Study on the Positive Regulation of Drought Tolerance by PdMYB2R032 Based on R2R3-MYB Gene Family Analysis in Populus deltoides | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Study on the Positive Regulation of Drought Tolerance by PdMYB2R032 Based on R2R3-MYB Gene Family Analysis in Populus deltoides Xueli Zhang, Ying Chen, Sheng Zhu, Ning Liu, Jinshu Li, Fenfen Liu, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8045203/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jan, 2026 Read the published version in BMC Plant Biology → Version 1 posted 15 You are reading this latest preprint version Abstract Plants growing in natural environments are constantly exposed to various biotic and abiotic stresses, among which drought is a major abiotic factor that severely limits growth and development. As a water-demanding species, Populus is particularly vulnerable to drought under the context of global climate warming, making its drought tolerance a key determinant of adaptability and productivity. R2R3-MYB transcription factors play critical regulatory roles in plant responses to drought stress. In this study, we performed a comprehensive genome-wide identification and analysis of the R2R3-MYB gene family in P. deltoides ‘I-69’ using bioinformatics approaches, and further investigated the drought-responsive function of PdMYB2R032 through transgenic experiments. A total of 100 R2R3-MYB genes ( Pd2RMYBs ) were identified and classified into 12 subgroups based on phylogenetic analysis. Cis -element analysis of promoter regions revealed abundant motifs related to light response, hormone signaling, and drought regulation. Gene Ontology (GO) annotation indicated that Pd2RMYBs are potentially involved in hormone signaling pathways and responses to abiotic stresses. Phylogenetic analysis showed that PdMYB2R032 from P. deltoides × P. euramericana ‘Nanlin895’ is most closely related to Pd2RMYB21 in P. deltoides ‘I-69’. Functional studies revealed that overexpression of PdMYB2R032 in Arabidopsis thaliana significantly promoted root development and biomass accumulation under drought conditions. In addition, PdMYB2R032 regulated stomatal movement by reducing stomatal aperture under drought stress, thereby minimizing water loss. It also reduced malondialdehyde (MDA) accumulation, alleviating drought-induced oxidative damage. Furthermore, PdMYB2R032 enhanced seed germination, accelerated flowering, and shortened the reproductive cycle in transgenic Arabidopsis . Collectively, these results demonstrate that PdMYB2R032 acts as a positive regulator of drought tolerance through multiple biological pathways, providing theoretical support for elucidating the drought-responsive mechanisms of R2R3-MYB genes and for molecular breeding of drought-resistant poplars. Drought stress Drought tolerance Gene function Populus deltoides R2R3-MYB genes Transcription factor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Frequent fluctuations in global climate have led to an increasing occurrence and severity of drought events, which pose serious threats to the structure and function of forest ecosystems [ 1 ] . Prolonged drought stress disrupts the water transport system in trees, resulting in crown defoliation, growth decline, or even tree mortality [ 2,3 ] . To cope with such stress and threats, plants generally adopt physiological strategies to maintain normal development (e.g., flowering) and ensure productivity [ 4 ] , such as enhancing root water uptake [ 5,6 ] , adjusting nutrient allocation strategies [ 7,8 ] , closing stomata [ 9 ] , and reducing leaf area [ 10 ] . In addition to physiological adaptations, plants also activate molecular response mechanisms when sensing abiotic stresses such as drought and heat, which help improve environmental adaptability [ 4,11,12 ] . Transcription factors (TFs), as key regulatory proteins, participate in the drought stress response through both ABA-dependent and ABA-independent pathways and play vital roles in stress adaptation [ 13 ] . TFs are sequence-specific DNA-binding proteins that regulate gene expression by binding to specific cis -acting elements, playing a central role in transcriptional control [ 14,15 ] . Among them,R2R3-MYB transcription factors constitute the largest subfamily of the MYB superfamily in plants [ 16,17 ] . They are widely involved in primary and secondary metabolism, plant development, hormone signaling, and responses to biotic and abiotic stresses, playing essential roles in understanding plant development and deciphering molecular mechanisms underlying environmental adaptation [ 1,18 ] . In recent years, the role of R2R3-MYB genes in regulating drought tolerance has attracted increasing attention [ 15,19,20 ] . For example, Arabidopsis thaliana genes AtMYB77 and AtMYB70 promote root development and mediate crosstalk between ABA and IAA signaling, maintaining physiological water balance under drought [ 21,22 ] . AtMYB96 and PtoMYB170 promote stomatal closure to reduce water loss [ 23,24 ] , while AtMYB61 reduces stomatal aperture and gas exchange to enhance drought tolerance [ 25 ] . Furthermore, some R2R3-MYB genes participate in drought responses by modulating hormone levels, osmotic regulators, or antioxidants. For example, Triticum aestivum TaMYB33 enhances drought tolerance by promoting osmotic balance and ROS scavenging [ 26 ] ; PtoMYB99 negatively regulates osmotic stress tolerance by reducing antioxidant enzyme activity [ 27 ] ; and PtrMYB94 induces the expression of oxidative stress-related proteins [ 28 ] . However, most of these studies have focused on herbaceous plants or crops, and reports on perennial woody plants—especially forest trees with long life cycles—remain limited. With the advancement of molecular biology and genomics, the study of gene regulatory mechanisms in plants under abiotic stress has received growing attention [ 29,30 ] . Populus spp. are among the most widely distributed and fast-growing tree species globally and play important roles in timber production, energy plantations, and ecological restoration [ 3 ] . Due to its relatively small and well-annotated genome, Populus has also become a model species for woody plant studies [ 31 ] . However, under the current trend of global warming, drought has become a major limiting factor for poplar growth and adaptability [ 32 ] . Given the species’ high water demand, its sensitivity to water deficit poses a key constraint for artificial forest development and productivity [ 33 ] . Therefore, elucidating the molecular basis of drought response and identifying key regulatory genes are essential for improving both productivity and ecological resilience in poplar [ 34 ] . In recent years, several drought-responsive transcription factors have been reported in poplar, such as P rt NAC 029 [ 33 ] , PtobZIP18 [ 35 ] , and PtoWRKY68 [ 36 ] . Nevertheless, compared to herbaceous plants, the functional characterization of drought-responsive genes in poplar remains limited, particularly for R2R3-MYB family members, and their regulatory roles in poplar drought tolerance remain largely unexplored. In previous research, we identified an R2R3-MYB gene, PdMYB2R032 , in P. deltoides × P. euramericana ‘Nanlin895’ that is homologous to Potri.002G173900 in Populus trichocarpa and potentially involved in drought stress response [ 37 ] . Additionally, Wang et al . (2017) cloned the homolog MYB115 from P. tomentosa , which was shown to regulate proanthocyanidin (PA) biosynthesis [ 38 ] . PA has been reported as a key secondary metabolite involved in poplar’s defense against abiotic stresses including drought [ 39,40 ] . Its homologous gene AtMYB5 has been reported to regulate heat stress response in Arabidopsis [ 41 ] . However, whether PdMYB2R032 actively involved in the molecular drought response pathway in poplar remains unclear. Therefore, the objectives of this study were to: (i) systematically identify and analyze R2R3-MYB family members in P. deltoides ‘I-69’ using bioinformatics tools; (ii) functionally validate the drought-responsive role of PdMYB2R032 through transgenic approaches; and (iii) explore the molecular mechanisms by which this gene regulates drought stress responses. This research aims to provide new insights into the functional roles of R2R3-MYB genes in drought tolerance and offer candidate genes for poplar genetic improvement under water-deficit conditions. Materials and Methods Identification of R2R3-MYB G enes in P. deltoides To identify drought-related R2R3-MYB genes in P. deltoides and investigate their relationships with those in other species, we performed identification and bioinformatic analysis of members of this gene family. The genome sequences of P. deltoides ‘I-69’ (GCA_015852605.2), A. thaliana (TAIR10), and Oryza sativa Japonica (v1.0) were obtained from the NCBI Genome Database (https://www.ncbi.nlm.nih.gov/genome/) and Ensembl Plants (https://plants.ensembl.org/info/data/ftp/index.html). The hidden Markov model (HMM) profile of the MYB DNA-binding domain (Pfam accession: PF00249) was downloaded from the Pfam database (https://pfam.xfam.org/) and used to scan the P. deltoides ‘I-69’ proteome (E-value cut-off = 1e -3 ). In parallel, a BLASTP search was performed against the P. deltoides protein database using known A. thaliana R2R3-MYB protein sequences retrieved from the Arabidopsis Information Resource (https://www.arabidopsis.org/) [ 42 ] , with an E-value threshold of 1e -5 . Candidate Pd2RMYBs were identified by combining the results of HMM and BLAST searches, and further validated for conserved domains using the methods described by Wang et al . (2023) [ 43 ] and Letunic et al . (2021) [ 44 ] to remove sequences lacking intact MYB domains. Bioinformatic Analysis of the Pd2RMYB Gene Family Chromosomal locations of Pd2RMYBs were retrieved from the genome annotation of P. deltoides ‘I-69’ and visualized using TBtools (v2.1.1). The physicochemical properties of the Pd2RMYB proteins were analyzed using the ProtParam tool (https://www.expasy.org/resources/protparam). Cis -acting elements within the 2000 bp upstream promoter regions were predicted using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). Phylogenetic trees were constructed with MEGA (v12) using the neighbor-joining (NJ) method and default parameters, based on the full-length R2R3-MYB protein sequences from P. deltoides and A. thaliana . Conserved motifs of Pd2RMYB proteins were identified using MEME (version 5.5.9, https://meme-suite.org/meme/tools/meme). Exon-intron structures were extracted from the genome annotation and visualized with TBtools. Tandem and segmental duplication events were identified using MCScanX and BLASTP (E-value < 1e -10 ). Homologous sequences to PdMYB2R032 were obtained via BLASTP searches against NCBI, and a cross-species phylogenetic tree was constructed with 1000 bootstrap replicates. Secondary and tertiary structures of PdMYB2R032 proteins were predicted using SOPMA (https://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) and SWISS-MODEL (https://www.swissmodel.expasy.org/), respectively. Gene Expression Patterns and Detection of PdMYB2R032 Activity Under Drought Stress This study utilized tissue culture seedlings of P. deltoides × P. euramericana 'Nanlin895' (NL895) , a hybrid bred by the Forest Tree Genetics and Breeding team of Nanjing Forestry University. One-month-old subcultured seedlings of NL895 were treated with 15% PEG6000 (w/v) (Coolaber, Beijing, China) to simulate drought stress. Leaves were collected at 0 hours, 12 hours, 1 day, and 3 days after treatment. RNA was then extracted and subjected to qRT-PCR analysis, using the ΔΔCt method to calculate gene expression levels. Eight Pd2RMYB genes were randomly selected to investigate their expression patterns at different treatment time points. The PdMYB2R032 gene was ligated into the pGBKT7 vector (Coolaber, Beijing, China) using the ClonExpress® II One Step Cloning Kit (Vazyme, Nanjing, China) to construct the pGBKT7- PdMYB2R032 fusion vector, which was subsequently transformed into AH109 yeast competent cells (Coolaber, Beijing, China). Using pGBKT7 as the control, yeast cultures carrying pGBKT7- PdMYB2R032 were spotted onto SD/-Trp media (Coolaber, Beijing, China ) containing 0%, 10%, and 30% PEG6000 at concentration gradients of 1, 1/10, 1/100, 1/1000, and 1/10000, followed by incubation at 29°C for 48 hours. Construction of Overexpression Vector and Genetic Transformation The pBI121-3HA-des vector (provided by Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University, Nanjing, China) was digested with restriction enzymes, and the target gene PdMYB2R032 was ligated into the vector using specific primers pBI121-3HA- PdMYB2R032 (F) and (R) (Table 1). The recombinant plasmid was transformed into Escherichia coli ( Trelief TM 5α Chemically Competent Cell, Tsingke, Beijing, China), and positive clones were preliminarily screened by colony PCR using 35S and PdMYB2R032 -R primers. Verified clones were sequenced, expanded, and used for plasmid extraction, then introduced into Agrobacterium tumefaciens GV3101 (Tsingke, Beijing, China). Table 1 . Primer information required. Primer name Primer sequence (5’-3’) pBI121-3HA- PdMYB2R032 (F) CCAGATTATGCTAGTCTTATGGGAAGGGCTCCTTGTTGC pBI121-3HA- PdMYB2R032 (R) GAACGATCGGGGAAATTCTCATACCAGCAGTGACTCGGCG 35S AGGAAGGTGGCTCCTACAAATGCCATC 3HA ATTATGCTAGTCTTATGTACC The transgenic receptor was A. thaliana ecotype Columbia Col-0 (,wild-type, provided by Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University, Nanjing, China), grown under conditions of 25 °C, 16 h light, and 65% relative humidity. Transformation was performed using the floral dip method. T0 seeds were screened on 1/2 MS medium (Hopebiol, Qingdao, China) containing kanamycin. Positive seedlings were verified by PCR and propagated for two additional generations. Homozygous PdMYB2R032 -overexpressing lines were selected for subsequent experiments. This experiment was completed at the Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University. Drought Simulation Experiment Drought stress was simulated using PEG6000 (Coolaber, Beijing, China) at concentrations of 0%, 5%, and 10%, following the method of van der Weele et al . (2000) [ 45 ] . (1) In vitro PEG stress treatment: Arabidopsis seedlings were grown for 10 days on standard 1/2 MS medium (Hopebiol, Qingdao, China), then transferred to media containing different PEG6000 concentrations. (2) Soil-based drought treatment: Seedlings of uniform growth were transplanted into pots (perlite: vermiculite: nutrient soil = 1:3:1) after 15 days on standard medium, and placed in a growth chamber (25 °C, 16 h light/8 h dark, 65% humidity). After 10 days of acclimation, drought and rewatering treatments were performed. Measurement of Growth and Physiological Parameters under Drought Stress Six wild-type (WT) and six PdMYB2R032 -OE Arabidopsis plants (from three independent lines) were subjected to PEG-induced drought stress. Aboveground and root phenotypes were recorded on days 2 and 6 of stress. On day 6, total fresh weight (T-FW) and root fresh weight (R-FW) were measured. For pot-grown plants, leaves from WT and PdMYB2R032 -OE lines were sampled under three conditions: well-watered control (CK), 7-day drought, and 3-day rewatering. Then, the stomatal size of the leaves at the same position was observed under a microscope (Zeiss, Oberkochen, Germany). In addition, on the third day of sowing, the effects of different concentrations of PEG6000 on the seed germination rates of WT and transgenic Arabidopsis were evaluated. Each plate contained 36 WT and 36 PdMYB2R032 -OE seeds; three plates were used per treatment, totaling 108 seeds per genotype. Measurement of Soluble Protein and Malondialdehyde (MDA) Contents Healthy leaves from WT and PdMYB2R032 -OE plants subjected to 7 days of drought stress were sampled to determine soluble protein and MDA contents (three biological replicates per treatment). Soluble protein was measured using the Coomassie brilliant blue G-250 method [ 46 ] , with absorbance at 595 nm recorded by UV-2600A Type UV-Vis Spectrophotometer (Unico, Shanghai, China ). MDA content was assessed following the method of Hou et al . (2020) [ 47 ] , with absorbance measured at 450 nm, 532 nm, and 600 nm to estimate lipid peroxidation. Results Identification and Phylogenetic Analysis of Pd2RMYB Gene Family Members A total of 100 R2R3-MYB genes were identified from the P. deltoides 'I-69' genome and were designated Pd2RMYB1 to Pd2RMYB100 (Table S1). Chromosomal localization revealed that all but Pd2RMYB100 were unevenly distributed across the 19 chromosomes. Chromosome 1 (Chr1) harbored the largest number of genes, while Chr11 and Chr16 each contained only one gene (Fig. 1). Phylogenetic analysis of Pd2RMYBs and R2R3-MYB genes from A. thaliana grouped them into 12 subgroups (Fig. 2). Group 9 contained the largest number of Pd2RMYB members (24), followed by Group 11 (19 members), while Groups 4, 6, and 12 each had only three members. Physicochemical Properties of Pd2RMYB Proteins As summarized in Table S1, Pd2RMYB proteins had an average length of 351 amino acids and an average molecular weight of 39.3 kDa. Their theoretical