Inhaled Neutrophil Elastase Inhibitor Alleviates Lipopolysaccharide Triggers Neutrophil Extracellular Trap-Mediated Acute Lung Injury via the MAPK/AKT/NLRP3 Pathway

Inhaled Neutrophil Elastase Inhibitor Alleviates Lipopolysaccharide Triggers Neutrophil Extracellular Trap-Mediated Acute Lung Injury via the MAPK/AKT/NLRP3 Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inhaled Neutrophil Elastase Inhibitor Alleviates Lipopolysaccharide Triggers Neutrophil Extracellular Trap-Mediated Acute Lung Injury via the MAPK/AKT/NLRP3 Pathway Yuanlin Song, Xinjun Tang, Nurbiya Aji, Nana Feng, Ting Pan, Miao Li, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3875684/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS), an overwhelming inflammatory condition, is characterized by systemic inflammation and multiorgan dysfunction. Neutrophil extrusion of neutrophil extracellular traps (NETs) and concomitant cell death process (NETosis) provides host defense, while neutrophil elastase (NE), a serine protease stored in the azurophilic granules of neutrophils, contributes to NETs for entrapping extracellular pathogens. Importantly, excess NETs and NETosis mediated pyroptosis in the etiopathogenesis. However, the exact mechanism underlying NE-mediated NET formation contributed to pyroptosis during ALI/ARDS remains unclear. In this study, we reported that neutrophils were susceptible to NETosis in the lungs of ARDS patients. We investigated the effects and the underlying mechanisms of an inhaled NE inhibitor AK0705 on lipopolysaccharide (LPS)-induced ALI in mice. The inflammatory cytokines assessments, pathologic examination, and detection of NETs indicated that inhalation of AK0705 ameliorated LPS-induced lung injury, and suppressed the secretion of IL-6, TNF-α, IL-1β, and MCP-1 in bronchoalveolar lavage fluid (BALF). Furthermore, the results of cell-free DNA, myeloperoxidase (MPO), citrullinated histone (citH3), NE level, and NE activity showed that AK0705 significantly inhibited LPS-induced NET formation. Western blot revealed that AK0705 effectively inhibited LPS-triggered pyroptosis by downregulating MAPK/AKT/NLRP3 signaling pathway. In conclusion, our investigation demonstrated for the first time that AK0705 could protect against LPS-induced ALI by promoting a reduction of NET formation and suppressing pyroptosis. These data suggest that targeting NETs, especially NE, using AK0705 is a promising approach to prevent NET formation in the progression of ALI/ALRDS. neutrophil extracellular traps acute lung injury neutrophil elastase AK0705 pyroptosis NETosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is an acute, diffuse, inflammatory lung injury precipitated by a predisposing risk factor such as pneumonia, nonpulmonary vascular and epithelial permeability, lung edema, and gravity-dependent atelectasis, all of which contribute to the injury of lung tissue. Histological findings vary but can include intra-alveolar edema, inflammation, hyaline membrane formation, and alveolar hemorrhage [1]. The cellular and molecular mechanisms of ALI/ARDS are still unclear. A better understanding of the mechanism of ALI/ARDS will be useful in finding cellular and molecular targets for preventing and treating the disease. Leukocytosis and neutrophils are hallmarks of acute infection [2]. Neutrophilia predicts poor outcomes in patients with COVID-19 [3], and our previous study revealed that the neutrophil-to-lymphocyte ratio is a prognostic marker in ARDS patients [4]. Neutrophils are recruited early to sites of infection, where they kill pathogens (bacteria, fungi, and viruses) by oxidative burst and phagocytosis [5]. However, neutrophils have another, much less recognized means of killing pathogens: the formation of neutrophil extracellular traps (NETs) [6]. Recent studies have demonstrated that this special form of extracellular DNA deposition is a mechanism by which neutrophils trap bacteria in a web-like structure of DNA with histones, granule proteins such as myeloperoxidase (MPO) and neutrophil elastase (NE) [6, 7]. These NETs are mixed with neutrophil-derived nuclear proteins, leading to ensnaring pathogens [2, 6, 8-10]. Aberrant NET formation is linked to pulmonary diseases, particularly ARDS [2]. Neutrophils from patients with pneumonia-associated ARDS appear “primed” to form NETs, and the level of NETs in their blood correlates with their disease severity and mortality [11, 12]. NETs are released primarily through a cell death process termed NETosis [13]. Neutrophil death by NET extrusion (NETosis) pathway that is different from apoptosis and necrosis [6, 14]. During NETosis, in contrast to other forms of cell death, the nucleus disintegrates before the cytoplasmic membrane is compromised, and chromatin is released into the extracellular space [15]. NET release begins with the activation of peptidyl arginine deiminase 4 (encoded by PAD4), which causes histone citrullination, extensive chromatin decondensation, and the nuclear localization of granular enzymes such as myeloperoxidase (MPO) and neutrophil elastase (NE) [16, 17]. NETs are a double-edged sword, as they are beneficial for fighting infection but can be pathogenic because they expose autoantigens [15]. NET formation is a regulated process, although the signals involved are incompletely understood, and the specific role of NETs in ARDS/ALI also remains unknown. Intensive inflammatory responses and oxidative stress are regarded as important physiologic mechanisms of ALI/ARDS [12]. Macrophages, resident immune cells, act as the first line of immune defense in the lung. They exert immediate protective responses against toxic substances together with alveolar epithelial cells. In ALI/ARDS, pulmonary macrophages are mainly proinflammatory (M1) macrophages that produce high levels of mediators of inflammation (tumor necrosis factor (TNF)-α, interleukin (IL)-1β, etc.) and reactive oxygen species (ROS), thereby evoking a cytokine storm and severe lung injury [18]. Particularly, the NLR family pyrin domain–containing 3 (NLRP3) inflammasome is commonly activated by the overproduction of ROS. In response to various toxic stimuli, the NLRP3 inflammasome oligomerizes with apoptosis-associated speck-like protein containing CARD (ASC), which allows the NLRP3 inflammasome to link with Caspase-1 to form an active inflammasome (NLRP3, ASC, and Caspase-1) that produces matured IL-1β [19, 20]. Moreover, activated Caspase-1 actuates the formation of the N-terminal domain of gasdermin D (GSDMD-Nterm), which triggers the release of inflammatory molecules (IL-1β, TNF-α, lactate dehydrogenase (LDH), etc.), begins pyroptosis and further amplifies the cytokine storm [15, 21, 22]. As potential drivers of an amplified inflammatory storm in ARDS, neutrophils crosstalk with macrophages to activate the NLRP3 inflammasome by inducing NET formation in a PAD4-, NE-, and ROS-dependent manner, leading to a vicious loop accelerating the inflammatory response [15]. Caspase-11- and GSDMD-deficient mice are protected from septic shock induced by LPS, demonstrating the importance of pyroptosis in driving LPS-induced inflammation in vivo [23, 24]. However, the precise mechanisms regulating NET formation in ARDS have not been completely elucidated. Although the signaling pathways that regulate NETosis are not fully understood, growing evidence has shown that mitogen-activated protein kinases (MAPKs) are important int NET formation. ROS are the key to the development of suicidal NETosis [25]. ROS can also activate some key enzymes, such as MPO, NE, and PAD4, thus promoting the formation of NETs [26]. More