Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation

Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation Floris Bosveld , Baptiste Tesson , Eric van Leen , Sam Amirebrahimi , Raphael Thinat , Yohanns Bellaiche doi: https://doi.org/10.1101/2025.10.18.682384 Floris Bosveld 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: floris.bosveld{at}curie.fr yohanns.bellaiche{at}curie.fr Baptiste Tesson 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Eric van Leen 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sam Amirebrahimi 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Raphael Thinat 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yohanns Bellaiche 1 Institut Curie, PSL Research University, CNRS UMR3215, INSERM U934 , F-75248 Paris Cedex 05, France 2 Sorbonne Universités, UPMC Univ Paris 06, CNRS, CNRS UMR3215, INSERM U934 , F-75005, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: floris.bosveld{at}curie.fr yohanns.bellaiche{at}curie.fr Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Multicellular organisms possess conserved safeguard mechanisms that ensure the maintenance of tissue integrity. Exploring these mechanisms has proven instrumental in understanding how tissues robustly develop and prevent tumor initiation. Here, we investigate how epithelial tissues preserve their architecture and cell number in the face of spindle mis-orientation. Spindle mis-orientation, due to the lack of spindle pulling forces, centrosomes, or mitotic rounding, can cause epithelial cells to be mispositioned within or outside the tissue, leading to significant cell loss. By inducing spindle mis-orientation in Drosophila epithelial tissue, we first found that acentrosomal microtubules and cell contractility prevent excessive epithelial cell loss by enabling mispositioned cells to reintegrate into the epithelium. However, this mechanism alone is insufficient to maintain the total epithelial cell number. We uncovered that epithelial mechanics and cell size sensing monitor and compensate for epithelial cell loss predominantly by reducing physiological apoptosis through Hippo/YAP signaling. Lastly, we found that systemic TNF signaling protects the organism by eliminating potentially harmful non-reintegrating cells. Overall, our results delineate the complementary roles of mechanics and systemic signaling in controlling cell number and position at both tissue and organismal levels. Introduction During tissue development, homeostasis, and repair, the tight control of both cell number and position is instrumental for tissue organization, stem cell dynamics, and the prevention of tumor initiation. Accordingly, tissues have implemented safeguarding mechanisms to monitor and correct defects in cell positioning or number to ensure robust tissue dynamics. Within epithelial tissues, defects in spindle orientation drastically challenge both cell positioning and number, and can promote tumor initiation. 1 – 7 Yet, we lack a comprehensive understanding of the mechanisms buffering the adverse effects of epithelial cell mispositioning and loss due to spindle mis-orientation. In monolayered epithelial tissues, cells divide with their spindles oriented in the plane of the tissue, so that both daughters are born within the tissue; thus, increasing cell number and maintaining tissue architecture. 8 – 10 Epithelial spindle orientation depends on cell geometry, polarity, adhesion, mechanical, and signaling cues that converge on the cortical localization of the NuMA protein. 8 , 10 , 11 NuMA, in turn, binds to the Dynein complex to generate astral microtubule (MT) pulling forces that orient the spindle in the plane of the tissue. 8 , 10 , 11 Consequently, the loss of NuMA function leads to misplaced epithelial daughter cells due to mis-oriented cell division. These misplaced cells can either reintegrate into the epithelial tissue or delaminate from it. 6 , 7 , 12 – 14 While cell-cell adhesion in the Drosophila follicular epithelium is necessary for the reintegration of all misplaced cells within the tissue, 13 , 14 in most tissues, the mechanisms regulating the balance between reintegration and delamination remain unknown. Importantly, upon spindle mis-orientation, daughter cells failing to reintegrate into the tissue undergo apoptosis, resulting in cell divisions that produce only a lone epithelial resident daughter. 6 , 7 Despite this reduced increase in cell number upon division mis-orientation, the loss of NuMA has been reported to cause only mild effects on tissue development, 7 , 12 suggesting the existence of mechanisms compensating for cell divisions producing only one epithelial daughter cell. In addition, the death of delaminated cells is shown to be essential to avoid tumor initiation. 8 However, the mechanisms triggering their apoptosis are still unknown. Notably, both the loss of centrosomes and the lack of mitotic cell rounding also cause spindle orientation defects. 7 , 15 – 19 This further emphasizes the need to comprehensively characterize the mechanisms that promote cell reintegration, compensate for epithelial cell loss, and ensure the death of delaminated daughter cells. Here, we investigate the mechanisms controlling cell positioning and number upon spindle mis-orientation by taking advantage of high-resolution and long-term imaging in the Drosophila pupal dorsal thorax epithelium (notum) within a whole living organism. Using Drosophila epithelial tissue devoid of the conserved spindle guidance protein Mud (mammalian NuMA), we first delineate the mechanisms controlling the balance between reintegration and delamination by uncovering that acentrosomal MTs and cortical tension are necessary for cell reintegration upon division mis-orientation. Second, we found that upon the delamination of a misplaced daughter cell, the apex of the lone epithelial daughter served as a mechanical ruler for cell number control, reducing the apoptosis rate in the tissue and thus, restoring tissue cell number. Lastly, we established that systemic TNF signaling promotes the death of delaminated cells. Altogether, our results reveal how the complementary roles of cell mechanics and systemic signaling act as safeguard mechanisms in the control of cell positioning and number at the tissue and animal level. Results Spindle mis-orientation leads to epithelial cell mispositioning and loss We have previously reported that Drosophila NuMA, Mud, controls the apical-basal (AB) spindle orientation in the posterior domain of the Drosophila pupal notum, the scutellum. 20 , 21 Therefore, we decided to focus on this region to explore the short- and long-term consequences of spindle mis-orientation on epithelial cell dynamics. Within notum tissues expressing the E-Cad:GFP apical adherens junction (AJ) marker, cell divisions can be easily identified by cell apex area expansion and rounding during mitosis. 20 , 21 Upon division, we thus tracked and compared the behaviors of the two daughter cells in wild-type (wt) and mud scutellum tissues ( Figure 1A ; Video S1). As expected, in wt tissue the two daughter cells are positioned within the tissue, and their apical areas are of similar size. In mud tissue, 60% of the divisions ( n= 4829 out of 7975 divisions) initially produced 2 daughter cells, both of which can be easily distinguished within the tissue upon cytokinesis. The initial size of the two daughter apices varied from nearly equal to differences as high as 90%; despite such difference in their initial apex size the two daughters rapidly reached similar apex size ( Figure 1A ; Video S1). The remaining 40% of the cell divisions can be further categorized as follows. In 27% of the cases (12% of the total number of division), cell division leads to the formation of one very large daughter cell and a barely identifiable second daughter (apex area less than 10% of its sibling). The apex of this second daughter increased in area as the cell reintegrated within the tissue, eventually leading to the presence of two daughter cells with approximately equal apex area. In the remaining 73% of cases (27% of the total number of division), only one daughter was observed in the tissue with a disproportionally large apex area ( Figures 1A and 1B ; Video S1). Time-lapse imaging using E-Cad:GFP, the nuclear His2B:RFP and centrosomal YFP:Asl markers in mud tissue showed that such mis-oriented division led to one sibling located below the epithelial tissue ( Figure 1C ). These basal daughter cells eventually underwent apoptosis as shown by the accumulation of cleaved Caspase-3 (Casp3) positive staining in cells beneath mud epithelial tissue at 22 hours after pupa formation (hAPF) ( Figures 1D-F ). These later divisions therefore produce a lone epithelial daughter, leading to substantial epithelial cell loss. Importantly, the formation of one or two epithelial daughter cells upon cell division within mud tissue correlated with the magnitude of AB spindle mis-orientation ( Figure 1G ). As found in multiple tissues, 6 , 7 , 12 – 14 , 22 , 23 spindle mis-orientation can cause both epithelial cell mispositioning and cell loss in the notum. To investigate how cell positioning and number are regulated upon division mis-orientation, we focused on the 40% of divisions with a highly tilted spindle, which produced either two epithelial daughters, one of which has an apex area less than 10% of its sibling, or a single lone epithelial daughter cell. Download figure Open in new tab Figure 1. Division mis-orientation induces cell mispositioning and loss (A) Top view time-lapse images of apical E-Cad:GFP in wt (top panels) and mud tissues. wt cells divide with an average apex area difference of 14.55 ± 1.75 sem ( n= 50 cells). For mud three types of divisions are shown. Divisions that produce two daughter cells, one whereby both daughters have a 60% difference in apex area (second row panels), and a division where one daughter cell has an apex area <10% of its sibling (third row panels), as well as a division that produces a lone epithelia daughter cell (bottom panels). Black asterisks, dividing cells at anaphase onset t= 0 min. Red and blue asterisks indicate tissue resident daughter cells following division characterized by a small or large apex, respectively. Red arrowheads, reintegrating mispositioned daughter cell. (B) Apical-basal (AB) schematics illustrating the orientation of the spindle and the positioning of daughter cells in wt and mud mutant tissues. The relative apical areas of the two daughter cells for each division type are indicated and correspond to divisions shown in A. The orientation (°) of the mitotic spindle along the apical-basal axis (αAB) is indicated for each panel. (C) AB view time-lapse images of E-Cad:GFP, YFP:Asl and His2B:RFP in mud tissue showing a highly mis-oriented division (dashed white outline) resulting in a basally born cell residing underneath the epithelium (solid white outlines). White arrows, centrosome of the basally born daughter cell. (D) AB view image of fixed mud tissue at 22 hAPF stained with antibodies against SJ marker Cora and cleaved Casp3 showing a basal apoptotic Casp3 positive corpse. (E) Graph of the number (mean ± sem) of Casp3 positive corpses per hemi-scutellum tissue in wt and mud . **** p <0.0001, student t -test. N , number of tissues analyzed. (F) Top view images of fixed wt and mud tissues at 22 hAPF stained with antibodies against SJ marker Cora and cleaved Casp3. aSC and pSC, anterior and posterior scutullar macrochaetes (yellow circles). (G) Graph of αAB at t= -2 min prior to anaphase onset for mud divisions that produced either two epithelial daughters whereby one cell has and apex area <10% of its sibling (light blue) or a lone epithelial daughter (dark blue), plotted as cumulative percentage. The two distributions are significantly different ( p <0.0001, Mann-Whitney U test). Schematic, αAB was calculated by measuring the spindle orientation relative to the tissue AB axis, whereby a fully planar orientation is characterized by an angle of 0°, while a perpendicular orientation by an angle of 90° (see B). n , number of divisions analyzed. Scale bars: 1 µm (A, C, D), 10 µm (F). Lateral cell-cell adhesion does not modulate basal-to-apical reintegration of mispositioned cells We first aimed to understand the mechanisms that ensure the reintegration of highly mispositioned daughter cells, thereby preventing their loss. Upon spindle mis-orientation in the Drosophila follicular epithelium, which results solely in apical cell mispositioning, all apically misplaced cells reintegrate back into the epithelium. In this tissue with immature septate junctions (SJ), such apical-to-basal reintegration depends on lateral cell-cell adhesion SJ proteins, Nrg, FasII and FasIII. 13 , 14 , 24 The notum tissue harbors mature SJ 25 , 26 and as observed in other tissues, basally mispositioned cells reintegrate within the tissue in a basal-to-apical reintegration process. 12 , 13 To test whether basal-to-apical reintegration depends on lateral adhesion, we knocked-down Nrg, FasII or FasIII function by RNAi in clones generated within mud tissues. The ratio of delaminating over reintegrating cells (R d/r ) were then compared between the double loss-of-function clones and surrounding mud tissue. The R d/r ratios were similar in mud and in mud tissue upon knock-down of Nrg RNAi , FasII RNAi or FasIII RNAi ( Figures 2A and S1A-C ) indicating that lateral adhesion is not essential for basal-to-apical cell reintegration. Download figure Open in new tab Figure 2. Cell reintegration is associated with the formation of an apical cap enriched in PIP 2 and microtubules (A) Graphs of the delamination/reintegration ratios (R d/r ) in mud , and mud w RNAi , mud Nrg RNAi , mud FasII RNAi , mud FasIII RNAi tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (B) Graphs of the delamination/reintegration ratios (R d/r ) in mud , and mud aka RNAi , mud Gli RNAi , mud M6 RNAi tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (C) Graphs of the delamination/reintegration ratios (R d/r ) in mud , and mud E-cad RNAi , mud αCat RNAi tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (D) Top (top panels) and AB (bottom panels) view time-lapse images of YFP:Asl and PH:GFP of a highly mis-oriented division in mud tissue resulting in a mispositioned daughter cell (red arrowheads in top views and red asterisk in AB views) that reintegrates back within the tissue. Insets show high magnification of the apical cap formed by the reintegrating cell. Note that the centrosome appears in the cap at t= 14 min (white arrows). White asterisk, dividing cell at anaphase onset t= 0 min. Blue asterisk, large sibling. (E) 3D segmented time-lapse images (AB views) of a mis-oriented division resulting in a mispositioned daughter cell that reintegrates back within the tissue (top panels, same cell as shown in D), or a lone epithelial daughter cell (bottom panels) captured from mud epithelia expressing YFP:Asl and PH:GFP. The blue cells correspond to either the large sibling or the lone epithelial daughter resulting from a mis-oriented division, while the red cells correspond to the reintegrating or delaminating siblings, respectively. (F) Top (top panels) and AB (bottom panels) view live images of PH:GFP (right panels) and the intensity of the PLCγPH(PIP2) reporter in Fire LUT (right panels) at t= 12 min after anaphase onset. Red arrowheads, reintegrating cell. Blue asterisk, large sibling. Red asterisk, reintegrating daughter. White arrows, apical cap (corresponding to the reintegrating cell, red arrowheads). (G) Top view time-lapse images of apical Tub:GFP (grey top panels, magenta bottom panels) and E-Cad:3mKate2 (magenta bottom panels) in mud tissue showing a highly mis-oriented division resulting in a mispositioned daughter cell that reintegrates back within the epithelium (red arrows). White asterisk, dividing cell at anaphase onset t= 0 min. Blue asterisks, large sibling. (H) Graph of the evolution of the normalized Tub:GFP mean apical fluorescence intensity ( MFI ± sem) measured in the smallest daughter cells as compared to their larger siblings upon division in wt and mud tissues. **** p <0.0001, student t -test at t= 10 min. n , number of cells analyzed. The schematic to the right shows how the normalized MFI was calculated in mud and wt tissue. Thereto the apical intensity (I) in the largest sibling was subtracted from the intensity in the smallest daughter cell (in mud this corresponds to reintegrating cells with an initial apex area <10% of its sibling, while in wt this reflects the daughter cells with the smallest apex area). The resulting intensities were normalized to the highest measured difference (see Methods). Asterisks indicate tissue resident daughter cells characterized by a small (red) or large (blue) apex following division in wt and mud tissue. (I) Top (top panels) and AB (bottom panels) view live images of the apical cap (red arrowheads) localization of Tub:GFP and PH:ChFP at t= 12 min after anaphase onset in a reintegrating cell in mud tissue. The PLCγPH(PIP 2 ) intensity is shown in Fire LUT. Blue asterisk, large sibling. (J) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud Kat60 OE tissue normalized to the R d/r in mud . * p <0.05, chi-square test. n , number of divisions analyzed. (K) Top (top) and AB (bottom) view live images of PH:GFP and Spd-2:RFP in mud tissue following a highly mis-oriented division at t= 10 min after anaphase onset. Blue asterisk, large sibling. Red arrowhead/asterisk, reintegrating cell. White arrows, centrosomes. (L) Graph of áAB at t= -2 min prior to anaphase onset in wt, mud and Sas-4 , plotted as cumulative percentage. The αAB in mud and Sas-4 are significantly different from wt ( p <0.0001, Mann-Whitney U test). n , number of cells analyzed. (M) Graph of the delamination/reintegration ratio (R d/r ) in mud , Sas-4 , and mud Sas-4 tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. Scale bars: 1 µm. We then tested whether other regulators of cell-cell adhesion might promote cell reintegration. Basal-to-apical cell insertion, or radial cell intercalation, occurs as part of mucociliary epitheliogenesis during Xenopus embryogenesis. 27 , 28 Since during this process, tricellular junctions (TCJ) and their components play critical roles, 28 we investigated whether known Drosophila lateral tricellular SJ components Aka 29 , Gli 30 and M6 31 would facilitate the basal-to-apical reintegration. As for the depletions of the lateral adhesion proteins, no changes in the R d/r ratios were observed when comparing mud tissues with surrounding mud aka RNAi , mud Gli RNAi or mud M6 RNAi clones ( Figures 2B and S1D-F ). These results indicate that tricellular SJ components are unlikely to ensure basal-to-apical reintegration of the mispositioned cells. Lastly, we tested the role of the core AJ cell-cell adhesion components E-Cad and α -Catenin. 