isoelectric points (pI) ranged from 4.5 (Pd2RMYB63) to 10.09 (Pd2RMYB93). Instability index values varied from 36.68 (Pd2RMYB2) to 71.89 (Pd2RMYB80), with most proteins exceeding the threshold of 40, suggesting they may be unstable. The average aliphatic index was 67.22, and all GRAVY values were below zero, indicating good hydrophilicity. Subcellular localization predictions indicated that all Pd2RMYB proteins were localized to the nucleus, except Pd2RMYB9 and Pd2RMYB58 (Table S2). Gene Family Collinearity and Gene Structure Analysis A total of 57 collinear gene pairs involving 65 Pd2RMYB genes were identified by the collinearity analysis of the Pd2R-MYB gene family ,which have undergone whole-genome duplication (WGD) or segmental duplication events (Table S3, Fig. 3A). Furthermore, strong collinearity was observed between R2R3-MYB genes of P. deltoides and A. thaliana , while weaker collinearity was found with the monocot O. sativa (Fig. 3B). As shown in Fig. S1, most Pd2RMYB genes (86%) contained 2–3 exons. Eleven genes had only one exon, while three genes had more than three. The fact that approximately 80% of Pd2RMYB proteins contained motif1, motif2, and motif3 indicates a high degree of structural conservation among them. All 19 gene members of Group 11 lacked motif1 and motif2 but possessed unique motif4 and motif6, conferring a subgroup-specific structure that clearly distinguishes them from other subgroups. Cis -Element and GO Functional Annotation analysis Cis -element analysis in the 2,000 bp upstream promoter regions identified various regulatory elements (Table S4, Fig. 4A), including light-responsive elements (e.g., GT1-motif, G-box, TCT-motif), ABA-responsive elements (ABRE), MeJA-responsive elements (CGTCA-motif, TGACG-motif), and ethylene-responsive elements (AuxRR-core, TGA-box). In addition, 46 genes contained drought-responsive MBS elements, and 41 contained low-temperature responsive LTR motifs. GO annotation revealed that Pd2RMYBs are mainly involved in transcriptional regulation (GO:0140110, GO:0001067) and DNA binding (e.g., GO:0000981) (Fig. 4B). Among 69 genes localized to the nucleus, 39 were associated with hormone responses (e.g., auxin, ABA, MeJA), and several others were related to abiotic stress responses including drought, salt, and osmotic stress (Table S5). Additionally, we randomly selected eight genes and investigated their expression patterns under drought stress using qRT-PCR. The results revealed that Pd2RMYB71 exhibited a significantly downregulated expression pattern under drought stress, while Pd2RMYB18 showed an expression pattern that initially decreased and subsequently increased, and the other six genes all demonstrated an expression pattern characterized by an initial increase followed by a decrease. PdMYB2R032 Protein Structure and Phylogenetic Relationship Secondary structure analysis revealed that PdMYB2R032 protein from P. deltoides × P. euramericana 'Nanlin895' was mainly composed of random coils (56.84%) and alpha helices (29.82%) (Fig. 5A), along with a smaller proportion of extended strands (7.72%) and beta turns (5.61%) (Fig. 5B). Phylogenetic analysis indicated that PdMYB2R032 shared the highest homology with Pd2RMYB21 (EVM05107.T1) in P. deltoides , and clustered closely with other Populus species (Fig. 5C). Transformation of PdMYB2R032 into Y east C ells and Arabidopsis thaliana We preliminarily investigated the drought tolerance of PdMYB2R032 using yeast cells. The results showed that both pGBKT7 control and pGBKT7-PdMYB2R032 transgenic yeast exhibited some degree of growth inhibition under drought stress (10% and 30% PEG). However, under drought conditions, the viability of pGBKT7- PdMYB2R032 transformed yeast cells was higher than that of the pGBKT7 control (Fig. 5D). To further validate the function of this gene, we overexpressed PdMYB2R032 in A. thaliana . Transgenic validation confirmed successful integration and stable expression of PdMYB2R032 in Arabidopsis , with three transgenic lines obtained. (Fig. 5E). PdMYB2R032 Enhances Biomass Accumulation and Alleviates Drought-Induced Damage in Arabidopsis Under different PEG6000 concentrations, PdMYB2R032 -OE Arabidopsis lines exhibited enhanced growth with larger leaves and more lateral roots compared to wild-type (WT) plants (Fig. 6A–B). Both total and root fresh weight initially increased and then decreased with increasing PEG concentrations. Importantly, biomass accumulation under drought stress was significantly higher in PdMYB2R032 -OE lines than in WT (Fig. 6C–D). Additionally, PdMYB2R032 -OE lines exhibited significantly lower malondialdehyde (MDA) levels than WT (~60% of WT) (Fig. 6E). PdMYB2R032 Regulates Stomatal Closure and Promotes Seed Germination Under drought conditions, three PdMYB2R032 -OE lines exhibited clear stomatal closure, which was reversed after rehydration, whereas stomatal apertures in WT plants remained largely unchanged (Fig. 7A–B). Seed germination rates of OE lines were consistently higher than WT under both normal and drought conditions (Fig. 7C–D), suggesting that PdMYB2R032 promotes drought-resilient germination. Furthermore, PdMYB2R032 -OE plants bolted, flowered, and set seed earlier than WT, significantly shortening the vegetative phase (Fig. 8). Discussion Drought is one of the most common and devastating natural disasters worldwide. Severe drought events can lead to widespread tree mortality, thereby impeding sustainable human life and economic development [ 48 ] . In response to water-deficient conditions, plants rely on complex molecular regulatory mechanisms to maintain physiological stability and adapt to environmental changes 4 . Among numerous stress-responsive factors, the R2R3-MYB transcription factor family, due to its large number of members, conserved structure, and involvement in multiple signaling pathways, plays a key role in abiotic stress adaptation 1 . To date, R2R3-MYB genes have been identified in several woody species, including Eucalyptus grandis [ 49 ] , Malus domestica [ 50 ] , Cinnamomum camphora [ 51 ] , Camellia sinensis [ 52 ] , Vitis vinifera [ 53 ] , and Populus trichocarpa [ 54 ] . Zhuang et al . (2021) [ 55 ] characterized the MYB gene family in P. deltoides ‘WV94’, and Bai et al . (2021) [ 56 ] achieved chromosome-level genome assembly of P. deltoides ‘I-69’ using Nanopore sequencing and Hi-C technology, providing valuable genomic resources for candidate gene mining related to abiotic stress in poplars. In the present study, we identified 100 members of the PdMYB2Rs gene family in P. deltoides ‘I-69’. Phylogenetic analysis grouped these genes and A. thaliana R2R3-MYB genes into 12 subgroups. Genes within the same subgroup displayed conserved structures, laying a foundation for understanding the genetic basis of drought tolerance in poplar and other plant species. Gene duplication events are known to occur widely in the evolutionary history of angiosperms [ 57 ] . Previous studies have shown that whole-genome duplication (WGD) and segmental duplication are major drivers of gene family expansion and are particularly prominent in poplar genome evolution [ 58,59 ] . Our findings revealed extensive WGD events within the Pd2RMYB family, consistent with the results of Wu et al . (2022) [ 60 ] , suggesting that such duplication events have contributed significantly to gene family expansion and the acquisition of novel functions that enhance environmental adaptability [ 61 ] . Furthermore, synteny analysis showed stronger collinearity between P. deltoides and the dicotyledonous A. thaliana than with the monocotyledonous O. sativa , indicating higher homology [ 62 ] and suggesting that some Pd2RMYB genes may function similarly to their A. thaliana counterparts in drought response. Yang et al . (2021a) [ 54 ] identified 196 R2R3-MYB genes in P. trichocarpa and detected cis -acting regulatory elements (CREs) associated with development, light response, phytohormone response, and environmental stress within their promoter regions. Consistent with previous findings, our study also detected these categories of CREs within the 2 kb upstream regions of Pd2RMYB genes, including GT1-motif, G-box, ABRE, and MBS. These elements reflect the functional diversity of the Pd2RMYB family [ 63 ] and serve as key components in regulatory networks under stress conditions [ 64 ] . GO analysis, combined with previous studies, suggests that Pd2RMYBs are involved in hormone signaling pathways [ 1 ] , responses to drought and salt stress [ 21,65 ] , transcriptional regulation, and primary metabolic processes [ 66 ] . These studies indicate that members of this gene family play crucial roles in environmental stress responses. In fact, after identifying the candidate gene, further functional validation is necessary to elucidate the complete regulatory mechanism of the gene under stress conditions [ 20 ] . To this end, we conducted a functional exploration of the R2R3-MYB gene— PdMYB2R032 [ 37 ] , which has been previously identified as potentially involved in drought stress. Our study found that the protein encoded by this gene shares the highest homology with the P. deltoides ‘I-69’ Pd2RMYB21(EVM05107.T1) protein, suggesting potential similarities in their structure and function [ 67 ] . Furthermore, we observed that the overexpression of the PdMYB2R032 gene under drought stress promotes root growth in Arabidopsis , leading to an increase in lateral root production. Conversely, it reduces the stomatal aperture of the leaves, further demonstrating that this gene optimizes root structure to maintain normal growth and development of plants under environmental stress, such as improved water and nutrient use efficiency [ 23,68 ] . Indeed, plants facing adversity reduce water loss by closing their stomata to minimize leaf transpiration, thereby maintaining normal water balance under drought conditions and enhancing their drought tolerance [ 69,70 ] . This has also been confirmed in the present study, which illustrates that the PdMYB2R032 gene enhances drought tolerance in Arabidopsis by regulating root development and stomatal movement. Apart from their underground root systems, the development of aboveground plant parts, such as flowering and fruiting, often reflects environmental sensitivity during the developmental process more intuitively [ 71 ] . This study also found that the PdMYB2R032 gene can advance the flowering and fruiting times of transgenic plants, enabling Arabidopsis to transition from vegetative to reproductive growth earlier. This may be attributed to tissue-specific responses induced by the transgene, such as enhanced root growth and stomatal closure, which alter intracellular signal transduction and ultimately lead to earlier flowering or growth inhibition [ 4 ] . Our study found that the PdMYB2R032 gene can promote the germination of Arabidopsis seeds under both normal watering and drought conditions. Previous studies have reported that the Arabidopsis AtMYB5 gene, homologous to PdMYB2R032 , regulates seed coat development, and the differentiation of the seed coat may potentially influence the seed's ability to absorb water and germinate [ 72,73 ] . Therefore, we speculate that the overexpression of PdMYB2R032 may enhance the seeds' ability to absorb more water from the culture medium, which is beneficial for the development and germination of Arabidopsis seeds. In addition, drought stress also leads to excessive accumulation of reactive oxygen species (ROS), disrupting ROS homeostasis and causing oxidative damage through the generation of malondialdehyde (MDA), which harms proteins, lipids, and carbohydrates [ 74,75 ] . Proanthocyanidins (PAs), a class of flavonoids, are efficient non-enzymatic antioxidants involved in ROS scavenging and the suppression of lipid peroxidation [ 76,77 ] . Notably, PtoMYB115 , a homolog of PdMYB2R032 in P. tomentosa , can interact with the bHLH transcription factor TT8 to regulate PA biosynthetic genes such as ANR1 and LAR3 [ 38,78 ] . Likewise, AtMYB5 in Arabidopsis modulates heat shock factor HSFA2 expression through cooperation with TT2, TT8, and TTG1 within the MBW complex, mediating responses to multiple environmental stresses [ 41 ] . In our study, transgenic lines overexpressing PdMYB2R032 exhibited significantly lower MDA levels under drought stress, indicating that the gene enhances drought tolerance by reducing oxidative damage [ 17,79 ] . Based on these findings and previous reports [ 80,81 ] , we speculate that PAs may play a central role in this process. Nonetheless, it remains ambiguous whether this gene is involved in the plant's response to drought stress through the modulation of PAs or other flavonoid biosynthetic pathways, as well as its cooperative regulatory interactions with various transcription factors or drought-responsive genes both upstream and downstream. We intend to conduct comprehensive transcriptomic and metabolomic analyses in subsequent investigations to clarify the gene-metabolite network. Concurrently, we will implement yeast two-hybrid (Y2H) and chromatin immunoprecipitation (ChIP) methodologies to identify and validate its target gene interactions, with the objective of effectively translating our research outcomes into precise molecular breeding strategies for poplar and related species. Conclusions In this study, a total of 100 R2R3-MYB gene family members were identified in P . deltoides ‘I-69’ and classified into 12 subgroups. Their encoded proteins exhibited instability and hydrophilicity in physicochemical properties, along with structural conservation. Evolutionary analysis revealed that 57 duplicated R2R3-MYB gene pairs in this family were influenced by whole-genome duplication (WGD) or segmental duplication events. Furthermore, stronger collinearity was observed between members of this family and their homologous genes in Arabidopsis . Cis -acting element prediction combined with GO annotations suggested that Pd2RMYBs may be involved in primary metabolic regulation, gene expression control, phytohormone signaling, and responses to abiotic stresses such as drought and salinity. Preliminary studies had suggested that PdMYB2R032 might confer drought tolerance to yeast cells. Consistent with this, functional characterization revealed its role as a positive regulator of drought stress, as its overexpression in Arabidopsis ultimately enhanced drought tolerance by promoting root growth, increasing biomass, reducing stomatal aperture, lowering MDA levels, and accelerating seed germination.. Although this study offers preliminary insight into the molecular mechanism of Pd2RMYB032 in drought stress through genome-wide family analysis, its interacting transcription factors/proteins and the downstream molecular regulatory network remain unknown. Further in-depth analysis is required in this area to establish a more comprehensive theoretical foundation for molecular breeding in poplar. Declarations Acknowledgements Not applicable. Authors’ contributions QJ.H, Y.C, CG.L: conceptualization, resources; Y.C, XL.Z, S.Z and JS.L: methodology, visualization. XL.Z, N.L, CC.G, FF.L and JM.S: formal analysis, investigation. XL-Z: data curation. XL.Z and CG.L: writing - original draft. QJ.H, JH.L, CG.L and N.L: writing - review & editing. QJ.H, CG.L and S.Z: supervision. QJ-H: funding acquisition. All authors read and approved of the final manuscript. Funding This study was financially supported by the National Key Research and Development Project during the 14th Five-Year Plan Period (2022YFD2200301). Availability of data and materials All data generated or analyzed during this study are included in this article and supplementary information files. Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. References Ambawat S, Sharma P, Yadav NR, Yadav RC. MYB transcription factor genes as regulators for plant responses: an overview. Physiol Mol Biol Plants: Int J Funct Plant Biol . 2013;19(3):307-321. doi:10.1007/s12298-013-0179-1 Barbeta A, Mejía-Chang M, Ogaya R, Voltas J, Dawson TE, Peñuelas J. The combined effects of a long-term experimental drought and an extreme drought on the use of plant-water sources in a mediterranean forest. Global Change Biol . 2015;21(3):1213-1225. doi:10.1111/gcb.12785 Yu D, Janz D, Zienkiewicz K, et al. Wood formation under severe drought invokes adjustment of the hormonal and transcriptional landscape in poplar. Int J Mol Sci . 2021;22(18):9899. doi:10.3390/ijms22189899 Gupta A, Rico-Medina A, Caño-Delgado AI. The physiology of plant responses to drought. Sci ence . 2020;368(6488):266-269. doi:10.1126/science.aaz7614 Zhou Y, Zhang Y, Wang X, et al. Root-specific NF-Y family transcription factor, PdNF-YB21, positively regulates root growth and drought resistance by abscisic acid-mediated indoylacetic acid transport in populus . New Phytol . 2020;227(2):407-426. doi:10.1111/nph.16524 Xiong Y, Song X, Mehra P, et al. ABA-auxin cascade regulates crop root angle in response to drought. Curr biol: CB . 2025;35(3):542-553.e4. doi:10.1016/j.cub.2024.12.003 Bondaruk VF, Xu C, Wilfahrt P, et al. Aridity modulates grassland biomass responses to combined drought and nutrient addition. Nat Ecol Evol . 