importantly, the excessive production of ROS damages the cellular macromolecules proteins, lipids, and DNA. ROS can induce phosphorylation of c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase 1/2 (ERK1/2), and the p38 MAPK family of serine/threonine kinases. Because of the important role of MAPK and Akt in the initiation of NETosis [27], we examined the expression of these kinases in LPS-induced ALI mice. Based on the above, NE may play a vital role in the pathogenesis of ALI [28, 29] and the early stage of ARDS with NET-mediated cytokine storm [30]. As a potent proteolytic enzyme, NE can damage surrounding tissues, contributing to organ and tissue dysfunction [31, 32]. NE activities are significantly increased in the serum and lungs of animal models [33, 34]. Sivelestat, a recombinant NE inhibitor, reduces ALI in animal models [33, 34] as well as humans [35]. Here, we show a small-molecule NE inhibitor, AK0705, blocks NET formation in vivo and in vitro . We suspect that AK0705, like sivelestat, is a potential inhalation drug. Via inhalation, drugs may exert their therapeutic effects on the lungs directly [36]. Through inhalation, pharmaceutical agents can be delivered to the lungs to protect against ALI/ARDS [37, 38]. There have been no definitive studies on whether the inhaled NE inhibitor AK0705 inhibits LPS-induced oxidative stress and pyroptosis by activating the MAPK/NLRP3 signaling axis in vivo and in vitro . Overall, our findings reveal a mechanism through which LPS contributes to neutrophil-mediated inflammation, highlighting the importance of NETs as a therapeutic target in ALI/ARDS and showing the role of a potent inhaled NE inhibitor, AK0705, in improving clinical outcomes. Materials and Methods Clinical Samples A total of 22 ARDS patients (17 active ARDS patients and 5 control patients) were consecutively included in the present study, and BALF samples were collected from all participants after obtaining informed consent. All BALF samples were immediately stored at -80 °C after collection. The biological samples of ARDS patients and healthy donors were obtained under a protocol approved by the Institutional Research Ethics Committee of Zhongshan Hospital (ID: 2011-212), Shanghai, China. Informed consent was provided by all participants. Mice Male C57BL/6 mice, aged 8-12 weeks and weighing 18-22 g, were purchased from JSJ Laboratory Animals (Shanghai, China). The mice were kept in a controlled environment with a 12-hour light/dark cycle, provided with free access to mouse chow and water. The ambient temperature was maintained at 22-24 °C with humidity levels between 50-70%. After acclimatizing for one week, the mice were housed in specific pathogen-free conditions at the Animal Center of Zhongshan Hospital, Fudan University. The mice were anesthetized by intraperitoneal injection of Avertin (Sigma-Aldrich). Subsequently, LPS from Escherichia coli 0111:B4 (5 mg/kg; cat#L4391, Sigma-Aldrich, St.Louis, MO, USA) dissolved in phosphate-buffered saline (PBS) to induce endometritis or only PBS with an equal volume was delivered intratracheally. The size of the lung was measured, and BALF were harvested for flow cytometry and cytokine analysis. Lung samples were collected, fixed in 4% paraformaldehyde, and embedded in paraffin. Additional lung samples were stored at -80 °C. In some experiments, to inhibit NET formation, CI-amidine (20mg/kg, HY-100574A, MCE, China, i.p.) was given 24 h and 1 h before LPS stimulation, once daily. DPI (1mg/kg, D2926, Sigma-Aldrich, USA, i.p.) was given 0.5 h before LPS stimulation, once daily. Additionally, sivelestat (50mg/kg, HY-17443, MCE China) was administered at 3 h after LPS stimulation, twice a day. All experimental procedures were conducted in accordance with institutional guidelines and approved by the Animal Care and Use Committee of Zhongshan Hospital. Isolation and Stimulation of Mouse Bone Marrow-derived Neutrophils BMDNs were isolated by density gradient centrifugation using Ficoll-Paque PLUS (GE Healthcare, Tokyo, Japan). Total bone marrow cells were collected from tibias and femurs, and the RBCs were lysed. Mature neutrophils were purified by centrifugation for 30 min at 300 × g without braking on a Ficoll opaque PLUS. BMDNs were collected in the bottom layer. The total number of cells was counted. Collected neutrophils were seeded onto 4-well chamber slides (1 × 10 6 cells/mL) and cultured in RPMI 1640 supplemented with 10% FBS for 3.5 hours at 37 °C with stimulation from LPS (100 ng/ml), NE inhibitor AK0705 (20 μM). Cells were fixed, blocked, and incubated with primary antibodies overnight at 4 °C and then with secondary antibodies for 60 minutes at 25 ℃. After mounting with DAPI stain solution NETs could be observed under a FV3000 confocal microscope (Olympus). Quantification of Cell-free DNA and NETs-DNA Complexes Cell-free DNA was quantified using the Quant-iT PicoGreen double-stranded DNA (dsDNA) assay kit (Invitrogen, USA), following the manufacturer's instructions. BALF was added to each well, followed by a 10-minute incubation. MPO-DNA, NE-DNA, and citH3-DNA complexes were quantified using the Quanti-iT PicoGreen assay. Anti-MPO monoclonal antibody (ab25989, 1:1000; Abcam,), anti-NE antibody (ab68672, 1:1000; Abcam), and anti-citH3 antibody (ab5103, 1:1000; Abcam) were coated onto 96-well microtiter plates overnight at 4 °C. After blocking in 1% BSA for 90 minutes at room temperature, BALF was added to each well and incubated overnight at 4 °C. PicoGreen was used to detect cell-free DNA and NET-DNA complexes. NET Detection and Quantification After stimulation, neutrophils or BMDNs were fixed with 4% paraformaldehyde for 30 min at room temperature (RT) and washed three times with 1% PBS-Tween (PBST) for 15 min. After washing, the cells were blocked in 1% BSA at RT. Protein staining was performed using an anti-MPO antibody (ab208670, 1:100; Abcam), a mouse monoclonal anti-NE antibody (sc-55549, 1:50; Santa Cruz) overnight at 4 °C. After three washes, the cells were placed in florescent secondary antibodies (goat anti-rabbit Alexa Flour® 488 or 594) for 1 h incubation at RT. The cells were again washed three times with 1% PBST for 15 min. After desiccation, the cells were counterstained with 4'-6 diamidino-2-phenylindole (2 ug/mL, DAPI, Servicebio, Wuhan, China) for 8 min. After three washes, images were obtained using FV3000 confocal system (Olympus). Analysis of Bronchoalveolar Lavage Fluid (BALF) Following terminal anesthesia with avertin, the BALF was collected by 1 ml of PBS into the trachea and lungs through a 22-inch intravenous catheter. The supernatant of BALF was collected by centrifugation at × 500 g for 10 min at 4 °C and then stored at -80 °C for further analysis. Total numbers in BALF were counted using CellDrop® (DeNovix, Wilmington, DE, USA). Total protein levels in BALF were determined using the Enhanced BCA Protein Assay Kit (EpiZyme). According to the manufacturer’s protocols, cytokine levels in BALF or serum were detected using an enzyme-linked immunosorbent assay (ELISA) DuoSet kit (R&D System). Kits were used for measuring IL-6, TNF-α, IL-1β, and monocyte chemotactic protein-1 (MCP-1). Neutrophil Elastase Activity Assay NE activity was quantified neutrophil elastase activity assay kit (ab204730, Abcam). Standards or BALFs from mice were plated in a 96-well plate. 