32 , 33 Neither E-Cad RNAi nor αCat RNAi knock-down in mud tissues modified the R d/r upon spindle mis-orientation ( Figures 2C , S1G and S1H ). Based on these results, we conclude that the reintegration of basally mispositioned cells is not affected by decreasing the function of components of the lateral and tricellular septate junctions, or adherens junctions. The initial step of cell reintegration is controlled by acentrosomal microtubules To understand how mispositioned cells reintegrate within the tissue in a basal-to-apical process, we then characterized the 3D shape of reintegrating cells versus delaminating cells upon spindle mis-orientation. Using the membrane marker PLCγPH:GFP (PH:GFP), which binds phosphatidylinositol biphosphate (PIP 2 ), 34 to record the 3D cell shape and YFP:Asl to follow spindle orientation, we analyzed mud daughter cells generated by a division with a spindle tilt greater than 40°, since many of them either reintegrate or delaminate from the tissue ( Figure 1G ). We found that most of the daughters that reintegrated within the tissue initially formed an apical cap (91%, n= 69 cells), whereas 98% of daughter cells without an apical cap delaminated from the tissue ( n= 107 cells, Figure 2D ). This apical cap constitutes an apical membranous structure enriched in PIP 2 ( Figure 2F ). 3D cell segmentation revealed that the apical cap belongs to an elongated apical-to-basal stalk formed by the mispositioned daughter ( Figure 2E ). The cap then progressively enlarged as the mispositioned daughter cell reintegrated in the tissue ( Figures 2D and 2E ; Video S2). This suggests that the initial step for cell reintegration is associated with the formation and maintenance of a membranous apical cap. To define how this initial step of cell reintegration is regulated, we aimed to identify proteins enriched in the apical cap. Strikingly, during our analyses of spindle orientation using the MT marker α− Tubulin (Tub:GFP), we observed an enrichment of MTs in the apical cap of the reintegrating daughter cells as compared to their larger siblings ( Figures 2G-I ; Video S3), implicating MTs as potential regulators of cell reintegration. Indeed, over-expression of the MT severing enzyme Kat60 35 , 36 in mud tissue significantly increased the R d/r ( Figure 2J ), while did not elicit a phenotype in wt interphasic or mitotic cells ( n = 149 cells). Thus, MTs contribute to the reintegration of highly mispositioned cells within the tissue to prevent their loss. MTs can be nucleated by centrosomal or non-centrosomal mechanisms. 16 , 37 Since we found that centrosomes were present in the apical cap ( Figures 2D and 2K ) and centrioles have been reported to control radial cell intercalation in Xenopus , 38 we first investigated the putative role of centrosomes. This was aided by analyzing divisions in Sas-4 tissues, which are devoid of centrosomes and known to cause spindle mis-orientation in epithelial tissues. 7 , 16 , 39 In Sas-4 notum tissues, we found that mitotic spindles were mis-oriented resulting in cell mispositioning as observed in mud ( Figures 2L and 2M ). We found that 11% ( n= 613 out of 5445 divisions) of the of divisions led to the formation of one barely visible daughter cell (apex area <10% of its sibling) that subsequently reintegrated within the tissue. This number is close to that in mud mutant tissue, Furthermore, the R d/r was similar in mud , Sas-4 and mud Sas-4 double mutant tissues ( Figure 2M ), indicating that centrosomes do not contribute to the reintegration of basally mispositioned mud cells. Together, these results prompted us to investigate whether regulators of non-centrosomal MTs might contribute to cell reintegration. The MT minus-end stabilizing protein Patronin (Pat, CAMSAP) has important functions in the regulation of non-centrosomal MT dynamics. 40 – 44 Interestingly, a functional Pat:tagRFP 45 , whose localization is restricted to the apical domain in notum tissue ( Figures S1I and S1J ), localizes to the apical cap and is enriched in the apex of the reintegrating cells during reintegration as compared to their larger siblings ( Figures 3A and 3B ; Video S3). Importantly, no enrichment in apical Pat:tagRFP ( n= 8 cells) or Tub:RFP ( n= 9 cells) was observed in mispositioned cells that did not form an apical cap ( Figures S1K and S1L ). Furthermore, while over-expression of Pat did not elicit a phenotype in mud tissue, we found that the depletion of Pat by clonal dsRNA expression in mud tissue increased the R d/r ratio by 2.6-fold ( Figures 3C , S1M and S1N ). We then investigated the specificity of the Pat loss-of-function regarding cell reintegration. dsRNA knock-down of Pat function neither led to cell delamination in wt tissue, nor affected spindle orientation in wt or mud tissue, nor changed the 3D cell geometry compared to that observed in mud tissue ( Figures S1O-R ), suggesting a specific role during cell reintegration. Consistent with an acentrosomal MT-dependent mechanism preventing cell loss, Pat localization and dynamics during reintegration were similar in reintegrating mud and Sas-4 cells ( Figures S1S and S1T ). Together, our data suggest that the acentrosomal function of Pat in MT dynamics or organization promotes the reintegration of highly mispositioned daughter cells. Download figure Open in new tab Figure 3. Pat/Eb1 are necessary to initiate the reintegration of mispositioned cells (A) Top (top panels) and AB (bottom panels) view live images of the apical cap (red arrowheads) localization of Pat:tagRFP and PH:GFP at t= 12 min after anaphase onset in a reintegrating cell in mud tissue. The PLCγPH(PIP 2 ) intensity is shown in Fire LUT. Blue asterisk, large sibling. (B) The left top view live image shows apical Pat:tagRFP localization at t= 15 min after anaphase onset in a small daughter cell (red arrowhead) following a highly mis-oriented division in mud tissue co-expressing E-Cad:GFP. Blue asterisk, large sibling. The right graph shows the evolution of the normalized Pat:tagRFP mean apical fluorescence intensity ( MFI ± sem) measured in the smallest daughter cells as compared to their larger siblings upon division in wt and mud tissues. **** p <0.0001, student t -test at t= 10 min. n , number of cells analyzed. (C) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud pat RNAi tissue normalized to the R d/r in mud . *** p <0.001, chi-square test. n , number of divisions analyzed. (D) Top (top panels) and AB (bottom panels) view live images of the apical cap (red arrowheads) localization of Eb1:tdGFP and PH:ChFP at t= 12 min after anaphase onset in a reintegrating cell in mud tissue. The PLCγPH(PIP 2 ) intensity is shown in Fire LUT. Blue asterisk, large sibling. (E) The left top view live image shows apical Eb1:tdGFP localization at t= 16 min after anaphase onset in a small daughter cell (red arrowhead) following a highly mis-oriented division in mud tissue co-expressing E-Cad:3mKate2. Blue asterisk, large sibling. The right graph shows the evolution of the normalized Eb1:tdGFP mean apical fluorescence intensity ( MFI ± sem) measured in the smallest daughter cells as compared to their larger siblings upon division in wt and mud tissues. **** p <0.0001, student t -test at t= 10 min. n , number of divisions. (F) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud Eb1 RNAi tissue normalized to the R d/r in mud . *** p <0.001, chi-square test. n , number of divisions analyzed. (G) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud pat RNAi Eb1 RNAi tissue normalized to the R d/r in mud . **** p <0.0001, chi-square test. n , number of divisions analyzed. (H) Top view time-lapse images of apical PH:GFP localization in mud , mud pat RNAi and mud Eb1 RNAi . Upon a highly mis-oriented division in mud tissue, most cells (91%, n= 69 cells) forming an apical cap (red arrowheads) reintegrated within the epithelium (red asterisk, top panels). On the contrary, such apical cap was mostly absent in divisions that produced a delaminating daughter cell (blue asterisks, 5% of n= 111 delaminated cells had a cap) (second row panels). In mud pat RNAi and mud Eb1 RNAi (bottom two panels) mis-oriented divisions associated with the formation of an apical cap (red arrowheads) frequently produced a lone epithelial daughter (blue asterisks, quantified in I). White asterisks, dividing cells at anaphase onset t= 0 min. Blue asterisks, large or lone siblings. (I) Graph of the percentage of mis-oriented divisions that produced daughters forming an apical cap and that subsequently delaminated from the epithelium in mud , mud pat RNAi and mud Eb1 RNAi . The frequency of cells forming an apical cap and delaminated rather than reintegrated back within the tissue was significantly different between mud and mud pat RNAi ( p <0.0013) or mud and mud Eb1 RNAi ( p <0.0000). ** p <0.01, **** p <0.0001, chi-square test. n , number of divisions analyzed. Scale bars: 1 µm. To analyze whether Pat localization at in the apex of the reintegrating cell is relevant for cell reintegration, we aimed the define the mechanism by which Pat is apically localized within the apex of reintegrating cells. To this end we screened through a set of 16 genes, known to interact with Pat or reported to be enriched at the apical side of epithelial cells ( Figures S2A-K ). 42 , 46 – 57 For these selected candidates, we analyzed in mud tissue either both their localization in the apical cap during cell reintegration as well as their effect on the R d/r or only their effect on the R d/r ( Figures S2A-K ). This screen revealed that the apical cap was enriched in several epithelial apical components including the Sas transmembrane protein ( Figure S2J ). Sas encodes an apical surface protein involved the elimination of tumorigenic cells. 58 – 60 Furthermore, we observed that the depletion of Sas by clonal dsRNA expression in mud tissue specifically increased the R d/r ratio ( Figure S2K ). Accordingly, upon knockdown of Sas, Pat is displaced from the medial apical cortex of interphasic and reintegrating cells to the cell-cell junctions ( Figures S1M and S1N ). This suggest that medial Pat localization at the cell apex is necessary for cell reintegration and that the apical epithelial protein Sas controls the reintegration of mispositioned cells upon spindle mis-orientation. In parallel, we explored the function of the plus-end binding MT polymerizing protein Eb1, which also plays a critical role in acentrosomal MT dynamics. 44 , 61 Mirroring the results for Pat, we found that Eb1 was enriched in the apical cap of reintegrating cells and absent from daughter cells that failed to reintegrate ( Figures 3D, 3E , and S3A ). Furthermore, the depletion of Eb1 by RNAi in mud tissue increased the R d/r ratio by 2.6-fold ( Figures 3F and S3B ). As shown for Pat, this Eb1 enhancement was specific to cell reintegration and Eb1 over-expression in mud tissue did not modulate the R d/r ratio ( Figure S3C ). Last, triple mud pat RNAi Eb1 RNAi mutant tissues exhibited a R d/r ratio similar to that of mud pat RNAi or mud Eb1 RNAi , indicating that Pat and Eb1 are likely involved in the same process to ensure epithelial cell repositioning of misplaced cells upon defects in division orientation ( Figure 2G ). Since cell reintegration is initiated by the formation of an apical cap in the reintegrating cells, we then analyzed its formation and dynamics in mispositioned mud pat RNAi and mud Eb1 RNAi cells in tissue expressing the PH:GFP membrane marker. In contrast to mud tissue where most mispositioned cells forming a cap subsequently reintegrated within the tissue, we found that a large proportion of mispositioned cells forming an apical cap subsequently delaminated in mud pat RNAi and mud Eb1 RNAi cells ( Figures 2H and 2I ; Video S4). We then compared the reintegration dynamics of mispositioned daughter cells in mud tissue with those in mud Eb1 RNAi and mud pat RNAi tissues that eventually reintegrated within the tissue. The reintegration dynamics, as measured by the expansion of their apex areas relative to their siblings between 10 to 500 min after anaphase onset, was similar in mud , mud Eb1 RNAi , and mud pat RNAi cells ( Figures S3G and S3H ). Taken together, we conclude that, in mud tissue, Pat and Eb1 are necessary to maintain or stabilize the apical cap, but not to form it, thereby promoting the basal-to-apical reintegration of mispositioned daughter cells and preventing their loss. Interestingly, although Pat and Eb1 apical intensity levels remained high and largely unchanged during early (10-38 min after anaphase onset) reintegration ( Figures S3I-K ), they are not required for subsequent apex area expansion once an apical cap has been successfully formed and stabilized. Local cortical tension contributes to cell reintegration Having found that the initial step of cell reintegration is associated with the formation of an apical cap and that the MT regulators Eb1 and Pat are required for its maintenance to allow reintegration to proceed, we next aimed to identify the mechanisms driving the subsequent step of apex area expansion during reintegration. In particular, we sought to investigate the roles of the surrounding cells by analyzing whether reintegrating cells push on the surrounding cells or are being pulled by them. Towards this goal, we first performed two types of laser ablation experiments. First, we ablated the medial apical apex of the reintegrating cells. Upon ablation, the cell apical area of these cells very rapidly increased ( Figures 4A and 4B ; Video S5). Second, when we ablated the cells surrounding a reintegrating cell, the apical area of the isolated cell decreased by approximately 60% ( Figures 4C and 4D ; Video S5). Additionally, when we analyzed reintegrating cells neighboring a dividing cell undergoing cytokinesis, we observed that cytokinetic ring constriction temporally sped up the reintegration of mispositioned cells ( Figures 4E-G ). Since cytokinetic ring constriction produces pulling forces on neighboring cells, 62 – 64 combined these findings agree with the notion that pulling forces from neighboring cells may modulate the reintegration of mispositioned cells. MyoII being a critical regulator of junctional tension, 32 , 33 , 65 , 66 we decided to analyze this possible neighboring pulling effect in more detail, first by investigating mud tissue in which we over-expressed a dominant negative form of MyoII heavy chain ( zip DN ) 67 , 68 to decrease MyoII function. In mud zip DN tissue, a large portion of daughter cells that exhibited an initially small apex due to spindle mis-orientation failed to further expand their apices, which then shrank and disappeared ( Figures 4H and 4I ; Video S6). Moreover, for mud zip DN mispositioned daughter cells that eventually managed to reintegrate within the tissue, we found that they exhibited slower reintegration dynamics as compared to control mud w RNAi tissue ( Figure 4J ). To further test the contribution of the neighboring cells, we analyzed the dynamics of reintegrating mud cells that retain MyoII function themselves, abutting mud tissue in which we clonally over-expressed zip DN ( mud-mud zip DN ) and compared them with reintegrating mud cells neighboring a control mud w RNAi tissue ( mud-mud w RNAi ). As observed for the global inactivation of MyoII activity, the reintegration of cells was slower for cells facing neighboring cells compromised of MyoII function as compared to the control ones ( Figures 4K and 4L ; Video S6). Similar results were obtained when we analyzed mud cells facing mud cells in which we over-expressed a dsRNA against the positive regulator of MyoII activity, Rok 69 ( Figure 4M ). This role of neighboring cells concurred with the observation that the apices of reintegrating cells exhibited lower MyoII enrichment compared to that of the neighboring cells ( Figure S4A ). Importantly, reporters of actomyosin activity (Rok:GFP, AniRBD:GFP, UtrABD:GFP) showed no apparent enrichment in neighboring cell junctions ( Figure S4B ). Accordingly, we did not observe a change in the junctional tension in cells neighboring a reintegrating cell (+1N) as compared to the rest of the tissue (+2N) in mud tissues ( Figures S4C and S4D ). Hence, reintegration of highly mispositioned cells depends on actomyosin forces, but does not require their upregulation in neighboring cells; instead, these forces originate from the tensile forces present within the epithelium. Consistent with these findings, we did not detect a change in neighboring cell junction tension or MyoII intensity in mud w RNAi or mud pat RNAi double mutant tissue ( Figures S4E and S4F ). Combined with the observation that the reintegration dynamics of mud Eb1 RNAi or mud pat RNAi double mutant cells were similar to mud w RNAi ( Figures S3G and S3H ), these findings show that MyoII-dependent pulling forces in neighboring cells are likely independent of acentrosomal MT regulation in reintegrating cells. Download figure Open in new tab Figure 4. Tissue tension promotes reintegration of mispositioned cells (A) Top view time-lapse images of apical Jup:GFP and E-Cad:3mKate2 in mud tissue of a reintegrating daughter cell upon a highly mis-oriented division following ablation in the apical cell center (white arrow and small dot in t= 0 min). Note that the apex area rapidly increased, which is considerably faster compared to the rate of reintegration without ablation (see Figure 5B ). (B) Graph of the apex area change (between t= 0 and 79 sec) following apical cell center ablation (mean ± sem) of a reintegrating daughter cell upon a highly mis-oriented division in mud tissue. **** p <0.0001, paired student t -test. n , number of cells analyzed. (C) Top view time-lapse images of apical Jup:GFP and E-Cad:3mKate2 in mud tissue of a reintegrating daughter cell upon a highly mis-oriented division following apical ablation of neighboring cells (dashed white lines in t= 0 min). (D) Graph of the apex area change (between t= 0 and 79 sec) following apical ablation of the neighboring cells (mean ± sem) of a reintegrating daughter cell upon a highly mis-oriented division in mud tissue. **** p <0.0001, paired student t -test. n , number of cells analyzed. (E) Top view time-lapse images of apical E-Cad:GFP in mud tissue of a reintegrating daughter cell upon a highly mis-oriented division adjacent to a neighboring cell undergoing division. The apex area of the reintegrating cell (red arrowheads) increases during neighboring cytokinesis (furrow indicated by black arrows). Blue asterisks, large tissue sibling. (F) Graph of the apex area dynamics of reintegrating (small) cells adjacent to a neighboring dividing cell undergoing cytokinesis in mud tissue (% of the sum of the apical areas of the two siblings ± sem, sliding average 10 min). The time t= 0 min is set to neighboring cytokinesis onset (dashed line). n , number of cells analyzed. (G) Graph of the velocity of apex area expansion of reintegrating cells neighboring a dividing cell undergoing cytokinesis in mud tissue (µm 2 /min ± sem, sliding average 10 min). The time t= 0 min is set to neighboring cytokinesis onset (dashed line). n , number of cells analyzed. (H) Top view time-lapse images of apical E-Cad:3mKate2 of a reintegrating daughter cell (red arrowheads) upon a highly mis-oriented division in mud zip DN tissue. Note that the cell fails to reintegrate and is lost from the tissue at t= 220 min. Black asterisk, dividing cell at anaphase onset t= 0 min. Blue asterisks, large sibling. (I) Graph of the percentage of cells that initiated reintegration, but failed (as in H) in mud w RNAi and mud zip DN tissues. **** p <0.0001, chi-square test. n , number of divisions analyzed. (J) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud and mud zip DN tissues (mean % of the sum of the apical areas of the two siblings ± sem, sliding average 30 min). Lines indicate t 1/2 , the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned cells is significantly different between