-matched mice and underwent a 6-week treatment regimen to evaluate the impact of the drugs on motor dysfunction. Before drug application, HEK293 or SH-SY5Y cells are plated in complete growth medium and cultured at 37\u0026deg;C with 5% CO₂ until they reach roughly 70% confluence. On the treatment day, the spent medium is aspirated and replaced with pre-warmed medium containing the appropriate compound: HEK293 cultures receive 5 \u0026micro;M DES or 2 \u0026micro;M GW (each a 1:200 dilution), whereas SH-SY5Y and MEF cultures receive 2.5 \u0026micro;M DES or 1 \u0026micro;M GW (1:400 dilutions); parallel vehicle controls are given an equivalent dilution of DMSO. Cells treated with DES are incubated for 24 h, whereas those exposed to GW are incubated for 6 h under the same conditions, after which they are immediately processed for the designated downstream assays.\u003c/p\u003e\n\u003cp\u003eCo-Immunoprecipitation Assays\u003c/p\u003e\n\u003cp\u003eCo-immunoprecipitations (Co-IP) for protein-protein interactions were carried out using protein A/G magnetic bead (Selleck, #B23201). Briefly, 10\u003csup\u003e6\u003c/sup\u003e WT and KO cells were harvested and washed in PBS for two times. Cells were lysed in ice-cold IP Lysis/Wash Buffer. The whole cell lysate was stored on ice for the following steps. Transfer 30 \u0026micro;L bead slurry to a 1.5 mL tube, then wash the slurry in binding buffer. Whole-cell lysates were mixed with primary antibodies for 1 hour at room temperature. Bead slurry was subsequently added and mixed with whole-cell lysates for overnight at 4\u0026deg;C. The beads were washed three times with lysis buffer. Samples were eluted into SDS Loading Buffer and analyzed by western blot. These primary antibodies were used: mouse anti-PLA2G6 (1:10, Santa Cruz, #sc-376563), mouse anti-IP3R (1:10, Santa Cruz, # sc-377518). The normal controls were presented in the Key Resources Table. For the analysis of Ceramide-protein interactions, we employed ceramide beads (Echelon Biosciences, #P-BCER). In brief, gently mix the beads and transfer 50\u0026ndash;100 \u0026micro;L of a 50% bead slurry to a 0.5\u0026ndash;1.5 mL tube. Pellet the beads at 1,000 x g, carefully removing the supernatant. Wash the beads with a 10X excess of the wash buffer, repeating twice for 1\u0026ndash;2 minutes each. Resuspend the beads in whole cell lysates and incubate the protein-bead solution for 2 hours with continuous motion. Pellet the beads, remove the supernatant, and wash the beads two to five times. Elute bound proteins by adding SDS Loading Buffer and heating to 70\u0026deg;C for 10 minutes. Pellet the beads, store the supernatant at -20\u0026deg;C, and discard the beads. Analyze proteins by western blotting. The same procedure was applied to control beads (Echelon Biosciences, # P-B000) following the above steps to serve as a negative control.\u003c/p\u003e\n\u003cp\u003eProximity ligation assays\u003c/p\u003e\n\u003cp\u003eProximity ligation assays (PLA) were conducted to examine the proximity and potential interaction of two proteins (within \u0026lt;\u0026thinsp;40 nm). Duolink\u0026reg; In Situ Red Starter Kit (Sigma-Aldrich, # DUO92102) was employed according to the manufacturer\u0026apos;s guidelines. Cells cultured on glass slides underwent fixation, permeabilization, and blocking before overnight incubation with paired primary antibodies (mouse anti-IP3R (1;50, Santa Cruz, #sc-377518), rabbit anti-VDAC1 (1;200, Proteintech, #5259-1-AP)). Following a buffer wash, paired secondary antibodies (anti-rabbit PLUS and anti-mouse MINUS) conjugated with oligonucleotides were applied. When the distance between the two proteins of interest was less than 40 nm, ligase action connected the oligonucleotides, forming a closed circular DNA. Signal amplification occurred through rolling circle amplification (RCA) under polymerase action, resulting in dot-like PLA signals observable under a fluorescence microscope. Simultaneous negative control PLA experiments were performed, and PLA signals were quantified using the \u0026quot;Particle Analysis\u0026quot; function of ImageJ.\u003c/p\u003e\n\u003cp\u003eCHX protein degeneration experiment\u003c/p\u003e\n\u003cp\u003eSeed NC and KO cells at a 1:4 ratio into eight wells of a 12-well plate. After 18\u0026ndash;24 h, confirm cell density at approximately 80%. Pretreated the cells with MG132 for 4h. Prepare 500 \u0026micro;g of CHX in 0.6 mL tubes by adding 10 \u0026micro;L of DMSO and mixing well to achieve a final CHX (Selleck, #S7418) concentration of 50 mg/mL. Slowly introduce 1 \u0026micro;L of CHX into the 1 mL cell culture medium, gently shaking the plate for thorough mixing. As a control, add 1 \u0026micro;L of DMSO into the corresponding well. Treat cells with CHX (50 \u0026micro;g/mL) for designated timepoints (0, 4, 8, 12 hours). Harvest cells and extract cellular proteins for subsequent analysis.\u003c/p\u003e\n\u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e flux analysis\u003c/p\u003e\n\u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e dynamics in three compartments\u0026mdash;cytosol, ER lumen and mitochondria\u0026mdash;after ATP stimulation were observed via Fluo-4, Mag-Fluo-4 or Rhod-2, respectively. Approximately 1 x 10\u003csup\u003e5\u003c/sup\u003e cells were seeded on 20mm glass bottom cell culture dishes (NEST). The cells were loaded with 2 \u0026micro;M Fluo-4, 2 \u0026micro;M Mag-Fluo-4 or Rhod-2 or 5 \u0026micro;M Rhod-2, AM in HANKs buffer for 30 min at 37\u0026deg;C to monitor mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e dynamics. After four washes with HANKs buffer, the cells were further incubated at 37\u0026deg;C for 30 min to enhance mitochondrial uptake following de-esterification of the dye. Subsequently, the dishes were bathed in HANKs buffer, and image acquisition was performed using a Zeiss Observer7 laser microscope. Fluo-4, Mag-Fluo-4 or Rhod-2 was excited with a laser of 494 nm, 494 nm, and 555 nm, respectively. Ca\u003csup\u003e2+\u003c/sup\u003e release from the ER-stores was induced using 100 \u0026micro;M ATP (Selleck, #S5260). Each experiment involved imaging about 30 cells, and corresponding mitochondrial calcium uptake was recorded for about 6 min, capturing an image every 10 seconds.\u003c/p\u003e\n\u003cp\u003eMitochondrial membrane potential (\u0026Delta;\u0026psi;m) assessment\u003c/p\u003e\n\u003cp\u003eTo detect the \u0026Delta;\u0026psi;m, cells within one well of a 24-well plate were treated as indicated and incubated with 1 ml TMRE dilution (1:1000, Beyotime, #C2001S) for 30 min at 37\u0026deg;C in the dark. Following the incubation period, the cells underwent centrifugation to eliminate the supernatant, underwent three washes with PBS, and were then prepared for flow cytometric analysis. Each 500 \u0026micro;l fractions were used for flow cytometry (Beckman Coulter, Inc., USA). The PE channel was employed for the observation of the TMRE signal. Flow cytometry analysis was performed using an unstained control to determine appropriate gates required in flow cytometry.\u003c/p\u003e\n\u003cp\u003eMitochondrial ROS assessment\u003c/p\u003e\n\u003cp\u003eMitochondrial ROS levels were evaluated using MitoSox (Thermo Fisher Scientific, #M36008), a mitochondrion-specific hydroethidine-derivative fluorescent dye. Experiments were conducted on the same day utilizing a freshly prepared MitoSox stock solution. Approximately 1 x 10\u003csup\u003e5\u003c/sup\u003e cells were plated on 20mm glass-bottom cell culture dishes. After 18\u0026ndash;24 hours, the cell density was confirmed to be approximately 70%. After centrifugation to collect the cells, cells were incubated with the MitoSOX Red working solution (1 \u0026micro;M) for 30 minutes, followed by three washes with Hanks\u0026apos; balanced salt solution at 4\u0026deg;C. Following eliminating the supernatant, resuspend the pallet in 500 \u0026micro;l Hanks\u0026apos; balanced salt solution, which were used for flow cytometry (Beckman Coulter, Inc., USA). The PE channel was employed for the observation of the MitoSox signal. Flow cytometry analysis was performed using an unstained control to determine appropriate gates required in flow cytometry.\u003c/p\u003e\n\u003cp\u003eMitoTracker staining\u003c/p\u003e\n\u003cp\u003eWe initially seeded cells on well plates following standard protocols to ensure uniform growth. After achieving the desired confluence, we administered transfections or drug interventions. For staining, we prepared a 1 mM MitoTracker (Thermo Fisher Scientific Scientific, #M7513) stock solution, diluting it 1:1000 under light-protected conditions immediately before use. At 70\u0026ndash;80% confluence, we washed the cells with pre-warmed PBS and added fresh medium infused with MitoTracker, incubating them for 15 to 45 minutes based on cell type and dye specifics. Post-staining, the cells were washed with PBS to eliminate unbound dye, followed by staining for additional markers or nuclear staining, fixation, and mounting. Finally, we visualized the mitochondria using a fluorescence microscope at 576 nm and analyzed the images with Fiji software to evaluate mitochondrial morphology.\u003c/p\u003e\n\u003cp\u003eATP assay\u003c/p\u003e\n\u003cp\u003eSeeded adherent cells are rinsed, then 200 \u0026micro;L of ice-cold lysis buffer is added per well of a six-well plate and repeatedly pipetted to ensure complete lysis. Lysates are spun at 12 000 g for 5 min at 4\u0026deg;C and the supernatant is kept on ice for ATP measurement. ATP standards are prepared on ice by serially diluting the stock with the same lysis buffer to 0.01\u0026ndash;10 \u0026micro;M (adjust this range to match sample levels).The detection reagent is made fresh by diluting luciferase substrate 1 : 9 with its buffer and kept on ice. To each assay well 100 \u0026micro;L of detection reagent is dispensed and left at room temperature for 3\u0026ndash;5 min to deplete background ATP. Next, 20 \u0026micro;L of sample or standard is added, mixed quickly, and after a 2-s delay the relative light units are recorded with a multimode microplate reader. Sample volumes can be varied between 10 and 100 \u0026micro;L provided standards are run at the same volume; highly concentrated samples are diluted with lysis buffer to keep readings within the linear range. ATP concentrations are interpolated from the standard curve and, if desired, expressed as nmol mg⁻\u0026sup1; protein after normalizing to protein content measured by a BCA assay.