2 ul of neutrophil elastase substrate was added to each well, and measure output was on a fluorescent microplate reader at Ex/Em = 380/500 nm in a kinetic mode, every 2-3 minutes, for 10-20 minutes at 37 °C protected from light. Pulmonary Edema Evaluation After wiping out the blood, the lungs were excised and weighed as the wet weight, which was then fired in a 60 °C oven to obtain the constant dry weight. Lung inflammation score grading from 0 to 4 was calculated by two independent pathologists blinded to the groups as previously described. Pulmonary edema was calculated as lung wet-to-dry ratio. Histology, Immunohistochemistry and Immunofluorescence of lung Lung tissue sections were stained with H&E staining. The histopathology was assessed in a double-blind manner according to the following criteria [39]: the presence of exudates, hyperemia or congestion, neutrophilic infiltrates, intra-alveolar hemorrhage or debris, and cellular hyperplasia. Each item was graded on a four-point scale from 0 to 3: 0 (normal lungs), 1 (mild injury), 2 (moderate injury), 3 (severe injury). To detect neutrophils and macrophages in the lung tissue using immunochemistry, paraffin-embedded mouse lung sections were stained by antibodies against Ly6G (GB11229, 1:1000, Servicebio), F4/80 (GB11027, 1:1000, Servicebio). To detect NET formation in the lung tissue, lung tissues were removed and fixed in 4% paraformaldehyde at 4°C for 3 days, then dehydrated in 30% sucrose, and finally embedded in paraffin. The tissues were then cut into 5 μm-thick serial sections and incubated with anti-citH3 (ab5103, 1:200; Abcam), anti-MPO antibody (ab25989 or ab208670, 1:100; Abcam), and anti-NE (sc-55549, 1:50; Santa Cruz), and DAPI was used to detect DNA. Then stained with an Alexa Fluor® 488 or 594 conjugate secondary antibody (1:1000, dilution). Finally, slides were visualized using an Olympus FV3000 confocal microscope. Lactate Dehydrogenase (LDH) Assay The mouse BALF was collected, and then subjected to detection according to the instruction of LDH assay kit (Beyotime, Shanghai, China). The LDH activity was calculated in the samples. LDH activity (U/L) = [(measured optical density (OD) value – control OD value/standard OD value – blank OD value)] × concentration of the standard (0.22 μmol/mL) × 1000. Qunatitative real-time reverse transcriptase-PCR (qRT-PCR) Total RNA was isolated from lung tissues using TRIzol reagent (Byeotime) and quantified by NanoDrop (Thermo Fisher Scientific, Shanghai, China). The reverse transcription of RNA into cDNA was performed using the BeyoRT™ first strand cDNA synthesis kit (Beyotime). The qRT-PCR reactions on cDNA were carried out using SYBR Green PCR Master Mix (Solarbio, Beijing, China) and 0.2 μM primers and analyzed using the Applied Biosystems 7500HT Real-Time PCR System (Foster City, CA, USA). The PCR conditions were as follows: initial denaturation at 95 °C for 5 min, followed by 33 cycles of denaturation at 95 °C for 40 s, primer annealing at 52 °C for 30 s, and extension was conducted at 72 °C for 10 min. Data were normalized to GAPDH and expressed as fold change over control. Primer sequences were listed in Table 1. Table 1 Sequences of Primers Used for Reverse Transcription Quantitative PCR Gene (mouse) Sequence (5'→3') IL-6 in forward 5’- CTGCAAGAGACTTCCATCCAG - 3’ IL-6 in reverse 5’- AGTGGTATAGACAGGTCTGTTGG - 3’ TNF-α in forward 5’- CCCTCACACTCAGATCATCTTCT - 3’ TNF-α in reverse 5’- GCTACGACGTGGGCTACAG - 3’ IL-1β in forward 5’- GCAACTGTTCCTGAACTCAACT - 3’ IL-1β in reverse 5’- ATCTTTTGGGGTCCGTCAACT - 3’ MCP-1 in forward 5’- CTCTCTCTTCCTCCACCACCAT- 3’ MCP-1 in reverse 5’- AGCCGGCAACTGTGAACAG - 3’ GAPDH in forward 5’- ACATGGCCTCCAAGGAGTAAGAA- 3’ GAPDH in reverse 5’- GGGATAGGGCCTCTCTTGCT - 3’ Flow Cytometry BALF leukocytes were stained for 30 min at 4 °C using fluorescently labeled antibodies: PerCP-conjugated anti-mouse CD45 (30-F11 clone, 557235, 1:100, BD), FITC-conjugated anti-mouse CD11b (M1/70 clone, 101206, 1:100, Biolegend), PE-Cy7-conjugated anti-mouse Ly6G (1A8 clone, 1:100, 560601, BD), PE-conjugated anti-mouse F4/80 (BM8 clone, 550992, 1:100, BD). All assays were performed by Arial II flow cytometers (BD Bioscience, San Jose, CA, USA) and analyzed with FlowJo software (version10.0, Three Star, Inc., Ashland, OR, USA). Western Blotting Mouse lungs and BMDNs were lysed in RIPA lysis buffer (EpiZyme) containing protease inhibitor cocktails (Roche Diagnostics, Mannheim, Germany) and phosSTOP (Roche Diagnostics). The protein lysates were separated on 10% or 15% SDS/PAGE gel and transferred onto a polyvinylidene fluoride membrane. Membranes and lung tissues were blocked with 3% bovine serum albumin (BSA; Sigma-Aldrich) for 1 h at room temperature and incubated with primary antibodies overnight at 4 °C. Upon washing the blots for 5 min with TBST (100mM Tris-HCl, pH7.5, 0.1% Tween 20) 3 times, blots were incubated with secondary antibodies at a dilution of 1:20000 for 2 h at room temperature. Followed by HRP-conjugated anti-rabbit IgG (Beyotime) or HRP-conjugated anti-mouse IgG (1:5000), and the signals were detected by ECL assays (Epizyme). The following antibodies were used: Anti-MPO (ab25989, 1:1000; Abcam), Anti-NE (ab68672, 1:1000; Abcam), Anti-citH3 (ab5103, 1:1000; Abcam), Anti-NLRP3 (#13158, 1:1000; Cell Signaling Technology), Anti-Caspase-1 (#2225, 1:1000; Cell Signaling Technology), Anti-Cleaved Caspase-1 (#4199, 1:1000; Cell Signaling Technology), Anti-Caspase-11 (#14340, 1:1000; Cell Signaling Technology), Anti-Gasdermin D (#69469, 1:1000; Cell Signaling Technology), IL-1β (ab229696, 1:1000; Abcam), Anti-Erk1/2 (#4695, 1:1000; Cell Signaling Technology), Anti-pERK1/2 (#4370, 1:1000; Cell Signaling Technology), Anti-JNK (#9252, 1:1000; Cell Signaling Technology), Anti-pJNK (#4668, 1:1000; Cell Signaling Technology), Anti-p38 MAPK (#8690, 1:1000; Cell Signaling Technology), Anti-p-p38 MAPK (#4511, 1:1000; Cell Signaling Technology), Anti-Akt (#4691, 1:1000; Cell Signaling Technology), Anti-p-Akt (#13038, 1:1000; Cell Signaling Technology), Anti-mouse IgG HRP-linked (#7076, 1:1000; Cell Signaling Technology), and Anti-rabbit IgG HRP-linked (#7074, 1:1000; Cell Signaling Technology). Anti-GAPDH (ab8245, 1:1000; Abcam) was used as an internal control. The signals were detected by ECL assays (Epizyme). Bands were quantitated using ImageJ (v1.48 & v1.53c, Bio-Rad, USA), and results are expressed as fold change relative to the internal control. Statistical analysis All data were statistically analyzed using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). Quantitative data are expressed as the means ± SD (standard deviation). An independent-sample t -test was used to compare the two groups. One-way or two-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparisons. The correlation was determined using the Spearman correlation analysis. p value < 0.05 was considered statistically significant. Results The Levels of Inflammatory Cytokines and NETs are Highly Expressed in the BALF of ARDS To understand the role of NET formation in ALI/ARDS, proinflammatory cytokines and chemokines were detected in BALF by ELISA. As shown in Fig. 1a-d, in the ARDS patients, IL-6, TNF-α, IL-1β, and MCP-1 were significantly upregulated compared with matched control patients (healthy control, n=5). We detected circulating levels of cfDNA, MPO-DNA, citH3-DNA, and NE-DNA in ARDS patients were significantly higher than those in healthy controls (fig. 1e-h). While cell-free DNA and MPO-DNA, citH3-DN, and NE-DNA showed significant positive correlation (fig. 1i-l). In summary, cytokines, cell-free DNA and, to a lesser extent, MPO/DNA, NE/DNA, and citH3/DNA demonstrate significant correlations with NET formation in the occurrence and progression of inflammation in BALF of ARDS patients. Additionally, the results show that NETs predominantly composed of cfDNA, MPO, and NE may promote the progression