mud and mud zip DN tissues. * p <0.05, student t -test. n , number of cells analyzed. (K) Top view time-lapse images of apical E-Cad:3mKate2 of a reintegrating daughter cell (red arrowheads) upon a highly mis-oriented division in mud tissue neighboring mud tissue over-expressing zip DN (indicated by yellow dashed lines at t= 0 min). Black asterisk, dividing cell at anaphase onset t= 0 min. Blue asterisks, large sibling. (L) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud tissue neighboring mud tissue over-expressing w RNAi or zip DN (mean % of the sum of the apical areas of the two siblings ± sem, sliding average 30 min). Lines indicate t1/2, the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned mud cells abutting either mud w RNAi or mud zip DN cells is significantly different. ** p <0.01, student t -test. n , number of cells analyzed. (M) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud tissue neighboring mud tissue over-expressing w RNAi or Rok RNAi (mean % of the sum of the apical areas of the two siblings ± sem, sliding average 30 min). Lines indicate t 1/2 , the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned mud cells abutting either mud w RNAi or mud Rok RNAi cells is significantly different. ** p <0.01, student t -test. n , number of cells analyzed. Scale bars: 1 µm (E, H, K), 5 µm (A, C). Collectively, we conclude that a combination of acentrosomal MT dynamics or organization, and contractility prevent excessive cell loss upon spindle mis-orientation, and that steady-state surrounding cell contractility enhances the reintegration rate of basally mispositioned daughter cells. Reduced apoptosis compensates for cell loss induced by mis-oriented division Having identified the contributions of acentrosomal MTs and contractility for cell reintegration, we next investigated the long-term consequence of cell loss due to spindle mis-orientation. Since spindle mis-orientation in mud scutellar tissue led to the formation of only one epithelial daughter in 27% of the divisions, it should lead to a substantial reduction in the number of epithelial cells. Given that most cells in this epithelial region of the notum undergo two rounds of division between 12 and 27 hAPF, 70 , 71 we theoretically expected this cell loss to be of around 25% (see Methods). Strikingly, by comparing the tissue cell numbers at 12 and 27 hAPF in wt and mud , we observed that the cell number in mud tissue was similar to that in wt tissue ( Figure 5A panel a). Importantly, in Sas-4 tissue, spindle mis-orientation led to the formation of only one epithelial daughter cell in 31% of the divisions ( n= 5445 divisions). Despite this excessive cell loss, the tissue cell number increase was also similar in Sas-4 and wt scutellar tissues ( Figure S5A panel a). Based on these observations, we hypothesized that a homeostatic mechanism exists to restore the tissue cell number upon cell loss due to spindle mis-orientation. Cell loss could be compensated for by either decreased apoptosis or increased cell division. Previous studies have shown that both cell proliferation and apoptosis are spatially and temporally regulated in the notum. 70 – 78 This enabled us to precisely compare cell proliferation and apoptosis rates in wt and mud tissues. The scutellum region is characterized by two successive waves of cell division and an increase in apoptosis rate following the first wave of cell division ( Figure 5A panels b and d). During the first division wave in the tissue, the rate of cell division is similar in wt and mud tissue. Nevertheless, the tissue cell number increase in mud tissue is less than in wt tissue, in agreement with the substantial cell loss associated with mis-oriented cell division. Strikingly, the mud tissue cell number eventually converges to match the tissue cell number observed in wt tissue at 27 hAPF ( Figure 5A panel a). Interestingly, we found that while proliferation was slightly extended in mud tissue after 24 hAPF, albeit at low rate, the rate of cell division producing two daughter cells was similar in mud and wt tissue in this extended phase ( Figure 5A panel c). In contrast, we found that in mud tissue, the rate of apoptosis of cells within the tissue is strongly reduced following the first wave of division ( Figure 5A panel d). Interestingly, quantitative analyses of cell apoptosis and division rates in mud and wt tissues revealed that the apoptosis rate was reduced by 4-fold in mud tissue and that such a reduction in apoptosis contributed to 65% of the cell number restoration ( Figure S5B ). As observed in mud tissue, we found that in Sas-4 tissue, the tissue cell number decrease due to mis-oriented divisions is also associated with a substantial decrease in apoptosis following the first wave of division and prolonged proliferation ( Figures S5A panels b and c, and S5C ). Together these results prompted us to explore how the production of a lone epithelial daughter cell following a mis-oriented division could lead to a reduced rate of apoptosis to ensure that the final cell number is close to the one observed in wt tissue. Download figure Open in new tab Figure 5. Apex area sensing by Hippo/YAP prevents apoptosis to restore tissue cell number (A) Graphs of the tissue cell number fold increase (a)(relative to the initial cell number, mean ± sem), the total division rate (b), the division rate for divisions producing 2 daughter cells (c), and the apoptosis rate (d)(rates relative to the initial cell number, mean ± sem, sliding average 60 min) in wt and mud scutellum tissue. N , hemi-scutella analyzed. (B) Graph of the apex area dynamics of the daughter cells following mud divisions that produced either two epithelial daughters where one cell has and apex area <10% of its sibling (small, large) or a lone epithelial daughter. Apex areas are relative to the apex area of their mothers at -60 min prior to, t= 0 min anaphase onset (mean% ± sem). The time to reach halfway of the predicted area (i.e. 50% of the mother apex area) is indicated, t 1/2 = 115, 70, and 255 min for the small, large, and lone daughters, respectively. n , number of divisions analyzed. (C) Schematic diagram and histogram of the quantification of the ban3-GFP nuclear mean fluorescence intensity ( MFI ± sem) in wt daughter cells upon division, and in the lone mud tissue resident siblings following a highly mis-oriented division. ban3-GFP levels were measured 60 min post anaphase onset ( t= 0 min) and cells were binned according to their initial apex area, using the sum of the siblings as a proxy ( Figure S5F ), to enable comparison between wt and mud cells. Note that in each bin the lone mud epithelial cells exhibit an apex area approximately twice as large as their wt counterparts. ns, not significant, *** p <0.001, **** p <0.0001, ANOVA with post-hoc Tukey test. n , number of divisions analyzed. (D) Top view time-lapse images of PH:ChFP at -30 min prior to and 60 min after anaphase onset ( t= 0 min) of a dividing wt cell (top panels) and a mud cell producing a lone epithelial daughter (bottom panels). The images depict the apical domain of dividing cells corresponding to the smallest apical area bin (10-20 µm 2 ) as quantified in C. For the 60 min time-point the lateral PH:ChFP (magenta) and the nuclear ban3-GFP (green) for the daughter cells are shown (white arrows). White outlines, cells analyzed. Blue and red asterisks indicate tissue resident daughter cells following division for which the ban3-GFP was quantified. (E) Graph of the frequency distribution (%) of daughter apex areas for wt cells after division and mud cells after mis-oriented divisions that produced a lone daughter cell (a), as well as the graphs of the frequencies of these wt and mud cells that subsequently undergo apoptosis (b) or division (c). ns, not significant, **** p <0.0001, chi-square test. n , number of daughter cells analyzed. (F) Graphs of the tissue cell number fold increase (a)(relative to the initial cell number, mean ± sem), the total division rate (b), and the apoptosis rate (c)(rates relative to the initial cell number, mean ± sem, sliding average 60 min) in mud w RNAi and mud Actn RNAi medial scutellum tissue. The final tissue cell number is significantly different between mud w RNAi and mud Actn RNAi . * p <0.05, student t -test. N , hemi-scutella analyzed. (G) Graphs of the cumulative divisions and apoptosis (% of initial cell number, mean ± sem) in mud w RNAi and mud Actn RNAi medial scutellum tissue. The final cumulative apoptosis is significantly different between mud w RNAi and mud Actn RNAi . * p <0.05, student t -test. N , hemi-scutella analyzed. Scale bars: 1 µm. Interplay between cell apex size and tissue mechanical tension restore cell number To investigate the mechanisms contributing to the reduction of cell apoptosis, we focused on divisions producing only a lone epithelial daughter for two reasons. First, such divisions are the ones leading to cell loss. Second, the lone epithelial daughters were characterized by an initial apical size like the one of their mother cells for 2.67 h and subsequently decreased their apical area to half of their mother’s size (t 1/2 = 4.25 h) ( Figure 5B ). This contrasts with the dynamics of the daughter cells originating from highly mis-oriented divisions generating two unequal epithelial daughter cells, where the apical size reached to half their mother’s size with t 1/2 of 1.92 h and 1.17 h for the small and large siblings, respectively ( Figure 5B ). We found that the loss of daughter cells upon mis-oriented division in mud tissue was not associated with elevated calcium signaling ( Figures S5D and S5E ), indicative of the absence of a damage response associated with tissue repair upon injury. 79 , 80 To identify the mechanism ensuring tissue cell number regulation, we then turned our attention to the Hippo/YAP pathway, which is a key mediator of mechanochemical signaling within tissues to control proliferation and apoptosis. 81 – 84 Previously, we have shown that in the central scutellum tissue, the YAP signaling output scales as a function of apical cell size. 85 Furthermore, the rate of apoptosis inversely correlates with cell apical area and YAP activity. 72 In wt tissue, each division produces two daughter cells whose apical areas are close to half the size of their mother cell. 71 , 72 In contrast, in mud tissue, with mis-oriented cell division producing only one epithelial daughter, the apical area of this lone epithelial sibling is similar to that of its mother ( Figure S5F ). Therefore, cell loss in mud tissue is concomitant with the formation of a lone sibling having an apex area twice as large as that observed in wt tissue. Given that YAP activity scales with apical area in the regulation of cell apoptosis, 72 , 85 we hypothesized that the production of only one epithelial daughter cell exhibiting a larger apical size could account for the reduced apoptosis in mud tissue. Hippo/YAP signaling modulates apoptosis through the transcriptional control of the microRNA bantam (ban), 86 , 87 whose expression can be used as a readout for pathway activity using the ban3-GFP transgene. 88 To test whether Hippo/YAP signaling could participate in the change in apoptosis in mud epithelial tissue, we measured the ban3-GFP level in wt and mud cells. Specifically, one hour after division, we compared the nuclear ban3-GFP level in wt daughter cells and in mud daughter cells originating from divisions that produced only a lone epithelial daughter cell. Importantly, to compare the ban3-GFP level in wt and mud cells, cells were binned according to their mother’s apical cell size, using the sum of the apical areas of the siblings as a proxy ( Figure S5F ). As observed when measuring YAP activity in wt tissue at any time point during the cell cycle, 85 we found that the ban3-GFP intensity scales with apex area in wt cells as early as 1 h after cell division ( Figures 5C and 5D ). In wt tissue, the offspring from the 10-20 µm² mothers constitute the smallest cells in the tissue; they have the lowest YAP activity and the highest probability of undergoing apoptosis. 72 Strikingly, the ban3-GFP intensity in lone mud epithelial daughters of the smallest mother cells was twice as high as in wt offspring originating from the smallest mother cells ( Figure 5C ). Therefore, in mud tissue, the lone epithelial daughter cells originating from the smallest sized mothers harbor an apical area twice as large as their wt counterparts and are characterized by a higher level of Hippo/YAP signaling. To investigate whether this increase in YAP activity correlated with a lower rate of apoptosis, we tracked the fate of the lone mud daughter epithelial cells alongside wt daughter cells of comparable mother apex size. Strikingly, we found that the frequency of mud cells originating from divisions producing only one epithelial daughter cell to undergo subsequent apoptosis was drastically reduced compared to that observed in wt cells ( Figure 5E panels a and b). Furthermore, in line with the slight change in the rate of cell division in mud tissue, the frequency of such cells undergoing division was elevated, although not significantly compared to wt cells ( Figure 5E panel c). Therefore, we conclude that the reduced rate of apoptosis in mud tissue is associated with the formation of daughter cells that are similar in size to their mother and exhibit a higher level of Hippo/YAP signaling as well as a lower rate of apoptosis. Since the scaling between Hippo/YAP activity and apical cell size depends on the actin cross-linker α-Actinin (Actn) 85 , we reduced Actn function in mud ( mud Actn RNAi ) and quantified the tissue cell dynamics. In mud Actn RNAi , the proliferation rate was largely unaffected, but apoptosis was significantly increased, resulting in a decrease in tissue cell number compared to mud w RNAi ( Figures 5F , 5G, S5G and S5H ), which was not due to a change in the Rd/r ratio ( Figure S5I ). This is consistent with a model in which sensing of apex area in response to tissue tension by Hippo/YAP pathway prevents apoptosis in cells with relatively larger apices. Altogether, we conclude that upon spindle mis-orientation the decrease in cell apoptosis within the epithelial tissue is contributing to cell number homeostasis. Furthermore, we propose that this decreased apoptotic rate is due to the formation of only one lone epithelial daughter harboring an apical size equal to that of its mother, leading to higher YAP signaling. Systemic TNF signaling eliminates basally displaced cells that fail to reintegrate To further challenge this model, we wondered whether the death of daughter cells positioned below the tissue could contribute to regulating epithelial cell numbers. To address this question, we decided to identify the mechanisms that promote their death to prevent it. We hypothesized that upon mis-oriented division the basally located cells lose their epithelial polarity and epithelial barrier function. Accordingly, basally born cells lack a polarized distribution of the apical marker GFP:aPKC ( Figure S6A ). Therefore, we focused on the role of systemic Tumor Necrosis Factor (TNF) signaling, which has recently been shown to control the elimination of polarity-deficient epithelial cells. 89 Since, the Drosophila TNF ligand, Egr, 90 , 91 is produced by the fat body cells and secreted into the hemolymph, 92 we first downregulated Egr specifically in the fat body cells using the lpp-GAL4 93 driver in wt and mud animals. Quantification of cleaved Casp3 positive cells beneath the tissue showed that while egr RNAi in the fat body did not change the number of basal apoptotic corpses in control tissues, egr RNAi in the fat body of mud animals strongly reduced the apoptosis observed beneath mud epithelial tissue ( Figures 6A and 6B ). Secondly, we downregulated the Drosophila TNF receptor Grnd 94 in wt and mud tissues to test whether this would prevent apoptosis of the basally born cells. Indeed, like the depletion of egr RNAi in the fat body, compared to mud w RNAi control tissue the number of basal apoptotic corpses was strongly reduced in mud grnd RNAi ( Figures 6C and 6D ). Furthermore, tracking of the basally born cells, labelled using the DNA replication marker PCNA:GFP, 95 – 97 revealed that knockdown of grnd in mud tissue led to 26% (5/19) of the basally located cells to re-enter the cell cycle, as they underwent S-phase to then likely remain in G2 ( Figures S6B-D ). This also confirmed that grnd RNAi in mud tissue is necessary to promote the apoptosis of basally located cells since 30% of the basally delaminated cell did not exhibit signs of apoptosis as compared to all 17 tracked control mud w RNAi cells that showed nucleus fragmentation ( Figure S6C ). Importantly, grnd RNAi in mud tissue neither modulated the R d/r ratio, nor changed the proliferation and apoptosis rates, nor modified the tissue cell number ( Figures S6E and S6F ). We therefore uncovered that the elimination of basally born daughter cells upon mis-oriented division is promoted by systemic TNF signaling and that their elimination is not necessary to regulate epithelial cell number. Altogether, our work establishes how complementary cell, tissue, and systemic mechanisms act to control cell number within and outside the epithelium upon spindle mis-orientation. Download figure Open in new tab Figure 6. Systemic TNF signaling eliminates misplaced basal cells (A) Top view images of fixed mud lpp>w RNAi and mud lpp>egr RNAi tissues at 22 hAPF stained with antibodies against cleaved Casp3 and against SJ marker FasIII. aSC and pSC, anterior and posterior scutullar macrochaetes. The lpp-Gal4 driver specifically expressed the RNAi in the fat body. (B) Graph of the number (mean ± sem) of Casp3 positive corpses per hemi-scutellum tissue in wt and mud tissues of lpp>w RNAi and lpp>egr RNAi animals. **** p w RNAi and mud Act5c>grnd RNAi tissues at 22 hAPF stained with antibodies against cleaved Casp3 and against SJ marker FasIII. aSC and pSC, anterior and posterior scutullar macrochaetes (yellow circles). The Act5c-Gal4 driver promotes ubiquitous expression of the RNAi. (D) Graph of the number (mean ± sem) of Casp3 positive corpses per hemi-scutellum tissue in wt and mud tissues of Act5c>w RNAi and Act5c>grnd RNAi animals. **** p <0.0001, ANOVA with post-hoc Tukey test. N , number of tissues analyzed. Scale bars: 10 µm. Discussion Tissue cell number and positioning are tightly regulated during epithelial development, homeostasis, and repair. Here, we induced cell mispositioning and loss by disrupting spindle orientation to investigate the mechanisms that maintain tissue architecture and cell number during development. We established the role of the MT and actomyosin cytoskeletons in regulating the balance between cell reintegration and delamination in mispositioned cells. Additionally, we elucidated that apical cell size and Hippo/YAP signaling promote the restoration of cell number within the tissue upon cell loss. Lastly, we found that systemic TNF signaling selectively promotes the death of delaminated cells, hindering the accumulation of potentially harmful cells. Thus, we propose that epithelial integrity and cell number upon spindle mis-orientation rely on complementary functions of local tissue mechanics and systemic signaling, collectively safeguarding the tissue and the organism against mispositioned cells and cell delamination. Our work positions the investigation of spindle mis-orientation as a paradigm for exploring how cell-, tissue-, and organism-scale processes maintain tissue architecture and cell number. Cell reintegration is crucial for preventing excessive cell loss upon spindle mis-orientation and has also been identified as a physiological process associated with cell dissemination. 