2025;9(6):937-946. doi:10.1038/s41559-025-02705-8 Guo H, Zhang J, Kang X, Yu C, He N. Aridity‐driven non‐linear shift of plant sodium allocation strategy at regional and global scales. Global Ecol Biogeogr . 2025;34(3). doi:10.1111/geb.70025 Feng Z, Li H, Sun Z, et al. ZmGCT1/2 negatively regulate drought tolerance in maize by inhibiting ZmSLAC1 to maintain guard cell turgor. PNAS . 2025;122(15):e2423037122. doi:10.1073/pnas.2423037122 Mengoli G, Harrison SP, Prentice IC. The response of carbon uptake to soil moisture stress: adaptation to climatic aridity. Global Change Biol . 2025;31(3):e70098. doi:10.1111/gcb.70098 Chang Y, Fang Y, Liu J, et al. Stress-induced nuclear translocation of ONAC023 improves drought and heat tolerance through multiple processes in rice. Nat Commun . 2024;15(1):5877. doi:10.1038/s41467-024-50229-9 Xu X, Liu H, Praat M, et al. Stomatal opening under high temperatures is controlled by the OST1-regulated TOT3-AHA1 module. Nat Plants . 2025;11(1):105-117. doi:10.1038/s41477-024-01859-w Hussain Q, Asim M, Zhang R, Khan R, Farooq S, Wu J. Transcription factors interact with ABA through gene expression and signaling pathways to mitigate drought and salinity stress. Biomolecules . 2021;11(8):1159. doi:10.3390/biom11081159 Henley MJ, Koehler AN. Advances in targeting “undruggable” transcription factors with small molecules. Nat Rev Drug Discov . 2021;20(9):669-688. doi:10.1038/s41573-021-00199-0 Guo Y, Guo Z, Zhong J, et al. Positive regulatory role of R2R3 MYBs in terpene biosynthesis in lilium ‘siberia.’ Horticultural Plant J . 2023;9(5):1024-1038. doi:10.1016/j.hpj.2023.05.004 Wu Y, Wen J, Xia Y, Zhang L, Du H. Evolution and functional diversification of R2R3-MYB transcription factors in plants. Hortic Res . 2022;9:uhac058. doi:10.1093/hr/uhac058 Zhang HC, Gong YH, Tao T, et al. Genome-wide identification of R2R3-MYB transcription factor subfamily genes involved in salt stress in rice ( oryza sativa L.). BMC Genomics . 2024;25(1):797. doi:10.1186/s12864-024-10693-5 Zhao K, Cheng Z, Guo Q, et al. Characterization of the poplar R2R3-MYB gene family and over-expression of PsnMYB108 confers salt tolerance in transgenic tobacco. Front Plant Sci . 2020;11:571881. doi:10.3389/fpls.2020.571881 Zhu N, Duan B, Zheng H, et al. An R2R3 MYB gene GhMYB3 functions in drought stress by negatively regulating stomata movement and ROS accumulation. Plant physiol biochem: PPB . 2023;197:107648. doi:10.1016/j.plaphy.2023.107648 Zhang D, Zhou H, Zhang Y, et al. Diverse roles of MYB transcription factors in plants. J Integr Plant Biol . 2025;67(3):539-562. doi:10.1111/jipb.13869 Baldoni E, Genga A, Cominelli E. Plant MYB transcription factors: their role in drought response mechanisms. Int J Mol Sci . 2015;16(7):15811-15851. doi:10.3390/ijms160715811 Wan J, Wang R, Zhang P, et al. MYB70 modulates seed germination and root system development in A rabidopsis . iScience . 2021;24(11):103228. doi:10.1016/j.isci.2021.103228 Seo PJ, Xiang F, Qiao M, et al. The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in A rabidopsis . Plant Physiol . 2009;151(1):275-289. doi:10.1104/pp.109.144220 Xu C, Fu X, Liu R, et al. PtoMYB170 positively regulates lignin deposition during wood formation in poplar and confers drought tolerance in transgenic A rabidopsis . Tree Physiol . 2017;37(12):1713-1726. doi:10.1093/treephys/tpx093 Liang YK, Dubos C, Dodd IC, Holroyd GH, Hetherington AM, Campbell MM. AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in A rabidopsis thaliana . Curr Biol . 2005;15(13):1201-1206. doi:10.1016/j.cub.2005.06.041 Qin Y, Wang M, Tian Y, He W, Han L, Xia G. Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in A rabidopsis . Mol Biol Rep . 2012;39(6):7183-7192. doi:10.1007/s11033-012-1550-y Long T, Yang F, Chen Z, et al. Overexpression of PtoMYB99 diminishes poplar tolerance to osmotic stress by suppressing ABA and JA biosynthesis. J Plant Physiol . 2024;292:154149. doi:10.1016/j.jplph.2023.154149 Kong X, Chen Y, Li H, et al. Dissociation of transcription factor MYB94 and histone deacetylases HDA907/908 alleviates oxidative damage in poplar. Plant Physiol . 2024;196(1):181-194. doi:10.1093/plphys/kiae325 Dietz KJ, Vogelsang L. A general concept of quantitative abiotic stress sensing. Trends Plant Sci . 2024;29(3):319-328. doi:10.1016/j.tplants.2023.07.006 Raza A, Li Y, Prakash CS, Hu Z. Panomics to manage combined abiotic stresses in plants. Trends Plant Sci . Published online March 26, 2025:S1360-1385(25)00061-5. doi:10.1016/j.tplants.2025.03.001 Shi T, Zhang X, Hou Y, et al. The super-pangenome of populus unveils genomic facets for its adaptation and diversification in widespread forest trees. Mol Plant . 2024;17(5):725-746. doi:10.1016/j.molp.2024.03.009 Zhou Z, Zhang H, Bian L, Zhou L, Ge Y. Integrating sensor fusion with machine learning for comprehensive assessment of phenotypic traits and drought response in poplar species. Plant Biotechnol J . 2025;23(7):2464-2481. doi:10.1111/pbi.70039 Niu MX, Feng CH, He F, et al. The miR6445-NAC029 module regulates drought tolerance by regulating the expression of glutathione S-transferase U23 and reactive oxygen species scavenging in P opulus . New Phytol . 2024;242(5):2043-2058. doi:10.1111/nph.19703 Wang J, Rousseau RJ, Himes A, Siegert C, Ouyang Y, Renninger HJ. Migrating P opulus with climate change: Phenology, coppice management, cold spell susceptibility, leaf dynamics, and biomass production. Forest Ecosystems . 2025;14:100343. doi:10.1016/j.fecs.2025.100343 Jin Z, Li P, Huang R, et al. Natural variation in PtobZIP18 confers the trade-off between stem growth and drought tolerance in populus. Plant Biotechnol J . Published online July 13, 2025. doi:10.1111/pbi.70261 Fang Y, Wang D, Xiao L, et al. Allelic variation in transcription factor PtoWRKY68 contributes to drought tolerance in P opulus . Plant Physiol . 2023;193(1):736-755. doi:10.1093/plphys/kiad315 Zhang X, Wang H, Chen Y, Huang M, Zhu S. Comprehensive genome-wide analyses of poplar R2R3-MYB transcription factors and tissue-specific expression patterns under drought stress. Int J Mol Sci . 2023;24(6):5389. doi:10.3390/ijms24065389 Wang L, Ran L, Hou Y, et al. The transcription factor MYB115 contributes to the regulation of proanthocyanidin biosynthesis and enhances fungal resistance in poplar. New Phytol . 2017;215(1):351-367. doi:10.1111/nph.14569 Dabravolski SA, Isayenkov SV. The role of anthocyanins in plant tolerance to drought and salt stresses. Plants . 2023;12(13):2558. doi:10.3390/plants12132558 Li Z, Ahammed GJ. Hormonal regulation of anthocyanin biosynthesis for improved stress tolerance in plants. Plant physiol biochem . 2023;201:107835. doi:10.1016/j.plaphy.2023.107835 Jacob P, Brisou G, Dalmais M, et al. The seed development factors TT2 and MYB5 regulate heat stress response in A rabidopsis . Genes . 2021;12(5):746. doi:10.3390/genes12050746 Stracke R, Werber M, Weisshaar B. The R2R3-MYB gene family in A rabidopsis thaliana . Curr Opin Plant Biol . 2001;4(5):447-456. doi:10.1016/s1369-5266(00)00199-0 Wang J, Chitsaz F, Derbyshire MK, et al. The conserved domain database in 2023. Nucleic Acids Res . 2023;51(D1):D384-D388. doi:10.1093/nar/gkac1096 Letunic I, Khedkar S, Bork P. SMART: recent updates, new developments and status in 2020. Nucleic Acids Res . 2021;49(D1):D458-D460. doi:10.1093/nar/gkaa937 van der Weele CM, Spollen WG, Sharp RE, Baskin TI. Growth of A rabidopsis thaliana seedlings under water deficit studied by control of water potential in nutrient-agar media. J Exp Bot . 2000;51(350):1555-1562. doi:10.1093/jexbot/51.350.1555 Georgiou CD, Grintzalis K, Zervoudakis G, Papapostolou I. Mechanism of Coomassie brilliant blue G-250 binding to proteins: a hydrophobic assay for nanogram quantities of proteins. Anal Bioanal Chem . 2008;391(1):391-403. doi:10.1007/s00216-008-1996-x Hou L, Yu J, Zhao L, He X. Dark septate endophytes improve the growth and the tolerance of M edicago sativa and A mmopiptanthus mongolicus under cadmium stress. Front Microbiol . 2019;10:3061. doi:10.3389/fmicb.2019.03061 Gebrechorkos SH, Sheffield J, Vicente-Serrano SM, et al. Warming accelerates global drought severity. Nature . 2025;642(8068):628-635. doi:10.1038/s41586-025-09047-2 Soler M, Camargo ELO, Carocha V, et al. The eucalyptus grandis R2R3-MYB transcription factor family: evidence for woody growth-related evolution and function. New Phytol . 2015;206(4):1364-1377. doi:10.1111/nph.13039 Jia D, Wu P, Shen F, et al. Genetic variation in the promoter of an R2R3-MYB transcription factor determines fruit malate content in apple ( M alus domestica borkh.). Plant Physiol . 2021;186(1):549-568. doi:10.1093/plphys/kiab098 Luan X, Xu W, Zhang J, et al. Genome-scale identification, classification, and expression profiling of MYB transcription factor genes in C innamomum camphora . Int J Mol Sci . 2022;23(22):14279. doi:10.3390/ijms232214279 Chen X, Wang P, Gu M, et al. R2R3-MYB transcription factor family in tea plant ( C amellia sinensis ): genome-wide characterization, phylogeny, chromosome location, structure and expression patterns. Genomics . 2021;113(3):1565-1578. doi:10.1016/j.ygeno.2021.03.033 Matus JT, Aquea F, Arce-Johnson P. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across V itis and A rabidopsis genomes. BMC Plant Biol . 2008;8:83. doi:10.1186/1471-2229-8-83 Yang X, Guo T, Li J, Chen Z, Guo B, An X. Genome-wide analysis of the MYB-related transcription factor family and associated responses to abiotic stressors in P opulus . Int J Biol Macromol . 2021;191:359-376. doi:10.1016/j.ijbiomac.2021.09.042 Zhuang W, Shu X, Lu X, et al. Genome-wide analysis and expression profiles of PdeMYB transcription factors in colored-leaf poplar ( P opulus deltoids ). BMC Plant Biol . 2021;21(1):432. doi:10.1186/s12870-021-03212-1 Bai S, Wu H, Zhang J, et al. Genome assembly of salicaceae P opulus deltoides (eastern cottonwood) I-69 based on nanopore sequencing and hi-C technologies. J Hered . 2021;112(3):303-310. doi:10.1093/jhered/esab010 Zhang T, Huang W, Zhang L, Li DZ, Qi J, Ma H. Phylogenomic profiles of whole-genome duplications in poaceae and landscape of differential duplicate retention and losses among major poaceae lineages. Nat Commun . 2024;15(1):3305. doi:10.1038/s41467-024-47428-9 Feng X, Chen Q, Wu W, et al. Genomic evidence for rediploidization and adaptive evolution following the whole-genome triplication. Nat Commun . 2024;15(1):1635. doi:10.1038/s41467-024-46080-7 Zhou F, Chen Y, Wu H, Yin T. Genome-wide comparative analysis of R2R3 MYB gene family in P opulus and S alix and identification of Male flower bud development-related genes. Front Plant Sci . 2021;12:721558. doi:10.3389/fpls.2021.721558 Wu Y, Wen J, Xia Y, Zhang L, Du H. Evolution and functional diversification of R2R3-MYB transcription factors in plants. Hortic Res . 2022;9. doi:10.1093/hr/uhac058 Wu W, Zhu S, Zhu L, et al. Characterization of the L iriodendron chinense MYB gene family and its role in abiotic stress response. Front Plant Sci . 2021;12:641280. doi:10.3389/fpls.2021.641280 Tang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH. Synteny and collinearity in plant genomes. Sci ence . 2008;320(5875):486-488. doi:10.1126/science.1153917 Yang X, Li J, Guo T, Guo B, Chen Z, An X. Comprehensive analysis of the R2R3-MYB transcription factor gene family in P opulus trichocarpa . Ind Crops Prod . 2021;168:113614. doi:10.1016/j.indcrop.2021.113614 Staut J, Pérez NM, Ferrando AM, Dissanayake I, Vandepoele K. A map of integrated cis-regulatory elements enhances gene-regulatory analysis in maize. Plant Commun . 2025;6(7):101376. doi:10.1016/j.xplc.2025.101376 Roy S. Function of MYB domain transcription factors in abiotic stress and epigenetic control of stress response in plant genome. Plant Signaling Behav . 2016;11(1):e1117723. doi:10.1080/15592324.2015.1117723 Li J, Han G, Sun C, Sui N. Research advances of MYB transcription factors in plant stress resistance and breeding. Plant Signaling Behav . 2019;14(8):1613131. doi:10.1080/15592324.2019.1613131 Han X, Li J, Li G, et al. Rapid formation of stable autotetraploid rice from genome-doubled F1 hybrids of japonica-indica subspecies. Nat Plants . 2025;11(4):743-760. doi:10.1038/s41477-025-01966-2 Zhang Y, Wu X, Wang X, Dai M, Peng Y. Crop root system architecture in drought response. J Genet Genom . 2025;52(1):4-13. doi:10.1016/j.jgg.2024.05.001 Cominelli E, Galbiati M, Vavasseur A, et al. A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. Curr biol: CB . 2005;15(13):1196-1200. doi:10.1016/j.cub.2005.05.048 Haghpanah M, Hashemipetroudi S, Arzani A, Araniti F. Drought tolerance in plants: physiological and molecular responses. Plants . 2024;13(21):2962. doi:10.3390/plants13212962 Li W, Migliavacca M, Forkel M, et al. Widespread increasing vegetation sensitivity to soil moisture. Nat Commun . 2022;13(1):3959. doi:10.1038/s41467-022-31667-9 Gonzalez A, Mendenhall J, Huo Y, Lloyd A. TTG1 complex MYBs, MYB5 and TT2, control outer seed coat differentiation. Dev Biol . 2009;325(2):412-421. doi:10.1016/j.ydbio.2008.10.005 Li SF, Milliken ON, Pham H, et al. The A rabidopsis MYB5 transcription factor regulates mucilage synthesis, seed coat development, and trichome morphogenesis. Plant Cell . 2009;21(1):72-89. doi:10.1105/tpc.108.063503 Cruz de Carvalho MH. Drought stress and reactive oxygen species: production, scavenging and signaling. Plant Signaling Behav . 2008;3(3):156-165. doi:10.4161/psb.3.3.5536 Gill SS, Tuteja N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant physiol biochem . 2010;48(12):909-930. doi:10.1016/j.plaphy.2010.08.016 Bogs J, Downey MO, Harvey JS, Ashton AR, Tanner GJ, Robinson SP. Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves. Plant Physiol . 2005;139(2):652-663. doi:10.1104/pp.105.064238 Lu N, Rao X, Li Y, Jun JH, Dixon RA. Dissecting the transcriptional regulation of proanthocyanidin and anthocyanin biosynthesis in soybean ( G lycine max ). Plant Biotechnol J . 2021;19(7):1429-1442. doi:10.1111/pbi.13562 James AM, Ma D, Mellway R, et al. Poplar MYB115 and MYB134 transcription factors regulate proanthocyanidin synthesis and structure. Plant Physiol . 2017;174(1):154-171. doi:10.1104/pp.16.01962 Zhao L, Ma X, Ma W, et al. MsPYL6 and MsPYL9 improves drought tolerance by regulating stomata in alfalfa ( M edicago sativa ). Plant J: Cell Mol Biol . 2025;122(6):e70265. doi:10.1111/tpj.70265 Li D, Yang J, Pak S, et al. PuC3H35 confers drought tolerance by enhancing lignin and proanthocyanidin biosynthesis in the roots of P opulus ussuriensis . New Phytol . 2022;233(1):390-408. doi:10.1111/nph.17799 Xu Q, Fu Q, Li Z, et al. The flavonoid procyanidin C1 has senotherapeutic activity and increases lifespan in mice. Nat Metab . 2021;3(12):1706-1726. doi:10.1038/s42255-021-00491-8 Additional Declarations No competing interests reported. Supplementary Files Supplementarytables1.xlsx Table S1. Physicochemical property analysis of Pd2RMYB proteins. Table S2. Subcellular localization prediction of Pd2RMYB proteins. Table S3. Pd2RMYB gene pairs with collinearity. Table S4. The main cis-acting elements of Pd2RMYB genes. Table S5. GO function annotation of Pd2RMYB. FigureS1.tif Fig. S1 Gene structure and conserved motif analysis. Cite Share Download PDF Status: Published Journal Publication published 31 Jan, 2026 Read the published version in BMC Plant Biology → Version 1 posted Editorial decision: Revision requested 23 Dec, 2025 Reviews received at journal 23 Dec, 2025 Reviews received at journal 22 Dec, 2025 Reviews received at journal 18 Dec, 2025 Reviews received at journal 07 Dec, 2025 Reviewers agreed at journal 05 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers agreed at journal 04 Dec, 2025 Reviewers invited by journal 04 Dec, 2025 Editor assigned by journal 04 Dec, 2025 Editor invited by journal 26 Nov, 2025 Submission checks completed at journal 25 Nov, 2025 First submitted to journal 25 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8045203","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":555832060,"identity":"a3503ce2-350e-4d6e-82d8-615cebec1371","order_by":0,"name":"Xueli Zhang","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Xueli","middleName":"","lastName":"Zhang","suffix":""},{"id":555832061,"identity":"2a197bb5-c3c4-461d-9870-ca3d4a828d8c","order_by":1,"name":"Ying Chen","email":"","orcid":"","institution":"Key Laboratory of Forest Genetics and Biotechnology, Ministry of Education of China, Co-Innovation Center for the Sustainable Forestry in Southern China, Nanjing Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Chen","suffix":""},{"id":555832062,"identity":"f3aa1368-7b12-49bd-a0b3-6c0f85e6d320","order_by":2,"name":"Sheng Zhu","email":"","orcid":"","institution":"College of Biology and the Environment, Nanjing Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Sheng","middleName":"","lastName":"Zhu","suffix":""},{"id":555832063,"identity":"826b20ce-2a08-45bb-acf7-527cf9babc7c","order_by":3,"name":"Ning Liu","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Liu","suffix":""},{"id":555832064,"identity":"32189da0-3106-4830-b1bb-c91c729274c8","order_by":4,"name":"Jinshu Li","email":"","orcid":"","institution":"Key Laboratory of Forest Genetics and Biotechnology, Ministry of Education of China, Co-Innovation Center for the Sustainable Forestry in Southern China, Nanjing Forestry University","correspondingAuthor":false,"prefix":"","firstName":"Jinshu","middleName":"","lastName":"Li","suffix":""},{"id":555832065,"identity":"2e99239d-4a0c-4f39-9ec2-cc28d69a0f1d","order_by":5,"name":"Fenfen Liu","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Fenfen","middleName":"","lastName":"Liu","suffix":""},{"id":555832066,"identity":"a51171df-a07d-49b3-a1d6-048bd7949ddc","order_by":6,"name":"Chengcheng Gao","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Chengcheng","middleName":"","lastName":"Gao","suffix":""},{"id":555832067,"identity":"6cbc2495-f84e-4b44-b8d8-42e3181c77ca","order_by":7,"name":"Jinhua Li","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Jinhua","middleName":"","lastName":"Li","suffix":""},{"id":555832068,"identity":"f50a877d-40dc-4bb7-afc0-4f7bbc7b996a","order_by":8,"name":"Jimeng Sun","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Jimeng","middleName":"","lastName":"Sun","suffix":""},{"id":555832069,"identity":"7e179c31-c16c-47c3-85ea-d637ade8d0cd","order_by":9,"name":"Qinjun Huang","email":"","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":false,"prefix":"","firstName":"Qinjun","middleName":"","lastName":"Huang","suffix":""},{"id":555832070,"identity":"91a83d77-eb40-4cc4-ab0f-c808f9960114","order_by":10,"name":"Chenggong Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYBACPmYwZcHADyQ/EKWFDaJFgkGygYFxBnFaGKBaDA4QrYWdx/Dj1zYJ2c3HDz9sYKixY+Cf3UDIYTzG0rJtEsbbzqQZNjAcS2aQuHOAoBYzZsltEonbbjCYP2BgO8BgIJFApJbNM9g/NjD8I1IL40eglg0SPIYNjG1EaWErlmb8J2E840xOYUNiXzKPxA0CWvj5D2/8+OOMjWx/+/GNDR++2cnxzyCgBQSYeRgYGBtALKBiHsLqgYDxB0zLKBgFo2AUjAJsAACeBzqCIRb4+AAAAABJRU5ErkJggg==","orcid":"","institution":"State Key Laboratory of Tree Genetics and Breeding, Research Institute of Forestry, Chinese Academy of Forestry","correspondingAuthor":true,"prefix":"","firstName":"Chenggong","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-11-06 07:53:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8045203/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8045203/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12870-026-08191-9","type":"published","date":"2026-01-31T15:58:53+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":97712693,"identity":"e2295c78-a7cc-4d97-b8a0-2894bd7a2367","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1055599,"visible":true,"origin":"","legend":"\u003cp\u003eChromosomal location of \u003cem\u003ePd2RMYBs.