of inflammation by regulating NETosis in ARDS. LPS Leads to an Early/Rapid NETosis-mediated Inflammation with Increased Neutrophil Infiltration When we investigated the pathogenetic role of NET-mediated inflammation, LPS-stimulated mice demonstrated obvious neutrophil increases followed by a mild increase in macrophage infiltration in BALF compared to PBS-instilled mice (fig. 1a-d). The number of neutrophils began to rise at 3 h and rose significantly at 24 h (fig. 2a-b). The percentage of macrophages did not significantly change (fig. 2c). H&E staining confirmed that neutrophil infiltration in the lungs of LPS-treated mice started at 3 h, reaching a peak at 6 h post instillation (fig. 2e). LPS-stimulated mice developed extensive alveolar damage with abundant inflammatory cell infiltration (fig. e-f). In addition, obvious pulmonary edema was evoked by LPS stimulation, while the ratio of wet/dry (W/D) lung was significantly increased in LPS-stimulated mice at 6 h (fig. 2g). Consistent with hyperinflammation, LPS-stimulated mice developed elevated levels of BALF proinflammatory total proteins and cytokines after 3 h, including IL-6, TNF-α, IL-1β, and MCP-1, which were markedly elevated by 6 h and persisted beyond 24 h poststimulation (fig. 2h-k). Taken together, these data indicate that LPS drives lung inflammation, mainly manifesting as excessive release of cytokines, neutrophilia, lung edema, and neutrophil infiltration in the lungs of mice. Importantly, neutrophils are required for LPS-triggered NET formation-mediated systemic inflammation and lung injury. Additionally, LPS induces an early/rapid NETosis-mediated inflammation with increased neutrophil infiltration. LPS Stimulation Activates Neutrophils to generate NETs and the MAPK /AKT Signaling Pathway in Mice To examine the existence of NETs in LPS-induced lung injury, we evaluated the expression of NET-specific markers, including MPO-DNA, citH3-DNA, and NE-DNA complexes and cfDNA, in the BALF of mice 3 h, 6 h, 12 h, and 24 h after LPS stimulation (fig. 3a-d). As indicated in fig. 3a-d, the expression of MPO, citH3, and NE progressively increased to be significantly higher than baseline at 6 h. After LPS instillation, the production of NETs was highest at 6 h and had fallen significantly at 12 h and 24 h (fig. 3a-d). Since mice treated with LPS for 6 h begins to show significant inflammatory phenotype and the lung damage, we selected the first inhalation of AK0705 at 3 h after LPS stimulation. Next, we isolated BMDNs from LPS-treated mice exhibited an increased capacity for releasing extracellular DNA. We identified NETs as cloud-like structures colocalized with DNA, MPO, and NE with the disintegration of BMDNs with a weak DAPI signal on immunohistochemistry (fig. 3e). Further, western blot analysis (fig. 3f, g) indicated that LPS instillation activates neutrophils to generate NETs in mice. In addition, compared to control mice, lung tissues collected 24 h after LPS stimulation from mice had significantly higher levels of phosphorylated JNK, ERK, p38, and Akt than control mice (fig. 3h, i), suggesting activation of the MAPK pathway in mice in response to LPS-induced inflammation. In conclusion, these results indicate that LPS induces NET formation via activating the MAPK/AKT axis. Inhaled NE inhibitor AK0705 Attenuates LPS-Stimulated Cytokine Release and NET Release in Mice AK0705 is a potential first-in-class drug targeting an enzyme that plays an important role in respiratory inflammation and is being developed to treat a broad spectrum of respiratory diseases (fig. 4a). Oxidative stress and the subsequent inflammatory responses are the major causes of LPS-induced lung epithelial cell apoptosis. Therefore, we determined whether the inhaled NE inhibitor AK0705 could prevent NET-mediated lung epithelial apoptosis. To determine the effect of AK0705 on pulmonary injury, mice were challenged with LPS to induce lung injury with or without AK0705 treatment for 3 days (fig. 4b). The BCA assay showed that LPS stimulation induced significant increases in total protein levels of BALF compared to PBS, LPS+AK0705-treated groups, while inhaled AK0705 significantly downregulated total protein levels in BALF compared to LPS-stimulated mice (Fig. 4c). The BALF levels of the proinflammatory cytokines IL-6, TNF-α, IL-1β, and MCP-1 were significantly decreased in LPS+AK0705-treated mice compared with LPS-stimulated mice (fig. 4d). By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, in the LPS+AK0705 treatment group, the mRNA expression levels of IL-6, TNF-α, IL-1β, and MCP-1 were significantly lower than those in the LPS stimulation group (fig. 4e). To determine whether NET marker levels decreased in LPS+AK0705-treated mice, we compared the levels of NET markers in the BALF of LPS-stimulated and LPS+AK0705-treated mice using the PicoGreen assay (fig. 4f). As found above, LPS+AK0705-treated mice harvested on day 3 had significantly downregulated cfDNA, MPO-DNA, NE-DNA, and citH3-DNA levels in BALF compared with LPS-only-stimulated mice (fig. 4f). In addition, we observed that the activity of NE increased in LPS-stimulated mice in BALF, while reduction in the activity of NE in LPS+AK0705-treated mice (fig. 4g). However, the involvement of NE in the signaling driving NET formation is still under investigation. In summary, these results indicate that AK0705 may alleviate the inflammatory response and NET formation in an NE-dependent manner. AK0705 Suppresses the Formation of NET in LPS-Stimulated Neutrophils In Vivo and In Vitro The LPS-induced mouse model of ALI was successfully established. Significant elevation of NET markers, including MPO, NE, and citH3 was detected by immunofluorescence staining and western blotting, both in vivo and in vitro (fig. 5a-g). Higher expression of NET markers was observed in experimental LPS-stimulated mice than in LPS+AK0705-treated or control mice, as assessed by immunostaining (fig. 5a). Interestingly, we observed that the lung tissue level of MPO was significantly upregulated in LPS-stimulated mice compared with LPS+AK0705-treated or healthy control mice (fig. 5b, c). However, there were no significant differences in citH3 levels between LPS-stimulated and LPS+AK0705-treated or control mice (fig. 5b, c). As a biomarker of pyroptosis, LDH release was significantly increased in BALF of LPS-stimulated mice. AK0705 significantly inhibited LPS-induced LDH release from LPS-stimulated mice (fig. 5d). Furthermore, enhanced NET formation was displayed by immunofluorescence staining of MPO and NE in BMDNs from LPS-stimulated mice when compared with BMDNs from LPS+AK0705-treated or PBS-treated mice (fig. 5e). When we isolated BMDNs from 72-h-LPS-treated mice, we observed significantly increased expression of the NET markers MPO, NE, and citH3, as measured by western blot (fig. 5f, g). Collectively, the results indicate that treatment with the NE inhibitor AK0705 downregulates the expression of NET markers in vivo and in vitro in LPS-induced ALI. AK0705 Inhibits NLRP3 Inflammasome-Mediated Pyroptosis and LPS-NET-Cytokine Loop in Mice It has been reported in the literature that the NLRP3/GSDMD signaling pathway is closely associated with the expression of NETosis and pyroptosis, western blot analysis result indicated that AK0705 decreased the levels of NLRP3/GSDMD, GSDMD-NT, IL-1β after LPS stimulation. In this study, we explored the GSDMD-NLRP3 signaling pathway, western blot analysis showed that GSDMD-NLRP3 signaling proteins were significantly upregulated in LPS-stimulated mice compared to controls or LPS+AK0705-treated mice (fig. 6a, b). Next, we