8 , 98 , 99 The mechanisms regulating cell reintegration upon division mis-orientation have predominantly been studied in Drosophila follicular cells, where all cells reintegrate in an apical-to-basal fashion. In this context, lateral SJ cell-cell adhesion proteins promote reintegration. 13 , 14 In other tissues and in the notum, reintegration occurs from basal-to-apical. 12 , 24 Whether these different modes of cell reintegration rely on similar mechanisms has been unclear. We found that lateral SJ, TCJ, and E-Cadherin adhesion molecules are not required for basal-to-apical cell reintegration, and identified the cytoskeleton’s contributions in both the reintegrating cell and its neighbors. Firstly, we established that acentrosomal Pat- and Eb1-dependent MTs are necessary for maintaining the apical cap associated with the reintegration of basally mispositioned cells. Given that MT spatial organization and dynamics regulate actomyosin contractility, 100 – 102 membrane protein delivery, 48 , 103 , 104 and pushing forces on the membranes, 105 – 107 these functions likely contribute to the stabilization or maintenance of the apical cap during the initial step of cell reintegration. Additionally, in line with previous studies demonstrating the importance of Pat distribution on MT network organization, 42 , 46 , 49 , 51 – 53 , 108 we found that loss of the apical transmembrane protein Sas led to both the delocalization of Pat from the apical medial cortex to the cell junctions and altered the reintegration of mispositioned cells. This suggests that the organization of the apical acentrosomal cytoskeletal MT network is tuned to ensure cell reintegration. Exactly, how Sas regulates Pat localization remains to be further investigated, but might involve its receptor PTP10D, whose trans-interaction with neighboring cells has been shown to eliminate potentially tumorigenic cells. 58 – 60 , 109 Secondly, we found that surrounding epithelial cells promote reintegration of mispositioned cells by exerting pulling forces. These forces, which originate from the steady-state tensile forces within the epithelium, are necessary to prevent delamination and enhance the rate of cell reintegration. Our work thus suggests a mechanical interplay between mispositioned cells and their surroundings during reintegration. While acentrosomal Pat- and Eb1-dependent MT function in apical cap maintenance is restricted to the early step of the cell reintegration process, contractility also supports tissue maintenance and regulates cell shape, as well as their variation, throughout tissue development. 110 , 111 Previous work on Xenopus radial cell intercalation has shown the critical roles of TCJ, actomyosin forces, and centrosomal MTs in promoting the emergence of basally located cells. 27 , 28 , 112 Our analysis revealed that, despite similarities in cell dynamics, the regulation of basal-to-apical cell reintegration of basally mispositioned cells differs from radial intercalation. Specifically, while radially intercalating cells push their neighbors, we found that mispositioned cells are rather pulled by surrounding cells. Furthermore, centrioles play a crucial role in radial cell intercalation, 38 yet centrosomes were not essential for reintegration of mispositioned daughter cells in the notum epithelium. Last, our study also highlights the existence of mechanisms controlling the relative apical size of daughter cells within a tissue. Upon spindle mis-orientation, daughter cells with unequal apical sizes rapidly adjust their apex areas to match those observed under normal conditions. The mechanisms controlling apical cell area and its relation to cell survival remain to be understood, and spindle mis-orientation could be used to further probe the contributions of contractility, cell-cell adhesion, cell-extracellular matrix adhesion, apical-basal polarity, and cell-cell signaling. During development, homeostasis, and repair, the number of cells within tissues is tightly controlled by the balance between cell proliferation and death. Classical approaches to probing the mechanisms regulating epithelial cell number have relied on inducing local changes in growth, proliferation, or apoptosis rates. This has enabled the identification of key mechanisms that safeguard tissue cell numbers, such as cell competition and compensatory cell proliferation upon cell apoptosis. 113 – 123 In addition, mechanical stress, which can propagate over long distances, has emerged as a potential long-range regulator of cell proliferation and apoptosis in epithelial cell density control. 124 – 128 However, it remains critical to understand how these diverse processes quantitatively account for the global control of tissue cell numbers upon cell loss. Here, we established that the loss of one daughter cell upon spindle mis-orientation leads to the formation of a lone epithelial daughter with an apical size similar to that of its mother. Furthermore, these lone daughter cells exhibit higher levels of YAP activity and a reduced rate of apoptosis. This regulation predominantly affects the smallest lone daughter cells, consistent with our previous findings that Hippo/YAP signaling is controlled by apical area up to a certain apical area threshold. 72 , 85 Since we previously found that Hippo/YAP signaling is dependent on global tissue mechanical stress and cell apical size, our findings delineate how the complementary roles of tissue mechanical stress and cell geometry can locally adjust cell number. This regulation might support the hypothesis that cell apical area, rather than cell volume, is a factor in controlling the number of cells within a tissue. Importantly, our data also suggest that the observed increased rate of cell division upon loss of Mud function could result from the additional proliferation of lone daughter cells. Interestingly, the major change in ban3-GFP level between wt daughters and mud lone epithelial daughters occurs for the mud lone daughter cells of apex area lower than 20 µm 2 . This is rather expected since we previously found, 85 that the scaling between apical size and ban3-GFP mainly happens for apex area between 5 and 25 µm 2 . The loss of Mud function therefore leads to changes in ban3-GFP level and apoptosis in the smallest cells of the tissue, which are the ones prone to die in wt tissue. 72 , 85 As compensatory cell proliferation has been proposed to safeguard against spindle mis-orientation in other tissues, 7 it will be relevant to explore the roles of Hippo/YAP signaling, cell apical area, and mechanical stress in response to spindle mis-orientation more broadly. More generally, the complementary inputs provided by global tissue mechanics and cell geometry are emerging as a paradigm for locally modulating cell number within tissues. In collective cell assemblies in vitro , it has been found that both mechanical forces and cell area are good predictors of cell proliferation, 129 and that local tissue tension and nucleus size induce the proliferation of a subset of cells surrounding apoptotic cells. 123 It will be interesting to further explore how nucleus size and cell area are correlated in tissues and how their respective contributions are integrated to control proliferation and apoptosis, thereby robustly controlling tissue cell number. While Hippo/YAP activity emerges as a regulator to prevent the death of large lone daughter cells upon spindle mis-orientation, we foresee that ERK and Notch signaling, or Hippo/YAP-mediated compensatory proliferation could act in parallel to the anti-apoptotic function of the Hippo/YAP pathway. First, we previously uncovered that Notch signaling is critical for modulating apoptosis as a function of relative cell apical area. 72 It is therefore possible that the larger cell size of lone daughter cells relative to their direct neighbors also prevents their death. Second, the ERK pathway has recently emerged as a regulator of cell apoptosis in response to local mechanical forces, dependent on the pulling forces associated with the delamination of dying cells. 73 , 130 Since, upon spindle mis-orientation, the lone daughter cell initially occupies the space of the mother, spindle mis-orientation is unlikely to initially promote ERK activation. Nevertheless, over longer time scales, the large lone daughter decreases its area, possibly pulling on its neighbors and increasing ERK activity to prevent the death of its surrounding cells. Finally, the mechanism we uncovered can only compensate for epithelial cell loss if the endogenous apoptosis rate is higher than the rate of cell loss induced by spindle mis-orientation. If the endogenous rate of apoptosis is too low, our data suggest that the rate of proliferation could be enhanced to ensure cell number regulation, possibly via Hippo/YAP signaling. This could explain why higher levels of cell proliferation were reported in Drosophila epithelial tissue lacking centrosomes, which induced cell loss via spindle mis-orientation, DNA damage and aneuploidy. 7 , 131 As cell proliferation requires cell cycle progression, it is possible that a reduced rate of apoptosis acts as an early response, while compensatory proliferation can act on a longer time scale in the case of more significant cell loss. While spindle mis-orientation can predispose basally born epithelial daughter cells to initiate tumor formation upon apoptosis inhibition, 8 the mechanisms selectively inducing the death of delaminated cells have remained unclear. We propose that the loss of cell polarity in delaminated cells signals their elimination. Loss of cell polarization, caused by the loss of key polarity factors or tumor suppressors, is known to activate the TNF pathway due to mis-localized TNF receptors activated by the systemic TNF ligand Egr. 89 We showed that the TNF ligand Egr, produced by the fat body, promotes the death of delaminated cells. This function is limited to mispositioned cells, suggesting that loss of polarization is crucial for selective cell death. Furthermore, the death of delaminated cells does not affect epithelial apoptosis or proliferation rates, indicating that delaminated cell death is unlikely to signal for regulating epithelial cell numbers. Apoptosis prevention has been shown to induce cellular senescence and to arrest cells either at the G1 or G2 phase of the cell cycle. 132 – 135 Similarly, we found that loss of the TNF receptor Grnd reduced basal cell apoptosis, and that some basally born cells were able to progress through S-phase. Because we did not observe any basal cell division, these data indicate that these cells might remain in G2 phase. Since in numerous contexts TNF regulates JNK signaling, which mediates stress-induced apoptosis, 89 , 136 – 140 we envision that Egr promotes the death of basally located daughter cells via activation of the JNK pathway. Previous work showed that loss of centrosomes causes cell apoptosis in a JNK-dependent manner, but the downregulation of Egr expression in this epithelium did not prevent apoptosis. 7 Building on our findings, it will be interesting to test the role of systemic Egr in controlling cell death induced by centrosome loss. Collectively, our results indicate that the systemic TNF pathway enables for detecting delaminated cells in the absence of gene function loss that regulate epithelial polarity, delineating a simple and potentially common mechanism preventing the accumulation of non-epithelial, cancer-prone cells. Development entails the highly complex spatiotemporal dynamics of thousands of cells. It has emerged as an error-prone process backed-up by compensatory and checkpoint mechanisms. Loss-of-function analyses have been instrumental in delineating such mechanisms that ensure the robustness of tissue development and have provided key insights into tissue homeostasis, repair, and aging. This includes: at the cellular level, mitotic checkpoints ensure the fidelity of genome segregation 141 ; at the tissue level, cell competition and compensatory proliferation buffer local changes in growth, apoptotic rates, or cell identities 113 – 122 ; or at the organismal level, inter-organ communication helps maintain organ allometry and symmetry. 142 , 143 Spindle mis-orientation is associated with numerous pathologies and arises from defects in cortical cues, cell contractility, and microtubule organizing centers. 4 , 8 , 144 Our study reveals a multilayered system of safeguards that reuse robust homeostatic mechanisms to maintain epithelial integrity and cell number in the face of spindle mis-orientation, opening new avenues for investigating the complex interplay between cell behavior, tissue mechanics, and systemic regulation in epithelial biology. Limitations of the study The microtubule-associated proteins (MAPs) Pat and Eb1 have important functions in the regulation of MT dynamics and organization. Our findings regarding the function of these MAPs suggest that their activity is confined to mispositioned reintegrating cells to prevent their loss. However, we cannot formally rule out a function in neighboring cells during cell reintegration. In addition, the limits imposed by live imaging impeded us from delineating whether they act by controlling MT dynamics or organization in the apical cap of the reintegrating daughter cells. To investigate the role of Hippo/YAP signaling we analyzed the ban3-GFP at one hour post division. This analysis required the simultaneous acquisition of the 3D cell outlines using PH:ChFP with ban3-GFP. Photobleaching and 3D cell tracking hindered the quantitative analyses of the ban3-GFP level changes over time to explore the dynamics of Hippo/YAP signaling in lone daughter cells upon spindle mis-orientation. Due to similar challenges in live cell imaging and tracking, cell cycle progression of basally born cells using the PCNA:GFP marker combined with PH:ChFP could only be reliably followed for an average of 4.2 ± 0.2 h after a mis-oriented division. Although all basally born cells underwent apoptosis in control mud w RNAi tissue, due to the technical limitation to track for extensive periods the basally born cells in mud grnd RNAi cells, further work will be necessary to fully characterize their fate and tumorigenic potential. STAR METHODS RESOURCE AVAILIBILITY Lead contact Further information and requests for resources and reagents should be directed and will be fulfilled by the lead contacts, Floris Bosveld ( floris.bosveld{at}curie.fr ) and Yohanns Bellaïche ( yohanns.bellaiche{at}curie.fr ). Materials availability All unique/stable regents generated in this study are available from the lead contacts without restriction. Data and code availability All original microscopy data reported in this manuscript will be shared by the lead contacts upon request. Any additional information required to reanalyze the data reported in this manuscript is available from the lead contacts upon request. All code associated with this study will be shared by the lead contacts upon request. EXPERIMENTAL MODEL AND SUBJECT DETAILS Drosophila melanogaster husbandry and stocks Fly stocks were maintained on standard molasses/cornmeal/yeast food at 18°C or 25°C. Experiments were performed at 25°C or 29°C as specified in the Methods. The Drosophila stocks used in this study are listed in the Key resource table. METHODS DETAIL Genetics Experiments were performed at 25°C, or 29°C when utilizing the Act5c-GAL4 driver for global over-expression experiments. For temperature-controlled experiments we used the GAL4/GAL80 ts system 145 and these animals were reared at 18°C. To induce expression animals were pre-incubated at 29°C for 24-30 h prior to imaging, which generally commenced at 12-15 hours after pupa formation (hAPF). For clonal analyses, the flip-out system was utilized 146 . Thereto larvae were exposed to a 37°C heat-shock (7-20 min) and imaged 3-4 days after heat-shock. Construction of Ck:GFP The Ck:GFP allele was generated by CRISPR/Cas9-mediated homologous recombination at its endogenous locus, using the vas-Cas9 line. 147 Thereto guide RNAs: 5’-GTCGTATGTGTAGGTTTTACTAGTGTTT-3’ and 5’-GTCGAAATATTTTGCGTTATGTGTGTTT-3’, were cloned into the pCFD5:U6:3-t::gRNA vector. 148 The homology sequences: HR1 and HR2 were amplified using the following primers: HR1F-5’-TATGGGGTGTCGCCCTTCGGGTCTCTAGTGTAAAGATCGCGGATAAGGTCA-3’, HR1R-5’-ACTGCCTGAAGAACCGCTGGACCCCGAACTGTTGGCTCGAATGGTTCGATT-3’; HR2F-5’– GGAAGTGGTAGCTCAGGGTCTAGTGGATAGCACATAACGCAAAATATTT-3’, HR2R-5’-GCCCTTGAACTCGATTGACGCTCTTCGTCCGTCAGGCAAGAAAATCAAGGGA-3’ and cloned, using SLIC, 149 into a recombination vector, p931_GFPCter_Mini-White, carrying a hs-mini-white cassette flanked by two LoxP recombination sites for its removal and a C-terminal GFP. 150 All constructs were confirmed by sequencing and embryo transgenesis was performed by Bestgene. Immunostaining of fixed tissue Pupae were prepared for fixed tissue imaging as described previously. 