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/d6fed3db1f3f6c3af38974d1.png"},{"id":97712696,"identity":"eec56dd2-782c-447b-b55d-dd844612481a","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5429076,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of \u003cem\u003eR2R3-MYB\u003c/em\u003e genes in \u003cem\u003eP. deltoides\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e.\u003cstrong\u003e \u003c/strong\u003eThe twelve subgroups are marked with branches of different colors. Blue dots represent \u003cem\u003ePd2RMYB\u003c/em\u003e genes from \u003cem\u003eP. deltoides\u003c/em\u003e, while green dots indicate \u003cem\u003eR2R3-MYB\u003c/em\u003e genes from \u003cem\u003eA. thaliana\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/5663d2361d6afb458b71602a.png"},{"id":97895859,"identity":"de1d7f85-f791-4f04-afe0-a8265f2e32de","added_by":"auto","created_at":"2025-12-10 15:35:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6075985,"visible":true,"origin":"","legend":"\u003cp\u003eIntraspecific and interspecific collinearity of \u003cem\u003eR2R3-MYB\u003c/em\u003e genes. (A) Collinearity analysis of the \u003cem\u003ePd2RMYB\u003c/em\u003e gene family. From outer to inner layers, the circular diagram shows the 19 chromosomes, chromosome density represented by lines, and chromosome density displayed as a heatmap. The gray inner connections indicate intragenomic collinear relationships, with red lines representing collinear \u003cem\u003ePd2RMYB\u003c/em\u003e gene pairs. (B) Interspecific collinearity analysis of \u003cem\u003eR2R3-MYB\u003c/em\u003e genes. From top to bottom, the chromosomes of \u003cem\u003eA. thaliana\u003c/em\u003e, \u003cem\u003eP. deltoides\u003c/em\u003e, and \u003cem\u003eO. sativa\u003c/em\u003e are shown. Blue lines in the center indicate collinear \u003cem\u003eR2R3-MYB\u003c/em\u003egene pairs between \u003cem\u003eP. deltoides\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e/\u003cem\u003eO. sativa\u003c/em\u003e. Red triangles (▽) represent the positions of \u003cem\u003ePd2RMYB\u003c/em\u003e genes on the chromosomes.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/5160981076bf581816dcb7fe.png"},{"id":97712695,"identity":"d0267fe4-5b38-4e05-b9b2-8bbf59392828","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1507481,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eCis\u003c/em\u003e-acting elements and GO annotation. (A) \u003cem\u003eCis\u003c/em\u003e-acting elements of \u003cem\u003ePd2RMYB\u003c/em\u003egenes. The font size of each element label reflects the number of corresponding elements — the larger the font, the greater the number of elements. (B) GO functional annotation of \u003cem\u003ePd2RMYB\u003c/em\u003e genes. The x-axis represents GO terms, and the y-axis indicates the number of genes enriched in each term. BP: Biological Process; MF: Molecular Function; CC: Cellular Component. (C) Heatmap of \u003cem\u003ePd2RMYB\u003c/em\u003e genes expression under drought stress.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/0ee3a878538c9e25c0d1f47b.png"},{"id":97712697,"identity":"7b136066-915b-4232-9a32-0bf4c7c55b9d","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3986816,"visible":true,"origin":"","legend":"\u003cp\u003eStructure of PdMYB2R032 protein, interspecific phylogenetic tree, and construction of overexpression vector. (A) Secondary structure of the PdMYB2R032 protein; (B) Tertiary structure of the\u003cem\u003e \u003c/em\u003ePdMYB2R032 protein; (C) Interspecific phylogenetic tree of the PdMYB2R032 protein; (D) Transcriptional activation of PdMYB2R032 under drought stress; (E) Detection of transgenic \u003cem\u003eA. thaliana\u003c/em\u003eoverexpressing \u003cem\u003ePdMYB2R032\u003c/em\u003e,L1/L2/L3 represent three transgenic \u003cem\u003eArabidopsis thaliana\u003c/em\u003e lines.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/3f25e19486f91765ba2358e3.png"},{"id":97712700,"identity":"f3fd7f73-5ac4-4691-9a84-a0efbc20454f","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":8032951,"visible":true,"origin":"","legend":"\u003cp\u003ePhenotypic and physiological measurements of \u003cem\u003eA. thaliana\u003c/em\u003e under drought stress. (A) Aboveground growth phenotype of \u003cem\u003eA. thaliana\u003c/em\u003e under drought stress. The three plants above the red line are wild-type (WT), and the three below are transgenic plants. (B) Root phenotype of \u003cem\u003eA. thaliana\u003c/em\u003e under drought stress. The three plants to the left of the red line are WT, and the three to the right are transgenic lines, L1/L2/L3 represent three distinct transgenic lines. Each grid measures 1.2 cm × 1.2 cm. (C) Total fresh weight (T-FW) of \u003cem\u003eA. thaliana\u003c/em\u003eafter six days of drought treatment. (D) Root fresh weight (R-FW) of \u003cem\u003eA. thaliana\u003c/em\u003eafter six days of drought treatment. (E) MDA content and soluble protein content in \u003cem\u003eA. thaliana\u003c/em\u003e after 7 consecutive days of water deprivation. ** indicates \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; *** indicates \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; ns indicates no significant difference.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/ada31cde136ae4fa43bd9387.png"},{"id":97712699,"identity":"7ddb91da-ee8a-42d6-8c15-48a85d10c3dd","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":7393632,"visible":true,"origin":"","legend":"\u003cp\u003eStomatal response and seed germination rate of \u003cem\u003eA. thaliana\u003c/em\u003e under drought treatment. (A) Stomatal aperture images of \u003cem\u003eA. thaliana\u003c/em\u003e under drought and rehydration treatments. \"Control\" indicates stomata under normal water conditions; \"Drought\" refers to stomata after 7 consecutive days without watering; \"Rehydration\" represents stomata after 3 days of rewatering. The black scale bar represents 5 μm. (B) Statistical analysis of stomatal aperture under drought and rehydration treatments. (C) Seed germination rates of \u003cem\u003eA. thaliana\u003c/em\u003e under different drought treatments. (D) Seed germination images of \u003cem\u003eA. thaliana\u003c/em\u003e under different drought treatments.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/767dd5870113a565c6c91ffc.png"},{"id":97712701,"identity":"5e6cdf16-9def-4a3c-9918-5f4be1329166","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":10617858,"visible":true,"origin":"","legend":"\u003cp\u003eFlowering and fruiting time of transgenic \u003cem\u003eA. thaliana\u003c/em\u003e. Panels a, b, and c each include three pots of wild-type (WT) plants (bottom row) and three pots of \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE transgenic lines (top row). The growth status of WT and \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE plants was recorded at 12, 17, and 28 days after sowing. The three transgenic plants represent three independent transgenic lines.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/59b79acf292c47c7ef5374e1.png"},{"id":101690533,"identity":"be1b767a-4c38-42d3-828b-e9c76c92dbad","added_by":"auto","created_at":"2026-02-02 16:04:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":43598981,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/259e1207-87af-47c9-8bcb-515af88a259d.pdf"},{"id":97712694,"identity":"ef895c6f-e6cb-47b0-8174-80263773d0b7","added_by":"auto","created_at":"2025-12-08 14:02:55","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":38144,"visible":true,"origin":"","legend":"\u003cp\u003eTable S1. Physicochemical property analysis of Pd2RMYB proteins.\u003c/p\u003e\n\u003cp\u003eTable S2. Subcellular localization prediction of Pd2RMYB proteins.\u003c/p\u003e\n\u003cp\u003eTable S3. \u003cem\u003ePd2RMYB\u003c/em\u003e gene pairs with collinearity.\u003c/p\u003e\n\u003cp\u003eTable S4. The main cis-acting elements of \u003cem\u003ePd2RMYB\u003c/em\u003egenes.\u003c/p\u003e\n\u003cp\u003eTable S5. GO function annotation of Pd2RMYB.\u003c/p\u003e","description":"","filename":"Supplementarytables1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/2b9c2ea2a9cd856634be8a78.xlsx"},{"id":97712723,"identity":"2319bc4d-08b6-434f-8143-b91c688f876f","added_by":"auto","created_at":"2025-12-08 14:03:03","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":246549052,"visible":true,"origin":"","legend":"\u003cp\u003eFig. S1 Gene structure and conserved motif analysis.\u003c/p\u003e","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8045203/v1/81908f10263b8932df18c229.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on the Positive Regulation of Drought Tolerance by PdMYB2R032 Based on R2R3-MYB Gene Family Analysis in Populus deltoides","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFrequent\u0026nbsp;fluctuations in global climate have led to an increasing occurrence and severity of drought events, which pose serious threats to the structure and function of forest ecosystems\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Prolonged drought stress disrupts the water transport system in trees, resulting in crown defoliation, growth decline, or even tree mortality\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e2,3\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. To cope with such stress and threats, plants generally adopt physiological strategies to maintain normal development (e.g., flowering) and ensure productivity\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, such as enhancing root water uptake\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e5,6\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, adjusting nutrient allocation strategies\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e7,8\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, closing stomata\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, and reducing leaf area\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e10\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. In addition to physiological adaptations, plants also activate molecular response mechanisms when sensing abiotic stresses such as drought and heat, which help improve environmental adaptability\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e4,11,12\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Transcription factors (TFs), as key regulatory proteins, participate in the drought stress response through both ABA-dependent and ABA-independent pathways and play vital roles in stress adaptation\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e13\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTFs are sequence-specific DNA-binding proteins that regulate gene expression by binding to specific \u003cem\u003ecis\u003c/em\u003e-acting elements, playing a central role in transcriptional control\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e14,15\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Among them,R2R3-MYB transcription factors constitute the largest subfamily of the MYB superfamily in plants\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e16,17\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. They are widely involved in primary and secondary metabolism, plant development, hormone signaling, and responses to biotic and abiotic stresses, playing essential roles in understanding plant development and deciphering molecular mechanisms underlying environmental adaptation\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e1,18\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. In recent years, the role of \u003cem\u003eR2R3-MYB\u003c/em\u003e genes in regulating drought tolerance has attracted increasing attention\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e15,19,20\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. For example, \u003cem\u003eArabidopsis thaliana\u003c/em\u003e genes \u003cem\u003eAtMYB77\u003c/em\u003e and \u003cem\u003eAtMYB70\u003c/em\u003e promote root development and mediate crosstalk between ABA and IAA signaling, maintaining physiological water balance under drought\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e21,22\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. \u003cem\u003eAtMYB96\u003c/em\u003e and \u003cem\u003ePtoMYB170\u003c/em\u003e promote stomatal closure to reduce water loss\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e23,24\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, while \u003cem\u003eAtMYB61\u003c/em\u003e reduces stomatal aperture and gas exchange to enhance drought tolerance\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e25\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Furthermore, some \u003cem\u003eR2R3-MYB\u003c/em\u003e genes participate in drought responses by modulating hormone levels, osmotic regulators, or antioxidants. For example, \u003cem\u003eTriticum aestivum\u003c/em\u003e \u003cem\u003eTaMYB33\u003c/em\u003e enhances drought tolerance by promoting osmotic balance and ROS scavenging\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e26\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e; \u003cem\u003ePtoMYB99\u003c/em\u003e negatively regulates osmotic stress tolerance by reducing antioxidant enzyme activity\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e27\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e; and \u003cem\u003ePtrMYB94\u003c/em\u003e induces the expression of oxidative stress-related proteins\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. However, most of these studies have focused on herbaceous plants or crops, and reports on perennial woody plants—especially forest trees with long life cycles—remain limited.