treated LPS-stimulated mice with AK0705, sivelestat (an NE inhibitor), Cl-amidine (a PAD4 inhibitor), and DPI (an NADPH oxidase inhibitor) to demonstrate the indispensable roles of NE, PAD4 and ROS in LPS-induced NET formation. AK0705, sivelestat, Cl-amidine, and DPI significantly downregulated the W/D ratio of lungs (fig. 6c) and total protein levels of BALF when compared to LPS-stimulated mice (fig. 6d). Decreased BALF levels of IL-6, TNF-α, IL-1β, and MCP-1 were also observed (fig. 6e). The mRNA levels of IL-6, TNF-α, IL-1β, and MCP-1 were significantly lower than LPS-treated mice (fig. 6f). Importantly, AK0705, sivelestat, Cl-amidine, and DPI each significantly blocked NET formation in BALF (fig. 6g). H&E staining and Immunohistochemical showed that Ly6G and F4/80 markers of lung inflammatory cell expression were significantly downregulated in all the above inhibitor-treated mice compared to LPS-stimulated mice, along with the downregulation of lung injury scores compared to LPS-stimulated mice (fig. 6h, i), the percentage of positive cells was quantified (5 fields per mouse, n=3) (fig. 7a, b). All inhibitors abrogated LPS-induced NET formation and inflammation, as confirmed by cell-free DNA, MPO-DNA, citH3-DNA, and NE-DNA (fig. 6c-i). In summary, these results demonstrate that LPS promotes NET formation and the inflammatory response in an NE-, PAD4-, and ROS-dependent manner. LPS-Induced NETosis is Dependent on NE, PAD4, ROS and Contributes to Increased NET Formation by Activating the MAPK/AKT/NLRP3 Pathway Axis in Mice We observed less deposition in the lungs of LPS-stimulated mice treated with AK0705, sivelestat, Cl-amidine, or DPI (fig. 7c), all inhibitors significantly reduced LPS-induced NET formation. Then, to further investigate the molecular changes in LPS-treated NET-mediated ALI, considering the important mitogen-activated protein kinases (MAPK) and Akt in the initiation of NETosis, we continue to detect the expression of MAPK and Akt signaling proteins. Interestingly, inhibition of NET release by NE inhibitors like sivelestat or AK0705, the PAD4 inhibitor Cl-amidine, and DPI administration effectively reversed the suppression of MAPK/AKT in LPS-induced ALI mice (fig. 7d-f). Notably, as shown in Fig. 7d and Fig. 6a, the inhaled NE inhibitor AK0705 attenuated NET formation by downregulating the MAPK/AKT/NLRP3 pathway in LPS-induced NET-mediated ALI. Collectively, these results indicate that LPS promotes NET formation by activating the MAPK/AKT/NLRP3 pathway in LPS-induced ALI mice. Discussion Inflammation and cytokine storms, as key pathogenic mechanisms, aid in the development of ALI/ARDS in vulnerable hosts during infection. Thus, targeting the inflammatory storm may reduce the severity of ALI/ARDS. In addition, the cytokine storm activates the immune system and leads to uncontrollable pulmonary inflammation. Importantly, ARDS is characterized by hyperactivation with enhanced NET formation. We investigated whether LPS could play a pathogenic role in ALI/ARDS through NET formation. Using clinical samples and mouse models, we comprehensively assessed the proinflammatory effect of NET-mediated inflammation. We showed that LPS activated neutrophils to form NETs and contributed to the cytokine storm and lung inflammation. LPS activated neutrophils to facilitate ERK, JNK, p38, and AKT activation, thus enhancing neutrophil infiltration in the lung with abundant NET formation. Importantly, our findings also revealed that treatment with inhaled NE, PAD4, or NADPH inhibitors significantly reduced neutrophil infiltration in the lung and ameliorated the inflammatory response. The term “cytokine storm” was first used to describe the pathogenesis of graft-versus-host disease (GVHD) and was later demonstrated to be associated with various infectious, autoimmune, and inflammatory diseases [40]. The cytokine storm is characterized by increased production of IL-1β, IL-6, TNF-α, MCP1, and other cytokines. These inflammatory mediators activate the immune system and lead to life-threatening uncontrollable inflammation [41]. However, the understanding of cytokine storm is still in the early stage. COVID-19, a virus-induced respiratory disease, has brought attention to cytokine storms [42]. In severe COVID-19 patients, a hyperinflammatory status with a massive release of proinflammatory cytokines has been proven, which shows that neutrophilia predicts poor outcomes in patients with severe COVID-19 [43]. In addition, inflammation and cytokine storms, as key pathogenic mechanisms, aid in developing ALI/ARDS in some vulnerable hosts during COVID-19 infections. Thus, targeting the inflammatory storm may reduce the severity of ALI/ARDS. Notably, NETs can facilitate the production of inflammatory mediators and further be enhanced by these mediators, leading to a vicious uncontrollable, inflammatory loop [44]. Although it has yet to be determined whether NETs contribute to the amplified inflammatory process in ARDS patients, there is accumulating evidence to indicate inflammatory cytokines in the ARDS niche that can interact with NETs [45]. Indeed, a NET-cytokine loop exists in various diseases, including COVID-19, atherosclerosis, and systemic lupus erythematosus (SLE) [2, 46, 47]. Despite recent advances in exploring the role of neutrophils and NETs in the pathophysiology of ALI/ARDS, little is known about the underlying mechanism. Herein, our observation is that the levels of NET components in BALF were associated with the clinical outcome of ARDS patients. Although we have not tested NET formation in COVID-19, the LPS–NET–cytokine storm loop may be validated in the future, since enhanced NET formation and a hyperinflammatory state are features of patients with severe ARDS. Considering that many endogenous pathways are involved in NETosis, we investigated the underlying molecular mechanisms of LPS-induced NET formation [15]. Previous studies have shown that the generation of ROS is needed for NET formation in ARDS [48]. In addition, several studies have suggested that PAD4 or NE inhibitors prevent NETosis in human neutrophils and mice [49, 50]. In contrast, NETosis induced by different physiological stimuli is very diverse in terms of the engaged pathways. In addition, granulocyte-macrophage colony-stimulating factor (GM-CSF) and TNF can induce NETosis in a ROS-independent but PAD4-dependent way [51]. We analyzed these biological processes in LPS-stimulated neutrophils and found that NE, PAD4, and ROS were essential molecules for LPS-induced NET formation. MAPKs and Akt are at the center of two important signaling pathways that have been closely linked to NETosis, and GSDMD is an important signaling pathway that has been closely linked to pyroptosis. Our study shows that the inhaled NE inhibitor AK0705 attenuated LPS-induced NET-mediated inflammation by downregulating the ERK/JNK/p38 MAPK, Akt, and NLRP3-GSDMD signaling pathways. Herein, we demonstrated, first, that the inhaled NE inhibitor AK0705 blocks NET formation in the lungs of mice undergoing experimental LPS stimulation. Following induction with LPS, NETs were primarily expressed during the inflammatory period and were observed in the alveolar and interstitial space. Second, we demonstrated that LPS-induced NETs depend on neutrophil infiltration and activation both in vivo and in vitro . Third, inhaled NE inhibitors led to reduced formation of NETs and proinflammatory mediators and prevented further deterioration of lung damage. Finally, we found that LPS-induced NETosis depended on NE, PAD4, and ROS in the development of lung inflammation. We analyzed these biological