151 Tissues were stained with primary antibodies: rabbit anti-cleaved Caspase3 (1:200), guinea-pig anti-Cora (1:2000), mouse anti-FasIII (1:50), rat-anti-αCat (1:250), mouse anti-BrdU (1:25) and subsequently counterstained with fluorescently tagged secondary antibodies (1:200): goat-Alexa488 anti-rabbit, donkey-Cy5 anti-guinea-pig, donkey-Cy3 anti-mouse, goat-Alexa555 anti-rat. BrdU incorporation assay BrdU staining was performed by dissecting notae (14-16 hAPF) from PCNA:GFP expressing animals in Schneider’s Drosophila medium. Notae were subsequently cultured in Schneider’s Drosophila medium containing 75 µg/ml BrdU for 30 min at 25 °C, washed two times 5 min with Schneider’s Drosophila medium and once 5 min with 1xPBS, after which the tissues were fixed for 20 min in 1xPBS containing 4% PFA. After two 10 min washes in 1xPBS + 0.3% Triton X-100, and two 10 min washes in 1xPBS + 0.5% Triton X-100, notae were permeabilized for 40 min in 1xPBS + 0.5% Triton X-100. Next, the DNA was depurinated for 30 min in a 1:1 mixture of 1xPBS + 0.5% Triton X-100: 4N HCl (2N final concentration), after which tissues were washed three times 10 min in 1xPBS + 0.25% Triton X-100. Immunolabelling and mounting was performed as described in immunostaining of fixed tissue. Image acquisition, processing, and quantification Mounting of pupae for live imaging was performed as in described in. 71 Microscopes used in this study for fixed or live tissue imaging include: an inverted spinning disk wide borealis confocal microscope CSU-W1 (Andor/Roper/Nikon) with sCMOS camera (Orca Flash4, Hamamatsu), an inverted spinning disk wide homogenizer confocal microscope CSU-W1 (Roper/Zeiss) with sCMOS camera (Orca Flash4, Hamamatsu), an inverted spinning disk wide confocal microscope CSU-W1 (Roper/Nikon/GATACA) with sCMOS camera (BSI camera with 95%QE), an inverted spinning disk wide homogenizer confocal microscope CSU-W1 (Roper/Zeiss/Spark) with sCMOS camera (Orca Flash4, Hamamatsu), an inverted spinning disk confocal microscope (Roper/Nikon) with sCMOS camera (Orca Flash4, Hamamatsu), and a spinning disk upright confocal microscope (Roper/Zeiss) with Coolsnap HQ2 camera (Photometrics). Laser ablations For tissue laser ablations, we used an inverted laser scanning microscope (LSM880 NLO, Carl Zeiss) equipped with a multi-photon Ti::Sapphire laser (Mai Tai HP DeepSee, Spectra-Physics). Circular and point ablations were performed in tissue expressing the microtubule associated protein Jup:GFP as well as the E-Cad:3mKate2 AJ marker by using a 40x/1.3 OIL DICII PL APO (UV) VIS-IR (420762-9800) objective and imaging in single-photon bidirectional scan mode with 1.0 sec time-steps. To evaluate the apex area change upon ablation, a small point was ablated in the medial cortex of the reintegrating cell, or a region of interest (ROI) drawn around the reintegrating cells was severed using the Ti::Sapphire laser in two-photon mode at 820-890 nm. The change in apex area was measured between t 0 = 0 and t 80 = 79 sec and statistical significance evaluated using the paired t -test. For junction ablations we used a 63x/1.4 OIL DICII PL APO objective and imaged a region of 26.45 µm x 26.45 µm (301x301 pixels). Junction ablations were performed in tissue expression the AJ marker E-Cad:GFP and imaged with 0.56 sec time-steps. To estimate the relative junctional tension, 152 we measured the recoil velocity of the vertices after junction ablation between t 0 = 0 sec and t 7 = 3.92 sec. Ablations were performed in mud tissue to probe the relative tension in the junctions of cells neighboring a reintegrating cell (+1N) as well as the relative local tissue tension by ablation of junctions belonging to cells 2 cell distances away from the reintegrating cell (+2N)( Figure S4C ). To enable comparison, we ablated in a single experiment two junctions, alternating between either first a +1N junction or a +2N junction. For each experiment we determined the ratio of the measured relaxation velocities, +1N/+2N. Statistical significance was evaluated using the paired t -test. Similar ablation experiments were performed to estimate the relative junction tension in +1N cells in mud w RNAi and mud pat RNAi double mutant tissues. Delamination versus reintegration In all analyses delamination and reintegration events were visually identified and quantified in Fiji 153 on Z-stack live-images of tissues expressing either AJ markers ubi-E-Cad:GFP, E-Cad:GFP, E-Cad:3mKate2 or the SJ marker Dlg:GFP. Typically 16-26 Z-stack slices at 0.5 µm spacing per time-point were acquired with a temporal resolution of 2-5 min between 12 to 28 hAPF using ojectives: 63x/1.4 OIL DICII PL APO, 60x/1.4 OIL DIC N2 PL APO VC, 40x/1.4 OIL DIC H/N2 PL FLUOR, 40x/1.3 OIL DIC H/N2 PL FLUOR, 40x/1.3 OIL DIC PL APO (UV) VIS-IR. Both events were scored following mitotic rounding/apex area expansion. In all analyses the anaphase elongation and apex area reduction after maximal rounding and expansion was set to reference t= 0 min. All data plotted and analyzed for reintegrating daughter cells represents daughter cells exhibiting an apex area <10% of the sum of the two siblings. Delaminations were scored by rounding/apex area expansion following the production of a lone epithelial sibling. Scoring the delaminating versus reintegrating cells within the tissue yielded the ratio R d/r , which was used to evaluate differences amongst genotypes, and to evaluate whether dsRNA mediated knock-down in mosaic tissues generated in a mud mutant background modulates cell reintegration by comparing the R d/r in mud cells and the neighboring clonal double mutant tissue. For these analyses similar numbers of divisions were analyzed between 12 to 18 hAPF in the mud and double mutant tissue. The data from multiple animals was pooled and the R d/r in mud cells was set to 1 for each condition analyzed. To compare the proportions across the different categories (e.g. mud and surrounding double mutant tissue), we used the chi-square test to evaluate statistical significance. Similar clonal analyses were performed in wt tissue; at least 100 divisions were analyzed for each condition. None of the dsRNA transgenes reported in this manuscript elicited a phenotype in wt tissue, indicating their specificity in modulating epithelial cell delamination and reintegration only in context of mispositioned cells upon division mis-orientation. Dynamics of lone epithelial daughters and reintegrating cells To follow the apex area dynamics of the two daughter siblings upon a highly asymmetric division and of the lone epithelial daughter after division mis-orientation, their apex areas were measured in Fiji. The resulting areas were normalized to the apex area of their mother at -1 h prior to division and plotted as a 30 min sliding average. Similar quantifications were performed to compare the reintegration dynamics of mispositioned daughter cells in different genotypes, by plotting the apex area of the small reintegrating sibling as a percentage normalized by the sum of the two siblings. The time to reach halfway of the predicted area (i.e. 50% of the mother apex area), denoted as t 1/2 , was used to evaluate whether reintegration dynamics differed between genotypes, using a student t -test. Mitotic spindle orientation Spindle orientation along the apical-basal (αAB) tissue plane was determined for dividing cells between 12 to 18 hAPF, at t= -2 min prior to anaphase elongation, using Fiji and a custom plugin, in tissue expressing either a centrosome (YFP:Asl, Spd-2:RFP) or mitotic spindle (αTub:GFP, RFP:αTub) marker, as previously described. 20 Z-stack live-images (40-50 slices at 0.5 µm spacing) were aquired with a temporal resolution of 2 min using either a 100x/1.45 OIL PL APO L, a 100x/1.4 OIL DIC N2 PL APO VC, a 63x/1.4 OIL DICII PL APO or 60x/1.4 OIL DIC N2 PL APO VC objective. To evaluate how AB spindle orientation related to the production of either a lone epithelial daughter or resulted in a division producing a daughter cell with a small apex that reintegrated back within the epithelial tissue plane, we imaged mud tissue expressing the E-Cad:GFP AJ, the centrosomal YFP:Asl and RFP:αTub mitotic spindle markers using a 63x/1.4 OIL DICII PL APO objective and aquired Z-stack images (40 slices at 0.5 µm spacing) with a temporal resolution of 2 min. Statistical significane was evaluated using the Mann-Whitney U test. Tissue cell number, division, and apoptosis rates To quantify tissue cell number increase, and the division and apoptosis rates, Z-stack live-images (26 slices at 0.5 µm spacing) of tissues expressing AJ markers ubi-E-Cad:GFP, E-Cad:GFP or E-Cad:3mKate2 were acquired with a temporal resolution of 5 min between 12 to 28 hAPF using a 40x/1.4 OIL DIC H/N2 PL FLUOR, a 40x/1.3 OIL DIC H/N2 PL FLUOR or a 40x/1.3 OIL DIC PL APO (UV) VIS-IR objective. To keep the focus of the tissue, autofocus detection (Metamorph software) was used for the duration of the imaging. The aquired movies were processed and projected (maximum intensity Ζ-stack projection) using a CARE deep neural network model 154 adapted to the notum tissue. 72 All movies were temporally aligned using ¾ of the first division peak. 71 The ROI for quantification, which corresponds to the medial scutellum tissue and region previously analyzed, 85 was defined by a squared box whose exterior was delineated by the positions of the posterior dorsocentral (pDC), the anterior and posterior scutullar macrochaetes (aSC and pSC), as well as the axis of symmetry, the tissue midline. Within this ROI cells were manually tracked to quantify divisions, cell reintegration or cell delamination caused by mis-oriented cell division or apoptosis using Fiji. To quantify tissue cell number, and the division and apoptosis rates within the entire scutellum tissue the ROI was defined by the midline and the pDC, pSC and the anterior postalar (aPA) macrocheates. For all analyses of cell number changes, division and apoptosis rates, the scored number of events were normalized to the initial number of cells tracked within the tissue. To evaluate statistical significance, we performed a student t -test on the final time point when comparing their cumulative effects. To evaluate the fate of lone epithelial daughter following mis-oriented divisions, we tracked these cells, which were born during the second division wave, during a period of 12.16 h starting at 19 hAPF. We recorded their subsequent division or apoptosis. For comparison with wt daughter cells following division, we selected an equal number of cells with similar apex area from an equal number of tissues, ensuring their positions corresponded to identical locations to those analyzed in mud tissue within the analyzed ROI. The chi-square test was used to evaluate statistical significance. Estimation of the contribution of the changes in cell division orientation as well as cell division and apoptosis rates in the variation of cell number in control and mud tissues Within a tissue where all cells divide twice and 27% of cell divisions in mud produced only one epithelial daughter, the cell number is expected to be reduced by 25% relative to the control tissue. Indeed, if we consider a tissue initially composed of n cells, 𝑛 cells in wt tissue, the cell number upon one division is 2𝑛 cells , and the number of cells upon two divisions is 4n cells. In mud tissue, the cell number upon one division is 𝑛 cells + 𝑛 cells * 0.73 = 1.73𝑛 cells . Upon the second division, the number of cells is 1.73𝑛 cells + 1.73𝑛 cells * 0.73 ≈ 3𝑛 cells . Therefore, the cell number in mud tissue is 75% of the number of cells in wt tissue. To account for the experimental division rate, the apoptotic rates as well as to estimate the final number of cells in mud tissue if no compensatory process occurred, we turned to computational analyses of the contribution of division and apoptosis to the variation of cell number fold change. We first considered that the tissue cell number evolves as: Thus, by mathematical induction: Therefore, the cell fold change within the tissue from t= 0 is given by: Thus, averaging across animals gives: Therefore, allowing to isolate the average contributions of divisions and apoptosis to the average fold change in cell number. To evaluate the contribution of the compensation through both apoptosis and division rates in mud tissue, we considered two different cases: The first one, to evaluate the evolution of cell fold change in the absence of compensation by variations in the rate of cell division or apoptosis, . To do so, we evaluated the success rate of division producing two daughter cells 𝑠̅ in mud tissue through time as follows: This way, we could compute the adjusted contribution of division to fold change as: And evaluate the evolution of the fold change as: The second one, to evaluate the contribution of the decreased apoptosis observed in mud tissue alone, Fc without apoptosis compensation . To do so, we replaced the contribution of apoptosis observed in wt to the evolution of the fold change in mud tissue as follows: These values were calculated using Python code and plotted to compare the fold change evolution observed in wt and mud tissues across different conditions. Quantification of apoptosis beneath the epithelial tissue, and tracking and Quantification of basal cell apoptosis was performed on maximum intensity Z-stack (80-100 slices at 0.5 µm spacing) projections of fixed tissues acquired using 40x/1.4 OIL DIC H/N2 PL FLUOR or 40x/1.3 OIL DIC H/N2 PL FLUOR objectives. This was achieved by manually counting the number of Casp3-positive corpses underneath the epithelium in a ROI corresponding to a 120.75 µm x 120.75 µm box, using the midline, and the anterior and posterior scutellar macrochaetes as spatial references in tissues counter-stained with antibodies against the SJ proteins Cora or FasIII to reveal the epithelial cells. To evaluate statistical significance between conditions we used either the student t -test or ANOVA with post-hoc Tukey test. To evaluate the fate of delamintated cells in mud and mud grnd RNAi , we manually tracked the cells in tissue expressing the PH:ChFP membrane marker in conjunction with the DNA replication marker PCNA:GFP, which enables to distinguish cells in G1, G2, and S-phase of the cell cycle, as well as mitosis 95 – 97 and apoptosis as evidenced by the fragmentation of the nucleus ( Figure S6C ). Basally born cells were tracked on average for 4.0 ± 0.2 sem h in Fiji on time-lapse Z-stack live-images (30 slices at 1 µm spacing) aquired using a 100x/1.4 OIL DIC N2 PL APO VC or a 100x/1.45 OIL PL APO L objective at 5 min intervals. 3D cell geometry To determine the 3D cell geometry in mud , mud pat RNAi and mud Eb1 RNAi , clones expressing a dsRNA against Pat or Eb1 were generated in mud tissues expressing the PH:GFP membrane marker. Subsequently, Z-stack live-images were acquired at 0.5 µm spacing using a 100x/1.4 OIL DIC N2 PL APO VC objective. Using the PH:GFP membrane marker we measured the cell height (h) and apical area (A) to determine the 3D cell shape, expressed as , in the double mutant clones and compared it to the mud tissue surrounding the double mutant clones. The student t -test was used to evaluate statistical significance between cells in mud and surrounding double mutant tissue. Quantification of apical protein intensity Quantification of apical protein intensity (Tub:GFP, Pat:tagRFP and Eb1:tdGFP) during cell reintegration was performed on Z-stack images (20-16 slices at 0.5 µm spacing) acquired at 2 min intervals using a 100x/1.4 OIL DIC N2 PL APO VC or a 100x/1.45 OIL PL APO L objective in tissue also expressing either E-Cad:GFP or E-Cad:3mKate2. To keep the focus of the tissue, autofocus detection (Metamorph software) was used for the duration of the imaging. The apical intensities were measured in Fiji on 2 µm average Z-stack projections around the E-Cad signal and by using the E-Cad signal to delineate the apical areas of the small and large siblings starting at 10 min after anaphase elongation ( t= 0 min). To measure the relative apical mean fluorescence intensity (MFI) in the reintegrating cell, and to enable to compare it with wt, the measured intensity of the largest sibling was subtracted from the intensity of the smallest sibling (in mud corresponding to the reintegrating cells as characterized by an apex area <10% of its sibling) and the resulting intensity differences for each condition (both wt and mutant) were normalized to the highest measured difference. To evaluate statistically significant differences in apical intensities a student t -test was performed at t= 10 min after anaphase onset. The absolute MFI in the reintegrating cell was calculated by dividing the measured intensity in the apex of the small reintegrating cell (after subtraction of the background intensity measured in out-of-focus plane) by the intensity measured in the entire tissue (after subtraction of the background intensity measured in out-of-focus plane). A paired t -test was performed to assess whether a statistically significant change in MFI occurred during reintegration, as calculated between the average measured intensities at 10-12 min and 36-38 min. Apical Sqh:3GFP MFI in cell junctions neighboring a reintegrating cell (+1N) in mud pat RNAi and mud w RNAi tissues, was measured on average projected images (1 µm) around the E-Cad:3mKate2 signal at t= 20-30 min after anaphase onset, that were acquired at 5 min intervals (20 Z-stack slices at 0.5 µm spacing) using a 100x/1.4 OIL DIC N2 PL APO VC or a 100x/1.45 OIL PL APO L objective. The measured bicellular junctional fluorescent intensity, measured between the vertices of neighboring cells using a line width of 0.65 µm in Fiji, was divided by the total MFI within the tissue. The student t -test was performed the determine statistically significant differences. Analyses of apical cap protein localization and formation To evaluate Pat:tagRFP, Tub:RFP and Eb1:tdGFP localization in the apical cap we imaged at high spatial resolution mud tissue co-expressing the PLCγPH:GFP (PH:GFP) or PLCγPH:ChFP (PH:ChFP) membrane markers that specifically bind the phosphoinositide, phosphatidylinositol biphosphate (PIP 2 ). 34 , 156 Due to photobleaching, we imaged only the apical domain using a 100x/1.4 OIL DIC N2 PL APO VC or a 100x/1.45 OIL PL APO L objective, acquiring Z-stack images (12 slices at 0.5 µm spacing) at 2 min intervals. Representative (selected from > n = 5 divisions) x-y and x-z images showing Pat:tagRFP, Tub:RFP and Eb1:tdGFP enrichment at t= 12 min after anaphase onset in the apical cap as well as PIP 2 were generated for reintegrating cells following a highly mis-oriented division using Fiji. To highlight apical cap enrichment in PIP 2 intensity, a semi-quantitative approach was used to render the image in a color-code reflecting the pixel intensity in the image (fire LUT), thereby highlighting the difference in intensity in the apical cap. To illustrate this PIP 2 enrichment in full 3D, we imaged PH:GFP in mud tissue using a 100x/1.4 OIL DIC N2 PL APO VC objective, acquiring Z-stack images (40 slices at 0.5 µm spacing) at 2 min intervals and generated representative (selected from > n = 5 divisions) x-y and x-z images in fire LUT using Fiji at t= 12 min after anaphase onset. A similar high resolution imaging protocol and was used to evaluate the apical cap localization of Kst:YFP, Ck:GFP, Shot:YFP, Par-1:GFP, Cad99C:GFP, RhoGEF2:sfGFP, Crb:GFP-A, Jup:GFP, Sas:sfGFP. To analyze apical cap formation in mud , mud pat RNAi and mud Eb1 RNAi , tissues expressing the PH:GFP membrane marker, with or without the YFP:Asl centrosome marker, were imaged at high spatiotemporal resolution (40-50 slices Z-stack with 0.5 µm spacing acquired every 2 min) using either a 100x/1.45 OIL PL APO L or a 100x/1.4 OIL DIC N2 PL APO VC objective. Cell divisions during which an apical cap was detected and subsequently followed either by an reintegration event or a delaminating daughter cell were mannually scored and used to determine differences amongst genotypes. The chi-square test was used to evaluate statistical significance. Representative divisions followed by a reintegration event or the production of only one epithelial daughter were segmented using Imaris software (Oxford Instruments) to follow their 3D geometry. Quantification of Ban3-GFP reporter and apex cell area To measure Hippo/YAP activity we used the Ban3-GFP reporter, whose nuclear intensity reflects Hippo/YAP pathway activity 88 , and analyzed daughter cells following division during the second division wave between 17 to 27 hAPF 70 , 71 within the previously defined ROI 85 and which was used to evaluate tissue cell number, division, and apoptosis rates. Thereto, we manually measured in Fiji, by drawing the nuclear outline, the mean Ban3-GFP intensity 60 min post anaphase in the daughter cells, in a single Z-plane of acquired Z-stack images (30 slices at 1.0 µm spacing acquired at 5 or 10 min intervals using a 63x/1.4 OIL DICII PL APO objective) at the center of the nucleus (along the AB tissue axis) in tissue expressing both Ban3-GFP and PH:ChFP to label the cell contours. Dividing cells were visually identified by rounding and apical area expansion. The time of maximum apex area expansion and rounding, prior to anaphase elongation, was set as the 0 min reference. The measured mean nuclear intensity was first corrected for background signal by subtracting the mean background signal (e.g. measured in out-of-focus plane), and subsequently divided by the mean tissue intensity measured in the entire tissue at the same