\u003c/p\u003e\n\u003cp\u003eIsolation of PBMCs\u003c/p\u003e\n\u003cp\u003eBlood is collected from healthy donors or patients. The enrolled subjects were consecutively recruited from Xiangya Hospital of Central South University (Changsha, China) and collaborative institutions through the Parkinson\u0026apos;s Disease \u0026amp; Movement Disorders Multicenter Database and Collaborative Network in China (PD-MDCNC, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.pd-mdcnc.com\u003c/span\u003e\u003c/span\u003e). All subjects or their guardians completed written informed consent and the study protocol was approved by the Medical Ethics Committee of Xiangya Hospital, Central South University.\u003c/p\u003e\n\u003cp\u003eThe amount of blood collected depends on the required number of PBMCs for the experiment. Before the processes, warm the PBS and Histopaque (Sigma-Aldrich, #11191) to room temperature. Next, dilute the anticoagulated blood with an equal volume of PBS to decrease its density, which helps in layering over the Histopaque. Carefully layer the diluted blood over the Histopaque in a centrifuge tube. For a 15 mL centrifuge tube, we can use 7.5 mL of diluted blood and 7.5 mL of Histopaque. Ensure to layer the blood slowly to prevent mixing with the medium. Centrifuge the tubes at 400\u0026ndash;450 g for 30\u0026ndash;40 minutes at 18\u0026ndash;20\u0026deg;C, with the brake off to avoid disturbing the layers. After centrifugation, you\u0026apos;ll see distinct layers in the tube. The PBMCs form a thin layer at the interface between the plasma and the Histopaque. Carefully aspirate this layer using a pipette, taking care to minimize contamination with other layers. Transfer the collected PBMC layer to a new conical tube and add PBS up to 50 mL to wash the cells. Centrifuge at 300 g for 10 minutes at 18\u0026ndash;20\u0026deg;C. Discard the supernatant carefully. Resuspend the pellet in 10 mL of PBS and repeat the washing step if necessary. For cryopreservation, resuspend PBMCs at 1\u0026ndash;10 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/mL in cryopreservation medium (usually 90% fetal bovine serum\u0026thinsp;+\u0026thinsp;10% DMSO) and transfer to cryovials. Freeze the vials at -80\u0026deg;C for 24 hours before transferring to liquid nitrogen for long-term storage.\u003c/p\u003e\n\u003cp\u003emRNA expression data of the GRP75 gene in different tissues\u003c/p\u003e\n\u003cp\u003eBulk-tissue mRNA expression data of the \u003cem\u003eGRP75\u003c/em\u003e gene in whole blood were extracted from the Parkinson\u0026rsquo;s Progression Marker Initiative (PPMI) cohort [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e], which included 4,871 longitudinally collected whole blood samples from 1,570 clinically phenotypic individuals. The cohort obtained a high-quality transcriptome with an average of 100\u0026nbsp;million read pairs per sample. Differential expression of RNA species was examined between PPMI participants with and without a PD diagnosis. Besides, bulk-tissue mRNA expression data of the GRP75 gene in six brain regions (cerebellum, frontal cortex, medulla, striatum, substantia nigra, and superior frontal gyrus) were extracted from BrainEXPNPD database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://brainexpnpd.org:8088/BrainEXPNPD/\u003c/span\u003e\u003c/span\u003e), which is an updated database of BrainEXP [\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e]. The BrainEXPNPD database collected 8,317 human brain samples across 21 brain regions from 48 datasets on microarrays or RNA-seq platforms, which contain six complex neuropsychiatric disorders, including 163 PDs and 6,378 healthy controls (not neuropsychiatric-affected).\u003c/p\u003e\n\u003cp\u003eQuantification and Statistical Analysis\u003c/p\u003e\n\u003cp\u003eAll datasets were organized and analyzed in GraphPad Prism v8.0 (GraphPad Software, CA, USA); heat-maps and volcano plots were produced in R v4.2.2. Animal sample sizes are reported in the figure legends. Cell-based assays were performed in parallel with vehicle-treated wells on the same plate and repeated in at least three independent biological replicates; technical replicates within a replicate were averaged before statistical testing. Before any comparison, residuals were inspected for normality with the Shapiro\u0026ndash;Wilk test and for homogeneity of variance with an F- or Levene test. When both assumptions were met, differences between two groups were assessed with an unpaired two-tailed Student\u0026rsquo;s t-test; if variances were unequal, Welch\u0026rsquo;s correction was applied, and if normality was not satisfied, a Mann\u0026ndash;Whitney test was used. For three or more groups involving a single independent variable, one-way ANOVA followed by Tukey\u0026rsquo;s post-hoc test was employed; if variances were heterogeneous, Brown\u0026ndash;Forsythe and Welch ANOVA with Games\u0026ndash;Howell correction replaced the classical test. Two-way ANOVA with \u0026Scaron;id\u0026aacute;k adjustment was used when two variables were present. For experiments executed in multiple independent batches (e.g., ATP assay), raw values were first divided by the batch-matched vehicle mean to remove inter-batch effects. And for omics data, further corrected with the ComBat algorithm before differential analysis. Error bars represent the standard error of the mean (SEM). The criteria for significance are: ns (not significant) \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05; \u0026lowast;\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; \u0026lowast;\u0026lowast;\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and \u0026lowast;\u0026lowast;\u0026lowast;\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e3.1. \u003cem\u003ePLA2G6\u003c/em\u003e\u003csup\u003eD331Y/D331Y\u003c/sup\u003e KI mice exhibit a notable decrease in ER-mitochondria association\u003c/h2\u003e\u003cp\u003eA previously reported \u003cem\u003ePLA2G6\u003c/em\u003e\u003csup\u003eD331Y/D331Y\u003c/sup\u003e KI mouse model, created in 2019 using the LoxP-Cre system, demonstrated reduced PLA2G6 enzymatic activity but no detectable changes in protein levels[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. In this study, we generated the PLA2G6\u003csup\u003eD331Y/D331Y\u003c/sup\u003e KI mice using CRISPR/Cas9 to further elucidate the molecular mechanisms underlying PLA2G6-associated parkinsonism (Figure.1A). In our model, the mutation reduced both PLA2G6 protein levels and enzymatic activity in the \u003cem\u003esubstantia nigra\u003c/em\u003e (SN) (Figure.1B-D), resulting in age-dependent dopaminergic neuron loss (Figure.1E, F), decreased striatal DAT levels (Figure.1G, H), and progressive motor deficits (Figure.1I-L). Notably, the onset of neurodegeneration and motor dysfunction in our model occurred later than in the previous model [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These results indicate that our \u003cem\u003ePLA2G6\u003c/em\u003e\u003csup\u003eD331Y/D331Y\u003c/sup\u003e KI mice develop PD-like neurodegeneration and motor impairments.\u003c/p\u003e\u003cp\u003eTo further explore the structural changes underlying these phenotypes, we performed focused Ion Beam-Scanning Electron Microscope (FIB-SEM) on the SN region of WT and KI mice [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Besides mitochondrial impairment, we also observed significant disruptions in ER-mitochondria contacts (Figure.1M). 3D reconstructions revealed a markedly reduced MAMs area in the SN of KI mice (Figure.1N). As the results, the average area of MAMs in the SN of KI was reduced compared to WT (Figure.1O). And in WT mice, a substantial portion of the mitochondrial surface was in close contact with the ER, whereas this contact was significantly reduced in KI mice (Figure.1P). To further validate these findings in \u003cem\u003evitro\u003c/em\u003e, we established \u003cem\u003ePLA2G6\u003c/em\u003e knockout (KO) HEK293 cell lines. We also observed a significant reduction in short ER-mitochondria contacts (\u0026asymp;\u0026thinsp;8\u0026ndash;10 nm, marked by a specific probe, SPLICS Mt-ER Short P2A[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]) in KO cells (Figure.1Q, R), further confirming PLA2G6 deficiency also cause MAMs impairment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Identification of PLA2G6 in MAMs\u003c/h2\u003e\u003cp\u003eBased on these observations, we next aimed to determine the precise role of PLA2G6 in MAMs. Given the observed structural changes, we hypothesized that PLA2G6 might directly localize to MAMs and contribute to their integrity. Because no reliable antibody is available for staining endogenous PLA2G6, we transiently expressed an N-terminal HA tagged PLA2G6 and, in the same cells, co-expressed EGFP-Sec61β to mark the ER membranes; TOM20 immunostaining was used to label the mitochondrial outer membrane. Confocal imaging revealed that PLA2G6 forms discrete puncta precisely at the narrow interface between EGFP-Sec61β\u0026ndash;positive ER and TOM20-positive mitochondria (Figure.1S). To validate this observation, we employed Percoll-based subcellular fractionation and probed each fraction by Western blot for β-tubulin, IP3R, calnexin, VDAC1 and COX IV. Consistent with our microscopy data, PLA2G6 was found to be in the MAMs and ER fractions (Figure.1T), confirming its direct association with MAMs.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e3.3. PLA2G6 deficiency impairs the IP3R-GRP75-VDAC1 complex in MAMs\u003c/h2\u003e\u003cp\u003eFurther, we conducted analysis of several MAMs-related proteins in both total lysate and isolated MAMs fractions from \u003cem\u003ePLA2G6\u003c/em\u003e WT and KI mice. Our results revealed that the levels of GRP75 and IP3R proteins were significantly changed in both the total cellular fractions and the MAMs fractions. Although GRP75, VDAC1, and IP3R form a key complex in MAMs, changes in their levels varied: compared to WT mice, a significant decrease in GRP75 levels and an increase in IP3R levels was observed in both the whole lysate and MAMs fractions from the brains of KI mice, while VDAC1 and other MAMs-relate proteins remained unchanged (Figure.2A-G). Moreover, the \u003cem\u003ePLA2G6\u003c/em\u003e KO cells also exhibited reduced GRP75 levels and increased IP3R levels, aligning with our findings in KI mice (Figure.2H-K). Additionally, we also detected significant higher mRNA level of IP3R in KO cells while GRP75 remained unchanged (Figure.S1 A, B). The reduction of GRP75 and the increase of IP3R were also replicated in SH-SY5Y cells treated with \u003cem\u003ePLA2G6\u003c/em\u003e-targeting siRNAs (Figure.S1C-E), and in KI Mouse Embryonic Fibroblast (MEF) cells (Figure.S1F-H).