processes in LPS-stimulated lungs and discovered the important role of the inhaled NE inhibitor AK0705. We also found that NE, PAD4, and ROS are essential targets for LPS-induced NET formation. Furthermore, MAPK, Akt, and NLRP3-GSDMD are three important signaling pathways that have been closely linked to NETosis. This study shows that the ERK, JNK, Akt, and NLRP3 axes are activated in the lungs after LPS stimulation. Neutrophils, the earliest effector cells, are mainly involved in the inflammatory response in ALI. During ALI, excessively or continuously activated neutrophils from peripheral lymphoid organs can enter inflammatory sites by crossing pulmonary vascular endothelial cells and alveolar epithelial cells. There they produce ROS, proteolytic enzymes, and arachidonic acid metabolites [52], causing the basement membrane and alveolar-capillary barrier to be destroyed, alveolar-capillary permeability to increase, and eventually inflammatory cell entry into the lung interstitium and alveolar cavity to occur, accompanied by the formation of pulmonary edema [53]. MPO is a characteristic enzyme expressed by neutrophils, and its content in each neutrophil is constant (approximately 5% of dry cell weight). Therefore, MPO can also be utilized as a neutrophil marker [54, 55]. Furthermore, neutrophils play an important role in the pathogenesis of ALI via NE [28]. It has been suggested that NE may play a key role in the increase in pulmonary epithelial and microvascular permeability in ALI [56]. Our results showed that NE activity in lung tissue was significantly increased in ARDS patients and LPS-stimulated mice. AK0705 inhalation markedly reduced NE activity in lung tissues. Additionally, it benefited the mice by inhibiting NE activities and reducing lung inflammation, edema, proinflammatory cytokines, and NET markers. In our study, the effect of AK0705, which was delivered by inhalation on LPS-induced ALI rather than that of AK0705 administered intravenously. These findings suggest that when delivered via the inhalation route, more NE inhibitors can reach the lung directly than by the intravenous routes [36]. AK0705 is a small-molecule NE inhibitor, and NE activity may indirectly reflect the quantity of AK0705 that is inhaled into the alveoli. In the AK0705 inhalation group, NE activity was markedly inhibited in lung tissues compared with that in the LPS-stimulated group. These results indicate that AK0705 can be inhaled into the lung and effectively suppress NE activity in lung tissues. Overly increased NE activity in the lungs may play a vital role in the pathogenesis of LPS-induced ALI in mice. However, the physiological effect of inhaled AK0705 and LPS-stimulated neutrophil interactions remains unknown. The mechanism by which AK0705 is internalized by neutrophils and lungs will be investigated in our future studies. Lung involvement is very common in ARDS and other diseases. Importantly, excessive activation of neutrophils and NETs is implicated in numerous pathologies in many other diseases [50, 57]. In addition, NETs exacerbate inflammatory cascades and sterile inflammation in lung ischemia and reperfusion injury [58, 59]. In the present study, we observed that LPS stimulation induced lung neutrophilic inflammation, which was ameliorated by neutrophil depletion and suppression of NET formation. This indicates a dominant role of NETs as inflammatory mediators in LPS-related lung inflammation. There are several limitations to our study. First, we did not test combined therapy in LPS-stimulated mice in vivo . Second, it is still unclear whether membrane AK0705 receptor (mAK0705R) exists on the neutrophil membrane or whether mAK0705R is involved in LPS tolerance. Third, we demonstrated the pathogenic role of LPS in animal models and to some extent in patients of ARDS, but additional research is needed to verify the link between NETs and neutrophils in other hyperinflammatory conditions. In conclusion, our findings demonstrate the underlying relationship between hyperinflammation and NET formation. LPS induces the release of NETs in an NE-dependent manner, which contribute to lung inflammation. Accordingly, abolishing NETs or inhibiting NE activity could abrogate the LPS-induced hyperinflammatory process. Our study highlights the important role of the LPS–NE–NET and NET-MAPK/NLRP3 pathway in the overwhelming inflammatory response. This pathway could become a therapeutic target against the ARDS spectrum. Declarations ACKNOWLEDGEMENTS The authors appreciated the help of Zhongshan Hospital Affiliated to Fudan University. AUTHOR CONTRIBUTION YS, XT, and NF provided financial support. YS, XT, and NA designed the project and approved the final manuscript. NA and NF conducted all experiments and drafted the manuscript. ML, TP, and JS have made important contributions to the analysis and interpretation of data. CZ, YC, and CC conducted the experiments and provided valuable advice. The authors read and approved the final manuscript. FUNDING This study was supported by the National Natural Science Foundation of China(82130001, 82272243), the National key R&D plan (2020YFC2003700)， Shanghai Municipal Science and Technology Major Project (20Z11901000, 20DZ2261200, 20XD1401200, 22Y11900800), Science and Technology Commission of Shanghai Municipality (20Z11901000, 20DZ2261200, 20XD1401200, 22Y11900800), Clinical Research Plan of SHDC (SHDC2020CR5010-002), Shanghai Municipal Key Clinical Specialty (shslczdzk02201), Shanghai Municipal Health Commission and Shanghai Municipal Administrator of Traditional Chinese Medicine (ZY(2021-2023)-0207-01). This work was also sponsored by grants from the Clinical Medicine Foundation of Jiangsu University (JLY20180124); and Shanghai Municipal Health Commission (20204Y0082). DATA AVAILABILITY All the data supporting the findings of this study are available within the article and its supplementary information files or can be obtained from the corresponding author upon reasonable request. Source data are provided with this paper. Ethics Approval and Consent to Participate The studies involving human participants were reviewed and approved by the Institutional Research Ethics Committee of Zhongshan Hospital (ID: 2011-212), Shanghai, China. Informed consent was provided by all participants. Animal ethics approval was obtained from the Animal Care and Use Committee of Zhongshan Hospital. Competing interests The authors declare that they have no conflict of interest. References Matthay, M.A., et al. 2024. A New Global Definition of Acute Respiratory Distress Syndrome. Am J Respir Crit Care Med. 209(1):37-47. https://doi.org/10.1164/rccm.202303-0558ws. Barnes, B.J., et al. 2020. Targeting potential drivers of COVID-19: Neutrophil extracellular traps. J Exp Med. 217(6):e20200652. https://doi.org/10.1084/jem.20200652. Wang, D., et al. 2020. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA. 323(11):1061-1069. https://doi.org/10.1001/jama.2020.1585. Wang, Y., D. Zhang, and Y. Song. 2018. Neutrophil-to-Lymphocyte Ratio as a Prognostic Marker in Acute Respiratory Distress Syndrome Patients: A Retrospective Study. American Journal of Respiratory and Critical Care Medicine. 10(1):273-282. https://doi.org/10.21037/jtd.2017.12.131. Schonrich, G. and M.J. Raftery. 2016. Neutrophil Extracellular Traps Go Viral. Front Immunol. 7:366. https://doi.org/10.3389/fimmu.2016.00366. Brinkmann, V., et al. 2004. Neutrophil extracellular traps kill bacteria. Science. 303(5663):1532-5. https://doi.org/10.1126/science.1092385. Pires, R.H., S.B. Felix, and M. Delcea. 2016. The architecture of neutrophil extracellular traps investigated by atomic force microscopy. Nanoscale. 