Z-plane as for each individual nucleus. For each daughter cell the corresponding apex area was measured at the most apical plane using the PH:ChFP marker. To compare the intensity in mud and wt daughter cells, cells were binned according to their estimated initial mother cells apex area. Thereto, we used the sum of the two wt siblings and the apex area of the lone epithelial mud daughter 60 min post-anaphase, which we found correlated well with the initial mother cells apex area at -60 min pre-anaphase (R 2 = 0.84 for n= 77 wt cells, and R 2 = 0.63 for n= 64 cells mud , see Figure S5F ). To evaluate statistical significance between wt and mud apex area bins we used ANOVA with post-hoc Tukey test. Figure display and movies All movies and images in the manuscript represent maximum intensity projections and were subjected to denoising, bleach correction and contrast enhancement using, Corel PaintShop Pro, Adobe Photoshop and/or Fiji plugins to improve their visual display. Statistics Apart for the full cell tracking in scutellum tissue of Sas-4 mutants ( N= 2), for all analyses samples were taken from at least 3 different animals. The number of cells ( n ) or animals ( N ) analyzed are provided in each figure. The statistical tests used for analyses are indicated in the figure legends and each Methods section. An f -test was performed to determine whether the variances amongst conditions differed prior to using the student t -test. Data availability All the datasets presented in this manuscript are available from the corresponding authors upon reasonable request. Key resources table View this table: View inline View popup Declaration of Interests Y.B. is a Developmental Cell advisory board member. Author contributions F.B. and Y.B. designed the project and experiments; F.B., E.v.L., S.A., and R.T. performed experiments and analyzed the data; B.T. wrote the code for and ran the simulations; F.B. prepared the figures and videos; Y.B. secured funding for the work; F.B. and Y.B. wrote the manuscript. Download figure Open in new tab Figure S1. RNAi knock-down efficiency, MT protein localization, intensity and contribution to division orientation, cell shape and reintegration dynamics in wt and mutant conditions. Related to Figure 2 . (A) Top view live image of a Nrg RNAi expressing clone at 14 hAPF (marked by mRFP) in wt notum tissue expressing Nrg:GFP showing the efficacy of Nrg RNAi knock-down. (B) Top view live image of a FasII RNAi expressing clone at 14 hAPF (marked by mRFP) in wt notum tissue expressing FasII:YFP showing the efficacy of FasII RNAi knock-down. (C) Top view live image of a FasIII RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing FasIII:GFP showing the efficacy of FasIII RNAi knock-down. (D) Top view live image of an aka RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing Aka:sfGFP showing the efficacy of Aka RNAi knock-down. (E) Top view live image of a Gli RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing Gli:YFP showing the efficacy of Gli RNAi knock-down. (F) Top view live image of a M6 RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing M6:GFP showing the efficacy of M6 RNAi knock-down. (G) Top view live image of an E-Cad RNAi expressing clone at 14 hAPF (marked by mRFP) in wt notum tissue expressing E-Cad:GFP showing the efficacy of E-Cad RNAi knock-down. (H) Top view image of a á Cat RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in a fixed wt notum tissue labelled with antibodies against αCat showing the efficacy of αCat RNAi knock-down. (I) AB view live image showing apical Pat:tagRFP localization in mud tissue co-expressing PH:GFP. (J) AB view live image showing apical E-Cad:3mKate2 localization in mud tissue co-expressing PH:GFP. (K) Top view live images of apical Tub:RFP and PH:GFP localization in a lone daughter cell (blue asterisk) at t = 12 min after anaphase onset following a mis-oriented division producing a single epithelial daughter and a daughter that failed to reintegrate (note the absence of an apical cap). Representative images of n= 9 divisions. (L) Top view live images of apical Pat:tagRFP and PH:GFP localization in a lone daughter cell (blue asterisk) at t = 12 min after anaphase onset following a mis-oriented division producing a single epithelial daughter and a daughter that failed to reintegrate (note the absence of an apical cap). Representative images of n= 8 divisions. (M) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud pat OE tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (N) Top view live image of a pat RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing Pat:GFP showing the efficacy of Pat RNAi knock-down. (O) Graph of áAB at t= -2 min prior to anaphase onset in wt, wRNAi , mud and mud w RNAi , plotted as cumulative percentage. The αAB in wt and wRNAi are not different ( p <0.8690, Mann-Whitney U test). The αAB in mud and mud wRNAi are not different ( p <0.4277, Mann-Whitney U test). n , number of cells analyzed. (P) Graph of the AB spindle orientation (áAB) at t= -2 min prior to anaphase onset in wRNAi , patRNAi , mud w RNAi and mud pat RNAi , plotted as cumulative percentage. The αAB in wRNAi and patRNAi are not different ( p <0.1192, Mann-Whitney U test). The αAB in mud w RNAi and mud pat RNAi are not different ( p <0.1778, Mann-Whitney U test). n , number of cells analyzed. (Q) AB view live image of mud tissue expressing the PH:ChFP membrane marker and harboring a pat RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX). (R) Graph of the 3D cell geometry measured as the square-root of the cell apex area divided by the cell height (mean ± sem) in mud and neighboring mud pat RNAi mosaic tissue. ns, not significant, student t -test. n , number of cells analyzed. (S) The left top view live image shows apical Pat:tagRFP localization at t= 16 min after anaphase onset in a small daughter cell (red arrowhead) following a highly mis-oriented division in Sas-4 tissue co-expressing E-Cad:GFP. Blue asterisk, large sibling. The right graph shows the evolution of the normalized Pat:tagRFP mean apical fluorescence intensity ( MFI ± sem) measured in the smallest daughter cells as compared to their larger siblings upon division in wt and Sas-4 tissues. *** p <0.0001, student t -test at t= 10 min. n , number of cells analyzed. (T) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud and Sas-4 tissues (mean % of the sum of the apex areas are of the two siblings ± sem, sliding average 30 min). Lines indicate t 1/2 , the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned cells is not significantly different between mud and Sas-4 tissues. ns, not significant, student t -test. n , number of cells analyzed. Scale bars: 1 µm (I-L, S), 5 µm (Q), 15 µm (A-H, N). Download figure Open in new tab Figure S2. The apical transmembrane receptor Sas modulates Pat localization and cell reintegration. Related to Figure 3 . (A-H) Top view live images of the apical cap (red arrowheads) localization of selected protein candidates at t= 12 min after anaphase onset upon cell reintegration in mud tissue co-expressing PH:ChFP: Kst:GFP (A), Ck:GFP (B), Shot:YFP (C), Par-1:GFP (D), Cad99C:GFP (E), RhoGEF2:sfGFP (F), Crb:GFP-A (G), Jup:GFP (H). Representative images of n= > 5 divisions. Blue asterisk, large sibling. For each condition, the graph of the delamination/reintegration ratio (R d/r ) in mud , and double mutant tissue normalized to the R d/r in mud is shown (right graph of each panel). ns, not significant, chi-square test. n , number of divisions analyzed. (I) Graphs of the delamination/reintegration ratios (R d/r ) in mud , and mud Tao RNAi , mud cyst RNAi , mud Mbs RNAi , mud Sec5 RNAi , mud Rab35 RNAi , mud nuf RNAi , mud Pi3K92E OE tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (J) Top view live images of the apical cap (red arrowheads) localization of Sas:sfGFP and PH:ChFP at t= 12 min after anaphase onset upon cell reintegration in mud tissue. Representative images of n= > 5 divisions. Blue asterisk, large sibling. (K) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud sas RNAi tissue normalized to the R d/r in mud . * p <0.05, chi-square test. n , number of divisions analyzed. (L) Top view live image of a sas RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing Sas:sfGFP showing the efficacy of Sas RNAi knock-down. (M-N) Top view live images of a sas RNAi clone (marked by tagBFP:CAAX, indicated by the yellow dashed lines) in mud tissue at 14 hAPF showing Pat:tagRFP and E-Cad:GFP localization in a reintegrating cell (red arrowheads) in double mutant mud sas RNAi (M) and surrounding mud tissue (N). Note the apical Pat:tagRFP delocalization from the medial cell apex to the cell junctions upon sas RNAi . Bottom images are close-ups of the boxed regions in M and N, respectively (scale bars, 1 µm). Blue asterisks, large siblings. Scale bars: 1 µm (A-H, J), 10 µm (M, N), 15 µm (L). Download figure Open in new tab Figure S3. Eb1 localization, contribution to division orientation, cell shape and reintegration dynamics in wt and mud . Related to Figure 3 . (A) Top view live images of apical Eb1:tdGFP and PH:ChFP localization in a lone daughter cell (blue asterisk) at t = 12 min after anaphase onset following a mis-oriented division producing a single epithelial daughter and a daughter that failed to reintegrate (note the absence of an apical cap). Representative images of n= 13 divisions. (B) Top view live image of a Eb1 RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX) in wt notum tissue expressing Eb1:tdGFP showing the efficacy of Eb1 RNAi knock-down. (C) Graph of the delamination/reintegration ratio (R d/r ) in mud , and mud Eb1 OE tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. (D) Graph of áAB at t= -2 min prior to anaphase onset in w RNAi , Eb1 RNAi , mud w RNAi and mud Eb1 RNAi , plotted as cumulative percentage. The αAB in w RNAi and Eb1 RNAi are not different ( p <0.5512, Mann-Whitney U test). The αAB in mud w RNAi and mud Eb1 RNAi are not different ( p <0.0775, Mann-Whitney U test). n , number of cells analyzed. (E) AB view live image of mud tissue expressing the PH:ChFP membrane marker and harboring an Eb1 RNAi expressing clone at 14 hAPF (marked by tagBFP:CAAX). (F) Graph of the 3D cell geometry measured as the square-root of the cell apex area divided by the cell height (mean ± sem) in mud and neighboring mud Eb1 RNAi mosaic tissue. ns, not significant, student t -test. n , number of cells analyzed. (G) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud w RNAi and mud Eb1 RNAi tissues (% of the sum of the apex areas of the two siblings ± sem, sliding average 30 min). Lines indicate t 1/2 , the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned cells is not significantly different between w RNAi and mud Eb1 RNAi tissues. ns, not significant, student t -test. n , number of cells analyzed. (H) Graph of the apex area dynamics of the small daughter cells (initial apex area <10% of its sibling) in mud w RNAi and mud pat RNAi tissues (mean % of the sum of the apex areas of the two siblings ± sem, sliding average 30 min). Lines indicate t 1/2 , the time to reach halfway of the predicted area (i.e. 50% of the mother apex area). The t 1/2 of mispositioned cells is not significantly different between w RNAi and mud pat RNAi tissues. ns, not significant, student t -test. n , number of cells analyzed. (I) Graph of the Tub:GFP mean apical fluorescence intensity ( MFI ± sem) in reintegrating cells in mud tissue at two time points after anaphase onset (MFI at 10-12 min and 36-38 min were averaged). ns, not significant, student t -test. n , number of cells analyzed (for the same cells the evolution of the apical MFI in the small sibling as compared to its larger daughters are shown in Figure 2H ). (J) Graph of the Pat:tagRFP mean apical fluorescence intensity ( MFI ± sem) in reintegrating cells in mud tissue at two time points after anaphase onset (MFI at 10-12 min and 36-38 min were averaged). * p <0.05, student t -test. n , number of cells analyzed (for the same cells the evolution of the apical MFI in the small sibling as compared to its larger daughters are shown in Figure 3B ). (K) Graph of the Eb1:tdGFP mean apical fluorescence intensity ( MFI ± sem) in reintegrating cells in mud tissue at two time points after anaphase onset (MFI at 10-12 min and 36-38 min were averaged). ns, not significant, student t -test. n , number of cells analyzed (for the same cells the evolution of the apical MFI in the small sibling as compared to its larger daughters are shown in Figure 3E ). Scale bars: 1 µm (A), 5 µm (E), 15 µm (C). Download figure Open in new tab Figure S4. Apical actomyosin localization and analyses of junction tension during cell reintegration in mud and upon Pat loss of function. Related to Figure 4 . (A) Top view time-lapse images of apical MyoII regulatory light chain Sqh:GFP and Sqh:ChFP 152 patches 169 in mud tissue following a planar cell division (top panels) and a highly mis-oriented division producing a reintegrating daughter cell (bottom panels, red arrowheads). Representative images of n= 5 divisions. White asterisks, dividing cell at anaphase onset t = 0 min. Blue and red asterisks indicate tissue resident daughter cells following division. (B) Top view live images at t= 25-26 min after anaphase onset of apical AniRBD:GFP (a), UtrABD:GFP (b), Rok:GFP (c), and Sqh:3GFP (d) as well as E-Cad:3mKate2 in mud tissue following a highly mis-oriented division producing a reintegrating daughter cell (red arrowheads). Representative images of n= > 3 divisions. Blue asterisks, tissue resident daughter cells following division. (C) Top view time-laps images of apical E-Cad:GFP in mud tissue prior to ( t 0 = 0 sec) and after ablation ( t 7 = 3.92 sec) of a cell junction neighboring a reintegrating cell (+1N) as well as a junction belonging to a cell 2 cell distances away from a reintegrating cell (+2N). Red arrowhead, reintegrating cell. Red arrows, sites of junction ablation. (D) Graph of the +1N/+2N ratio of the recoil velocity (between t 7 - t 0 , mean ± sem) upon laser ablation of cell junctions neighboring a reintegrating cell (+1N) as well as junctions belonging to a cell 2 cell distances away from the reintegrating cell (+2N) in mud tissue. ns, not significant, paired student t -test. n , number of cells analyzed. (E) Graph of the +1N recoil velocity (between t 7 - t 0 , mean ± sem) upon laser ablation of cell junctions neighboring a reintegrating cell in mud w RNAi and mud pat RNAi tissue. ns, not significant, student t -test. n , number of cells analyzed. (F) Graph of the +1N Sqh:3GFP mean apical fluorescence intensity ( MFI ± sem) at cell junctions neighboring a reintegrating cell in mud w RNAi and mud pat RNAi tissue. ns, not significant, student t -test. n , number of cells analyzed. Scale bars: 1 µm (A, B), 2 µm (C). Download figure Open in new tab Figure S5. Characterization of wt, mud and Sas-4 cell and tissue dynamics. Related to Figure 5 . (A) Graphs of the tissue cell number fold increase (a)(relative to the initial cell number, mean ± sem), the total division rate (b), and the apoptosis rate (c)(rates relative to the initial cell number, mean ± sem, sliding average 60 min) in wt and Sas-4 scutellum tissue. N , hemi-scutella analyzed. (B) Graph of the tissue cell number fold increase (relative to the initial cell number, mean ± sem) in wt and mud scutellum tissue, as well as the simulated tissue cell number fold increase in mud with the wt apoptosis rate (green curve), and mud without compensatory mechanisms, hence, incorporating the wt apoptosis and division rates (blue curve). Note that for the simulation of mud without compensatory mechanisms, the rate of successful divisions producing two daughter cells in mud is applied to the wt division rate (see Methods). The simulation curves illustrate the extent to which apoptosis and division compensate for the cell loss due to mis-oriented divisions. N , hemi-scutella analyzed. For wt and mud the same data are shown in Figure 5A . (C) Graph of the tissue cell number fold increase (relative to the initial cell number, mean ± sem) in wt and Sas-4 scutellum tissue, as well as the simulated tissue cell number fold increase in Sas-4 with the wt apoptosis rate (green curve), and Sas-4 without compensatory mechanisms, hence, incorporating the wt apoptosis and division rates (blue curve). Note that for the simulation of Sas-4 without compensatory mechanisms, the rate of successful divisions producing two daughter cells in Sas-4 is applied to the wt division rate (see Methods). The simulation curves illustrate the extent to which apoptosis and division compensate for the cell loss due to mis-oriented divisions. N , hemi-scutella analyzed. For wt and Sas-4 the same data are shown in Figure S5A . (D, E) Representative time-lapse images (D) and kymograph (E) of a highly mis-oriented division producing a lone epithelial daughter in mud tissue expressing E-Cad:3mKate2 and GCaMP Ca 2+ reporter. Note that mis-oriented division is not associated with elevated calcium signaling. Representative images of n= 7 divisions. t= 0 min, anaphase onset. Dashed box, region plotted as a kymograph. White asterisks, dividing cell. Blue asterisks, lone sibling. (F) Graph of the correlation between the apex area of the mother cell -60 min prior to anaphase onset ( t= 0 min) and the area of the daughter cells (sum of the area of the siblings for wt and the area of the lone sibling in mud after division mis-orientation) +60 min after anaphase onset. Both correlate well in wt and mud tissues (dashed lines). R 2 for wt (0.84) and mud (0.63). n , number of divisions analyzed. (G) Graphs of the tissue cell number fold increase (a)(relative to the initial cell number, mean ± sem), the total division rate (b), and the apoptosis rate (c)(rates relative to the initial cell number, mean ± sem, sliding average 60 min) in wt w RNAi and mud w RNAi medial scutellum tissue. N , hemi-scutella analyzed. (H) Graphs of the cumulative divisions and apoptosis (% of initial cell number, mean ± sem) in wt w RNAi and mud w RNAi medial scutellum tissue. The final cumulative apoptosis is significantly different between wt w RNAi and mud w RNAi . *** p <0.001, student t -test. N , hemi-scutella analyzed. (I) Graph of the delamination/reintegration ratio (R d/r ) in mud and mud Actn RNAi tissue normalized to the R d/r in mud . ns, not significant, chi-square test n , number of divisions. Scale bars: 5 µm (D), 10 min (E). Download figure Open in new tab Figure S6. Basally born cells destined to delaminate lack aPKC and can renter S-phase upon grnd RNAi , but do not contribute to tissue cell number regulation. Related to Figure 6 . (A) AB view time-lapse images of PH:ChFP and GFP:aPKC in mud tissue upon a highly mis-oriented division producing a lone epithelial daughter cell. The apical GFP:aPKC marker does not accumulate at the most apical domain (white arrows) in the basally born daughter cell (red asterisks). Representative images of n= 5 divisions. White asterisk, dividing cell at anaphase onset t = 0 min. Blue asterisks, tissue remaining sibling. (B) Fixed wt notum tissue top view image showing PCNA:GFP and BrdU colocalization at 15 hAPF after a 30 min pulse of BrdU incorporation in ex vivo culture. Note that PCNA:GFP replication foci colocalize with sites of strong BrDU incorporation (white arrowheads). DNA is labelled with DAPI. (C) Top view time-lapse images of PCNA:GFP and PH:ChFP from -20 min to 165 min after anaphase onset ( t= 0 min) of a dividing cell in mud w RNAi tissue producing a lone epithelial daughter (white arrows). In time the delaminated cell undergoes nucleus fragmentation as evidenced by the presence of multiple PCNA:GFP structures within the cell ( t= 165 min). 