\u003c/p\u003e\n\u003cp\u003eWith\u0026nbsp;the\u0026nbsp;advancement of molecular biology and genomics, the study of gene regulatory mechanisms in plants under abiotic stress has received growing attention\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e29,30\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. \u003cem\u003ePopulus\u003c/em\u003e spp. are among the most widely distributed and fast-growing tree species globally and play important roles in timber production, energy plantations, and ecological restoration\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Due to its relatively small and well-annotated genome, \u003cem\u003ePopulus\u003c/em\u003e has also become a model species for woody plant studies\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e31\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. However, under the current trend of global warming, drought has become a major limiting factor for poplar growth and adaptability\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e32\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Given the species’ high water demand, its sensitivity to water deficit poses a key constraint for artificial forest development and productivity\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Therefore, elucidating the molecular basis of drought response and identifying key regulatory genes are essential for improving both productivity and ecological resilience in poplar\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e34\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. In recent years, several drought-responsive transcription factors have been reported in poplar, such as \u003cem\u003eP\u003c/em\u003e\u003cem\u003ert\u003c/em\u003e\u003cem\u003eNAC\u003c/em\u003e\u003cem\u003e029\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, \u003cem\u003ePtobZIP18\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e35\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, and \u003cem\u003ePtoWRKY68\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Nevertheless, compared to herbaceous plants, the functional characterization of drought-responsive genes in poplar remains limited, particularly for \u003cem\u003eR2R3-MYB\u003c/em\u003e family members, and their regulatory roles in poplar drought tolerance remain largely unexplored.\u003c/p\u003e\n\u003cp\u003eIn previous research, we identified an \u003cem\u003eR2R3-MYB\u003c/em\u003e gene, \u003cem\u003ePdMYB2R032\u003c/em\u003e, in\u0026nbsp;\u003cem\u003eP. deltoides × P. euramericana\u003c/em\u003e ‘Nanlin895’\u0026nbsp;that is homologous to Potri.002G173900 in \u003cem\u003ePopulus trichocarpa\u003c/em\u003e and potentially involved in drought stress response\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e37\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e.\u0026nbsp;Additionally, Wang \u003cem\u003eet al\u003c/em\u003e. (2017) cloned the homolog \u003cem\u003eMYB115\u0026nbsp;\u003c/em\u003efrom \u003cem\u003eP. tomentosa\u003c/em\u003e, which was shown to regulate proanthocyanidin (PA) biosynthesis\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e38\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. PA has been reported as a key secondary metabolite involved in poplar’s defense against abiotic stresses including drought\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e39,40\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e.\u0026nbsp;Its homologous gene \u003cem\u003eAtMYB5\u003c/em\u003e has been reported to regulate heat stress response in \u003cem\u003eArabidopsis\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e.\u0026nbsp;However, whether \u003cem\u003ePdMYB2R032\u003c/em\u003e actively involved in the molecular drought response pathway in poplar remains unclear.\u0026nbsp;Therefore, the objectives of this study were to: (i) systematically identify and analyze \u003cem\u003eR2R3-MYB\u0026nbsp;\u003c/em\u003efamily members in \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’ using bioinformatics tools; (ii) functionally validate the drought-responsive role of \u003cem\u003ePdMYB2R032\u003c/em\u003e through transgenic approaches; and (iii) explore the molecular mechanisms by which this gene regulates drought stress responses. This research aims to provide new insights into the functional roles of \u003cem\u003eR2R3-MYB\u003c/em\u003e genes in drought tolerance and offer candidate genes for poplar genetic improvement under water-deficit conditions.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eIdentification of \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eR2R3-MYB\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eG\u003c/strong\u003e\u003cstrong\u003eenes in \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eP. deltoides\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo identify drought-related \u003cem\u003eR2R3-MYB\u003c/em\u003e genes in \u003cem\u003eP. deltoides\u003c/em\u003e and investigate their relationships with those in other species, we performed identification and bioinformatic analysis of members of this gene family. The genome sequences of \u003cem\u003eP. deltoides\u003c/em\u003e \u0026lsquo;I-69\u0026rsquo; (GCA_015852605.2), \u003cem\u003eA. thaliana\u003c/em\u003e (TAIR10), and \u003cem\u003eOryza sativa\u003c/em\u003e Japonica (v1.0) were obtained from the NCBI Genome Database (https://www.ncbi.nlm.nih.gov/genome/) and Ensembl Plants (https://plants.ensembl.org/info/data/ftp/index.html). The hidden Markov model (HMM) profile of the MYB DNA-binding domain (Pfam accession: PF00249) was downloaded from the Pfam database (https://pfam.xfam.org/) and used to scan the \u003cem\u003eP. deltoides\u003c/em\u003e \u0026lsquo;I-69\u0026rsquo; proteome (E-value cut-off = 1e\u003csup\u003e-3\u003c/sup\u003e). In parallel, a BLASTP search was performed against the \u003cem\u003eP. deltoides\u003c/em\u003e protein database using known \u003cem\u003eA. thaliana\u003c/em\u003e \u003cem\u003eR2R3-MYB\u003c/em\u003e protein sequences retrieved from the \u003cem\u003eArabidopsis\u003c/em\u003e Information Resource (https://www.arabidopsis.org/)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e42\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, with an E-value threshold of 1e\u003csup\u003e-5\u003c/sup\u003e. Candidate \u003cem\u003ePd2RMYBs\u003c/em\u003e were identified by combining the results of HMM and BLAST searches, and further validated for conserved domains using the methods described by Wang \u003cem\u003eet al\u003c/em\u003e. (2023)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e43\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003eand Letunic \u003cem\u003eet al\u003c/em\u003e. (2021)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e44\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e to remove sequences lacking intact MYB domains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatic Analysis of the \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePd2RMYB\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e Gene Family\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChromosomal locations of \u003cem\u003ePd2RMYBs \u003c/em\u003ewere retrieved from the genome annotation of \u003cem\u003eP. deltoides\u003c/em\u003e \u0026lsquo;I-69\u0026rsquo; and visualized using TBtools (v2.1.1). The physicochemical properties of the Pd2RMYB proteins were analyzed using the ProtParam tool (https://www.expasy.org/resources/protparam). \u003cem\u003eCis\u003c/em\u003e-acting elements within the 2000 bp upstream promoter regions were predicted using PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/).\u003c/p\u003e\n\u003cp\u003ePhylogenetic trees were constructed with MEGA (v12) using the neighbor-joining (NJ) method and default parameters, based on the full-length R2R3-MYB protein sequences from \u003cem\u003eP. deltoides\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e. Conserved motifs of Pd2RMYB proteins were identified using MEME (version 5.5.9, https://meme-suite.org/meme/tools/meme). Exon-intron structures were extracted from the genome annotation and visualized with TBtools. Tandem and segmental duplication events were identified using MCScanX and BLASTP (E-value \u0026lt; 1e\u003csup\u003e-10\u003c/sup\u003e). Homologous sequences to \u003cem\u003ePdMYB2R032\u003c/em\u003e were obtained via BLASTP searches against NCBI, and a cross-species phylogenetic tree was constructed with 1000 bootstrap replicates. Secondary and tertiary structures of PdMYB2R032 proteins were predicted using SOPMA (https://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html) and SWISS-MODEL (https://www.swissmodel.expasy.org/), respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene Expression Patterns and \u003c/strong\u003e\u003cstrong\u003eDetection of \u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePdMYB2R032\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e Activity Under Drought Stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study utilized tissue culture seedlings of \u003cem\u003eP. deltoides\u003c/em\u003e \u0026times; \u003cem\u003eP. euramericana\u003c/em\u003e \u0026apos;Nanlin895\u0026apos; (NL895) , a hybrid bred by the Forest Tree Genetics and Breeding team of Nanjing Forestry University. One-month-old subcultured seedlings of NL895 were treated with 15% PEG6000 (w/v) (Coolaber, Beijing, China) to simulate drought stress. Leaves were collected at 0 hours, 12 hours, 1 day, and 3 days after treatment. RNA was then extracted and subjected to qRT-PCR analysis, using the \u0026Delta;\u0026Delta;Ct method to calculate gene expression levels. Eight \u003cem\u003ePd2RMYB\u003c/em\u003e genes were randomly selected to investigate their expression patterns at different treatment time points.\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003ePdMYB2R032\u003c/em\u003e gene was ligated into the pGBKT7 vector (Coolaber, Beijing, China) using the ClonExpress\u0026reg; II One Step Cloning Kit (Vazyme, Nanjing, China) to construct the pGBKT7-\u003cem\u003ePdMYB2R032\u003c/em\u003e fusion vector, which was subsequently transformed into AH109 yeast competent cells (Coolaber, Beijing, China). Using pGBKT7 as the control, yeast cultures carrying pGBKT7-\u003cem\u003ePdMYB2R032\u003c/em\u003e were spotted onto SD/-Trp media (Coolaber, Beijing, China ) containing 0%, 10%, and 30% PEG6000 at concentration gradients of 1, 1/10, 1/100, 1/1000, and 1/10000, followed by incubation at 29\u0026deg;C for 48 hours.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of Overexpression Vector and Genetic Transformation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe pBI121-3HA-des vector (provided by Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University, Nanjing, China) was digested with restriction enzymes, and the target gene \u003cem\u003ePdMYB2R032\u003c/em\u003e was ligated into the vector using specific primers pBI121-3HA-\u003cem\u003ePdMYB2R032\u003c/em\u003e (F) and (R) (Table 1). The recombinant plasmid was transformed into \u003cem\u003eEscherichia coli \u003c/em\u003e(\u003cem\u003eTrelief\u003c/em\u003e\u003csup\u003eTM \u003c/sup\u003e5\u0026alpha; Chemically Competent Cell, Tsingke, Beijing, China), and positive clones were preliminarily screened by colony PCR using 35S and \u003cem\u003ePdMYB2R032\u003c/em\u003e-R primers. Verified clones were sequenced, expanded, and used for plasmid extraction, then introduced into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV3101 (Tsingke, Beijing, China).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003cstrong\u003e. \u003c/strong\u003ePrimer information required.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"555\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 191px;\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 363px;\"\u003e\n \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 191px;\"\u003e\n \u003cp\u003epBI121-3HA-\u003cem\u003ePdMYB2R032\u003c/em\u003e (F)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 363px;\"\u003e\n \u003cp\u003eCCAGATTATGCTAGTCTTATGGGAAGGGCTCCTTGTTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 191px;\"\u003e\n \u003cp\u003epBI121-3HA-\u003cem\u003ePdMYB2R032\u003c/em\u003e (R)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 363px;\"\u003e\n \u003cp\u003eGAACGATCGGGGAAATTCTCATACCAGCAGTGACTCGGCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 191px;\"\u003e\n \u003cp\u003e35S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 363px;\"\u003e\n \u003cp\u003eAGGAAGGTGGCTCCTACAAATGCCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 191px;\"\u003e\n \u003cp\u003e3HA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 363px;\"\u003e\n \u003cp\u003eATTATGCTAGTCTTATGTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eThe transgenic receptor was \u003cem\u003eA. thaliana\u003c/em\u003e ecotype Columbia Col-0 (,wild-type, provided by Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University, Nanjing, China), grown under conditions of 25 \u0026deg;C, 16 h light, and 65% relative humidity. Transformation was performed using the floral dip method. T0 seeds were screened on 1/2 MS medium (Hopebiol, Qingdao, China) containing kanamycin. Positive seedlings were verified by PCR and propagated for two additional generations. Homozygous \u003cem\u003ePdMYB2R032\u003c/em\u003e-overexpressing lines were selected for subsequent experiments. This experiment was completed at the Key Laboratory of Forest Genetics and Biotechnology of Nanjing Forestry University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDrought Simulation Experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDrought stress was simulated using PEG6000 (Coolaber, Beijing, China) at concentrations of 0%, 5%, and 10%, following the method of van der Weele \u003cem\u003eet al\u003c/em\u003e. (2000)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e45\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. (1) In vitro PEG stress treatment: \u003cem\u003eArabidopsis\u003c/em\u003e seedlings were grown for 10 days on standard 1/2 MS medium (Hopebiol, Qingdao, China), then transferred to media containing different PEG6000 concentrations. (2) Soil-based drought treatment: Seedlings of uniform growth were transplanted into pots (perlite: vermiculite: nutrient soil = 1:3:1) after 15 days on standard medium, and placed in a growth chamber (25 \u0026deg;C, 16 h light/8 h dark, 65% humidity). After 10 days of acclimation, drought and rewatering treatments were performed. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of Growth and Physiological Parameters under Drought Stress\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSix wild-type (WT) and six \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE \u003cem\u003eArabidopsis\u003c/em\u003e plants (from three independent lines) were subjected to PEG-induced drought stress. Aboveground and root phenotypes were recorded on days 2 and 6 of stress. On day 6, total fresh weight (T-FW) and root fresh weight (R-FW) were measured. For pot-grown plants, leaves from WT and \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE lines were sampled under three conditions: well-watered control (CK), 7-day drought, and 3-day rewatering. Then, the stomatal size of the leaves at the same position was observed under a microscope (Zeiss, Oberkochen, Germany). In addition, on the third day of sowing, the effects of different concentrations of PEG6000 on the seed germination rates of WT and transgenic \u003cem\u003eArabidopsis\u003c/em\u003e were evaluated. Each plate contained 36 WT and 36 \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE seeds; three plates were used per treatment, totaling 108 seeds per genotype. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurement of Soluble Protein and Malondialdehyde (MDA) Contents\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHealthy leaves from WT and \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE plants subjected to 7 days of drought stress were sampled to determine soluble protein and MDA contents (three biological replicates per treatment). Soluble protein was measured using the Coomassie brilliant blue G-250 method\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e46\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, with absorbance at 595 nm recorded by UV-2600A Type UV-Vis Spectrophotometer (Unico, Shanghai, China ). MDA content was assessed following the method of Hou \u003cem\u003eet al\u003c/em\u003e. (2020)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, with absorbance measured at 450 nm, 532 nm, and 600 nm to estimate lipid peroxidation.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIdentification and Phylogenetic Analysis of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePd2RMYB\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Gene Family Members\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 100 \u003cem\u003eR2R3-MYB\u003c/em\u003e genes were identified from the \u003cem\u003eP. deltoides\u003c/em\u003e \u0026apos;I-69\u0026apos; genome and were designated \u003cem\u003ePd2RMYB1\u003c/em\u003e to \u003cem\u003ePd2RMYB100\u003c/em\u003e (Table S1). Chromosomal localization revealed that all but \u003cem\u003ePd2RMYB100\u003c/em\u003e were unevenly distributed across the 19 chromosomes. Chromosome 1 (Chr1) harbored the largest number of genes, while Chr11 and Chr16 each contained only one gene (Fig. 1).\u003c/p\u003e\n\u003cp\u003ePhylogenetic analysis of \u003cem\u003ePd2RMYBs\u003c/em\u003e and \u003cem\u003eR2R3-MYB\u003c/em\u003e genes from \u003cem\u003eA. thaliana\u003c/em\u003e grouped them into 12 subgroups (Fig. 2). Group 9 contained the largest number of \u003cem\u003ePd2RMYB\u003c/em\u003e members (24), followed by Group 11 (19 members), while Groups 4, 6, and 12 each had only three members.