\u003c/p\u003e\u003cp\u003eGiven the different trends of GRP75 and IP3R changes with PLA2G6 loss, we further elucidated the effect of PLA2G6 protein deficiency on the IP3R-GRP75-VDAC1 complex. We applied in-situ proximity ligation assays (PLA) to evaluate the contact sites between IP3R and VDAC1 in HEK293, which indicates diminished IP3R-GRP75-VDAC1 complex in the absence of PLA2G6 (Figure.2L, M). To extend these findings to disease-relevant neurons, we differentiated induced pluripotent stem cells (iPSCs) from a healthy donor and from two patients carrying the \u003cem\u003ePLA2G6\u003c/em\u003e D331Y mutation into dopaminergic (DA) neurons (Figure.S2). IP3R\u0026ndash;VDAC1 proximity signals were likewise diminished in patients-derived DAs, particularly within the soma (Figure.2N, O). Similar defects were observed in SH-SY5Y cell lines (Figure.S3A, B) and MEFs (Figure.S3C, D). Next, we assessed how PLA2G6 affects the function of the IP3R-GRP75-VDAC1 complex, we measured mitochondrial Ca\u0026sup2;⁺ uptake from the ER in HEK293 cells. The ATP-induced Ca\u003csup\u003e2+\u003c/sup\u003e flux peak was significantly lower in KO cells compared to normal control (NC) cells, suggesting impaired ER-mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e transport due to PLA2G6 loss (Figure.2P). Meanwhile, Co-IP analysis demonstrated a significantly reduced interaction between GRP75 and IP3R in KO cells, indicating PLA2G6 deficiency impairs the complex (Figure.2Q, R).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e3.4. PLA2G6 interacts with IP3R-GRP75-VDAC1\u003c/h2\u003e\u003cp\u003eTo further identify the relationship between PLA2G6 and IP3R-GRP75-VDAC1 complex, we immunoprecipitated endogenous PLA2G6 from whole-brain lysates and MAMs fractions of WT mice. The results showed that these three proteins could be identified among PLA2G6-interacting proteins in both whole lysate and MAMs fraction, suggesting that these interactions occur in the MAMs fraction under physiological conditions (Figure.3A). Consistent with this, confocal imaging of HA-PLA2G6\u0026ndash;expressing HEK293 cells demonstrated co-localization of PLA2G6 with IP3R, GRP75 and VDAC1. (Figure.3B).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e3.5. PLA2G6 regulates IP3R-GRP75-VDAC1 complex \u003cem\u003evia\u003c/em\u003e GRP75\u003c/h2\u003e\u003cp\u003eGiven that PLA2G6 deficiency reduces GRP75 without changing mRNA levels, we propose PLA2G6 regulates the complex \u003cem\u003evia\u003c/em\u003e GRP75. Since PLA2G6 directly interacts with GRP75, we hypothesized that its deficiency destabilizes GRP75, accelerating its degradation. To ensure that differences in GRP75 degradation were not confounded by unequal baseline abundance, both control and KO cells were pre-treated with the proteasome inhibitor MG132 (10\u0026micro;M for 4h) before cycloheximide (CHX, 50 \u0026micro;g/mL) chase. Once MG132 was removed and CHX applied, GRP75 decayed much faster in KO cells, confirming that PLA2G6 loss accelerates proteasome-dependent degradation (Figure.3C-D). We next examined whether overexpressing PLA2G6 and its mutant would restore GRP75 levels. As the result, re-expression of WT PLA2G6 and GRP75 but not D331Y-mutant PLA2G6 restored GRP75 abundance (Figure.3E-G). Pull-down result showed that WT PLA2G6 robustly co-precipitated IP3R, GRP75 and VDAC1, but the D331Y mutant displayed markedly weaker binding to all three partners, confirming a pathogenic defect in interaction (Figure.3H, I). The reduction of IP3R-VDAC1 contacts in KO cells was also rescued WT PLA2G6 or by GRP75 but not by PLA2G6 D331Y mutant (Figure.3J\u0026ndash;K).\u003c/p\u003e\u003cp\u003eFurthermore, we also quantified Ca\u0026sup2;⁺ dynamics in three compartments\u0026mdash;cytosol, mitochondria and ER lumen\u0026mdash;after ATP stimulation (Fluo-4, Rhod-2 and Mag-Fluo-4, respectively). We found that ATP-evoked cytosolic spike and mitochondrial uptake was significantly lower and delayed in KO cells, with the ER release recovered more slowly than that in controls. Re-expression of WT PLA2G6 WT restored all three profiles, whereas GRP75 over-expression produced its strongest rescue in the mitochondrial trace\u0026mdash;normalizing the Rhod-2 peak while only partially correcting the cytosolic and ER kinetics\u0026mdash;underscoring that GRP75 primarily reinstates ER-to-mitochondria Ca\u0026sup2;⁺ transfer. In contrast, the pathogenic D331Y variant achieved moderate recovery, leaving mitochondrial uptake still below normal. (Figure.3L)\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e3.6. PLA2G6 deficiency increases ceramide levels both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e\u003c/h2\u003e\u003cp\u003ePrevious studies showed that PLA2G6 deficiency impair multiple lipid metabolism pathways. Thus, we conducted a lipidomic analysis to compare the lipid profiles of midbrain tissues from WT and KI mice (Figure.S4).\u003c/p\u003e\u003cp\u003eSurprisingly, among nearly 500 lipid species, a significant accumulation was observed in ceramides, particularly Ceramide d18:1/16:0 (C16 ceramide), which showed the most evident changes (Figure.4A-B, and Figure.S5). The C16 ceramide could integrate into the mitochondrial outer membrane, affecting its permeability [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. High-throughput ceramide analysis further confirmed elevated ceramide levels in KO cells, compared to NC cells (Figure.4C). Notably, the elevation in ceramide level in KO cells was reduced by Desipramine (DES) and GW4869 (GW), which target acid and neutral sphingomyelinases, respectively (Figure.4C). Intriguingly, similar to what was observed in the animal models, C16 ceramide also become the most prominently altered ceramide in KO cells (Figure.S6). Consistent findings were obtained in immunofluorescence analyses using a ceramide antibody across different groups, supporting the ceramide accumulation and confirming the antibody's specificity (Figure.4D, E). The ceramide ELISA assay also confirmed the finding in both HEK293 cell lines and SH-SY5Y cell lines (Figure.4F and Figure.S7). Further we conducted the immunofluorescence analyses of ceramide in DA neurons. The ceramides also accumulated in DA neurons derived from patients carrying D331Y mutation (Figure.4H, G).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e3.7. PLA2G6 deficiency alters mitochondrial ceramide level\u003c/h2\u003e\u003cp\u003eTo further elucidate the effect of PLA2G6 deficiency on ceramide, we measured ceramide concentration in different subcellular compartments of both HEK293 cells and mice brain \u003cem\u003evia\u003c/em\u003e ELISA. Interestingly, ceramide concentrations were significantly elevated in the crude mitochondrial fractions of both HEK293 cells and mouse brain (Figure.4I, J). Additionally, we observed increased ceramide levels in whole-cell lysates and ER fractions; however, the elevation of ceramide in mitochondria was substantially greater than in other cellular compartments. These findings indicate that PLA2G6 deficiency predominantly disrupts ceramide homeostasis in mitochondria. To visualize subcellular ceramide changes, we conducted immunofluorescence analysis in HEK293 and U2OS cells to present the colocalization of mitochondria and ceramides (Figure.S7 A, B, H). Immunostaining revealed increased ceramide accumulation and stronger overlap between ceramide and mitochondria signals in PLA2G6-deficient cells (Figure.S7 C-G, I-M).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.8. PLA2G6 regulates ceramide \u003cem\u003evia\u003c/em\u003e GRP75\u003c/h2\u003e\u003cp\u003eConsidering the lipid regulatory functions of PLA2G6, along with its critical involvement in mitochondrial lipid homeostasis, we next sought to determine if mitochondrial ceramide accumulation was associated with GRP75 dysfunction due to PLA2G6 deficiency. Immunofluorescence revealed extensive co-localization of ceramide with GRP75 and VDAC1 in both HEK293 cells (Figure.5A) and DA neurons (Figure.5B), indicating interactions between ceramides and them. Pulldown with ceramide-coated beads confirmed that GRP75 and VDAC1 bind ceramide in whole-cell lysates and in isolated MAMs fractions (Figure.5C), suggesting these interactions occur in MAMs. Given the interaction between GRP75 and ceramide, along with the altered GRP75 levels in PLA2G6-deficient models, we explored the regulatory relationship between GRP75 and ceramide. We first examined whether reducing ceramide levels could restore the conformation and stability of the IP3R-GRP75-VDAC1 complex. To this end, PLA2G6-deficient cells were treated with DES and GW to lower ceramide levels, followed by assessment of GRP75 protein recovery and IP3R-VDAC1 interaction using the PLA technique. Our results indicated that lowering ceramide did not restore GRP75 levels (Figure.S9A, B) nor increase the number of IP3R-GRP75-VDAC1 complexes (Figure.S9C, D). These findings suggest that ceramide does not directly regulate the stability or conformation of these proteins under the tested conditions. Conversely, overexpression of PLA2G6 WT or GRP75 significantly decreased total ceramide as measured by ELISA, whereas the pathogenic the pathological variants D331Y only lead to a modest reduction (Figure.5D). To further confirmed the relationship between GRP75 and ceramide, we conducted high-throughput LC/MS/MS (Ceramide species targeted) in KO cells, comparing ceramide levels between cells transfected with an empty vector and those overexpressing GRP75. Consistently, GRP75 overexpression resulted in a significant reduction in ceramide levels (Figure.5E). And the immunofluorescence analyses corroborated the biochemical data, showing visibly fewer ceramide-positive puncta after GRP75 expression (Figure.S10).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.9. Targeting ceramides and GRP75 could address mitochondrial dysfunction caused by PLA2G6 deficiency\u003c/h2\u003e\u003cp\u003ePrevious studies have shown that PLA2G6 can impair mitochondrial integrity in \u003cem\u003eDrosophila\u003c/em\u003e models [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. To investigate whether similar effects occur in mammals, we performed ultrastructural analysis of the SNpc in PLA2G6 WT and KI mice (Figure.6A). TEM revealed significant mitochondrial damage in KI mice, characterized by reduced mitochondrial area, increased circularity, and disrupted cristae according to quantification methods descried in [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]) (Figure.6B-D). TOM20 immunostaining and MitoTracker labelling further showed pronounced mitochondrial fragmentation in \u003cem\u003ePLA2G6\u003c/em\u003e-deficient HEK293(Figure.6E, F and S11 A, B), SH-SY5Y (Figure.S11 C, D) and MEF cells (Figure.S11 E, F).