17 out of 17 tracked cell displayed such apoptotic feature. White asterisk, dividing cell. White outlines, cell mask based on PH:ChFP labelling. (D) Top view time-lapse images of PCNA:GFP and PH:ChFP from -20 min to 170 min after anaphase onset ( t= 0 min) of a dividing cell in mud grnd RNAi tissue producing a lone epithelial daughter (white arrows). In time the delaminated cell undergoes S-phase entry as evidenced by the presence of multiple PCNA:GFP DNA replication foci within the nucleus (white arrowhead at t= 170 min). 5 out of 19 tracked cell displayed such reentry into S-phase. White asterisk, dividing cell. White outlines, cell mask based on PH:ChFP labelling. (E) Graphs of the tissue cell number fold increase (a)(relative to the initial cell number, mean ± sem), the total division rate (b) and the apoptosis rate (c)(rates relative to the initial cell number, mean ± sem, sliding average 60 min) in mud Act5c>w RNAi and mud Act5c>grnd RNAi tissues. N , hemi-scutella analyzed. (F) Graph of the delamination/reintegration ratio (R d/r ) in mud and mud grnd RNAi tissue normalized to the R d/r in mud . ns, not significant, chi-square test. n , number of divisions analyzed. Scale bars: 1 µm. Video S1. Apical top view time-lapse series of dividing cells (asterisks) in wt (left) and mud notum tissue expressing E-Cad:GFP. The second panel shows a mud division producing two daughter cells of unequal apex area, the third panel a highly mis-oriented division resulting in a mispositioned daughter cell that reintegrates back within the epithelium (arrows), while the right panel shows a division that result in the production of only one epithelial daughter cell. Video S2. 3D segmented time-lapse series of a highly mis-oriented division in mud tissue showing the reintegration of a mispositioned daughter cell (red cell) relative to its sibling with larger apex area (blue cell) (left), as well as a mis-oriented division producing a lone epithelial daughter (blue cell) and a delaminating daughter (red cell) (right). Video S3. Apical top view time-lapse series of Tub:GFP and E-Cad:3mKate2 (top panels), Pat:tagRFP and E-Cad:GFP (middle panels), and Eb1:GFP and E-Cad:3mKate2 (bottom panels) in mud tissue showing a highly mis-oriented division (white asterisk) resulting in the reintegration of a mispositioned daughter (arrows). Note that Tub:GFP, Pat:tagRFP and Eb1:GFP are enriched in the smaller sibling as compared to its larger sibling. Video S4. Apical top view time-lapse series of tissue expressing the PH:GFP membrane marker illustrating the formation of an apical cap preceding cell reintegration (arrows) and absence of apical cap formation upon division that resulted in the formation of only one epithelial daughter in mud tissue (top left and right respectively). Initiation of apical cap formation (arrows) is observed in mud pat RNAi and mud Eb1 RNAi tissues, but is followed by the production of only one epithelial daughter cell (bottom left and right respectively). Asterisks, dividing cells. Video S5. Apical top view time-lapse series of Jup:GFP and E-Cad:3mKate2 in mud tissue following ablation of the medial cortex and of the surrounding cells (top versus bottom panels) of a mispositioned daughter with small apex area (white asterisks). Video S6. Apical top view time-lapse series of E-Cad:3mKate2 showing a reintegrating daughter cell (arrows) following a highly mis-oriented division (asterisk) in mud zip DN tissue (left), and a reintegrating daughter cell (arrows) upon a highly mis-oriented division (asterisk) in mud tissue neighboring mud tissue over-expressing zip DN (indicated by yellow dashed lines)(right). Acknowledgments We thank Richard G. Fehon, Stefan Luschnig, Enrique Martín-Blanco, Jose Pastor-Pareja, Yu-Chiun Wang, the Bloomington Drosophila Stock Center, Transgenic RNAi Project at Harvard Medical School, Vienna Drosophila Resource Center, Kyoto Drosophila Stock Center, and the Developmental studies Hybridoma Bank for reagents; the department of genetics and developmental biology imaging facility PICT-IBiSA@BDD for help with microscopy; Lale Alpar, Florencia di Pietro, and Mari W. Yoshida for valuable comments on the manuscript. This work was supported by Institut Curie, CNRS, INSERM, ERC Advanced Scaling-Sensitivity (101020243), ARC (SL220130607097), ANR (TiMecaDiv 20CE13000801), ANR (ChronoDamage 20CE13-0013), CANCERO-INCA (PLBIO2020/BELLAICHE), ANR Labex DEEP (11-LBX-0044, ANR-10-IDEX-0001-02). Funder Information Declared ERC Fondation ARC pour la Recherche sur le Cancer, https://ror.org/0489qz649 , SL220130607097 Agence Nationale de la Recherche, https://ror.org/00rbzpz17 , TiMecaDiv 20CE13000801 , ChronoDamage 20CE13-0013 , 11-LBX-0044, ANR-10-IDEX-0001-02 CANCERO-INCA , PLBIO2020/BELLAICHE Centre National de la Recherche Scientifique, https://ror.org/02feahw73 , UMR 3215 Inserm, https://ror.org/02vjkv261 , U934 Institut Curie, https://ror.org/04t0gwh46 , UMR 3215 U934 References 1. ↵ Vasillev , J. M. , Omelchenko , T. , Gelfand , I. M. , Feder , H. H. & Bonder , E. M . Rho overexpression leads to mitosis-associated detachment of cells from epithelial sheets: a link to the mechanism of cancer dissemination . Proc Natl Acad Sci U S A 101 , 12526 – 12530 ( 2004 ). OpenUrl Abstract / FREE Full Text 2. ↵ Fleming , E. S. , Temchin , M. , Wu , Q. , Maggio-Price , L. & Tirnauer , J. S . Spindle misorientation in tumors from APC(min/+) mice . Mol Carcinog 48 , 592 – 598 ( 2009 ). OpenUrl CrossRef PubMed 3. Pease , J. C. & Tirnauer , J. S . Mitotic spindle misorientation in cancer--out of alignment and into the fire . J Cell Sci 124 , 1007 – 1016 ( 2011 ). OpenUrl Abstract / FREE Full Text 4. ↵ Noatynska , A. , Gotta , M. & Meraldi , P . Mitotic spindle (DIS)orientation and DISease: cause or consequence? J Cell Biol 199 , 1025 – 1035 ( 2012 ). OpenUrl Abstract / FREE Full Text 5. Quyn , A. J. et al. Spindle orientation bias in gut epithelial stem cell compartments is lost in precancerous tissue . Cell Stem Cell 6 , 175 – 181 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 6. ↵ Nakajima , Y. I. , Meyer , E. J. , Kroesen , A. , McKinney , S. A. & Gibson , M. C . Epithelial junctions maintain tissue architecture by directing planar spindle orientation . Nature 500 , 359 – 362 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 7. ↵ Poulton , J. S. , Cuningham , J. C. & Peifer , M . Acentrosomal Drosophila Epithelial Cells Exhibit Abnormal Cell Division, Leading to Cell Death and Compensatory Proliferation . Dev Cell 30 , 731 – 745 ( 2014 ). OpenUrl CrossRef PubMed 8. ↵ Lechler , T. & Mapelli , M . Spindle positioning and its impact on vertebrate tissue architecture and cell fate . Nature Reviews Molecular Cell Biology vol. 22 691 – 708 Preprint at doi: 10.1038/s41580-021-00384-4 ( 2021 ). OpenUrl CrossRef PubMed 9. Morin , X. & Bellaïche , Y. Mitotic Spindle Orientation in Asymmetric and Symmetric Cell Divisions during Animal Development . Developmental Cell vol. 21 102 – 119 Preprint at doi: 10.1016/j.devcel.2011.06.012 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 10. ↵ di Pietro , F. , Echard , A. & Morin , X . Regulation of mitotic spindle orientation: an integrated view . EMBO Rep 17 , 1106 – 1130 ( 2016 ). OpenUrl Abstract / FREE Full Text 11. ↵ van Leen , E. V. , di Pietro , F. & Bellaïche , Y . Oriented cell divisions in epithelia: from force generation to force anisotropy by tension, shape and vertices . Curr Opin Cell Biol 62 , 9 – 16 ( 2020 ). OpenUrl CrossRef PubMed 12. ↵ Zhou , Z. , Alégot , H. & Irvine , K. D . Oriented Cell Divisions Are Not Required for Drosophila Wing Shape . Current Biology 29 , 856 – 864 .e3 ( 2019 ). OpenUrl CrossRef PubMed 13. ↵ Bergstralh , D. T. , Lovegrove , H. E. & St. Johnston , D . Lateral adhesion drives reintegration of misplaced cells into epithelial monolayers . Nat Cell Biol 17 , 1497 – 1503 ( 2015 ). OpenUrl CrossRef PubMed 14. ↵ Cammarota , C. , Finegan , T. M. , Wilson , T. J. , Yang , S. & Bergstralh , D. T . An Axon-Pathfinding Mechanism Preserves Epithelial Tissue Integrity . Current Biology 30 , 5049 – 5057 .e3 ( 2020 ). OpenUrl CrossRef PubMed 15. ↵ Taubenberger , A. V. , Baum , B. & Matthews , H. K . The Mechanics of Mitotic Cell Rounding . Front Cell Dev Biol 8 , ( 2020 ). 16. ↵ Hoffmann , I . Centrosomes in mitotic spindle assembly and orientation . Curr Opin Struct Biol 66 , 193 – 198 ( 2021 ). OpenUrl CrossRef PubMed 17. Chanet , S. , Sharan , R. , Khan , Z. & Martin , A. C . Myosin 2-Induced Mitotic Rounding Enables Columnar Epithelial Cells to Interpret Cortical Spindle Positioning Cues . Current Biology 27 , 3350 – 3358 .e3 ( 2017 ). OpenUrl CrossRef PubMed 18. Luxenburg , C. , Amalia Pasolli , H. , Williams , S. E. & Fuchs , E . Developmental roles for Srf, cortical cytoskeleton and cell shape in epidermal spindle orientation . Nat Cell Biol 13 , 203 – 214 ( 2011 ). OpenUrl CrossRef PubMed Web of Science 19. ↵ Minc , N. & Piel , M. Predicting division plane position and orientation . Trends in Cell Biology vol. 22 193 – 200 Preprint at doi: 10.1016/j.tcb.2012.01.003 ( 2012 ). OpenUrl CrossRef PubMed 20. ↵ Bosveld , F. et al. Epithelial tricellular junctions act as interphase cell shape sensors to orient mitosis . Nature 530 , 495 – 498 ( 2016 ). OpenUrl CrossRef PubMed 21. ↵ Herszterg , S. , Leibfried , A. , Bosveld , F. , Martin , C. & Bellaiche , Y . Interplay between the Dividing Cell and Its Neighbors Regulates Adherens Junction Formation during Cytokinesis in Epithelial Tissue . Dev Cell 24 , 256 – 270 ( 2013 ). OpenUrl CrossRef PubMed Web of Science 22. ↵ Seldin , L. , Muroyama , A. & Lechler , T . NuMA-microtubule interactions are critical for spindle orientation and the morphogenesis of diverse epidermal structures . Elife 5 , ( 2016 ). 23. ↵ Monster , J. L. et al. Cell division-dependent dissemination following E-cadherin loss underlies initiation of diffuse-type gastric cancer . J Pathol 263 , 226 – 241 ( 2024 ). OpenUrl CrossRef PubMed 24. ↵ Wilson , T. J. & Bergstralh , D. T . Cell reintegration: Stray epithelial cells make their way home . Bioessays 39 , ( 2017 ). 25. ↵ Daniel , E. et al. Coordination of Septate Junctions Assembly and Completion of Cytokinesis in Proliferative Epithelial Tissues . Current Biology 28 , 1380 – 1391 .e4 ( 2018 ). OpenUrl CrossRef PubMed 26. ↵ Wang , Z. , Bosveld , F. & Bellaïche , Y . Tricellular junction proteins promote disentanglement of daughter and neighbour cells during epithelial cytokinesis . J Cell Sci ( 2018 ) doi: 10.1242/jcs.215764 . OpenUrl Abstract / FREE Full Text 27. ↵ Sedzinski , J. , Hannezo , E. , Tu , F. , Biro , M. & Wallingford , J. B . Emergence of an Apical Epithelial Cell Surface In Vivo . Dev Cell 36 , 24 – 35 ( 2016 ). OpenUrl CrossRef PubMed 28. ↵ Ventura , G. et al. Multiciliated cells use filopodia to probe tissue mechanics during epithelial integration in vivo . Nat Commun 13 , ( 2022 ). 29. ↵ Byri , S. et al. The Triple-Repeat Protein Anakonda Controls Epithelial Tricellular Junction Formation in Drosophila . Dev Cell 33 , 535 – 548 ( 2015 ). OpenUrl CrossRef PubMed 30. ↵ Schulte , J. , Tepass , U. & Auld , V. J . Gliotactin, a novel marker of tricellular junctions, is necessary for septate junction development in Drosophila . Journal of Cell Biology 161 , 991 – 1000 ( 2003 ). OpenUrl Abstract / FREE Full Text 31. ↵ Dunn , B. S. , Rush , L. , Lu , J.-Y. & Xu , T . Mutations in the Drosophila tricellular junction protein M6 synergize with RasV12 to induce apical cell delamination and invasion . Proceedings of the National Academy of Sciences 115 , 8358 – 8363 ( 2018 ). OpenUrl Abstract / FREE Full Text 32. ↵ Pinheiro , D. & Bellaïche , Y . Mechanical Force-Driven Adherens Junction Remodeling and Epithelial Dynamics . Dev Cell 47 , 3 – 19 ( 2018 ). OpenUrl CrossRef PubMed 33. ↵ Lecuit , T. & Yap , A. S . E-cadherin junctions as active mechanical integrators in tissue dynamics . Nature Cell Biology vol. 17 533 – 539 Preprint at doi: 10.1038/ncb3136 ( 2015 ). OpenUrl CrossRef PubMed 34. ↵ Pinal , N. et al. Regulated and polarized PtdIns(3,4,5)P3 accumulation is essential for apical membrane morphogenesis in photoreceptor epithelial cells . Current Biology 16 , 140 – 149 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 35. ↵ McNally , F. J. & Vale , R. D . Identification of katanin, an ATPase that severs and disassembles stable microtubules . Cell 75 , 419 – 429 ( 1993 ). OpenUrl CrossRef PubMed Web of Science 36. ↵ Hartman , J. J. et al. Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40-containing subunit . Cell 93 , 277 – 287 ( 1998 ). OpenUrl CrossRef PubMed Web of Science 37. ↵ Petry , S. & Vale , R. D . Microtubule nucleation at the centrosome and beyond . Nat Cell Biol 17 , 1089 – 1093 ( 2015 ). OpenUrl CrossRef PubMed 38. ↵ Collins , C. , Majekodunmi , A. & Mitchell , B . Centriole Number and the Accumulation of Microtubules Modulate the Timing of Apical Insertion during Radial Intercalation . Current Biology 30 , 1958 – 1964 .e3 ( 2020 ). OpenUrl CrossRef PubMed 39. ↵ Basto , R. et al. Flies without Centrioles . Cell 125 , 1375 – 1386 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 40. ↵ Wu , J. & Akhmanova , A. Microtubule-Organizing Centers . Annu Rev Cell Dev Biol 33 , 51 – 75 ( 2017 ). OpenUrl CrossRef PubMed 41. Sanchez , A. D. & Feldman , J. L . Microtubule-organizing centers: from the centrosome to non-centrosomal sites . Curr Opin Cell Biol 44 , 93 – 101 ( 2017 ). OpenUrl CrossRef PubMed 42. ↵ Nashchekin , D. , Fernandes , A. R. & St Johnston , D . Patronin/Shot Cortical Foci Assemble the Noncentrosomal Microtubule Array that Specifies the Drosophila Anterior-Posterior Axis . Dev Cell 38 , 61 – 72 ( 2016 ). OpenUrl CrossRef PubMed 43. Goodwin , S. S. & Vale , R. D . Patronin Regulates the Microtubule Network by Protecting Microtubule Minus Ends . Cell 143 , 263 – 274 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 44. ↵ Li , W. et al. Reconstitution of dynamic microtubules with drosophila XMAP215, EB1, and sentin . Journal of Cell Biology 199 , 849 – 862 ( 2012 ). OpenUrl Abstract / FREE Full Text 45. ↵ Takeda , M. , Sami , M. M. & Wang , Y. C . A homeostatic apical microtubule network shortens cells for epithelial folding via a basal polarity shift . Nat Cell Biol 20 , 36 – 45 ( 2018 ). OpenUrl CrossRef PubMed 46. ↵ Guru , A. , Saravanan , S. , Sharma , D. & Narasimha , M . The microtubule end-binding proteins EB1 and Patronin modulate the spatiotemporal dynamics of myosin and pattern pulsed apical constriction . Development 149 , ( 2022 ). 47. Takeda , M. , Sami , M. M. & Wang , Y.-C . A homeostatic apical microtubule network shortens cells for epithelial folding via a basal polarity shift . Nat Cell Biol 20 , 36 – 45 ( 2018 ). OpenUrl CrossRef PubMed 48. ↵ Khanal , I. , Elbediwy , A. , de la Loza , M. del C. D. , Fletcher , G. C. & Thompson , B. J. Shot and Patronin polarise microtubules to direct membrane traffic and biogenesis of microvilli in epithelia . J Cell Sci 129 , 2651 – 2659 ( 2016 ). OpenUrl Abstract / FREE Full Text 49. ↵ Ramírez-Moreno , M. , Hunton , R. , Strutt , D. & Bulgakova , N. A . Deciphering the roles of cell shape and Fat and Dachsous planar polarity in arranging the Drosophila apical microtubule network through quantitative image analysis . Mol Biol Cell 34 , ( 2023 ). 50. Gillard , G. & Röper , K . β-H-Spectrin is a key component of an apical-medial hub of proteins during cell wedging in tube morphogenesis . J Cell Sci 137 , ( 2024 ). 51. ↵ Gillard , G. , Girdler , G. & Röper , K . A release- and-capture mechanism generates an essential non-centrosomal microtubule array during tube budding . Nat Commun 12 , ( 2021 ). 52. Booth , A. J. R. , Blanchard , G. B. , Adams , R. J. & Röper , K . A Dynamic microtubule cytoskeleton directs medial actomyosin function during tube formation . Dev Cell 29 , 562 – 576 ( 2014 ). OpenUrl CrossRef PubMed 53. ↵ Röper , K . Microtubules enter centre stage for morphogenesis . Philos Trans R Soc Lond B Biol Sci 375 , ( 2020 ). 54. Chung , S. Y. & Andrew , D. J . Cadherin 99C regulates apical expansion and cell rearrangement during epithelial tube elongation . Development 141 , 1950 – 1960 ( 2014 ). OpenUrl Abstract / FREE Full Text 55. Miao , H. & Blankenship , J. T . The pulse of morphogenesis: actomyosin dynamics and regulation in epithelia . Development 147 , ( 2020 ). 56. Glowinski , C. , Liu , R. H. S. , Chen , X. , Darabie , A. & Godt , D . Myosin VIIA regulates microvillus morphogenesis and interacts with cadherin Cad99C in Drosophila oogenesis . J Cell Sci 127 , 4821 – 4832 ( 2014 ). OpenUrl Abstract / FREE Full Text 57. ↵ Miao , H. , Vanderleest , T. E. , Jewett , C. E. , Loerke , D. & Todd Blankenship , J . Cell ratcheting through the Sbf RabGEF directs force balancing and stepped apical constriction . J Cell Biol 218 , 3845 – 3860 ( 2019 ). OpenUrl Abstract / FREE Full Text 58. ↵ Yamamoto , M. , Ohsawa , S. , Kunimasa , K. & Igaki , T . The ligand Sas and its receptor PTP10D drive tumour-suppressive cell competition . Nature 542 , 246 – 250 ( 2017 ). OpenUrl CrossRef PubMed 59. Schonbaum , C. P. , Organ , E. L. , Qu , S. & Cavener , D. R . The Drosophila melanogaster stranded at second (sas) gene encodes a putative epidermal cell surface receptor required for larval development . Dev Biol 151 , 431 – 445 ( 1992 ). OpenUrl CrossRef PubMed 60. ↵ Firmino , J. , Tinevez , J. Y. & Knust , E . Crumbs Affects Protein Dynamics In Anterior Regions Of The Developing Drosophila Embryo . PLoS One 8 , e58839 ( 2013 ). OpenUrl CrossRef PubMed 61. ↵ Moriwaki , T. & Goshima , G . Five factors can reconstitute all three phases of microtubule polymerization dynamics . Journal of Cell Biology 215 , 357 – 368 ( 2016 ). OpenUrl Abstract / FREE Full Text 62. ↵ Thieleke-Matos , C. , Osório , D. S. , Carvalho , A. X. & Morais-de-Sá , E . Emerging Mechanisms and Roles for Asymmetric Cytokinesis . Int Rev Cell Mol Biol 332 , 297 – 345 ( 2017 ). OpenUrl CrossRef PubMed 63. Mira-Osuna , M. & Le Borgne , R . Assembly, dynamics and remodeling of epithelial cell junctions throughout development . Development 151 , ( 2024 ). 64. ↵ Herszterg , S. , Pinheiro , D. & Bellaïche , Y . A multicellular view of cytokinesis in epithelial tissue . Trends Cell Biol 24 , 285 – 293 ( 2014 ). OpenUrl PubMed 65. ↵ Heer , N. C. & Martin , A. C . Tension, contraction and tissue morphogenesis . Development 144 , 4249 – 4260 ( 2017 ). OpenUrl Abstract / FREE Full Text 66. ↵ Quintanilla , M. A. , Hammer , J. A. & Beach , J. R . Non-muscle myosin 2 at a glance . J Cell Sci 136 , ( 2023 ). 