8(29):14193-202. https://doi.org/10.1039/c6nr03416k. Chapman, E.A., et al. 2019. Caught in a Trap? Proteomic Analysis of Neutrophil Extracellular Traps in Rheumatoid Arthritis and Systemic Lupus Erythematosus. Front Immunol. 10:423. https://doi.org/10.3389/fimmu.2019.00423. Petretto, A., et al. 2019. Neutrophil extracellular traps (NET) induced by different stimuli: A comparative proteomic analysis. PLoS One. 14(7):e0218946. https://doi.org/10.1371/journal.pone.0218946. Haider, P., et al. 2020. Neutrophil Extracellular Trap Degradation by Differently Polarized Macrophage Subsets. Arterioscler Thromb Vasc Biol. 40(9):2265-2278. https://doi.org/10.1161/atvbaha.120.314883. Adrover, J.M., et al. 2020. Programmed 'disarming' of the neutrophil proteome reduces the magnitude of inflammation. Nat Immunol. 21(2):135-144. https://doi.org/10.1038/s41590-019-0571-2. Ebrahimi, F., et al. 2018. Markers of neutrophil extracellular traps predict adverse outcome in community-acquired pneumonia: secondary analysis of a randomised controlled trial. Eur Respir J. 51(4):1701389. https://doi.org/10.1183/13993003.01389-2017. Fuchs, T.A., et al. 2007. Novel cell death program leads to neutrophil extracellular traps. J Cell Biol. 176(2):231-41. https://doi.org/10.1083/jcb.200606027. Brinkmann, V. and A. Zychlinsky. 2012. Neutrophil extracellular traps: is immunity the second function of chromatin? J Cell Biol. 198(5):773-83. https://doi.org/10.1083/jcb.201203170. Sollberger, G., et al. 2018. Gasdermin D plays a vital role in the generation of neutrophil extracellular traps. Sci Immunol. 3(26):eaar6689. https://doi.org/10.1126/sciimmunol.aar6689. Papayannopoulos, V. 2018. Neutrophil extracellular traps in immunity and disease. Nat Rev Immunol. 18(2):134-147. https://doi.org/10.1038/nri.2017.105. Papayannopoulos, V., et al. 2010. Neutrophil elastase and myeloperoxidase regulate the formation of neutrophil extracellular traps. J Cell Biol. 191(3):677-91. https://doi.org/10.1083/jcb.201006052. Chen, X., et al. 2020. Macrophage polarization and its role in the pathogenesis of acute lung injury/acute respiratory distress syndrome. Inflamm Res. 69(9):883-895. https://doi.org/10.1007/s00011-020-01378-2. Abderrazak, A., et al. 2015. NLRP3 inflammasome: from a danger signal sensor to a regulatory node of oxidative stress and inflammatory diseases. Redox Biol. 4:296-307. https://doi.org/10.1016/j.redox.2015.01.008. Gross, O., et al. 2011. The inflammasome: an integrated view. Immunol Rev. 243(1):136-51.. https://doi.org/10.1111/j.1600-065x.2011.01046.x. Swanson, K.V., M. Deng, and J.P. Ting. 2019. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 19(8):477-489. https://doi.org/10.1038/s41577-019-0165-0. Jia, C., et al. 2019. Endothelial cell pyroptosis plays an important role in Kawasaki disease via HMGB1/RAGE/cathespin B signaling pathway and NLRP3 inflammasome activation. Cell Death Dis. 10(10):778. https://doi.org/10.1038/s41419-019-2021-3. Kayagaki, N., et al. 2015. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signaling. Nature. 526(7575):666-71. https://doi.org/10.1038/nature15541. Kayagaki, N., et al. 2011. Non-canonical inflammasome activation targets caspase-11. Nature. 479(7371):117-21. https://doi.org/10.1038/nature10558. Winterbourn, C.C., A.J. Kettle, and M.B. Hampton. 2016. Reactive Oxygen Species and Neutrophil Function. Annu Rev Biochem. 85:765-92. https://doi.org/10.1146/annurev-biochem-060815-014442. Lv, X., et al. 2021. Tetrachlorobenzoquinone exhibits immunotoxicity by inducing neutrophil extracellular traps through a mechanism involving ROS-JNK-NOX2 positive feedback loop. Environ Pollut. 268(Pt B):115921. https://doi.org/10.1016/j.envpol.2020.115921. Jia, J., et al. 2022. Ferritin triggers neutrophil extracellular trap-mediated cytokine storm through Msr1 contributing to adult-onset Still's disease pathogenesis. Nat Commun. 13(1):6804. https://doi.org/10.1038/s41467-022-34560-7. Kinoshita, M., S. Ono, and H. Mochizuki. 2000. Neutrophils mediate acute lung injury in rabbits: role of neutrophil elastase. Eur Surg Res. 32(6):337-46. https://doi.org/10.1159/000052215. Ishii, T., et al. 2010. Neutrophil elastase contributes to acute lung injury induced by bilateral nephrectomy. Am J Pathol. 177(4):1665-73. https://doi.org/10.2353/ajpath.2010.090793. Bernard, G.R., et al. 1994. The American-European Consensus Conference on ARDS. Definitions, mechanisms, relevant outcomes, and clinical trial coordination. Am J Respir Crit Care Med. 149(3 Pt 1):818-24. https://doi.org/10.1164/ajrccm.149.3.7509706. Carden, D., et al. 1998. Neutrophil elastase promotes lung microvascular injury and proteolysis of endothelial cadherins. Am J Physiol. 275(2):H385-92.https://doi.org/10.1152/ajpheart.1998.275.2.h385. Harada, N., K. Okajima, and H. Isobe. 2008. Role of neutrophil elastase in development of pulmonary vascular injury and septic shock in rats. Shock. 30(4):379-87. https://doi.org/10.1097/shk.0b013e3181673e2c. Hagio, T., et al., Sivelestat, a specific neutrophil elastase inhibitor, prevented phorbol myristate acetate-induced acute lung injury in conscious rabbits. Pulm Pharmacol Ther, 2005. 18(4): p. 285-90. Hashimoto, S., et al. 2008. Neutrophil elastase activity in acute lung injury and respiratory distress syndrome. Respirology. 18(4):285-90. https://doi.org/10.1016/j.pupt.2004.12.013. Aikawa, N., et al. 2011. Reevaluation of the efficacy and safety of the neutrophil elastase inhibitor, Sivelestat, for the treatment of acute lung injury associated with systemic inflammatory response syndrome; a phase IV study. Pulm Pharmacol Ther. 24(5):549-54. https://doi.org/10.1016/j.pupt.2011.03.001. Kropp, J., et al. 2001. Inhalation of [123I]alpha1-protease inhibitor: toward a new therapeutic concept of alpha1-protease inhibitor deficiency? J Nucl Med. 42(5):744-51. Bueltmann, M., et al. 2009. Inhaled milrinone attenuates experimental acute lung injury. Intensive Care Med. 35(1):171-8. https://doi.org/10.1007/s00134-008-1344-9. Yen, C.C., et al. 2011. Aerosolized human extracellular superoxide dismutase prevents hyperoxia-induced lung injury. PLoS One. 6(10):e26870. https://doi.org/10.1371/journal.pone.0026870. Hirano, Y., et al. 2015. Neutralization of osteopontin attenuates neutrophil migration in sepsis-induced acute lung injury. Crit Care. 19(1):53. https://doi.org/10.1186/s13054-015-0782-3. Chousterman, B.G., F.K. Swirski, and G.F. Weber. 2017. Cytokine storm and sepsis disease pathogenesis. Semin Immunopathol. 39(5): p. 517-528. https://doi.org/10.1007/s00281-017-0639-8. Grom, A.A., A. Horne, and F. De Benedetti. 2016. Macrophage activation syndrome in the era of biologic therapy. Nat Rev Rheumatol. 12(5):259-68. https://doi.org/10.1038/nrrheum.2015.179. Mangalmurti, N. and C.A. Hunter. 2020. Cytokine Storms: Understanding COVID-19. Immunity. 53(1):19-25. https://doi.org/10.1016/j.immuni.2020.06.017. Liu, Y., et al. 2020. Neutrophil-to-lymphocyte ratio as an independent risk factor for mortality in hospitalized patients with COVID-19. J Infect. 81(1):e6-e12. https://doi.org/10.1016/j.jinf.2020.04.002. Delgado-Rizo, V., et al. 2017. Neutrophil Extracellular Traps and Its Implications in Inflammation: An Overview. Front Immunol. 8:81. https://doi.org/10.3389/fimmu.2017.00081. Khongthaw, B., et al. 2022. Lycopene: a therapeutic strategy against coronavirus disease 19 (COVID-19). Inflammopharmacology. 30(6):1955-1976. https://doi.org/10.1007/s10787-022-01061-4. Jorch, S.K. and P. Kubes. 