\u003c/p\u003e\u003cp\u003eMitochondrial function was assessed next. We used TMRE dyes to assess mitochondrial membrane potential in \u003cem\u003evitro\u003c/em\u003e. As a positive control, we used Carbonyl cyanide m-chlorophenyl hydrazone (CCCP), a known inhibitor of mitochondrial oxidative phosphorylation, which significantly reduced membrane potential. Flow cytometry analysis revealed a decrease in mitochondrial membrane potential in KO cells compared to the WT cells. Membrane potential was restored by the overexpression of GRP75 or PLA2G6 WT(Figure.6G-J), partially improved by reducing ceramide levels (Figure.6K, L) and only slightly increase by the overexpression of \u003cem\u003ePLA2G6\u003c/em\u003e D331Y (Figure.6J). Flow-cytometric MitoSox measurements showed a parallel rise in mitochondrial ROS in KO cells that was reversed by PLA2G6 overexpressing GRP75 or PLA2G6 WT, whereas only slightly decreased by overexpression of \u003cem\u003ePLA2G6\u003c/em\u003e D331Y (Figure.6M, N). And reducing ceramides with DES and GW effectively alleviated mitochondrial oxidative stress in KO cells (Figure.6O, P). Finally, luciferase ATP assays revealed that both overexpression of GRP75 or PLA2G6 WT and ceramide depletion each increased cellular ATP content in KO cells, whereas \u003cem\u003ePLA2G6\u003c/em\u003e D331Y failed to rescue (FigureS12A, B). Comparable bioenergetic deficits were observed in \u003cem\u003ePLA2G6\u003c/em\u003e-KD SH-SY5Y cells, which displayed lower ATP levels (FigureS12C) reduced TMRE fluorescence (Figure S12D, E), and elevated MitoSOX level (Figure S12F, G); all three parameters were partially rescued by DES or GW, mirroring the responses seen in HEK293 models. Collectively, above findings emphasize the deleterious effects of PLA2G6 deficiency on mitochondrial function and suggest that targeting ceramides and GRP75 could alleviate mitochondrial dysfunctions, thereby offering potential therapeutic benefits.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.10. Reducing ceramides exerts therapeutic effects on KI mice\u003c/h2\u003e\u003cp\u003eBased on our encouraging \u003cem\u003ein vitro\u003c/em\u003e results, we hypothesized that reducing ceramides could alleviate mitochondrial dysfunctions and mitigate PLA2G6-associated neuronal defects in mice. We initiated treatment in 12-13-month-old mice, a stage post-symptom manifestation, aligning with typical clinical intervention timings. We divided the mice into four groups: WT\u0026thinsp;+\u0026thinsp;DMSO (2.5% DMSO, 500 \u0026micro;L), KI\u0026thinsp;+\u0026thinsp;DMSO (2.5% DMSO, 500 \u0026micro;L), KI\u0026thinsp;+\u0026thinsp;DES (DES at 20 mg/kg/day), and KI\u0026thinsp;+\u0026thinsp;GW (GW at 1.5 mg/kg/day). Each group comprised 7 age- and weight-matched mice and underwent a 6-week treatment regimen to evaluate the impact of the drugs on motor dysfunction (Figure.7A). Comprehensive behavioral assessments were performed on all four groups, both before and after the treatment. At baseline, all three KI groups exhibited motor deficits compared to the WT group, with no notable weight differences (Figure.S13). Post the 6-week treatment, both the DES-treated and GW-treated groups showed significant behavioral improvements. Specifically, compared to the KI\u0026thinsp;+\u0026thinsp;DMSO group, the drug-treated KI mice showed increased endurance on wire grids (Figure.7B) and rotarod rods (Figure.7C), reduced time crossing the balance beam (Figure.7D), and fewer foot slips (Figure.7E). Post-treatment, TH\u003csup\u003e+\u003c/sup\u003e neuron counts in the \u003cem\u003eSNpc\u003c/em\u003e were also assessed. The KI\u0026thinsp;+\u0026thinsp;DMSO group showed a significant loss of TH\u003csup\u003e+\u003c/sup\u003e neurons, compared with the other groups (Figure.7F, G), suggesting that DES and GW effectively prevent further dopaminergic neuron loss in KI mice. Consistently, both DES and GW increased TH levels in the midbrain of KI mice (Figure.7H, I). Next, we performed the quantitative TEM analysis to assess the treatments' impact on mitochondria, also focusing on the average area, circularity index, and cristae scores of mitochondria across the four groups. The analysis demonstrated that DES and GW efficiently increased the average area and cristae scores of mitochondria in KI mice and decreased the circularity index (Figure.7J-M). These results collectively suggest that reducing ceramide is crucial in inhibiting mitochondrial fragmentation and enhancing overall mitochondrial integrity. In conclusion, our i\u003cem\u003en vivo\u003c/em\u003e findings highlight the therapeutic potential of ceramide reduction, specifically through DES and GW, in repairing mitochondrial dysfunction, preventing dopaminergic neuron loss, and ultimately alleviating motor dysfunction in aging mice with PLA2G6 deficiency.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.11. Altered GRP75 expression in peripheral blood mononuclear cells (PBMCs) of PLA2G6 mutant PD patients\u003c/h2\u003e\u003cp\u003eAccording to the data in Human Protein Atlas, GRP75 exhibits relatively high expression in human PBMCs. Previous studies have linked mitochondrial dysfunction in PBMCs to PD, reflecting similar pathological alterations in the brain [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Consequently, we isolated PBMC proteins from three PD patients harboring homozygous \u003cem\u003ePLA2G6\u003c/em\u003e mutations and compared them to six age-matched healthy controls. The results demonstrated a significant reduction in GRP75 levels in the \u003cem\u003ePLA2G6\u003c/em\u003e mutant PD patient samples (Figure.S14A-B).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.12. Altered GRP75 expression level in the whole blood and different brain regions of PD patients\u003c/h2\u003e\u003cp\u003eIn addition to PBMCs, we analyzed GRP75 mRNA expression in whole blood samples from the Parkinson's Progression Markers Initiative (PPMI) cohort, which comprises 6441 individuals. Our analysis showed a significant decrease in GRP75 mRNA expression in PD patients compared to healthy controls (Figure.S14 C), suggesting a potential role for GRP75 in the pathogenesis of PD. Furthermore, we assessed GRP75 expression across various brain regions in PD patients, utilizing data from the Brain Expression Database for Neurological Diseases (BrainEXP-NPD) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://brainexpnpd.org:8088/index.html\u003c/span\u003e\u003cspan address=\"http://brainexpnpd.org:8088/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. This database includes information from six different brain tissues, allowing for a comparative study between PD patients and controls. The meta-analysis integrating data from eight distinct PD cohorts within the BrainEXP-NPD revealed a decrease in GRP75 expression in the SN region of patients (Figure.S14 D). Since SN region is critically implicated in PD pathology, the significant decline in GRP75 expression in this specific area provides compelling evidence of its association with PD.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e This study provides new insights into the localization and function of PLA2G6 in MAMs, revealing its critical role in maintaining the integrity of the IP3R-GRP75-VDAC1 complex. Our findings demonstrate that PLA2G6 deficiency reduces GRP75 levels, leading to disrupted MAMs function and a specific pattern of ceramide accumulation, particularly in mitochondria. These changes result in mitochondrial fragmentation, oxidative stress, and dopaminergic neuronal loss. By showing that pharmacological reduction of ceramides or overexpression of GRP75 can alleviate these deficits, we position the PLA2G6\u0026ndash;GRP75\u0026ndash;ceramide axis as a unified mechanism and highlight ceramide modulation or GRP75 restoration as tractable therapeutic strategies for neurodegeneration.\u003c/p\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e4.1. PLA2G6 in MAMs\u003c/h2\u003e\u003cp\u003eOur study provides new insights into the localization and function of PLA2G6 in the mouse brain, expanding upon the current understanding that PLA2G6 is primarily found in the cytosol and mitochondria [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. We have revealed that a subset of PLA2G6 is located at the MAMs and ER fraction, which was further confirmed by the interaction between PLA2G6 and IP3R, GRP75, and VDAC1.\u003c/p\u003e\u003cp\u003eNotably, PLA2G6 deficiency destabilizes GRP75 and impairs MAMs integrity, while overexpression of GRP75 partially rescues this phenotype, underscoring their critical interplay. Unlike GRP75, IP3R upregulation is linked to increased mRNA levels, suggesting transcriptional regulation. Given that elevated IP3R transcription is often associated with ER stress [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], this finding aligns with the known link between PLA2G6 deficiency and ER stress[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Elucidating the precise mechanism driving IP3R elevation lies beyond the scope of this work but represents an intriguing direction for future investigation. Additionally, the upstream-downstream relationship between MAMs dysfunction and ER stress remains unresolved. Our data suggest that IP3R elevation may reflect a complex interplay between these processes in the context of PLA2G6 deficiency.