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhysicochemical Properties of Pd2RMYB Proteins\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAs summarized in Table S1, Pd2RMYB proteins had an average length of 351 amino acids and an average molecular weight of 39.3 kDa. Their theoretical isoelectric points (pI) ranged from 4.5 (Pd2RMYB63) to 10.09 (Pd2RMYB93). Instability index values varied from 36.68 (Pd2RMYB2) to 71.89 (Pd2RMYB80), with most proteins exceeding the threshold of 40, suggesting they may be unstable. The average aliphatic index was 67.22, and all GRAVY values were below zero, indicating good hydrophilicity. Subcellular localization predictions indicated that all Pd2RMYB proteins were localized to the nucleus, except Pd2RMYB9 and Pd2RMYB58 (Table S2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene Family Collinearity\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eand Gene Structure Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA total of 57 collinear gene pairs involving 65 \u003cem\u003ePd2RMYB\u003c/em\u003e genes were identified by the collinearity analysis of the \u003cem\u003ePd2R-MYB\u003c/em\u003e gene family ,which have undergone whole-genome duplication (WGD) or segmental duplication events (Table S3, Fig. 3A). Furthermore, strong collinearity was observed between \u003cem\u003eR2R3-MYB\u003c/em\u003e genes of \u003cem\u003eP. deltoides\u003c/em\u003e and \u003cem\u003eA. thaliana\u003c/em\u003e, while weaker collinearity was found with the monocot \u003cem\u003eO. sativa\u003c/em\u003e (Fig. 3B).\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. S1, most \u003cem\u003ePd2RMYB\u003c/em\u003e genes (86%) contained 2\u0026ndash;3 exons. Eleven genes had only one exon, while three genes had more than three. The fact that approximately 80% of Pd2RMYB proteins contained motif1, motif2, and motif3 indicates a high degree of structural conservation among them. All 19 gene members of Group 11 lacked motif1 and motif2 but possessed unique motif4 and motif6, conferring a subgroup-specific structure that clearly distinguishes them from other subgroups.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCis\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e-Element and GO Functional Annotation\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eanalysis\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCis\u003c/em\u003e-element analysis in the 2,000 bp upstream promoter regions identified various regulatory elements (Table S4, Fig. 4A), including light-responsive elements (e.g., GT1-motif, G-box, TCT-motif), ABA-responsive elements (ABRE), MeJA-responsive elements (CGTCA-motif, TGACG-motif), and ethylene-responsive elements (AuxRR-core, TGA-box). In addition, 46 genes contained drought-responsive MBS elements, and 41 contained low-temperature responsive LTR motifs. GO annotation revealed that \u003cem\u003ePd2RMYBs\u003c/em\u003e are mainly involved in transcriptional regulation (GO:0140110, GO:0001067) and DNA binding (e.g., GO:0000981) (Fig. 4B). Among 69 genes localized to the nucleus, 39 were associated with hormone responses (e.g., auxin, ABA, MeJA), and several others were related to abiotic stress responses including drought, salt, and osmotic stress (Table S5).\u003c/p\u003e\n\u003cp\u003eAdditionally, we randomly selected eight genes and investigated their expression patterns under drought stress using qRT-PCR. The results revealed that \u003cem\u003ePd2RMYB71\u003c/em\u003e exhibited a significantly downregulated expression pattern under drought stress, while \u003cem\u003ePd2RMYB18\u003c/em\u003e showed an expression pattern that initially decreased and subsequently increased, and the other six genes all demonstrated an expression pattern characterized by an initial increase followed by a decrease.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePdMYB2R032 Protein Structure and Phylogenetic Relationship\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSecondary structure analysis revealed that PdMYB2R032 protein from \u003cem\u003eP. deltoides\u003c/em\u003e \u0026times; \u003cem\u003eP. euramericana\u003c/em\u003e \u0026apos;Nanlin895\u0026apos; was mainly composed of random coils (56.84%) and alpha helices (29.82%) (Fig. 5A), along with a smaller proportion of extended strands (7.72%) and beta turns (5.61%) (Fig. 5B). Phylogenetic analysis indicated that\u003cem\u003e\u0026nbsp;\u003c/em\u003ePdMYB2R032\u003cem\u003e\u0026nbsp;\u003c/em\u003eshared the highest homology with Pd2RMYB21 (EVM05107.T1) in \u003cem\u003eP. deltoides\u003c/em\u003e, and clustered closely with other \u003cem\u003ePopulus\u003c/em\u003e species (Fig. 5C).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransformation of\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003ePdMYB2R032\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;into\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eY\u003c/strong\u003e\u003cstrong\u003eeast\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003cstrong\u003eells and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eArabidopsis thaliana\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe preliminarily investigated the drought tolerance of \u003cem\u003ePdMYB2R032\u003c/em\u003e using yeast cells. The results showed that both pGBKT7 control and pGBKT7-PdMYB2R032 transgenic yeast exhibited some degree of growth inhibition under drought stress (10% and 30% PEG). However, under drought conditions, the viability of pGBKT7-\u003cem\u003ePdMYB2R032\u003c/em\u003e transformed yeast cells was higher than that of the pGBKT7 control (Fig. 5D). To further validate the function of this gene, we overexpressed \u003cem\u003ePdMYB2R032\u003c/em\u003e in \u003cem\u003eA. thaliana\u003c/em\u003e. Transgenic validation confirmed successful integration and stable expression of \u003cem\u003ePdMYB2R032\u003c/em\u003e in\u003cem\u003e\u0026nbsp;Arabidopsis\u003c/em\u003e, with three transgenic lines obtained. (Fig. 5E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePdMYB2R032\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Enhances Biomass Accumulation and Alleviates Drought-Induced Damage in\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eArabidopsis\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUnder different PEG6000 concentrations, \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE \u003cem\u003eArabidopsis\u003c/em\u003e lines exhibited enhanced growth with larger leaves and more lateral roots compared to wild-type (WT) plants (Fig. 6A\u0026ndash;B). Both total and root fresh weight initially increased and then decreased with increasing PEG concentrations. Importantly, biomass accumulation under drought stress was significantly higher in \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE lines than in WT (Fig. 6C\u0026ndash;D). Additionally, \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE lines exhibited significantly lower malondialdehyde (MDA) levels than WT (~60% of WT) (Fig. 6E).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003ePdMYB2R032\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Regulates Stomatal Closure and Promotes Seed Germination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUnder drought conditions, three \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE lines exhibited clear stomatal closure, which was reversed after rehydration, whereas stomatal apertures in WT plants remained largely unchanged (Fig. 7A\u0026ndash;B). Seed germination rates of OE lines were consistently higher than WT under both normal and drought conditions (Fig. 7C\u0026ndash;D), suggesting that\u003cem\u003e\u0026nbsp;PdMYB2R032\u0026nbsp;\u003c/em\u003epromotes drought-resilient germination. Furthermore, \u003cem\u003ePdMYB2R032\u003c/em\u003e-OE plants bolted, flowered, and set seed earlier than WT, significantly shortening the vegetative phase (Fig. 8).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDrought is one of the most common and devastating natural disasters worldwide. Severe drought events can lead to widespread tree mortality, thereby impeding sustainable human life and economic development\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e48\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. In response to water-deficient conditions, plants rely on complex molecular regulatory mechanisms to maintain physiological stability and adapt to environmental changes\u003csup\u003e4\u003c/sup\u003e. Among numerous stress-responsive factors, the R2R3-MYB transcription factor family, due to its large number of members, conserved structure, and involvement in multiple signaling pathways, plays a key role in abiotic stress adaptation\u003csup\u003e1\u003c/sup\u003e. To date, \u003cem\u003eR2R3-MYB\u003c/em\u003e genes have been identified in several woody species, including \u003cem\u003eEucalyptus grandis\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e49\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, \u003cem\u003eMalus domestica\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e50\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, \u003cem\u003eCinnamomum camphora\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e51\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, \u003cem\u003eCamellia sinensis\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e52\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, \u003cem\u003eVitis vinifera\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e53\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, and \u003cem\u003ePopulus trichocarpa\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e54\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Zhuang \u003cem\u003eet al\u003c/em\u003e. (2021)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e55\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e characterized the MYB gene family in \u003cem\u003eP. deltoides\u003c/em\u003e ‘WV94’, and Bai \u003cem\u003eet al\u003c/em\u003e. (2021)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e56\u003c/sup\u003e\u003csup\u003e]\u0026nbsp;\u003c/sup\u003eachieved chromosome-level genome assembly of \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’ using Nanopore sequencing and Hi-C technology, providing valuable genomic resources for candidate gene mining related to abiotic stress in poplars. In the present study, we identified 100 members of the \u003cem\u003ePdMYB2Rs\u003c/em\u003e gene family in \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’. Phylogenetic analysis grouped these genes and \u003cem\u003eA. thaliana\u003c/em\u003e \u003cem\u003eR2R3-MYB\u003c/em\u003e genes into 12 subgroups. Genes within the same subgroup displayed conserved structures, laying a foundation for understanding the genetic basis of drought tolerance in poplar and other plant species.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGene duplication events are known to occur widely in the evolutionary history of angiosperms\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e57\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Previous studies have shown that whole-genome duplication (WGD) and segmental duplication are major drivers of gene family expansion and are particularly prominent in poplar genome evolution\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e58,59\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Our findings revealed extensive WGD events within the \u003cem\u003ePd2RMYB\u003c/em\u003e family, consistent with the results of Wu \u003cem\u003eet al\u003c/em\u003e. (2022)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e60\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, suggesting that such duplication events have contributed significantly to gene family expansion and the acquisition of novel functions that enhance environmental adaptability\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e61\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Furthermore, synteny analysis showed stronger collinearity between \u003cem\u003eP. deltoides\u003c/em\u003e and the dicotyledonous \u003cem\u003eA. thaliana\u003c/em\u003e than with the monocotyledonous \u003cem\u003eO. sativa\u003c/em\u003e, indicating higher homology\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e62\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e and suggesting that some \u003cem\u003ePd2RMYB\u003c/em\u003e genes may function similarly to their \u003cem\u003eA. thaliana\u003c/em\u003e counterparts in drought response.\u003c/p\u003e\n\u003cp\u003eYang \u003cem\u003eet al\u003c/em\u003e. (2021a)\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e54\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e identified 196 \u003cem\u003eR2R3-MYB\u003c/em\u003e genes in\u003cem\u003e\u0026nbsp;P. trichocarpa\u003c/em\u003e and detected\u003cem\u003e\u0026nbsp;cis\u003c/em\u003e-acting regulatory elements (CREs) associated with development, light response, phytohormone response, and environmental stress within their promoter regions. Consistent with previous findings, our study also detected these categories of CREs within the 2 kb upstream regions of \u003cem\u003ePd2RMYB\u003c/em\u003e genes, including GT1-motif, G-box, ABRE, and MBS. These elements reflect the functional diversity of the \u003cem\u003ePd2RMYB\u003c/em\u003e family\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e63\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e and serve as key components in regulatory networks under stress conditions\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e64\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. GO analysis, combined with previous studies, suggests that \u003cem\u003ePd2RMYBs\u003c/em\u003e are involved in hormone signaling pathways\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, responses to drought and salt stress\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e21,65\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, transcriptional regulation, and primary metabolic processes\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e66\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. These studies indicate that members of this gene family play crucial roles in environmental stress responses.\u003c/p\u003e\n\u003cp\u003eIn fact, after identifying the candidate gene, further functional validation is necessary to elucidate the complete regulatory mechanism of the gene under stress conditions\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e20\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. To this end, we conducted a functional exploration of the \u003cem\u003eR2R3-MYB\u003c/em\u003e gene—\u003cem\u003ePdMYB2R032\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e37\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, which has been previously identified as potentially involved in drought stress. Our study found that the protein encoded by this gene shares the highest homology with the \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’\u0026nbsp;Pd2RMYB21(EVM05107.T1) protein, suggesting potential similarities in their structure and function\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e67\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Furthermore, we observed that the overexpression of the \u003cem\u003ePdMYB2R032\u003c/em\u003e gene under drought stress promotes root growth in\u003cem\u003e\u0026nbsp;Arabidopsis\u003c/em\u003e, leading to an increase in lateral root production. Conversely, it reduces the stomatal aperture of the leaves, further demonstrating that this gene optimizes root structure to maintain normal growth and development of plants under environmental stress, such as improved water and nutrient use efficiency\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e23,68\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Indeed, plants facing adversity reduce water loss by closing their stomata to minimize leaf transpiration, thereby maintaining normal water balance under drought conditions and enhancing their drought tolerance\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e69,70\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. This has also been confirmed in the present study, which illustrates that the \u003cem\u003ePdMYB2R032\u003c/em\u003e gene enhances drought tolerance in\u003cem\u003e\u0026nbsp;Arabidopsis\u0026nbsp;\u003c/em\u003eby regulating root development and stomatal movement.\u003c/p\u003e\n\u003cp\u003eApart from their underground root systems, the development of aboveground plant parts, such as flowering and fruiting, often reflects environmental sensitivity during the developmental process more intuitively\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e71\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. This study also found that the \u003cem\u003ePdMYB2R032\u003c/em\u003e gene can advance the flowering and fruiting times of transgenic plants, enabling \u003cem\u003eArabidopsis\u003c/em\u003e to transition from vegetative to reproductive growth earlier. This may be attributed to tissue-specific responses induced by the transgene, such as enhanced root growth and stomatal closure, which alter intracellular signal transduction and ultimately lead to earlier flowering or growth inhibition\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e4\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Our study found that the \u003cem\u003ePdMYB2R032\u003c/em\u003e gene can promote the germination of \u003cem\u003eArabidopsis\u0026nbsp;\u003c/em\u003eseeds under both normal watering and drought conditions. Previous studies have reported that the \u003cem\u003eArabidopsis\u003c/em\u003e \u003cem\u003eAtMYB5\u003c/em\u003e gene, homologous to \u003cem\u003ePdMYB2R032\u003c/em\u003e, regulates seed coat development, and the differentiation of the seed coat may potentially influence the seed's ability to absorb water and germinate\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e72,73\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Therefore, we speculate that the overexpression of \u003cem\u003ePdMYB2R032\u0026nbsp;\u003c/em\u003emay enhance the seeds' ability to absorb more water from the culture medium, which is beneficial for the development and germination of \u003cem\u003eArabidopsis\u003c/em\u003e seeds.