67. ↵ Dawes-Hoang , R. E. et al. Folded gastrulation, cell shape change and the control of myosin localization . Development 132 , 4165 – 4178 ( 2005 ). OpenUrl Abstract / FREE Full Text 68. ↵ Franke , J. D. , Montague , R. A. & Kiehart , D. P . Nonmuscle myosin II generates forces that transmit tension and drive contraction in multiple tissues during dorsal closure . Current Biology 15 , 2208 – 2221 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 69. ↵ Barrett , K. , Leptin , M. & Settleman , J . The Rho GTPase and a putative RhoGEF mediate a signaling pathway for the cell shape changes in Drosophila gastrulation . Cell 91 , 905 – 915 ( 1997 ). OpenUrl CrossRef PubMed Web of Science 70. ↵ Guirao , B. et al. Unified quantitative characterization of epithelial tissue development . Elife 4 , e08519 ( 2015 ). OpenUrl CrossRef PubMed 71. ↵ Bosveld , F. et al. Mechanical Control of Morphogenesis by Fat/Dachsous/Four-Jointed Planar Cell Polarity Pathway . Science (1979) 336 , 724 – 727 ( 2012 ). OpenUrl Abstract / FREE Full Text 72. ↵ Cachoux , V. M. L. et al. Epithelial apoptotic pattern emerges from global and local regulation by cell apical area . Current Biology ( 2023 ) doi: 10.1016/j.cub.2023.09.049 . OpenUrl CrossRef PubMed 73. ↵ Valon , L. et al. Robustness of epithelial sealing is an emerging property of local ERK feedback driven by cell elimination . Dev Cell 56 , 1700 – 1711 .e8 ( 2021 ). OpenUrl CrossRef PubMed 74. Levayer , R. , Hauert , B. & Moreno , E . Cell mixing induced by myc is required for competitive tissue invasion and destruction . Nature 524 , 476 – 480 ( 2015 ). OpenUrl CrossRef PubMed 75. Levayer , R. , Dupont , C. & Moreno , E . Tissue Crowding Induces Caspase-Dependent Competition for Space . Current Biology 26 , 670 – 677 ( 2016 ). OpenUrl CrossRef PubMed 76. Villars , A. , Matamoro-Vidal , A. , Levillayer , F. & Levayer , R . Microtubule disassembly by caspases is an important rate-limiting step of cell extrusion . Nat Commun 13 , 1 – 18 ( 2022 ). OpenUrl CrossRef PubMed 77. Marinari , E. et al. Live-cell delamination counterbalances epithelial growth to limit tissue overcrowding . Nature 484 , 542 – 545 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 78. ↵ Fujisawa , Y. , Shinoda , N. , Chihara , T. & Miura , M . ROS Regulate Caspase-Dependent Cell Delamination without Apoptosis in the Drosophila Pupal Notum . iScience 23 , ( 2020 ). 79. ↵ Antunes , M. , Pereira , T. , Cordeiro , J. V. , Almeida , L. & Jacinto , A . Coordinated waves of actomyosin flow and apical cell constriction immediately after wounding . J Cell Biol 202 , 365 – 379 ( 2013 ). OpenUrl Abstract / FREE Full Text 80. ↵ Lehne , F. & Bogdan , S . Getting cells into shape by calcium-dependent actin cross-linking proteins . Front Cell Dev Biol 11 , ( 2023 ). 81. ↵ Totaro , A. , Panciera , T. & Piccolo , S . YAP/TAZ upstream signals and downstream responses . Nature Cell Biology vol. 20 888 – 899 Preprint at doi: 10.1038/s41556-018-0142-z ( 2018 ). OpenUrl CrossRef PubMed 82. Hannezo , E. & Heisenberg , C.-P . Mechanochemical Feedback Loops in Development and Disease . Cell 178 , 12 – 25 ( 2019 ). OpenUrl CrossRef PubMed 83. Davis , J. R. & Tapon , N . Hippo signalling during development . Development (Cambridge) 146 , ( 2019 ). 84. ↵ Irvine , K. D. & Shraiman , B. I . Mechanical control of growth: ideas, facts and challenges . Development 144 , 4238 – 4248 ( 2017 ). OpenUrl Abstract / FREE Full Text 85. ↵ López-Gay , J. M. et al. Apical stress fibers enable a scaling between cell mechanical response and area in epithelial tissue . Science (1979) 370 , eabb2169 ( 2020 ). OpenUrl Abstract / FREE Full Text 86. ↵ Brennecke , J. , Hipfner , D. R. , Stark , A. , Russell , R. B. & Cohen , S . M. bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila . Cell 113 , ( 2003 ). 87. ↵ Thompson , B. J. & Cohen , S. M . The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in Drosophila . Cell 126 , 767 – 774 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 88. ↵ Matakatsu , H. & Blair , S. S . Separating planar cell polarity and Hippo pathway activities of the protocadherins Fat and Dachsous . Development 139 , 1498 – 508 ( 2012 ). OpenUrl Abstract / FREE Full Text 89. ↵ de Vreede , G. , Gerlach , S. U. & Bilder , D . Epithelial monitoring through ligand-receptor segregation ensures malignant cell elimination . Science 376 , 297 – 301 ( 2022 ). OpenUrl CrossRef PubMed 90. ↵ Igaki , T. et al. Eiger, a TNF superfamily ligand that triggers the Drosophila JNK pathway . EMBO J 21 , 3009 – 3018 ( 2002 ). OpenUrl Abstract / FREE Full Text 91. ↵ Moreno , E. , Yan , M. & Basler , K . Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by Eiger, the Drosophila homolog of the TNF superfamily . Curr Biol 12 , 1263 – 1268 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 92. ↵ Agrawal , N. et al. The Drosophila TNF Eiger Is an Adipokine that Acts on Insulin-Producing Cells to Mediate Nutrient Response . Cell Metab 23 , 675 – 684 ( 2016 ). OpenUrl CrossRef PubMed 93. ↵ Palm , W. et al. Secretion and signaling activities of lipoprotein-associated hedgehog and non-sterol-modified hedgehog in flies and mammals . PLoS Biol 11 , ( 2013 ). 94. ↵ Andersen , D. S. et al. The Drosophila TNF receptor Grindelwald couples loss of cell polarity and neoplastic growth . Nature 522 , 482 – 486 ( 2015 ). OpenUrl CrossRef PubMed 95. ↵ Leonhardt , H. et al. Dynamics of DNA Replication Factories in Living Cells . J Cell Biol 149 , 271 ( 2000 ). 96. Kisielewska , J. , Lu , P. & Whitaker , M . GFP-PCNA as an S-phase marker in embryos during the first and subsequent cell cycles . Biol Cell 97 , 221 – 229 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 97. ↵ Shermoen , A. W. , McCleland , M. L. & O’Farrell , P. H . Developmental Control of Late Replication and S Phase Length . Current Biology 20 , 2067 – 2077 ( 2010 ). OpenUrl CrossRef PubMed 98. ↵ Ventura , G. & Sedzinski , J . Emerging concepts on the mechanical interplay between migrating cells and microenvironment in vivo . Front Cell Dev Biol 10 , ( 2022 ). 99. ↵ Gredler , M. L. & Zallen , J. A . Multicellular rosettes link mesenchymal-epithelial transition to radial intercalation in the mouse axial mesoderm . Dev Cell 58 , 933 – 950 .e5 ( 2023 ). OpenUrl CrossRef PubMed 100. ↵ Huber , F. , Boire , A. , López , M. P. & Koenderink , G. H . Cytoskeletal crosstalk: when three different personalities team up . Curr Opin Cell Biol 32 , 39 – 47 ( 2015 ). OpenUrl CrossRef PubMed 101. Xie , J. & Minc , N . Cytoskeleton Force Exertion in Bulk Cytoplasm . Front Cell Dev Biol 8 , ( 2020 ). 102. ↵ Matis , M . The Mechanical Role of Microtubules in Tissue Remodeling . Bioessays 42 , ( 2020 ). 103. ↵ Rodriguez-Boulan , E. , Kreitzer , G. & Müsch , A . Organization of vesicular trafficking in epithelia . Nat Rev Mol Cell Biol 6 , 233 – 247 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 104. ↵ Xie , Y. , Miao , H. & Blankenship , J. T . Membrane trafficking in morphogenesis and planar polarity . Traffic 19 , 679 – 689 ( 2018 ). OpenUrl CrossRef 105. ↵ Singh , A. et al. Polarized microtubule dynamics directs cell mechanics and coordinates forces during epithelial morphogenesis . Nat Cell Biol 20 , 1126 – 1133 ( 2018 ). OpenUrl CrossRef PubMed 106. Sulerud , T. et al. Microtubule-dependent pushing forces contribute to long-distance aster movement and centration in Xenopus laevis egg extracts . Mol Biol Cell 31 , 2791 – 2802 ( 2020 ). OpenUrl CrossRef PubMed 107. ↵ Yamamoto , S. et al. Actin network architecture can ensure robust centering or sensitive decentering of the centrosome . EMBO J 41 , ( 2022 ). 108. ↵ Akhmanova , A. & Steinmetz , M. O . Microtubule minus-end regulation at a glance . J Cell Sci 132 , ( 2019 ). 109. ↵ Taniguchi , K. & Igaki , T . Sas-Ptp10D shapes germ-line stem cell niche by facilitating JNK-mediated apoptosis . PLoS Genet 19 , ( 2023 ). 110. ↵ Niessen , C. M. , Manning , M. L. & Wickström , S. A . Mechanochemical Principles of Epidermal Tissue Dynamics . Cold Spring Harb Perspect Biol 17 , ( 2025 ). 111. ↵ Luciano , M. et al. Appreciating the role of cell shape changes in the mechanobiology of epithelial tissues . Biophys Rev 3 , ( 2022 ). 112. ↵ Collins , C. , Ventrella , R. & Mitchell , B. J . Building a ciliated epithelium: Transcriptional regulation and radial intercalation of multiciliated cells . Curr Top Dev Biol 145 , 3 – 39 ( 2021 ). OpenUrl CrossRef PubMed 113. ↵ Baker , N. E . Emerging mechanisms of cell competition . Nat Rev Genet 21 , 683 – 697 ( 2020 ). OpenUrl CrossRef PubMed 114. Vishwakarma , M. & Piddini , E. Outcompeting cancer . Nat Rev Cancer 20 , 187 – 198 ( 2020 ). OpenUrl CrossRef PubMed 115. Matamoro-Vidal , A. & Levayer , R . Multiple Influences of Mechanical Forces on Cell Competition . Current Biology 29 , R762 – R774 ( 2019 ). OpenUrl CrossRef PubMed 116. Johnston , L. A . Competitive Interactions Between Cells: Death, Growth, and Geography . Science (1979) 324 , 1679 – 1682 ( 2009 ). OpenUrl Abstract / FREE Full Text 117. Clavería , C. & Torres , M. Cell Competition: Mechanisms and Physiological Roles . Annu Rev Cell Dev Biol 32 , 411 – 439 ( 2016 ). OpenUrl CrossRef PubMed 118. Nagata , R. & Igaki , T . Cell competition: Emerging mechanisms to eliminate neighbors . Dev Growth Differ 60 , 522 – 530 ( 2018 ). OpenUrl CrossRef PubMed 119. Kashio , S. , Obata , F. & Miura , M . Interplay of cell proliferation and cell death in Drosophila tissue regeneration . Dev Growth Differ 56 , 368 – 375 ( 2014 ). OpenUrl CrossRef PubMed 120. Diwanji , N. & Bergmann , A . Two Sides of the Same Coin -Compensatory Proliferation in Regeneration and Cancer . Adv Exp Med Biol 1167 , 65 – 85 ( 2019 ). OpenUrl CrossRef PubMed 121. Penzo-Méndez , A. I. & Stanger , B. Z . Cell competition in vertebrate organ size regulation . Wiley Interdiscip Rev Dev Biol 3 , 419 – 427 ( 2014 ). OpenUrl PubMed 122. ↵ Krishnan , S. , Paul , P. K. & Rodriguez , T. A . Cell competition and the regulation of protein homeostasis . Curr Opin Cell Biol 87 , ( 2024 ). 123. ↵ Kawaue , T. et al. Inhomogeneous mechanotransduction defines the spatial pattern of apoptosis-induced compensatory proliferation . Dev Cell 58 , ( 2023 ). 124. ↵ Mao , Y. & Wickström , S. A . Mechanical state transitions in the regulation of tissue form and function . Nat Rev Mol Cell Biol 25 , ( 2024 ). 125. Chanet , S. & Martin , A. C . Mechanical Force Sensing in Tissues . Prog Mol Biol Transl Sci . 126 , 317 – 352 ( 2014 ). OpenUrl CrossRef PubMed 126. Irvine , K. D. & Shraiman , B. I . Mechanical control of growth: ideas, facts and challenges . Development 144 , 4238 – 4248 ( 2017 ). OpenUrl Abstract / FREE Full Text 127. Levayer , R . Staying away from the breaking point: Probing the limits of epithelial cell elimination . Curr Opin Cell Biol 86 , ( 2024 ). 128. ↵ Bonfim-Melo , A. , Duszyc , K. , Gomez , G. A. & Yap , A. S . Regulating life after death: how mechanical communication mediates the epithelial response to apoptosis . Eur Phys J E Soft Matter 45 , ( 2022 ). 129. ↵ Uroz , M. et al. Regulation of cell cycle progression by cell–cell and cell–matrix forces . Nat Cell Biol 20 , 646 – 654 ( 2018 ). OpenUrl CrossRef PubMed 130. ↵ Gagliardi , P. A. et al. Collective ERK/Akt activity waves orchestrate epithelial homeostasis by driving apoptosis-induced survival . Dev Cell 56 , 1712 – 1726 .e6 ( 2021 ). OpenUrl CrossRef PubMed 131. ↵ Poulton , J. S. , McKay , D. J. & Peifer , M . Centrosome Loss Triggers a Transcriptional Program To Counter Apoptosis-Induced Oxidative Stress . Genetics 212 , 187 – 211 ( 2019 ). OpenUrl Abstract / FREE Full Text 132. ↵ Joy , J. et al. Proteostasis failure and mitochondrial dysfunction leads to aneuploidy-induced senescence . Dev Cell 56 , 2043 – 2058 .e7 ( 2021 ). OpenUrl CrossRef PubMed 133. Muzzopappa , M. , Murcia , L. & Milán , M . Feedback amplification loop drives malignant growth in epithelial tissues . Proc Natl Acad Sci U S A 114 , E7291 – E7300 ( 2017 ). OpenUrl Abstract / FREE Full Text 134. Nakamura , M. , Ohsawa , S. & Igaki , T . Mitochondrial defects trigger proliferation of neighbouring cells via a senescence-associated secretory phenotype in Drosophila . Nature Communications 2014 5 : 1 5, 1 – 11 ( 2014 ). OpenUrl 135. ↵ Garcia-Arias , J. M. , Pinal , N. , Cristobal-Vargas , S. , Estella , C. & Morata , G . Lack of apoptosis leads to cellular senescence and tumorigenesis in Drosophila epithelial cells . Cell Death Discov 9 , 281 ( 2023 ). 136. ↵ Morata , G. & Calleja , M . Cell competition and tumorigenesis in the imaginal discs of Drosophila . Semin Cancer Biol 63 , 19 – 26 ( 2020 ). OpenUrl CrossRef PubMed 137. Nagata , R. & Igaki , T . Cell competition: Emerging mechanisms to eliminate neighbors . Dev Growth Differ 60 , 522 – 530 ( 2018 ). OpenUrl CrossRef PubMed 138. Serras , F . The sooner, the better: ROS, kinases and nutrients at the onset of the damage response in Drosophila . Front Cell Dev Biol 10 , ( 2022 ). 139. Madan , E. , Gogna , R. & Moreno , E . Cell competition in development: information from flies and vertebrates . Curr Opin Cell Biol 55 , 150 – 157 ( 2018 ). OpenUrl CrossRef PubMed 140. ↵ Muzzopappa , M. & Milán , M . Epithelial tumors: Growing from within . Fly (Austin) 12 , 127 – 132 ( 2018 ). OpenUrl PubMed 141. ↵ McAinsh , A. D. & Kops , G. J. P. L . Principles and dynamics of spindle assembly checkpoint signalling . Nat Rev Mol Cell Biol 24 , 543 – 559 ( 2023 ). OpenUrl CrossRef PubMed 142. ↵ Juarez-Carreño , S. , Morante , J. & Dominguez , M . Systemic signalling and local effectors in developmental stability, body symmetry, and size . Cell Stress 2 , 340 – 361 ( 2018 ). OpenUrl CrossRef PubMed 143. ↵ Boulan , L. & Léopold , P . What determines organ size during development and regeneration? Development 148 , ( 2021 ). 144. ↵ Hoffmann , I . Centrosomes in mitotic spindle assembly and orientation . Curr Opin Struct Biol 66 , 193 – 198 ( 2021 ). OpenUrl CrossRef PubMed 145. ↵ McGuire , S. E. , Le , P. T. , Osborn , A. J. , Matsumoto , K. & Davis , R. L . Spatiotemporal Rescue of Memory Dysfunction in Drosophila . Science (1979) 302 , 1765 – 1768 ( 2003 ). OpenUrl Abstract / FREE Full Text 146. ↵ Golic , K. G. & Lindquist , S . The FLP recombinase of yeast catalyzes site-specific recombination in the drosophila genome . Cell 59 , 499 – 509 ( 1989 ). OpenUrl CrossRef PubMed Web of Science 147. ↵ Gratz , S. J. et al. Highly specific and efficient CRISPR/Cas9-catalyzed homology-directed repair in Drosophila . Genetics 196 , 961 – 71 ( 2014 ). OpenUrl Abstract / FREE Full Text 148. ↵ Port , F. , Chen , H.-M. , Lee , T. & Bullock , S. L . Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila . Proc Natl Acad Sci U S A 111 , E2967 – 76 ( 2014 ). OpenUrl Abstract / FREE Full Text 149. ↵ Li , M. Z. & Elledge , S. J . SLIC: A method for sequence- and ligation-independent cloning . Methods in Molecular Biology 852 , 51 – 59 ( 2012 ). OpenUrl PubMed 150. ↵ Pinheiro , D. et al. Transmission of cytokinesis forces via E-cadherin dilution and actomyosin flows . Nature 545 , 103 – 107 ( 2017 ). OpenUrl CrossRef PubMed 151. ↵ Ségalen , M. et al. The Fz-Dsh Planar Cell Polarity Pathway Induces Oriented Cell Division via Mud/NuMA in Drosophila and Zebrafish . Dev Cell 19 , 740 – 752 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 152. ↵ Hutson , M. S . Forces for Morphogenesis Investigated with Laser Microsurgery and Quantitative Modeling . Science (1979) 300 , 145 – 149 ( 2003 ). OpenUrl Abstract / FREE Full Text 153. ↵ Schindelin , J. , et al. Fiji: An open-source platform for biological-image analysis . Nat Methods 9 , 676 – 682 ( 2012 ). OpenUrl CrossRef PubMed Web of Science 154. ↵ Weigert , M. et al. Content-aware image restoration: pushing the limits of fluorescence microscopy . Nat Methods 15 , 1090 – 1097 ( 2018 ). OpenUrl CrossRef PubMed 155. Xiong , F. et al. Interplay of Cell Shape and Division Orientation Promotes Robust Morphogenesis of Developing Epithelia . Cell 159 , 415 – 427 ( 2014 ). OpenUrl CrossRef PubMed 156. ↵ Pinheiro , D. et al. Transmission of cytokinesis forces via E-cadherin dilution and actomyosin flows . Nature 545 , 103 – 107 ( 2017 ). OpenUrl CrossRef PubMed 157. Guan , Z. et al. Mushroom body defect, a gene involved in the control of neuroblast proliferation in Drosophila, encodes a coiled-coil protein . Proc Natl Acad Sci U S A 97 , 8122 – 7 ( 2000 ). OpenUrl Abstract / FREE Full Text 158. Thacker , S. A. , Bonnette , P. C. & Duronio , R. J . The contribution of E2F-regulated transcription to Drosophila PCNA gene function . Current Biology 13 , 53 – 58 ( 2003 ). OpenUrl CrossRef PubMed Web of Science 159. Chen , J. , Sayadian , A. C. , Lowe , N. , Lovegrove , H. E. & St Johnston , D . An alternative mode of epithelial polarity in the Drosophila midgut . PLoS Biol 16 , ( 2018 ). 160. Huang , J. , Zhou , W. , Dong , W. , Watson , A. M. & Hong , Y . From the Cover: Directed, efficient, and versatile modifications of the Drosophila genome by genomic engineering . Proc Natl Acad Sci U S A 106 , 8284 – 9 ( 2009 ). OpenUrl Abstract / FREE Full Text 161. Varmark , H. et al. Asterless is a centriolar protein required for centrosome function and embryo development in Drosophila . Curr Biol 17 , 1735 – 1745 ( 2007 ). OpenUrl CrossRef PubMed 162. Buszczak , M. et al. The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies . Genetics 175 , 1505 ( 2007 ). OpenUrl Abstract / FREE Full Text 163. Sun , T. et al. Spectraplakin Shot Maintains Perinuclear Microtubule Organization in Drosophila Polyploid Cells . Dev Cell 49 , 731 – 747 .e7 ( 2019 ). OpenUrl CrossRef PubMed 164. Oda , H. , Tsukita , S. & Takeichi , M . Dynamic Behavior of the Cadherin-Based Cell – Cell Adhesion System during Drosophila Gastrulation . 450 , 435 – 450 ( 1998 ). OpenUrl 165. Conduit , P. T. et al. The centrosome-specific phosphorylation of Cnn by Polo/Plk1 drives Cnn scaffold assembly and centrosome maturation . Dev Cell 28 , 659 – 669 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 166. Grieder , N. C. , de Cuevas , M. & Spradling , A. C . The fusome organizes the microtubule network during oocyte differentiation in Drosophila . Development 127 , 4253 – 4264 ( 2000 ). OpenUrl Abstract 167. Markova , O. , Sénatore , S. , Chardès , C. & Lenne , P. F . Calcium Spikes in Epithelium: study on Drosophila early embryos . Sci Rep 5 , ( 2015 ). 168. Bosveld , F. , Ainslie , A. & Bellaïche , Y . Sequential activities of Dynein, Mud and Asp in centrosome-spindle coupling maintain centrosome number upon mitosis . J Cell Sci 130 , ( 2017 ). 169. ↵ Karess , R. E. et al. The regulatory light chain of nonmuscle myosin is encoded by spaghetti-squash, a gene required for cytokinesis in Drosophila . Cell 65 , 1177 – 1189 ( 1991 ). OpenUrl CrossRef PubMed Web of Science View the discussion thread. Back to top Previous Next Posted October 19, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation Floris Bosveld , Baptiste Tesson , Eric van Leen , Sam Amirebrahimi , Raphael Thinat , Yohanns Bellaiche bioRxiv 2025.10.18.682384; doi: https://doi.org/10.1101/2025.10.18.682384 Share This Article: Copy Citation Tools Tissue mechanics and systemic signaling safeguard epithelial tissue against spindle misorientation Floris Bosveld , Baptiste Tesson , Eric van Leen , Sam Amirebrahimi , Raphael Thinat , Yohanns Bellaiche bioRxiv 2025.10.18.682384; doi: https://doi.org/10.1101/2025.10.18.682384 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7642) Biochemistry (17715) Bioengineering (13907) Bioinformatics (42003) Biophysics (21470) Cancer Biology (18624) Cell Biology (25533) Clinical Trials (138) Developmental Biology (13390) Ecology (19935) Epidemiology (2067) Evolutionary Biology (24356) Genetics (15617) Genomics (22529) Immunology (17753) Microbiology (40432) Molecular Biology (17200) Neuroscience (88681) Paleontology (667) Pathology (2840) Pharmacology and Toxicology (4828) Physiology (7653) Plant Biology (15171) Scientific Communication and Education (2046) Synthetic Biology (4304) Systems Biology (9826) Zoology (2271)