\u003c/p\u003e\u003cp\u003eAlthough MAMs impairment has been repeatedly reported in neurodegenerative diseases, we also noticed that emerging studies found enhanced MAMs under pathological conditions. Enhanced ER-mitochondria connection have been extensively reported in AD models, linking it to excessive ROS production, calcium overload even Aβ aggregation[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. However, it should be mentioned that ER-mitochondria coupling might be also enhanced as adaptative response to mitochondria or ER impairment[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Whether such compensatory MAMs remodeling occurs early in PLAN\u0026mdash;and if it ultimately fails\u0026mdash;remains an important question. Dissecting these temporal dynamics and the molecular \u0026ldquo;switches\u0026rdquo; that determine adaptive versus maladaptive MAMs alterations will be critical for designing therapies that rebalance ER\u0026ndash;mitochondria communication in PLAN and other neurodegenerative diseases. Currently, a growing body of evidence identifies the MAMs as a common pathological platform for multiple neurodegenerative diseases. These disease-related proteins (such as α-synuclein, Aβ, TDP-43 etc.) converge on the MAMs [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], triggering neuronal death by disrupting its core functions in calcium signaling, lipid metabolism, organelle dynamics, and quality control. This creates a vicious cycle: protein misfolding causes MAMs dysfunction, and MAMs dysfunction in turn exacerbates protein misfolding and aggregation. And emerging factors have been identified to regulate such pathways. Therefore, targeting the MAMs as a unified therapeutic hub by developing drugs[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] that can stabilize its structure and function may offer a novel and powerful strategy to combat a wide range of neurodegenerative diseases.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e4.2. PLA2G6 regulate ceramides via GRP75\u003c/h2\u003e\u003cp\u003eIt is widely reported that PLA2G6 selectively hydrolyzes the ester bond at the sn-2 position of phospholipids, which is a key step in the Lands cycle. Previous studies have detected alterations of PC and PE in \u003cem\u003ePLA2G6\u003c/em\u003e KO mice [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. However, others, including our study, have not observed significant phospholipid changes following PLA2G6 loss [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This suggests that \u003cem\u003ePLA2G6\u003c/em\u003e mutations may have a limited impact on the Lands cycle, potentially due to compensatory mechanisms within phospholipid metabolism. Furthermore, we observed a significant increase of ceramides in \u003cem\u003ePLA2G6\u003c/em\u003e KI mice and KO cells. Pharmacological inhibition of ceramide synthesis mitigated mitochondrial dysfunction caused by PLA2G6 loss, thereby connecting ceramide accumulation with neuronal degeneration. Contrary to previous studies that suggested an altered Ceramide/sphingomyelin (SM) ratio[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], our study observed no significant changes in SM levels. This finding points to different pathways of ceramide dysregulation in PLA2G6 deficiency models. Our study also uncovers a more specific pattern of ceramide accumulation in different cellular compartments. By comparing the ceramide distribution across subcellular fractions, we identified a particularly pronounced increase in ceramide levels in the crude mitochondrial fraction of PLA2G6 KO cells. This suggests that mitochondria could serve as an early site of pathological ceramide elevation, preceding global cellular changes.\u003c/p\u003e\u003cp\u003eIn our exploration of the mechanisms underlying ceramide dyregulation, we identified an intriguing relationship between GRP75 and ceramide metabolism. Our results suggest that GRP75 could combine with ceramides and its impairment significant cause ceramide accumulations. To be noted, a recent clinical study also reported that inhibiting GRP75 could significantly increases ceramide levels, which is consistent with our data[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Given the close connection between GRP75 and ceramide, we propose that GRP75 binds ceramide within the MAMs \u0026ldquo;buffer pool\u0026rdquo; to regulate its steady-state distribution between the ER, MAMs, and mitochondria. Consistent with prior reports[\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], our ELISA data showed that ceramide levels in MAMs appeared enriched in ceramide compared with other fractions. We therefore proposed ceramide‐binding proteins such as VDAC1 and GRP75 could coordinate bidirectional lipid transport and metabolism within MAMs, maintaining ceramide concentrations within a narrow physiological window in both organelles. When GRP75 is impaired and MAMs integrity collapses, this buffering capacity is lost: ceramide can no longer be shuttled into the MAMs pool and instead accumulates excessively in the ER and, most prominently, within the mitochondrial. Although our findings highlight mitochondria as the major site of ceramide overload, confirming this model will require further experiments\u0026mdash;such as real-time lipid flux assays and rescue with MAMs-targeted GRP75 variants\u0026mdash;to establish causality and dissect the underlying molecular machinery.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e4.3. Restoring mitochondrial function by targeting GRP75 and ceramides\u003c/h2\u003e\u003cp\u003eOur study provides compelling evidence that targeting ceramides and GRP75 can alleviate mitochondrial dysfunction caused by PLA2G6 deficiency. We observed that PLA2G6-deficient mice and cells exhibit significant mitochondrial degeneration, characterized by reduced mitochondrial area, increased fragmentation, disrupted cristae, elevated ROS, and decreased mitochondrial membrane potential. These abnormalities have been noted in several PLA2G6-deficient models[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Prior work in Drosophila linked PLA2G6-related mitochondrial damage to cardiolipin imbalance [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], yet cardiolipin levels were unaltered in our mouse model, implying a distinct, ceramide-centered mechanism. By reducing ceramide levels using DES and GW, we were able to mitigate these mitochondrial abnormalities both in vitro and in vivo. Treatment with these agents improved mitochondrial morphology, decreased oxidative stress, and restored membrane potential. GRP75 over-expression produced similar benefits, underscoring its protective role. Importantly, ceramide reduction in PLA2G6-deficient mice not only preserved mitochondrial integrity but also improved motor performance and prevented further dopaminergic neuron loss in the SNpc. However, the impact of ceramide on other mitochondrial quality-control pathways\u0026mdash;such as mitophagy\u0026mdash;remains unexplored. Addressing these questions will clarify the full spectrum of ceramide-mediated insults. Overall, our findings show that targeting ceramides and GRP75 can reverse the mitochondrial and neuronal deficits caused by PLA2G6 deficiency. These findings have significant implications for developing new treatments for neurodegenerative diseases associated with mitochondrial dysfunction.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e4.4. Potential of GRP75 in PD pathology and therapeutic implications\u003c/h2\u003e\u003cp\u003eFurthermore, our findings extend beyond \u003cem\u003ePLA2G6\u003c/em\u003e mutant PD patients, as we also observed decreased GRP75 levels in the blood, and substantia nigra of other PD patients. This suggests a broader role for GRP75 in various types of PD. Previous studies also have established GRP75 (Mortalin/HSPA9) as a key regulator in PD. For instance, lower GRP75 levels have been documented in post-mortem brains of PD patients[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In toxin-based PD models (6-OHDA), GRP75 down-regulation correlates with mitochondrial fragmentation, increased ROS, and dopaminergic neuron loss, while GRP75 overexpression or HSP70 agonists rescue these defects[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. GRP75 also interacts with PD-related proteins (α-synuclein, PINK1, DJ-1)[\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], and its impairment under these genetic factors further disrupts MAMs structure and Ca\u0026sup2;⁺ flux. Besides PD, GRP75 also show multiple roles in other neurodegenerative disease. For example, recent studies in ALS showed that GRP75 in MAMs serve as a protective factor under ER stress[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Conversely, AD related gene, ApoE4 could impaired mitochondria by enhancing MAMs via GRP75, which suggests that GRP75 or MAMs could act as a double-edged sword[\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn our work, we expand GRP75\u0026rsquo;s role by identifying it as a ceramide-binding protein. We found that GRP75 involves in maintaining ceramide homeostasis, and potentially work as a ceramide reservoir within MAMs. This novel function might also occur in other PD models, highlighting sphingolipid metabolism as a new therapeutic axis downstream of GRP75 in PD. Given GRP75\u0026rsquo;s involvement in protein folding, Ca\u0026sup2;⁺ signaling, and now sphingolipid metabolism, it likely exerts diverse, context-dependent functions across PD models. Its consistent perturbation in patient samples and animal models highlights GRP75 as both a promising therapeutic target and a potential biomarker for neurodegeneration, although the precise molecular mechanisms linking its multifaceted roles to disease progression warrant further investigation.\u003c/p\u003e\u003c/div\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn summary, our data highlights PLA2G6's localization to MAMs and its interaction with the IP3R-GRP75-VDAC1 complex. Loss of PLA2G6 lowers GRP75 abundance, compromises MAM integrity and leads to a specific pattern of ceramide accumulation in mitochondria. Mechanistically, we demonstrate that GRP75 is a ceramide-binding chaperone whose down-regulation is both necessary and sufficient to drive this lipid imbalance, revealing an unrecognised route by which PLA2G6 deficiency perturbs sphingolipid homeostasis. Additionaly, our study suggests that targeting ceramide synthesis or enhancing GRP75 expression can alleviate mitochondrial dysfunction in PD models, underscoring the therapeutic leverage of the interaction between GRP75 and ceramides. Together, these findings elucidate the PLA2G6\u0026ndash;GRP75\u0026ndash;ceramide pathway in PD pathogenesis, guiding future efforts to develop small-molecule ceramide modulators and GRP75-targeted interventions for neurodegeneration.