\u003c/p\u003e\n\u003cp\u003eIn addition, drought stress also leads to excessive accumulation of reactive oxygen species (ROS), disrupting ROS homeostasis and causing oxidative damage through the generation of malondialdehyde (MDA), which harms proteins, lipids, and carbohydrates\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e74,75\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Proanthocyanidins (PAs), a class of flavonoids, are efficient non-enzymatic antioxidants involved in ROS scavenging and the suppression of lipid peroxidation\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e76,77\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Notably, \u003cem\u003ePtoMYB115\u003c/em\u003e, a homolog of \u003cem\u003ePdMYB2R032\u003c/em\u003e in \u003cem\u003eP. tomentosa\u003c/em\u003e, can interact with the bHLH transcription factor TT8 to regulate PA biosynthetic genes such as \u003cem\u003eANR1\u003c/em\u003e and \u003cem\u003eLAR3\u003c/em\u003e\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e38,78\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Likewise, \u003cem\u003eAtMYB5\u003c/em\u003e in \u003cem\u003eArabidopsis\u003c/em\u003e modulates heat shock factor \u003cem\u003eHSFA2\u003c/em\u003e expression through cooperation with TT2, TT8, and TTG1 within the MBW complex, mediating responses to multiple environmental stresses\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. In our study, transgenic lines overexpressing \u003cem\u003ePdMYB2R032\u003c/em\u003e exhibited significantly lower MDA levels under drought stress, indicating that the gene enhances drought tolerance by reducing oxidative damage\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e17,79\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Based on these findings and previous reports\u003csup\u003e[\u003c/sup\u003e\u003csup\u003e80,81\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e, we speculate that PAs may play a central role in this process. Nonetheless, it remains ambiguous whether this gene is involved in the plant's response to drought stress through the modulation of PAs or other flavonoid biosynthetic pathways, as well as its cooperative regulatory interactions with various transcription factors or drought-responsive genes both upstream and downstream. We intend to conduct comprehensive transcriptomic and metabolomic analyses in subsequent investigations to clarify the gene-metabolite network. Concurrently, we will implement yeast two-hybrid (Y2H) and chromatin immunoprecipitation (ChIP) methodologies to identify and validate its target gene interactions, with the objective of effectively translating our research outcomes into precise molecular breeding strategies for poplar and related species.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn this study, a total of 100\u003cem\u003e\u0026nbsp;R2R3-MYB\u003c/em\u003e gene family members were identified in\u003cem\u003e\u0026nbsp;P\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cem\u003e\u0026nbsp;deltoides\u003c/em\u003e ‘I-69’ and classified into 12 subgroups. Their encoded proteins exhibited instability and hydrophilicity in physicochemical properties, along with structural conservation. Evolutionary analysis revealed that 57 duplicated R2R3-MYB gene pairs in this family were influenced by whole-genome duplication (WGD) or segmental duplication events. Furthermore, stronger collinearity was observed between members of this family and their homologous genes in \u003cem\u003eArabidopsis\u003c/em\u003e. \u003cem\u003eCis\u003c/em\u003e-acting element prediction combined with GO annotations suggested that \u003cem\u003ePd2RMYBs\u003c/em\u003e may be involved in primary metabolic regulation, gene expression control, phytohormone signaling, and responses to abiotic stresses such as drought and salinity. Preliminary studies had suggested that \u003cem\u003ePdMYB2R032\u003c/em\u003e might confer drought tolerance to yeast cells. Consistent with this, functional characterization revealed its role as a positive regulator of drought stress, as its overexpression in \u003cem\u003eArabidopsis\u003c/em\u003e ultimately enhanced drought tolerance by promoting root growth, increasing biomass, reducing stomatal aperture, lowering MDA levels, and accelerating seed germination.. Although this study offers preliminary insight into the molecular mechanism of \u003cem\u003ePd2RMYB032\u003c/em\u003e in drought stress through genome-wide family analysis, its interacting transcription factors/proteins and the downstream molecular regulatory network remain unknown. Further in-depth analysis is required in this area to establish a more comprehensive theoretical foundation for molecular breeding in poplar.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQJ.H, Y.C, CG.L: conceptualization, resources; Y.C, XL.Z, S.Z and JS.L: methodology, visualization. XL.Z, N.L, CC.G, FF.L and JM.S: formal analysis, investigation. XL-Z: data curation. XL.Z and CG.L: writing - original draft. QJ.H, JH.L, CG.L and N.L: writing - review \u0026amp; editing. QJ.H, CG.L and S.Z: supervision. QJ-H: funding acquisition. All authors read and approved of the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by the National Key Research and Development Project during the 14th Five-Year Plan Period (2022YFD2200301).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this article and supplementary information files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAmbawat S, Sharma P, Yadav NR, Yadav RC. MYB transcription factor genes as regulators for plant responses: an overview. \u003cem\u003ePhysiol Mol Biol Plants: Int J Funct Plant Biol\u003c/em\u003e. 2013;19(3):307-321. doi:10.1007/s12298-013-0179-1\u003c/li\u003e\n \u003cli\u003eBarbeta A, Mej\u0026iacute;a-Chang M, Ogaya R, Voltas J, Dawson TE, Pe\u0026ntilde;uelas J. The combined effects of a long-term experimental drought and an extreme drought on the use of plant-water sources in a mediterranean forest. \u003cem\u003eGlobal Change Biol\u003c/em\u003e. 2015;21(3):1213-1225. doi:10.1111/gcb.12785\u003c/li\u003e\n \u003cli\u003eYu D, Janz D, Zienkiewicz K, et al. Wood formation under severe drought invokes adjustment of the hormonal and transcriptional landscape in poplar. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2021;22(18):9899. doi:10.3390/ijms22189899\u003c/li\u003e\n \u003cli\u003eGupta A, Rico-Medina A, Ca\u0026ntilde;o-Delgado AI. The physiology of plant responses to drought. \u003cem\u003eSci\u003c/em\u003e\u003cem\u003eence\u003c/em\u003e. 2020;368(6488):266-269. doi:10.1126/science.aaz7614\u003c/li\u003e\n \u003cli\u003eZhou Y, Zhang Y, Wang X, et al. Root-specific NF-Y family transcription factor, PdNF-YB21, positively regulates root growth and drought resistance by abscisic acid-mediated indoylacetic acid transport in \u003cem\u003epopulus\u003c/em\u003e. \u003cem\u003eNew Phytol\u003c/em\u003e. 2020;227(2):407-426. doi:10.1111/nph.16524\u003c/li\u003e\n \u003cli\u003eXiong Y, Song X, Mehra P, et al. ABA-auxin cascade regulates crop root angle in response to drought. \u003cem\u003eCurr biol: CB\u003c/em\u003e. 2025;35(3):542-553.e4. doi:10.1016/j.cub.2024.12.003\u003c/li\u003e\n \u003cli\u003eBondaruk VF, Xu C, Wilfahrt P, et al. Aridity modulates grassland biomass responses to combined drought and nutrient addition. \u003cem\u003eNat Ecol Evol\u003c/em\u003e. 2025;9(6):937-946. doi:10.1038/s41559-025-02705-8\u003c/li\u003e\n \u003cli\u003eGuo H, Zhang J, Kang X, Yu C, He N. Aridity‐driven non‐linear shift of plant sodium allocation strategy at regional and global scales. \u003cem\u003eGlobal Ecol Biogeogr\u003c/em\u003e. 2025;34(3). doi:10.1111/geb.70025\u003c/li\u003e\n \u003cli\u003eFeng Z, Li H, Sun Z, et al. ZmGCT1/2 negatively regulate drought tolerance in maize by inhibiting ZmSLAC1 to maintain guard cell turgor. \u003cem\u003ePNAS\u003c/em\u003e. 2025;122(15):e2423037122. doi:10.1073/pnas.2423037122\u003c/li\u003e\n \u003cli\u003eMengoli G, Harrison SP, Prentice IC. The response of carbon uptake to soil moisture stress: adaptation to climatic aridity. \u003cem\u003eGlobal Change Biol\u003c/em\u003e. 2025;31(3):e70098. doi:10.1111/gcb.70098\u003c/li\u003e\n \u003cli\u003eChang Y, Fang Y, Liu J, et al. Stress-induced nuclear translocation of ONAC023 improves drought and heat tolerance through multiple processes in rice. \u003cem\u003eNat Commun\u003c/em\u003e. 2024;15(1):5877. doi:10.1038/s41467-024-50229-9\u003c/li\u003e\n \u003cli\u003eXu X, Liu H, Praat M, et al. Stomatal opening under high temperatures is controlled by the OST1-regulated TOT3-AHA1 module. \u003cem\u003eNat Plants\u003c/em\u003e. 2025;11(1):105-117. doi:10.1038/s41477-024-01859-w\u003c/li\u003e\n \u003cli\u003eHussain Q, Asim M, Zhang R, Khan R, Farooq S, Wu J. Transcription factors interact with ABA through gene expression and signaling pathways to mitigate drought and salinity stress. \u003cem\u003eBiomolecules\u003c/em\u003e. 2021;11(8):1159. doi:10.3390/biom11081159\u003c/li\u003e\n \u003cli\u003eHenley MJ, Koehler AN. Advances in targeting \u0026ldquo;undruggable\u0026rdquo; transcription factors with small molecules. \u003cem\u003eNat Rev Drug Discov\u003c/em\u003e. 2021;20(9):669-688. doi:10.1038/s41573-021-00199-0\u003c/li\u003e\n \u003cli\u003eGuo Y, Guo Z, Zhong J, et al. Positive regulatory role of R2R3 MYBs in terpene biosynthesis in lilium \u0026lsquo;siberia.\u0026rsquo; \u003cem\u003eHorticultural Plant J\u003c/em\u003e. 2023;9(5):1024-1038. doi:10.1016/j.hpj.2023.05.004\u003c/li\u003e\n \u003cli\u003eWu Y, Wen J, Xia Y, Zhang L, Du H. Evolution and functional diversification of R2R3-MYB transcription factors in plants. \u003cem\u003eHortic Res\u003c/em\u003e. 2022;9:uhac058. doi:10.1093/hr/uhac058\u003c/li\u003e\n \u003cli\u003eZhang HC, Gong YH, Tao T, et al. Genome-wide identification of R2R3-MYB transcription factor subfamily genes involved in salt stress in rice (\u003cem\u003eoryza sativa\u003c/em\u003e L.). \u003cem\u003eBMC Genomics\u003c/em\u003e. 2024;25(1):797. doi:10.1186/s12864-024-10693-5\u003c/li\u003e\n \u003cli\u003eZhao K, Cheng Z, Guo Q, et al. Characterization of the poplar R2R3-MYB gene family and over-expression of PsnMYB108 confers salt tolerance in transgenic tobacco. \u003cem\u003eFront Plant Sci\u003c/em\u003e. 2020;11:571881. doi:10.3389/fpls.2020.571881\u003c/li\u003e\n \u003cli\u003eZhu N, Duan B, Zheng H, et al. An R2R3 MYB gene GhMYB3 functions in drought stress by negatively regulating stomata movement and ROS accumulation. \u003cem\u003ePlant physiol biochem: PPB\u003c/em\u003e. 2023;197:107648. doi:10.1016/j.plaphy.2023.107648\u003c/li\u003e\n \u003cli\u003eZhang D, Zhou H, Zhang Y, et al. Diverse roles of MYB transcription factors in plants. \u003cem\u003eJ Integr Plant Biol\u003c/em\u003e. 2025;67(3):539-562. doi:10.1111/jipb.13869\u003c/li\u003e\n \u003cli\u003eBaldoni E, Genga A, Cominelli E. Plant MYB transcription factors: their role in drought response mechanisms. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2015;16(7):15811-15851. doi:10.3390/ijms160715811\u003c/li\u003e\n \u003cli\u003eWan J, Wang R, Zhang P, et al. MYB70 modulates seed germination and root system development in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e. \u003cem\u003eiScience\u003c/em\u003e. 2021;24(11):103228. doi:10.1016/j.isci.2021.103228\u003c/li\u003e\n \u003cli\u003eSeo PJ, Xiang F, Qiao M, et al. The MYB96 transcription factor mediates abscisic acid signaling during drought stress response in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e. \u003cem\u003ePlant Physiol\u003c/em\u003e. 2009;151(1):275-289. doi:10.1104/pp.109.144220\u003c/li\u003e\n \u003cli\u003eXu C, Fu X, Liu R, et al. PtoMYB170 positively regulates lignin deposition during wood formation in poplar and confers drought tolerance in transgenic \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e. \u003cem\u003eTree Physiol\u003c/em\u003e. 2017;37(12):1713-1726. doi:10.1093/treephys/tpx093\u003c/li\u003e\n \u003cli\u003eLiang YK, Dubos C, Dodd IC, Holroyd GH, Hetherington AM, Campbell MM. AtMYB61, an R2R3-MYB transcription factor controlling stomatal aperture in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis thaliana\u003c/em\u003e. \u003cem\u003eCurr Biol\u003c/em\u003e. 2005;15(13):1201-1206. doi:10.1016/j.cub.2005.06.041\u003c/li\u003e\n \u003cli\u003eQin Y, Wang M, Tian Y, He W, Han L, Xia G. Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e. \u003cem\u003eMol Biol Rep\u003c/em\u003e. 2012;39(6):7183-7192. doi:10.1007/s11033-012-1550-y\u003c/li\u003e\n \u003cli\u003eLong T, Yang F, Chen Z, et al. Overexpression of PtoMYB99 diminishes poplar tolerance to osmotic stress by suppressing ABA and JA biosynthesis. \u003cem\u003eJ Plant Physiol\u003c/em\u003e. 2024;292:154149. doi:10.1016/j.jplph.2023.154149\u003c/li\u003e\n \u003cli\u003eKong X, Chen Y, Li H, et al. Dissociation of transcription factor MYB94 and histone deacetylases HDA907/908 alleviates oxidative damage in poplar. \u003cem\u003ePlant Physiol\u003c/em\u003e. 2024;196(1):181-194. doi:10.1093/plphys/kiae325\u003c/li\u003e\n \u003cli\u003eDietz KJ, Vogelsang L. A general concept of quantitative abiotic stress sensing. \u003cem\u003eTrends Plant Sci\u003c/em\u003e. 2024;29(3):319-328. doi:10.1016/j.tplants.2023.07.006\u003c/li\u003e\n \u003cli\u003eRaza A, Li Y, Prakash CS, Hu Z. Panomics to manage combined abiotic stresses in plants. \u003cem\u003eTrends Plant Sci\u003c/em\u003e. Published online March 26, 2025:S1360-1385(25)00061-5. doi:10.1016/j.tplants.2025.03.001\u003c/li\u003e\n \u003cli\u003eShi T, Zhang X, Hou Y, et al. The super-pangenome of populus unveils genomic facets for its adaptation and diversification in widespread forest trees. \u003cem\u003eMol Plant\u003c/em\u003e. 2024;17(5):725-746. doi:10.1016/j.molp.2024.03.009\u003c/li\u003e\n \u003cli\u003eZhou Z, Zhang H, Bian L, Zhou L, Ge Y. Integrating sensor fusion with machine learning for comprehensive assessment of phenotypic traits and drought response in poplar species. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e. 2025;23(7):2464-2481. doi:10.1111/pbi.70039\u003c/li\u003e\n \u003cli\u003eNiu MX, Feng CH, He F, et al. The miR6445-NAC029 module regulates drought tolerance by regulating the expression of glutathione S-transferase U23 and reactive oxygen species scavenging in \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus\u003c/em\u003e. \u003cem\u003eNew Phytol\u003c/em\u003e. 2024;242(5):2043-2058. doi:10.1111/nph.19703\u003c/li\u003e\n \u003cli\u003eWang J, Rousseau RJ, Himes A, Siegert C, Ouyang Y, Renninger HJ. Migrating \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus\u003c/em\u003e with climate change: Phenology, coppice management, cold spell susceptibility, leaf dynamics, and biomass production. \u003cem\u003eForest Ecosystems\u003c/em\u003e. 2025;14:100343. doi:10.1016/j.fecs.2025.100343\u003c/li\u003e\n \u003cli\u003eJin Z, Li P, Huang R, et al. Natural variation in PtobZIP18 confers the trade-off between stem growth and drought tolerance in populus. \u003cem\u003ePlant Biotechnol J\u003c/em\u003e. Published online July 13, 2025. doi:10.1111/pbi.70261\u003c/li\u003e\n \u003cli\u003eFang Y, Wang D, Xiao L, et al. Allelic variation in transcription factor PtoWRKY68 contributes to drought tolerance in \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus\u003c/em\u003e. \u003cem\u003ePlant Physiol\u003c/em\u003e. 2023;193(1):736-755. doi:10.1093/plphys/kiad315\u003c/li\u003e\n \u003cli\u003eZhang X, Wang H, Chen Y, Huang M, Zhu S. Comprehensive genome-wide analyses of poplar R2R3-MYB transcription factors and tissue-specific expression patterns under drought stress. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2023;24(6):5389. doi:10.3390/ijms24065389\u003c/li\u003e\n \u003cli\u003eWang L, Ran L, Hou Y, et al. The transcription factor MYB115 contributes to the regulation of proanthocyanidin biosynthesis and enhances fungal resistance in poplar. \u003cem\u003eNew Phytol\u003c/em\u003e. 2017;215(1):351-367. doi:10.1111/nph.14569\u003c/li\u003e\n \u003cli\u003eDabravolski SA, Isayenkov SV. The role of anthocyanins in plant tolerance to drought and salt stresses. \u003cem\u003ePlants\u003c/em\u003e. 2023;12(13):2558. doi:10.3390/plants12132558\u003c/li\u003e\n \u003cli\u003eLi Z, Ahammed GJ. Hormonal regulation of anthocyanin biosynthesis for improved stress tolerance in plants. \u003cem\u003ePlant physiol biochem\u003c/em\u003e. 2023;201:107835. doi:10.1016/j.plaphy.2023.107835\u003c/li\u003e\n \u003cli\u003eJacob P, Brisou G, Dalmais M, et al. The seed development factors TT2 and MYB5 regulate heat stress response in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e. \u003cem\u003eGenes\u003c/em\u003e. 2021;12(5):746. doi:10.3390/genes12050746\u003c/li\u003e\n \u003cli\u003eStracke R, Werber M, Weisshaar B. The R2R3-MYB gene family in \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis thaliana\u003c/em\u003e. \u003cem\u003eCurr Opin Plant Biol\u003c/em\u003e. 2001;4(5):447-456. doi:10.1016/s1369-5266(00)00199-0\u003c/li\u003e\n \u003cli\u003eWang J, Chitsaz F, Derbyshire MK, et al. The conserved domain database in 2023. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2023;51(D1):D384-D388. doi:10.1093/nar/gkac1096\u003c/li\u003e\n \u003cli\u003eLetunic I, Khedkar S, Bork P. SMART: recent updates, new developments and status in 2020. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 2021;49(D1):D458-D460. doi:10.1093/nar/gkaa937\u003c/li\u003e\n \u003cli\u003evan der Weele CM, Spollen WG, Sharp RE, Baskin TI. Growth of \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis thaliana\u003c/em\u003e seedlings under water deficit studied by control of water potential in nutrient-agar media. \u003cem\u003eJ Exp Bot\u003c/em\u003e. 2000;51(350):1555-1562. doi:10.1093/jexbot/51.350.1555\u003c/li\u003e\n \u003cli\u003eGeorgiou CD, Grintzalis K, Zervoudakis G, Papapostolou I. Mechanism of Coomassie brilliant blue G-250 binding to proteins: a hydrophobic assay for nanogram quantities of proteins. \u003cem\u003eAnal Bioanal Chem\u003c/em\u003e. 2008;391(1):391-403. doi:10.1007/s00216-008-1996-x\u003c/li\u003e\n \u003cli\u003eHou L, Yu J, Zhao L, He X. Dark septate endophytes improve the growth and the tolerance of \u003cem\u003eM\u003c/em\u003e\u003cem\u003eedicago sativa\u003c/em\u003e and \u003cem\u003eA\u003c/em\u003e\u003cem\u003emmopiptanthus mongolicus\u003c/em\u003e under cadmium stress. \u003cem\u003eFront Microbiol\u003c/em\u003e. 2019;10:3061. doi:10.3389/fmicb.2019.03061\u003c/li\u003e\n \u003cli\u003eGebrechorkos SH, Sheffield J, Vicente-Serrano SM, et al. Warming accelerates global drought severity. \u003cem\u003eNature\u003c/em\u003e. 2025;642(8068):628-635. doi:10.1038/s41586-025-09047-2\u003c/li\u003e\n \u003cli\u003eSoler M, Camargo ELO, Carocha V, et al. The eucalyptus grandis R2R3-MYB transcription factor family: evidence for woody growth-related evolution and function. \u003cem\u003eNew Phytol\u003c/em\u003e. 2015;206(4):1364-1377. doi:10.1111/nph.13039\u003c/li\u003e\n \u003cli\u003eJia D, Wu P, Shen F, et al. Genetic variation in the promoter of an R2R3-MYB transcription factor determines fruit malate content in apple (\u003cem\u003eM\u003c/em\u003e\u003cem\u003ealus domestica\u003c/em\u003e borkh.). \u003cem\u003ePlant Physiol\u003c/em\u003e. 2021;186(1):549-568. doi:10.1093/plphys/kiab098\u003c/li\u003e\n \u003cli\u003eLuan X, Xu W, Zhang J, et al. Genome-scale identification, classification, and expression profiling of MYB transcription factor genes in \u003cem\u003eC\u003c/em\u003e\u003cem\u003einnamomum camphora\u003c/em\u003e. \u003cem\u003eInt J Mol Sci\u003c/em\u003e. 2022;23(22):14279. doi:10.3390/ijms232214279\u003c/li\u003e\n \u003cli\u003eChen X, Wang P, Gu M, et al. R2R3-MYB transcription factor family in tea plant (\u003cem\u003eC\u003c/em\u003e\u003cem\u003eamellia sinensis\u003c/em\u003e): genome-wide characterization, phylogeny, chromosome location, structure and expression patterns. \u003cem\u003eGenomics\u003c/em\u003e. 2021;113(3):1565-1578. doi:10.1016/j.ygeno.2021.03.033\u003c/li\u003e\n \u003cli\u003eMatus JT, Aquea F, Arce-Johnson P. Analysis of the grape MYB R2R3 subfamily reveals expanded wine quality-related clades and conserved gene structure organization across \u003cem\u003eV\u003c/em\u003e\u003cem\u003eitis\u003c/em\u003e and \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e genomes. \u003cem\u003eBMC Plant Biol\u003c/em\u003e. 2008;8:83. doi:10.1186/1471-2229-8-83\u003c/li\u003e\n \u003cli\u003eYang X, Guo T, Li J, Chen Z, Guo B, An X. Genome-wide analysis of the MYB-related transcription factor family and associated responses to abiotic stressors in \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus\u003c/em\u003e. \u003cem\u003eInt J Biol Macromol\u003c/em\u003e. 2021;191:359-376. doi:10.1016/j.ijbiomac.2021.09.042\u003c/li\u003e\n \u003cli\u003eZhuang W, Shu X, Lu X, et al. Genome-wide analysis and expression profiles of PdeMYB transcription factors in colored-leaf poplar (\u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus deltoids\u003c/em\u003e). \u003cem\u003eBMC Plant Biol\u003c/em\u003e. 2021;21(1):432. doi:10.1186/s12870-021-03212-1\u003c/li\u003e\n \u003cli\u003eBai S, Wu H, Zhang J, et al. Genome assembly of salicaceae \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus deltoides\u003c/em\u003e (eastern cottonwood) I-69 based on nanopore sequencing and hi-C technologies. \u003cem\u003eJ Hered\u003c/em\u003e. 2021;112(3):303-310. doi:10.1093/jhered/esab010\u003c/li\u003e\n \u003cli\u003eZhang T, Huang W, Zhang L, Li DZ, Qi J, Ma H. Phylogenomic profiles of whole-genome duplications in poaceae and landscape of differential duplicate retention and losses among major poaceae lineages. \u003cem\u003eNat Commun\u003c/em\u003e. 2024;15(1):3305. doi:10.1038/s41467-024-47428-9\u003c/li\u003e\n \u003cli\u003eFeng X, Chen Q, Wu W, et al. Genomic evidence for rediploidization and adaptive evolution following the whole-genome triplication. \u003cem\u003eNat Commun\u003c/em\u003e. 2024;15(1):1635. doi:10.1038/s41467-024-46080-7\u003c/li\u003e\n \u003cli\u003eZhou F, Chen Y, Wu H, Yin T. Genome-wide comparative analysis of R2R3 MYB gene family in \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus\u003c/em\u003e and \u003cem\u003eS\u003c/em\u003e\u003cem\u003ealix\u003c/em\u003e and identification of Male flower bud development-related genes. \u003cem\u003eFront Plant Sci\u003c/em\u003e. 2021;12:721558. doi:10.3389/fpls.2021.721558\u003c/li\u003e\n \u003cli\u003eWu Y, Wen J, Xia Y, Zhang L, Du H. Evolution and functional diversification of R2R3-MYB transcription factors in plants. \u003cem\u003eHortic Res\u003c/em\u003e. 2022;9. doi:10.1093/hr/uhac058\u003c/li\u003e\n \u003cli\u003eWu W, Zhu S, Zhu L, et al. Characterization of the \u003cem\u003eL\u003c/em\u003e\u003cem\u003eiriodendron chinense\u0026nbsp;\u003c/em\u003eMYB gene family and its role in abiotic stress response. \u003cem\u003eFront Plant Sci\u003c/em\u003e. 2021;12:641280. doi:10.3389/fpls.2021.641280\u003c/li\u003e\n \u003cli\u003eTang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH. Synteny and collinearity in plant genomes. \u003cem\u003eSci\u003c/em\u003e\u003cem\u003eence\u003c/em\u003e. 2008;320(5875):486-488. doi:10.1126/science.1153917\u003c/li\u003e\n \u003cli\u003eYang X, Li J, Guo T, Guo B, Chen Z, An X. Comprehensive analysis of the R2R3-MYB transcription factor gene family in \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus trichocarpa\u003c/em\u003e. \u003cem\u003eInd Crops Prod\u003c/em\u003e. 2021;168:113614. doi:10.1016/j.indcrop.2021.113614\u003c/li\u003e\n \u003cli\u003eStaut J, P\u0026eacute;rez NM, Ferrando AM, Dissanayake I, Vandepoele K. A map of integrated cis-regulatory elements enhances gene-regulatory analysis in maize. \u003cem\u003ePlant Commun\u003c/em\u003e. 2025;6(7):101376. doi:10.1016/j.xplc.2025.101376\u003c/li\u003e\n \u003cli\u003eRoy S. Function of MYB domain transcription factors in abiotic stress and epigenetic control of stress response in plant genome. \u003cem\u003ePlant Signaling Behav\u003c/em\u003e. 2016;11(1):e1117723. doi:10.1080/15592324.2015.1117723\u003c/li\u003e\n \u003cli\u003eLi J, Han G, Sun C, Sui N. Research advances of MYB transcription factors in plant stress resistance and breeding. \u003cem\u003ePlant Signaling Behav\u003c/em\u003e. 2019;14(8):1613131. doi:10.1080/15592324.2019.1613131\u003c/li\u003e\n \u003cli\u003eHan X, Li J, Li G, et al. Rapid formation of stable autotetraploid rice from genome-doubled F1 hybrids of japonica-indica subspecies. \u003cem\u003eNat Plants\u003c/em\u003e. 2025;11(4):743-760. doi:10.1038/s41477-025-01966-2\u003c/li\u003e\n \u003cli\u003eZhang Y, Wu X, Wang X, Dai M, Peng Y. Crop root system architecture in drought response. \u003cem\u003eJ Genet Genom\u003c/em\u003e. 2025;52(1):4-13. doi:10.1016/j.jgg.2024.05.001\u003c/li\u003e\n \u003cli\u003eCominelli E, Galbiati M, Vavasseur A, et al. A guard-cell-specific MYB transcription factor regulates stomatal movements and plant drought tolerance. \u003cem\u003eCurr biol: CB\u003c/em\u003e. 2005;15(13):1196-1200. doi:10.1016/j.cub.2005.05.048\u003c/li\u003e\n \u003cli\u003eHaghpanah M, Hashemipetroudi S, Arzani A, Araniti F. Drought tolerance in plants: physiological and molecular responses. \u003cem\u003ePlants\u003c/em\u003e. 2024;13(21):2962. doi:10.3390/plants13212962\u003c/li\u003e\n \u003cli\u003eLi W, Migliavacca M, Forkel M, et al. Widespread increasing vegetation sensitivity to soil moisture. \u003cem\u003eNat Commun\u003c/em\u003e. 2022;13(1):3959. doi:10.1038/s41467-022-31667-9\u003c/li\u003e\n \u003cli\u003eGonzalez A, Mendenhall J, Huo Y, Lloyd A. TTG1 complex MYBs, MYB5 and TT2, control outer seed coat differentiation. \u003cem\u003eDev Biol\u003c/em\u003e. 2009;325(2):412-421. doi:10.1016/j.ydbio.2008.10.005\u003c/li\u003e\n \u003cli\u003eLi SF, Milliken ON, Pham H, et al. The \u003cem\u003eA\u003c/em\u003e\u003cem\u003erabidopsis\u003c/em\u003e MYB5 transcription factor regulates mucilage synthesis, seed coat development, and trichome morphogenesis. \u003cem\u003ePlant Cell\u003c/em\u003e. 2009;21(1):72-89. doi:10.1105/tpc.108.063503\u003c/li\u003e\n \u003cli\u003eCruz de Carvalho MH. Drought stress and reactive oxygen species: production, scavenging and signaling. \u003cem\u003ePlant Signaling Behav\u003c/em\u003e. 2008;3(3):156-165. doi:10.4161/psb.3.3.5536\u003c/li\u003e\n \u003cli\u003eGill SS, Tuteja N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. \u003cem\u003ePlant physiol biochem\u003c/em\u003e. 2010;48(12):909-930. doi:10.1016/j.plaphy.2010.08.016\u003c/li\u003e\n \u003cli\u003eBogs J, Downey MO, Harvey JS, Ashton AR, Tanner GJ, Robinson SP. Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves. \u003cem\u003ePlant Physiol\u003c/em\u003e. 2005;139(2):652-663. doi:10.1104/pp.105.064238\u003c/li\u003e\n \u003cli\u003eLu N, Rao X, Li Y, Jun JH, Dixon RA. Dissecting the transcriptional regulation of proanthocyanidin and anthocyanin biosynthesis in soybean (\u003cem\u003eG\u003c/em\u003e\u003cem\u003elycine max\u003c/em\u003e). \u003cem\u003ePlant Biotechnol J\u003c/em\u003e. 2021;19(7):1429-1442. doi:10.1111/pbi.13562\u003c/li\u003e\n \u003cli\u003eJames AM, Ma D, Mellway R, et al. Poplar MYB115 and MYB134 transcription factors regulate proanthocyanidin synthesis and structure. \u003cem\u003ePlant Physiol\u003c/em\u003e. 2017;174(1):154-171. doi:10.1104/pp.16.01962\u003c/li\u003e\n \u003cli\u003eZhao L, Ma X, Ma W, et al. MsPYL6 and MsPYL9 improves drought tolerance by regulating stomata in alfalfa (\u003cem\u003eM\u003c/em\u003e\u003cem\u003eedicago sativa\u003c/em\u003e). \u003cem\u003ePlant J: Cell Mol Biol\u003c/em\u003e. 2025;122(6):e70265. doi:10.1111/tpj.70265\u003c/li\u003e\n \u003cli\u003eLi D, Yang J, Pak S, et al. PuC3H35 confers drought tolerance by enhancing lignin and proanthocyanidin biosynthesis in the roots of \u003cem\u003eP\u003c/em\u003e\u003cem\u003eopulus ussuriensis\u003c/em\u003e. \u003cem\u003eNew Phytol\u003c/em\u003e. 2022;233(1):390-408. doi:10.1111/nph.17799\u003c/li\u003e\n \u003cli\u003eXu Q, Fu Q, Li Z, et al. The flavonoid procyanidin C1 has senotherapeutic activity and increases lifespan in mice. \u003cem\u003eNat Metab\u003c/em\u003e. 2021;3(12):1706-1726. doi:10.1038/s42255-021-00491-8\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Drought stress, Drought tolerance, Gene function, Populus deltoides, R2R3-MYB genes, Transcription factor","lastPublishedDoi":"10.21203/rs.3.rs-8045203/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8045203/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePlants growing in natural environments are constantly exposed to various biotic and abiotic stresses, among which drought is a major abiotic factor that severely limits growth and development. As a water-demanding species, \u003cem\u003ePopulus\u003c/em\u003e is particularly vulnerable to drought under the context of global climate warming, making its drought tolerance a key determinant of adaptability and productivity. R2R3-MYB transcription factors play critical regulatory roles in plant responses to drought stress. In this study, we performed a comprehensive genome-wide identification and analysis of the \u003cem\u003eR2R3-MYB\u003c/em\u003e gene family in \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’ using bioinformatics approaches, and further investigated the drought-responsive function of \u003cem\u003ePdMYB2R032\u003c/em\u003e through transgenic experiments. A total of 100 \u003cem\u003eR2R3-MYB\u003c/em\u003e genes (\u003cem\u003ePd2RMYBs\u003c/em\u003e) were identified and classified into 12 subgroups based on phylogenetic analysis. \u003cem\u003eCis\u003c/em\u003e-element analysis of promoter regions revealed abundant motifs related to light response, hormone signaling, and drought regulation. Gene Ontology (GO) annotation indicated that \u003cem\u003ePd2RMYBs\u003c/em\u003e are potentially involved in hormone signaling pathways and responses to abiotic stresses. Phylogenetic analysis showed that \u003cem\u003ePdMYB2R032\u003c/em\u003e from \u003cem\u003eP. deltoides × P. euramericana\u003c/em\u003e ‘Nanlin895’ is most closely related to \u003cem\u003ePd2RMYB21\u003c/em\u003e in \u003cem\u003eP. deltoides\u003c/em\u003e ‘I-69’. Functional studies revealed that overexpression of \u003cem\u003ePdMYB2R032\u003c/em\u003ein \u003cem\u003eArabidopsis thaliana\u003c/em\u003e significantly promoted root development and biomass accumulation under drought conditions. In addition, \u003cem\u003ePdMYB2R032\u003c/em\u003eregulated stomatal movement by reducing stomatal aperture under drought stress, thereby minimizing water loss. It also reduced malondialdehyde (MDA) accumulation, alleviating drought-induced oxidative damage. Furthermore, \u003cem\u003ePdMYB2R032\u003c/em\u003eenhanced seed germination, accelerated flowering, and shortened the reproductive cycle in transgenic \u003cem\u003eArabidopsis\u003c/em\u003e. Collectively, these results demonstrate that \u003cem\u003ePdMYB2R032\u003c/em\u003e acts as a positive regulator of drought tolerance through multiple biological pathways, providing theoretical support for elucidating the drought-responsive mechanisms of \u003cem\u003eR2R3-MYB\u003c/em\u003egenes and for molecular breeding of drought-resistant poplars.\u003c/p\u003e","manuscriptTitle":"Study on the Positive Regulation of Drought Tolerance by PdMYB2R032 Based on R2R3-MYB Gene Family Analysis in Populus deltoides","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-08 14:02:50","doi":"10.21203/rs.3.rs-8045203/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-23T14:10:57+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-23T10:18:13+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-23T04:14:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T16:29:44+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-08T00:55:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"53592333300658541554196564891988556191","date":"2025-12-05T13:15:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"167188960943805044657717764599936502105","date":"2025-12-05T04:49:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"311726694042700415752327358239374800365","date":"2025-12-05T02:01:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219462536982173066197967984851247941992","date":"2025-12-05T00:48:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"103781282142670381518830306518359016060","date":"2025-12-04T14:47:47+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-04T14:36:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-04T14:14:40+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-26T14:08:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-26T03:24:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2025-11-26T03:17:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f83ad620-7736-4d6b-8ff9-6c96bc2e3aaa","owner":[],"postedDate":"December 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-02T16:01:31+00:00","versionOfRecord":{"articleIdentity":"rs-8045203","link":"https://doi.org/10.1186/s12870-026-08191-9","journal":{"identity":"bmc-plant-biology","isVorOnly":false,"title":"BMC Plant Biology"},"publishedOn":"2026-01-31 15:58:53","publishedOnDateReadable":"January 31st, 2026"},"versionCreatedAt":"2025-12-08 14:02:50","video":"","vorDoi":"10.1186/s12870-026-08191-9","vorDoiUrl":"https://doi.org/10.1186/s12870-026-08191-9","workflowStages":[]},"version":"v1","identity":"rs-8045203","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8045203","identity":"rs-8045203","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.