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAD \u0026ndash; Alzheimer\u0026rsquo;s disease\u003c/p\u003e\n\u003cp\u003eALS \u0026ndash; Amyotrophic lateral sclerosis\u003c/p\u003e\n\u003cp\u003eCCCP \u0026ndash; Carbonyl cyanide m-chlorophenyl hydrazone\u003c/p\u003e\n\u003cp\u003eCHX \u0026ndash; Cycloheximide\u003c/p\u003e\n\u003cp\u003eDA \u0026ndash; Dopaminergic neuron\u003c/p\u003e\n\u003cp\u003eDAT \u0026ndash; Dopamine transporter\u003c/p\u003e\n\u003cp\u003eDES \u0026ndash; Desipramine\u003c/p\u003e\n\u003cp\u003eER \u0026ndash; Endoplasmic reticulum\u003c/p\u003e\n\u003cp\u003eFIB-SEM \u0026ndash; Focused ion beam-scanning electron microscopy\u003c/p\u003e\n\u003cp\u003eGW \u0026ndash; GW4869 (neutral sphingomyelinase inhibitor)\u003c/p\u003e\n\u003cp\u003eIP3R \u0026ndash; Inositol 1,4,5-trisphosphate receptor\u003c/p\u003e\n\u003cp\u003eiPSC \u0026ndash; Induced pluripotent stem cell\u003c/p\u003e\n\u003cp\u003eKI \u0026ndash; Knock-in\u003c/p\u003e\n\u003cp\u003eKO \u0026ndash; Knockout\u003c/p\u003e\n\u003cp\u003eLC/MS/MS \u0026ndash; Liquid chromatography tandem mass spectrometry\u003c/p\u003e\n\u003cp\u003eMAM \u0026ndash; Mitochondria-associated membrane\u003c/p\u003e\n\u003cp\u003eMEF \u0026ndash; Mouse embryonic fibroblast\u003c/p\u003e\n\u003cp\u003eNC \u0026ndash; Normal control\u003c/p\u003e\n\u003cp\u003eNBIA \u0026ndash; Neurodegeneration with brain iron accumulation\u003c/p\u003e\n\u003cp\u003ePBMC \u0026ndash; Peripheral blood mononuclear cell\u003c/p\u003e\n\u003cp\u003ePD \u0026ndash; Parkinson\u0026rsquo;s disease\u003c/p\u003e\n\u003cp\u003ePLA \u0026ndash; Proximity ligation assay\u003c/p\u003e\n\u003cp\u003ePPMI \u0026ndash; Parkinson\u0026rsquo;s Progression Markers Initiative\u003c/p\u003e\n\u003cp\u003eROS \u0026ndash; Reactive oxygen species\u003c/p\u003e\n\u003cp\u003eSH-SY5Y \u0026ndash; Human neuroblastoma SH-SY5Y cell line\u003c/p\u003e\n\u003cp\u003eSN \u0026ndash; Substantia nigra\u003c/p\u003e\n\u003cp\u003eSNpc \u0026ndash; Substantia nigra pars compacta\u003c/p\u003e\n\u003cp\u003eSPLICS \u0026ndash; Split-GFP-based contact site sensor\u003c/p\u003e\n\u003cp\u003eTEM \u0026ndash; Transmission electron microscopy\u003c/p\u003e\n\u003cp\u003eTMRE \u0026ndash; Tetramethylrhodamine ethyl ester\u003c/p\u003e\n\u003cp\u003eWT \u0026ndash; Wild type\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eSupplemental information\u003c/p\u003e\n\u003cp\u003eFigure S1\u0026ndash;S14;\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eEthics approval and consent to participate\u003c/h3\u003e\n\u003cp\u003eThe mouse protocol was approved by the Animal Care and Use Committee of the Central South University. And human samples were obtained with informed consent and the study protocol was approved by the Medical Ethics Committee of Xiangya Hospital, Central South University.\u003c/p\u003e\n\u003ch3\u003eConsent for publication\u003c/h3\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch3\u003eAvailability of data and materials\u003c/h3\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003ch3\u003eCompeting interests\u003c/h3\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003ch3\u003eFundings\u003c/h3\u003e\n\u003cp\u003eThis work was supported by the National Key R\u0026amp;D Program of China grant 2021YFC2501204 (to G JF), the Technology Major Project of Hunan Provincial Science and Technology Department grant 2021SK1011 (to G JF), the National Natural Science Foundation of China grants 82071439 and 82271281 (to G JF), the National Natural Science Foundation of China grant 82171258, the National Key Research and Development Program of China Grant No. 2021YFC2501204, No. 2021YFA0805200,\u0026nbsp;and Major Program of the National Natural Science Foundation of China (Grant No.22494704 (to T JQ).\u003c/p\u003e\n\u003ch3\u003eAuthors\u0026rsquo; contributions\u003c/h3\u003e\n\u003cp\u003eThe study was conceptualized by JB L, JF G, and JQ T. The methodology was designed and carried out by JB L, Q Y, R G,TL L, ZY X, YZ L, and XR H. The additional experiments included in this revision were carried out by JB L, Q Y, and R G. Investigation was performed by JB L, JF G, and JQ T. Visualization was done by JB L. Funding acquisition was managed by JF G and JQ T. Project administration was coordinated by JF G, JQ T, L S, H J, XJ W, JD L, J Q, ZT Z, XW Z, and BS T. The supervision of the study was provided by JF G, JQ T, L S, H J, XJ W, JD L, J Q, ZT Z, XW Z, and BS T. The original draft of the manuscript was written by JB L, JF G, and JQ T, while the review and editing of the manuscript were done by JB L, JF G, JQ T, and BS T.\u003c/p\u003e\n\u003ch3\u003eAcknowledgments\u003c/h3\u003e\n\u003cp\u003eWe thank Jiansheng Guo in the Center of Cryo-Electron Microscopy (CCEM), Zhejiang University and Prof. Xia Li in the Institute of Special Environmental Medicine and Medical School, Nantong University for their technical assistance on FIB-SEM.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditionally, we sincerely thank all the members of Guo\u0026rsquo;s Lab for their great effort and help throughout this study. Special thanks to Dr. Wu Yiming and Yang Yingxuan from ZZ Lab for their technological assistance. We also thank Dr. Junpu Wang for TEM imaging and the LipidALL Technologies Company Limited (Changzhou, China) for lipid analysis. We extend our gratitude to the Biomedical Center, Institute for Advanced Study of Central South University for their invaluable support in providing immunofluorescence imaging and technical assistance, and the Center of Cryo-Electron Microscopy, Zhejiang University for their invaluable support in FIB-SEM.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRocca WA: \u003cstrong\u003eThe burden of Parkinson\u0026apos;s disease: a worldwide perspective.\u003c/strong\u003e \u003cem\u003eLancet Neurol \u003c/em\u003e2018, \u003cstrong\u003e17:\u003c/strong\u003e928-929.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eParkinson disease \u003c/strong\u003e[https://www.who.int/news-room/fact-sheets/detail/parkinson-disease#:~:text=Parkinson%20disease%20,8%20million%20disability]\u003c/li\u003e\n\u003cli\u003eMorris HR, Spillantini MG, Sue CM, Williams-Gray CH: \u003cstrong\u003eThe pathogenesis of Parkinson\u0026apos;s disease.\u003c/strong\u003e \u003cem\u003eLancet \u003c/em\u003e2024, \u003cstrong\u003e403:\u003c/strong\u003e293-304.\u003c/li\u003e\n\u003cli\u003eBarbuti PA, Guardia-Laguarta C, Yun T, Chatila ZK, Flowers X, Wong C, Santos BF, Larsen SB, Lotti JS, Hattori N: \u003cstrong\u003eThe role of alpha-synuclein in synucleinopathy: Impact on lipid regulation at mitochondria\u0026ndash;ER membranes.\u003c/strong\u003e \u003cem\u003enpj Parkinson\u0026apos;s Disease \u003c/em\u003e2025, \u003cstrong\u003e11:\u003c/strong\u003e103.\u003c/li\u003e\n\u003cli\u003eGuardia-Laguarta C, Area-Gomez E, Rub C, Liu Y, Magrane J, Becker D, Voos W, Schon EA, Przedborski S: \u003cstrong\u003ealpha-Synuclein is localized to mitochondria-associated ER membranes.\u003c/strong\u003e \u003cem\u003eJ Neurosci \u003c/em\u003e2014, \u003cstrong\u003e34:\u003c/strong\u003e249-259.\u003c/li\u003e\n\u003cli\u003eGautier CA, Erpapazoglou Z, Mouton-Liger F, Muriel MP, Cormier F, Bigou S, Duffaure S, Girard M, Foret B, Iannielli A, et al: \u003cstrong\u003eThe endoplasmic reticulum-mitochondria interface is perturbed in PARK2 knockout mice and patients with PARK2 mutations.\u003c/strong\u003e \u003cem\u003eHum Mol Genet \u003c/em\u003e2016, \u003cstrong\u003e25:\u003c/strong\u003e2972-2984.\u003c/li\u003e\n\u003cli\u003eLiu Y, Ma X, Fujioka H, Liu J, Chen S, Zhu X: \u003cstrong\u003eDJ-1 regulates the integrity and function of ER-mitochondria association through interaction with IP3R3-Grp75-VDAC1.\u003c/strong\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2019, \u003cstrong\u003e116:\u003c/strong\u003e25322-25328.\u003c/li\u003e\n\u003cli\u003ePaisan-Ruiz C, Bhatia KP, Li A, Hernandez D, Davis M, Wood NW, Hardy J, Houlden H, Singleton A, Schneider SA: \u003cstrong\u003eCharacterization of PLA2G6 as a locus for dystonia-parkinsonism.\u003c/strong\u003e \u003cem\u003eAnn Neurol \u003c/em\u003e2009, \u003cstrong\u003e65:\u003c/strong\u003e19-23.\u003c/li\u003e\n\u003cli\u003eShi CH, Tang BS, Wang L, Lv ZY, Wang J, Luo LZ, Shen L, Jiang H, Yan XX, Pan Q, et al: \u003cstrong\u003ePLA2G6 gene mutation in autosomal recessive early-onset parkinsonism in a Chinese cohort.\u003c/strong\u003e \u003cem\u003eNeurology \u003c/em\u003e2011, \u003cstrong\u003e77:\u003c/strong\u003e75-81.\u003c/li\u003e\n\u003cli\u003eYoshino H, Tomiyama H, Tachibana N, Ogaki K, Li Y, Funayama M, Hashimoto T, Takashima S, Hattori N: \u003cstrong\u003ePhenotypic spectrum of patients with PLA2G6 mutation and PARK14-linked parkinsonism.\u003c/strong\u003e \u003cem\u003eNeurology \u003c/em\u003e2010, \u003cstrong\u003e75:\u003c/strong\u003e1356-1361.\u003c/li\u003e\n\u003cli\u003eMagrinelli F, Mehta S, Di Lazzaro G, Latorre A, Edwards MJ, Balint B, Basu P, Kobylecki C, Groppa S, Hegde A: \u003cstrong\u003eDissecting the phenotype and genotype of PLA2G6‐related parkinsonism.\u003c/strong\u003e \u003cem\u003eMovement Disorders \u003c/em\u003e2022, \u003cstrong\u003e37:\u003c/strong\u003e148-161.\u003c/li\u003e\n\u003cli\u003eVillal\u0026oacute;n-Garc\u0026iacute;a I, \u0026Aacute;lvarez-C\u0026oacute;rdoba M, Povea-Cabello S, Talaver\u0026oacute;n-Rey M, Villanueva-Paz M, Luz\u0026oacute;n-Hidalgo R, Su\u0026aacute;rez-Rivero JM, Su\u0026aacute;rez-Carrillo A, Munuera-Cabeza M, Salas JJ: \u003cstrong\u003eVitamin E prevents lipid peroxidation and iron accumulation in PLA2G6-Associated Neurodegeneration.\u003c/strong\u003e \u003cem\u003eNeurobiology of disease \u003c/em\u003e2022, \u003cstrong\u003e165:\u003c/strong\u003e105649.\u003c/li\u003e\n\u003cli\u003eLi T, Liu J, Huang X, Xie Y, Hu Y, Xu Q, Tang B, Tan J, Guo J: \u003cstrong\u003eDeficiency of PLA2G6 Induces Ferroptosis in Dopaminergic Neurons and Contributes to Parkinson\u0026rsquo;s Disease Pathogenesis via Disruption of PRDX6/FTH1/GPX4 Axis.\u003c/strong\u003e \u003cem\u003eMolecular Neurobiology \u003c/em\u003e2025\u003cstrong\u003e:\u003c/strong\u003e1-12.\u003c/li\u003e\n\u003cli\u003eChiu C-C, Lu C-S, Weng Y-H, Chen Y-L, Huang Y-Z, Chen R-S, Cheng Y-C, Huang Y-C, Liu Y-C, Lai S-C: \u003cstrong\u003ePARK14 (D331Y) PLA2G6 causes early-onset degeneration of substantia nigra dopaminergic neurons by inducing mitochondrial dysfunction, ER stress, mitophagy impairment and transcriptional dysregulation in a knockin mouse model.\u003c/strong\u003e \u003cem\u003eMolecular neurobiology \u003c/em\u003e2019, \u003cstrong\u003e56:\u003c/strong\u003e3835-3853.\u003c/li\u003e\n\u003cli\u003eZhou Q, Yen A, Rymarczyk G, Asai H, Trengrove C, Aziz N, Kirber MT, Mostoslavsky G, Ikezu T, Wolozin B: \u003cstrong\u003eImpairment of PARK14-dependent Ca2+ signalling is a novel determinant of Parkinson\u0026rsquo;s disease.\u003c/strong\u003e \u003cem\u003eNature communications \u003c/em\u003e2016, \u003cstrong\u003e7:\u003c/strong\u003e10332.\u003c/li\u003e\n\u003cli\u003eLin G, Lee PT, Chen K, Mao D, Tan KL, Zuo Z, Lin WW, Wang L, Bellen HJ: \u003cstrong\u003ePhospholipase PLA2G6, a Parkinsonism-Associated Gene, Affects Vps26 and Vps35, Retromer Function, and Ceramide Levels, Similar to alpha-Synuclein Gain.\u003c/strong\u003e \u003cem\u003eCell Metab \u003c/em\u003e2018, \u003cstrong\u003e28:\u003c/strong\u003e605-618 e606.\u003c/li\u003e\n\u003cli\u003eChiu C-C, Yeh T-H, Lu C-S, Huang Y-C, Cheng Y-C, Huang Y-Z, Weng Y-H, Liu Y-C, Lai S-C, Chen Y-L: \u003cstrong\u003ePARK14 PLA2G6 mutants are defective in preventing rotenone-induced mitochondrial dysfunction, ROS generation and activation of mitochondrial apoptotic pathway.\u003c/strong\u003e \u003cem\u003eOncotarget \u003c/em\u003e2017, \u003cstrong\u003e8:\u003c/strong\u003e79046.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003ePhospholipid synthesis in a membrane fraction associated with mitochondria.\u003c/strong\u003e \u003cem\u003eJournal of Biological Chemistry \u003c/em\u003e1990, \u003cstrong\u003e265:\u003c/strong\u003e7248-7256.\u003c/li\u003e\n\u003cli\u003eHerrera-Cruz MS, Simmen T: \u003cstrong\u003eOver six decades of discovery and characterization of the architecture at mitochondria-associated membranes (MAMs).\u003c/strong\u003e \u003cem\u003eorganelle contact sites: from molecular mechanism to disease \u003c/em\u003e2017\u003cstrong\u003e:\u003c/strong\u003e13-31.\u003c/li\u003e\n\u003cli\u003ePaillusson S, Stoica R, Gomez-Suaga P, Lau DH, Mueller S, Miller T, Miller CC: \u003cstrong\u003eThere\u0026apos;s something wrong with my MAM; the ER\u0026ndash;mitochondria axis and neurodegenerative diseases.\u003c/strong\u003e \u003cem\u003eTrends in neurosciences \u003c/em\u003e2016, \u003cstrong\u003e39:\u003c/strong\u003e146-157.\u003c/li\u003e\n\u003cli\u003eSzabadkai G, Bianchi K, Varnai P, De Stefani D, Wieckowski MR, Cavagna D, Nagy AI, Balla T, Rizzuto R: \u003cstrong\u003eChaperone-mediated coupling of endoplasmic reticulum and mitochondrial Ca2+ channels.\u003c/strong\u003e \u003cem\u003eJ Cell Biol \u003c/em\u003e2006, \u003cstrong\u003e175:\u003c/strong\u003e901-911.\u003c/li\u003e\n\u003cli\u003eVallese F, Catoni C, Cieri D, Barazzuol L, Ramirez O, Calore V, Bonora M, Giamogante F, Pinton P, Brini M, Cali T: \u003cstrong\u003eAn expanded palette of improved SPLICS reporters detects multiple organelle contacts in vitro and in vivo.\u003c/strong\u003e \u003cem\u003eNat Commun \u003c/em\u003e2020, \u003cstrong\u003e11:\u003c/strong\u003e6069.\u003c/li\u003e\n\u003cli\u003eSanjana NE, Shalem O, Zhang F: \u003cstrong\u003eImproved vectors and genome-wide libraries for CRISPR screening.\u003c/strong\u003e \u003cem\u003eNat Methods \u003c/em\u003e2014, \u003cstrong\u003e11:\u003c/strong\u003e783-784.\u003c/li\u003e\n\u003cli\u003eWieckowski MR, Giorgi C, Lebiedzinska M, Duszynski J, Pinton P: \u003cstrong\u003eIsolation of mitochondria-associated membranes and mitochondria from animal tissues and cells.\u003c/strong\u003e \u003cem\u003eNat Protoc \u003c/em\u003e2009, \u003cstrong\u003e4:\u003c/strong\u003e1582-1590.\u003c/li\u003e\n\u003cli\u003eAnnunziata I, Patterson A, d\u0026apos;Azzo A: \u003cstrong\u003eMitochondria-associated ER membranes (MAMs) and glycosphingolipid enriched microdomains (GEMs): isolation from mouse brain.\u003c/strong\u003e \u003cem\u003eJ Vis Exp \u003c/em\u003e2013\u003cstrong\u003e:\u003c/strong\u003ee50215.\u003c/li\u003e\n\u003cli\u003eKe M, Chong CM, Zeng H, Huang M, Huang Z, Zhang K, Cen X, Lu JH, Yao X, Qin D, Su H: \u003cstrong\u003eAzoramide protects iPSC-derived dopaminergic neurons with PLA2G6 D331Y mutation through restoring ER function and CREB signaling.\u003c/strong\u003e \u003cem\u003eCell Death Dis \u003c/em\u003e2020, \u003cstrong\u003e11:\u003c/strong\u003e130.\u003c/li\u003e\n\u003cli\u003eLi X, Qiao F, Guo J, Jiang T, Lou H, Li H, Xie G, Wu H, Wang W, Pei R, et al: \u003cstrong\u003eIn situ architecture of the intercellular organelle reservoir between epididymal epithelial cells by volume electron microscopy.\u003c/strong\u003e \u003cem\u003eNat Commun \u003c/em\u003e2025, \u003cstrong\u003e16:\u003c/strong\u003e1664.\u003c/li\u003e\n\u003cli\u003eLam SM, Zhang C, Wang Z, Ni Z, Zhang S, Yang S, Huang X, Mo L, Li J, Lee B, et al: \u003cstrong\u003eA multi-omics investigation of the composition and function of extracellular vesicles along the temporal trajectory of COVID-19.\u003c/strong\u003e \u003cem\u003eNat Metab \u003c/em\u003e2021, \u003cstrong\u003e3:\u003c/strong\u003e909-922.\u003c/li\u003e\n\u003cli\u003eShui G, Guan XL, Low CP, Chua GH, Goh JS, Yang H, Wenk MR: \u003cstrong\u003eToward one step analysis of cellular lipidomes using liquid chromatography coupled with mass spectrometry: application to Saccharomyces cerevisiae and Schizosaccharomyces pombe lipidomics.\u003c/strong\u003e \u003cem\u003eMol Biosyst \u003c/em\u003e2010, \u003cstrong\u003e6:\u003c/strong\u003e1008-1017.\u003c/li\u003e\n\u003cli\u003eShui G, Cheong WF, Jappar IA, Hoi A, Xue Y, Fernandis AZ, Tan BK, Wenk MR: \u003cstrong\u003eDerivatization-independent cholesterol analysis in crude lipid extracts by liquid chromatography/mass spectrometry: applications to a rabbit model for atherosclerosis.\u003c/strong\u003e \u003cem\u003eJ Chromatogr A \u003c/em\u003e2011, \u003cstrong\u003e1218:\u003c/strong\u003e4357-4365.\u003c/li\u003e\n\u003cli\u003eMiao H, Li B, Wang Z, Mu J, Tian Y, Jiang B, Zhang S, Gong X, Shui G, Lam SM: \u003cstrong\u003eErratum to \u0026quot;Lipidome Atlas of the Developing Heart Uncovers Dynamic Membrane Lipid Attributes Underlying Cardiac Structural and Metabolic Maturation\u0026quot;.\u003c/strong\u003e \u003cem\u003eResearch (Wash D C) \u003c/em\u003e2023, \u003cstrong\u003e6:\u003c/strong\u003e0185.\u003c/li\u003e\n\u003cli\u003eChiu CC, Lu CS, Weng YH, Chen YL, Huang YZ, Chen RS, Cheng YC, Huang YC, Liu YC, Lai SC, et al: \u003cstrong\u003ePARK14 (D331Y) PLA2G6 Causes Early-Onset Degeneration of Substantia Nigra Dopaminergic Neurons by Inducing Mitochondrial Dysfunction, ER Stress, Mitophagy Impairment and Transcriptional Dysregulation in a Knockin Mouse Model.\u003c/strong\u003e \u003cem\u003eMol Neurobiol \u003c/em\u003e2019, \u003cstrong\u003e56:\u003c/strong\u003e3835-3853.\u003c/li\u003e\n\u003cli\u003eNakamura K, Aoyama-Ishiwatari S, Nagao T, Paaran M, Obara CJ, Sakurai-Saito Y, Johnston J, Du Y, Suga S, Tsuboi M: \u003cstrong\u003eMitochondrial complexity is regulated at ER-mitochondria contact sites via PDZD8-FKBP8 tethering.\u003c/strong\u003e \u003cem\u003eNature Communications \u003c/em\u003e2025, \u003cstrong\u003e16:\u003c/strong\u003e3401.\u003c/li\u003e\n\u003cli\u003ePilotto F, Schmitz A, Maharjan N, Diab R, Odriozola A, Tripathi P, Yamoah A, Scheidegger O, Oestmann A, Dennys CN, et al: \u003cstrong\u003ePolyGA targets the ER stress-adaptive response by impairing GRP75 function at the MAM in C9ORF72-ALS/FTD.\u003c/strong\u003e \u003cem\u003eActa Neuropathol \u003c/em\u003e2022, \u003cstrong\u003e144:\u003c/strong\u003e939-966.\u003c/li\u003e\n\u003cli\u003eVaena S, Chakraborty P, Lee HG, Janneh AH, Kassir MF, Beeson G, Hedley Z, Yalcinkaya A, Sofi MH, Li H, et al: \u003cstrong\u003eAging-dependent mitochondrial dysfunction mediated by ceramide signaling inhibits antitumor T cell response.\u003c/strong\u003e \u003cem\u003eCell Rep \u003c/em\u003e2021, \u003cstrong\u003e35:\u003c/strong\u003e109076.\u003c/li\u003e\n\u003cli\u003eBaba M, Nakajo S, Tu PH, Tomita T, Nakaya K, Lee VM, Trojanowski JQ, Iwatsubo T: \u003cstrong\u003eAggregation of alpha-synuclein in Lewy bodies of sporadic Parkinson\u0026apos;s disease and dementia with Lewy bodies.\u003c/strong\u003e \u003cem\u003eAm J Pathol \u003c/em\u003e1998, \u003cstrong\u003e152:\u003c/strong\u003e879-884.\u003c/li\u003e\n\u003cli\u003eLam J, Katti P, Biete M, Mungai M, AshShareef S, Neikirk K, Garza Lopez E, Vue Z, Christensen TA, Beasley HK, et al: \u003cstrong\u003eA Universal Approach to Analyzing Transmission Electron Microscopy with ImageJ.\u003c/strong\u003e \u003cem\u003eCells \u003c/em\u003e2021, \u003cstrong\u003e10\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eSmith AM, Depp C, Ryan BJ, Johnston GI, Alegre-Abarrategui J, Evetts S, Rolinski M, Baig F, Ruffmann C, Simon AK, et al: \u003cstrong\u003eMitochondrial dysfunction and increased glycolysis in prodromal and early Parkinson\u0026apos;s blood cells.\u003c/strong\u003e \u003cem\u003eMov Disord \u003c/em\u003e2018, \u003cstrong\u003e33:\u003c/strong\u003e1580-1590.\u003c/li\u003e\n\u003cli\u003eXia C, Ma T, Jiao C, Chen C, Liu C: \u003cstrong\u003eBrainEXP-NPD: a database of transcriptomic profiles of human brains of six neuropsychiatric disorders.\u003c/strong\u003e \u003cem\u003ebioRxiv \u003c/em\u003e2021\u003cstrong\u003e:\u003c/strong\u003e2021.2005.2030.446363.\u003c/li\u003e\n\u003cli\u003eChiu CC, Yeh TH, Lu CS, Huang YC, Cheng YC, Huang YZ, Weng YH, Liu YC, Lai SC, Chen YL, et al: \u003cstrong\u003ePARK14 PLA2G6 mutants are defective in preventing rotenone-induced mitochondrial dysfunction, ROS generation and activation of mitochondrial apoptotic pathway.\u003c/strong\u003e \u003cem\u003eOncotarget \u003c/em\u003e2017, \u003cstrong\u003e8:\u003c/strong\u003e79046-79060.\u003c/li\u003e\n\u003cli\u003eHigo T, Hamada K, Hisatsune C, Nukina N, Hashikawa T, Hattori M, Nakamura T, Mikoshiba K: \u003cstrong\u003eMechanism of ER stress-induced brain damage by IP(3) receptor.\u003c/strong\u003e \u003cem\u003eNeuron \u003c/em\u003e2010, \u003cstrong\u003e68:\u003c/strong\u003e865-878.\u003c/li\u003e\n\u003cli\u003eZellmer JC, Tarantino MB, Kim M, Lomoio S, Maesako M, Hajn\u0026oacute;czky G, Bhattacharyya R: \u003cstrong\u003eStabilization of mitochondria‐associated endoplasmic reticulum membranes regulates A\u0026beta; generation in a three‐dimensional neural model of Alzheimer\u0026apos;s disease.\u003c/strong\u003e \u003cem\u003eAlzheimer\u0026apos;s \u0026amp; Dementia \u003c/em\u003e2025, \u003cstrong\u003e21:\u003c/strong\u003ee14417.\u003c/li\u003e\n\u003cli\u003eLi X, Yang Y, Shi X, Zhang Z, Ding S: \u003cstrong\u003eMitochondria-Associated Membranes as Key Regulators in Cellular Homeostasis and the Potential Impact of Exercise on Insulin Resistance.\u003c/strong\u003e \u003cem\u003eInt J Mol Sci \u003c/em\u003e2024, \u003cstrong\u003e25\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eBravo R, Vicencio JM, Parra V, Troncoso R, Munoz JP, Bui M, Quiroga C, Rodriguez AE, Verdejo HE, Ferreira J: \u003cstrong\u003eIncreased ER\u0026ndash;mitochondrial coupling promotes mitochondrial respiration and bioenergetics during early phases of ER stress.\u003c/strong\u003e \u003cem\u003eJournal of cell science \u003c/em\u003e2011, \u003cstrong\u003e124:\u003c/strong\u003e2143-2152.\u003c/li\u003e\n\u003cli\u003eStoica R, De Vos KJ, Paillusson S, Mueller S, Sancho RM, Lau KF, Vizcay-Barrena G, Lin WL, Xu YF, Lewis J, et al: \u003cstrong\u003eER-mitochondria associations are regulated by the VAPB-PTPIP51 interaction and are disrupted by ALS/FTD-associated TDP-43.\u003c/strong\u003e \u003cem\u003eNat Commun \u003c/em\u003e2014, \u003cstrong\u003e5:\u003c/strong\u003e3996.\u003c/li\u003e\n\u003cli\u003eChoi GE, Park JY, Park MR, Yoon JH, Han HJ: \u003cstrong\u003eGlucocorticoid enhances presenilin1-dependent A\u0026beta; production at ER\u0026rsquo;s mitochondrial-associated membrane by downregulating Rer1 in neuronal cells.\u003c/strong\u003e \u003cem\u003eRedox Biology \u003c/em\u003e2023, \u003cstrong\u003e65:\u003c/strong\u003e102821.\u003c/li\u003e\n\u003cli\u003eEtxebeste-Mitxeltorena M, Flores-Romero H, Ramos-Inza S, Masi\u0026aacute; E, Nenchova M, Montesinos J, Martinez-Gonzalez L, Porras G, Orz\u0026aacute;ez M, Vicent MJ: \u003cstrong\u003eModulation of Mitochondria\u0026ndash;Endoplasmic Reticulum Contacts (MERCs) by Small Molecules as a New Strategy for Restoring Lipid Metabolism in an Amyotrophic Lateral Sclerosis Model.\u003c/strong\u003e \u003cem\u003eJournal of Medicinal Chemistry \u003c/em\u003e2025.\u003c/li\u003e\n\u003cli\u003ePilotto F, Smeele PH, Scheidegger O, Diab R, Schobesberger M, Sierra-Delgado JA, Saxena S: \u003cstrong\u003eKaempferol enhances ER-mitochondria coupling and protects motor neurons from mitochondrial dysfunction and ER stress in C9ORF72-ALS.\u003c/strong\u003e \u003cem\u003eActa Neuropathologica Communications \u003c/em\u003e2025, \u003cstrong\u003e13:\u003c/strong\u003e21.\u003c/li\u003e\n\u003cli\u003eMori A, Hatano T, Inoshita T, Shiba-Fukushima K, Koinuma T, Meng H, Kubo SI, Spratt S, Cui C, Yamashita C, et al: \u003cstrong\u003eParkinson\u0026apos;s disease-associated iPLA2-VIA/PLA2G6 regulates neuronal functions and alpha-synuclein stability through membrane remodeling.\u003c/strong\u003e \u003cem\u003eProc Natl Acad Sci U S A \u003c/em\u003e2019, \u003cstrong\u003e116:\u003c/strong\u003e20689-20699.\u003c/li\u003e\n\u003cli\u003eDeng X, Wang J, Jiao L, Utaipan T, Tuma-Kellner S, Schmitz G, Liebisch G, Stremmel W, Chamulitrat W: \u003cstrong\u003eiPLA2beta deficiency attenuates obesity and hepatic steatosis in ob/ob mice through hepatic fatty-acyl phospholipid remodeling.\u003c/strong\u003e \u003cem\u003eBiochim Biophys Acta \u003c/em\u003e2016, \u003cstrong\u003e1861:\u003c/strong\u003e449-461.\u003c/li\u003e\n\u003cli\u003eLiu X, Xu F, Zhao K, Liu Y, Ye G, Zhang X, Qu Y: \u003cstrong\u003eComprehending the cuproptosis and cancer-immunity cycle network: delving into the immune landscape and its predictive role in breast cancer immunotherapy responses and clinical endpoints.\u003c/strong\u003e \u003cem\u003eFront Immunol \u003c/em\u003e2024, \u003cstrong\u003e15:\u003c/strong\u003e1344023.\u003c/li\u003e\n\u003cli\u003eMignard V, Dubois N, Lanoe D, Joalland MP, Oliver L, Pecqueur C, Heymann D, Paris F, Vallette FM, Lalier L: \u003cstrong\u003eSphingolipid distribution at mitochondria-associated membranes (MAMs) upon induction of apoptosis.\u003c/strong\u003e \u003cem\u003eJ Lipid Res \u003c/em\u003e2020, \u003cstrong\u003e61:\u003c/strong\u003e1025-1037.\u003c/li\u003e\n\u003cli\u003eBionda C, Portoukalian J, Schmitt D, Rodriguez-Lafrasse C, Ardail D: \u003cstrong\u003eSubcellular compartmentalization of ceramide metabolism: MAM (mitochondria-associated membrane) and/or mitochondria?\u003c/strong\u003e \u003cem\u003eBiochemical journal \u003c/em\u003e2004, \u003cstrong\u003e382:\u003c/strong\u003e527-533.\u003c/li\u003e\n\u003cli\u003eHayashi T, Fujimoto M: \u003cstrong\u003eDetergent-resistant microdomains determine the localization of \u0026sigma;-1 receptors to the endoplasmic reticulum-mitochondria junction.\u003c/strong\u003e \u003cem\u003eMolecular pharmacology \u003c/em\u003e2010, \u003cstrong\u003e77:\u003c/strong\u003e517-528.\u003c/li\u003e\n\u003cli\u003eMusthafa T, Nizami SK, Mishra A, Hasan G, Gopurappilly R: \u003cstrong\u003eAltered Mitochondrial Bioenergetics and Calcium Kinetics in Young‐Onset PLA2G6 Parkinson\u0026apos;s Disease iPSCs.\u003c/strong\u003e \u003cem\u003eJournal of Neurochemistry \u003c/em\u003e2025, \u003cstrong\u003e169:\u003c/strong\u003ee70059.\u003c/li\u003e\n\u003cli\u003eKinghorn KJ, Castillo-Quan JI, Bartolome F, Angelova PR, Li L, Pope S, Cocheme HM, Khan S, Asghari S, Bhatia KP: \u003cstrong\u003eLoss of PLA2G6 leads to elevated mitochondrial lipid peroxidation and mitochondrial dysfunction.\u003c/strong\u003e \u003cem\u003eBrain \u003c/em\u003e2015, \u003cstrong\u003e138:\u003c/strong\u003e1801-1816.\u003c/li\u003e\n\u003cli\u003eJin J, Hulette C, Wang Y, Zhang T, Pan C, Wadhwa R, Zhang J: \u003cstrong\u003eProteomic identification of a stress protein, mortalin/mthsp70/GRP75: relevance to Parkinson disease.\u003c/strong\u003e \u003cem\u003eMol Cell Proteomics \u003c/em\u003e2006, \u003cstrong\u003e5:\u003c/strong\u003e1193-1204.\u003c/li\u003e\n\u003cli\u003eMagalingam KB, Somanath SD, Ramdas P, Haleagrahara N, Radhakrishnan AK: \u003cstrong\u003e6-Hydroxydopamine Induces Neurodegeneration in Terminally Differentiated SH-SY5Y Neuroblastoma Cells via Enrichment of the Nucleosomal Degradation Pathway: a Global Proteomics Approach.\u003c/strong\u003e \u003cem\u003eJ Mol Neurosci \u003c/em\u003e2022, \u003cstrong\u003e72:\u003c/strong\u003e1026-1046.\u003c/li\u003e\n\u003cli\u003eRakovic A, Grunewald A, Voges L, Hofmann S, Orolicki S, Lohmann K, Klein C: \u003cstrong\u003ePINK1-Interacting Proteins: Proteomic Analysis of Overexpressed PINK1.\u003c/strong\u003e \u003cem\u003eParkinsons Dis \u003c/em\u003e2011, \u003cstrong\u003e2011:\u003c/strong\u003e153979.\u003c/li\u003e\n\u003cli\u003eJin J, Li GJ, Davis J, Zhu D, Wang Y, Pan C, Zhang J: \u003cstrong\u003eIdentification of novel proteins associated with both alpha-synuclein and DJ-1.\u003c/strong\u003e \u003cem\u003eMol Cell Proteomics \u003c/em\u003e2007, \u003cstrong\u003e6:\u003c/strong\u003e845-859.\u003c/li\u003e\n\u003cli\u003eLiang T, Hang W, Chen J, Wu Y, Wen B, Xu K, Ding B, Chen J: \u003cstrong\u003eApoE4 (Delta272-299) induces mitochondrial-associated membrane formation and mitochondrial impairment by enhancing GRP75-modulated mitochondrial calcium overload in neuron.\u003c/strong\u003e \u003cem\u003eCell Biosci \u003c/em\u003e2021, \u003cstrong\u003e11:\u003c/strong\u003e50.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Key Resources Table","content":"\u003cp\u003eKey Resources Table is available in the Supplementary Files section.\u003c/p\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":false,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"PLA2G6, Mitochondria-associated membranes, GRP75, Ceramide, Mitochondrial dysfunction, Parkinson’s disease","lastPublishedDoi":"10.21203/rs.3.rs-7426255/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7426255/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eLoss-of-function mutations in \u003cem\u003ePLA2G6\u003c/em\u003e cause mitochondrial abnormalities that contribute to Parkinson\u0026rsquo;s disease (PD), yet the precise mechanisms remain elusive.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eWe combined genetic, cellular, and pharmacological approaches to investigate the role of PLA2G6 in Parkinson\u0026rsquo;s disease. The \u003cem\u003ePLA2G6\u003c/em\u003e D331Y knock-in mouse model, PLA2G6 knockout cell lines, and patient-derived dopaminergic neurons were used to assess neuronal and mitochondrial phenotypes. ER\u0026ndash;mitochondria contacts and protein interactions were examined by Focused Ion Beam-Scanning Electron Microscope, subcellular fractionation, and biochemical assays. Lipidomic profiling and immunofluorescence were applied to quantified ceramide distribution, while mitochondrial respiration, Ca\u0026sup2;⁺ flux, and oxidative stress were evaluated by functional assays. Ceramide-lowering drugs and GRP75 overexpression were tested for therapeutic rescue \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eOur data show that PLA2G6 localized to mitochondria-associated membranes (MAMs) and interacted with the IP3R\u0026ndash;GRP75\u0026ndash;VDAC1 tether. Loss of PLA2G6 reduced GRP75 levels, disrupted ER\u0026ndash;mitochondria contacts, and weakened IP3R\u0026ndash;GRP75\u0026ndash;VDAC1 interactions, leading to impaired Ca\u0026sup2;⁺ transfer and mitochondrial dysfunction. PLA2G6 deficiency caused caused pronounced accumulation of mitochondrial ceramides, particularly C16 ceramide. GRP75 was identified as a ceramide-binding protein regulating lipid turnover in addition to Ca\u0026sup2;⁺ transfer. Restoring GRP75 or pharmacologically lowering ceramides rescues mitochondrial function in cells and alleviates motor deficits and dopaminergic neuron loss in \u003cem\u003ePLA2G6\u003c/em\u003e mutant mice. GRP75 reduction was also observed in peripheral blood cells and substantia nigra tissues from PD patients, supporting its clinical relevance.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eLoss of PLA2G6 destabilizes GRP75, leading to disrupted MAMs and mitochondrial ceramide overload, which drive neurodegeneration. These findings support a PLA2G6\u0026ndash;GRP75\u0026ndash;ceramide pathway that integrates organelle communication, lipid metabolism, and mitochondrial integrity, highlighting ceramide modulation or GRP75 restoration as therapeutic strategies for \u003cem\u003ePLA2G6\u003c/em\u003e-linked and sporadic PD.\u003c/p\u003e","manuscriptTitle":"Mutations in PLA2G6 impair ER–mitochondria contacts and ceramide homeostasis via GRP75 in Parkinson’s disease","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-22 10:33:44","doi":"10.21203/rs.3.rs-7426255/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"00ab49d5-11cd-4ac3-b73d-f37b8c5a509c","owner":[],"postedDate":"August 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-13T23:38:08+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-22 10:33:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7426255","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7426255","identity":"rs-7426255","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}