2017. An emerging role for neutrophil extracellular traps in noninfectious disease. Nat Med. 23(3):279-287. https://doi.org/10.1038/nm.4294. Middleton, E.A., et al. 2020. Neutrophil extracellular traps contribute to immunothrombosis in COVID-19 acute respiratory distress syndrome. Blood. 136(10):1169-1179. https://doi.org/10.1182/blood.2020007008. Rizvi, Z.A., et al. 2022. Prophylactic treatment of Glycyrrhiza glabra mitigates COVID-19 pathology through inhibition of pro-inflammatory cytokines in the hamster model and NETosis. Front Immunol. 13:945583. https://doi.org/10.3389/fimmu.2022.945583. Knight, J.S., et al. 2015. Peptidylarginine deiminase inhibition disrupts NET formation and protects against kidney, skin and vascular disease in lupus-prone MRL/lpr mice. Ann Rheum Dis. 74(12):2199-206. https://doi.org/10.1136/annrheumdis-2014-205365. Okeke, E.B., et al. 2020. Inhibition of neutrophil elastase prevents neutrophil extracellular trap formation and rescues mice from endotoxic shock. Biomaterials. 238:119836. https://doi.org/10.1016/j.biomaterials.2020.119836. Tatsiy, O. and P.P. McDonald. 2018. Physiological Stimuli Induce PAD4-Dependent, ROS-Independent NETosis, With Early and Late Events Controlled by Discrete Signaling Pathways. Front Immunol. 9:2036. https://doi.org/10.3389/fimmu.2018.02036. Nova, Z., H. Skovierova, and A. Calkovska. 2019. Alveolar-Capillary Membrane-Related Pulmonary Cells as a Target in Endotoxin-Induced Acute Lung Injury. Int J Mol Sci. 20(4):831. https://doi.org/10.3390/ijms20040831. Borges, L., et al. 2020. COVID-19 and Neutrophils: The Relationship between Hyperinflammation and Neutrophil Extracellular Traps. Mediators Inflamm. 2020:8829674. https://doi.org/10.1155/2020/8829674. Aratani, Y. 2018. Myeloperoxidase: Its role for host defense, inflammation, and neutrophil function. Arch Biochem Biophys. 640:47-52. https://doi.org/10.1016/j.abb.2018.01.004. Nair, A., et al. 2019. Conceptual Evolution of Cell Signaling. Int J Mol Sci. 20(13):3292. https://doi.org/10.3390/ijms20133292. Miyazaki, Y., et al. 1998. Effects of a neutrophil elastase inhibitor (ONO-5046) on acute pulmonary injury induced by tumor necrosis factor alpha (TNFalpha) and activated neutrophils in isolated perfused rabbit lungs. Am J Respir Crit Care Med. 157(1):89-94. https://doi.org/10.1164/ajrccm.157.1.9612021. Honda, M. and P. Kubes. 2018. Neutrophils and neutrophil extracellular traps in the liver and gastrointestinal system. Nat Rev Gastroenterol Hepatol. 15(4):206-221. https://doi.org/10.1038/nrgastro.2017.183. Ren, J., et al. 2021. Platelet TLR4-ERK5 Axis Facilitates NET-Mediated Capturing of Circulating Tumor Cells and Distant Metastasis after Surgical Stress. Cancer Res. 81(9):2373-2385. https://doi.org/10.1158/0008-5472.can-20-3222. Sorvillo, N., et al. 2019. Extracellular DNA NET-Works With Dire Consequences for Health. Circ Res. 125(4):470-488. https://doi.org/10.1161/circresaha.119.314581. Additional Declarations No competing interests reported. Supplementary Files Supplementaryfile.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3875684","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268427176,"identity":"d836f851-17ed-4994-959a-8db97c7b23ed","order_by":0,"name":"Yuanlin Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYDACdjD5n0eevbHx4QeitDBDSDnDnsPNxhKkaDFmuJHeJsBDjA6Dw+wPHxf8YktsnPmwjUGCwU5Ot4GgFh5j45l9PInt0oltDwoYko3NDhDWwibN2yOR2Dg7sd1AguFA4jbCWtifAbUYJDbcPNgmwUOcFgYzaZ4fCUDvMxKpRRLkF96GA8BATgQGsgERfuE73v7wMc+fA8CoPP7w4YcKOzmCWhRAChjb4O4koBwE5BtA5B8iVI6CUTAKRsHIBQDBukKhEipACAAAAABJRU5ErkJggg==","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yuanlin","middleName":"","lastName":"Song","suffix":""},{"id":268427177,"identity":"39f27511-d05e-4f40-a5d1-9f62c611fa63","order_by":1,"name":"Xinjun Tang","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xinjun","middleName":"","lastName":"Tang","suffix":""},{"id":268427178,"identity":"a2a5ca5c-0ace-49ca-bc58-96d0d86a3c5a","order_by":2,"name":"Nurbiya Aji","email":"","orcid":"","institution":"Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Nurbiya","middleName":"","lastName":"Aji","suffix":""},{"id":268427179,"identity":"a9c41339-9841-4e62-ad14-eaaaa7d47940","order_by":3,"name":"Nana Feng","email":"","orcid":"","institution":"Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Nana","middleName":"","lastName":"Feng","suffix":""},{"id":268427180,"identity":"524afcb1-46b7-445b-a133-914bb97b9994","order_by":4,"name":"Ting Pan","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Pan","suffix":""},{"id":268427181,"identity":"129d443c-85dc-4d05-a23f-89fdb2113f50","order_by":5,"name":"Miao Li","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Miao","middleName":"","lastName":"Li","suffix":""},{"id":268427182,"identity":"98eddeb9-8edf-4db7-892b-0ccc130bd2b3","order_by":6,"name":"Juan Song","email":"","orcid":"","institution":"Fudan University","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"","lastName":"Song","suffix":""},{"id":268427183,"identity":"6a9880ff-9bef-4a04-ba24-2279dfaac0e1","order_by":7,"name":"Cuiping Zhang","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Cuiping","middleName":"","lastName":"Zhang","suffix":""},{"id":268427184,"identity":"7d85f755-a9f5-4857-a540-fb0e9ca5deaf","order_by":8,"name":"Yencheng Chao","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yencheng","middleName":"","lastName":"Chao","suffix":""},{"id":268427185,"identity":"7ee7f93c-2cd6-4d2d-a446-4caf2af493df","order_by":9,"name":"Cuicui Chen","email":"","orcid":"","institution":"Zhongshan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Cuicui","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-01-18 11:59:10","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-3875684/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3875684/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49977927,"identity":"e15a042a-24e6-423e-a822-b2b76e16eb60","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":902318,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of cytokine and NET in BALF. \u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ed\u003c/strong\u003eBALF levels of IL-6, TNF-α, IL-1β, and MCP-1 were measured (n=5 in healthy control, n=17 in ARDS patients). \u003cstrong\u003ee\u003c/strong\u003e-\u003cstrong\u003eh\u003c/strong\u003e BALF levels of NET markers cfDNA, MPO-DNA, citH3-DNA, and NE-DNA complexes. \u003cstrong\u003ei\u003c/strong\u003e-\u003cstrong\u003el\u003c/strong\u003eCorrelation curves between the circulating levels of cfDNA, MPO-DNA, citH3-DNA, and NE-DNA, (total n = 22). BALF: bronchoalveolar lavage fluid; TNF-α: tumor necrosis factor alpha; MCP-1: monocyte chemotactic protein-1; cfDNA: cell-free DNA; MPO: myeloperoxidase (MPO); NE: neutrophil elastase; citH3: citrullinated histone. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 when compared with control group; ns = not significant. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/8097e726c771eb6420bf6d0c.png"},{"id":49977928,"identity":"cb35597b-235b-4902-a4ee-ac1c67fa6877","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5049616,"visible":true,"origin":"","legend":"\u003cp\u003eLPS leads to NET-mediated inflammation with increased neutrophil infiltration. \u003cstrong\u003ea,b\u003c/strong\u003e Dynamic changes of the frequencies and numbers of BALF neutrophils were assessed by flow cytometry (n = 5 for cell frequencies, n = 5 for cell numbers). \u003cstrong\u003ec\u003c/strong\u003e,\u003cstrong\u003ed\u003c/strong\u003e Frequencies and numbers of BALF macrophages. \u003cstrong\u003ee\u003c/strong\u003eH\u0026amp;E staining. Scale bars, 50 μm. \u003cstrong\u003ef \u003c/strong\u003eLung injury score. \u003cstrong\u003eg\u003c/strong\u003e Lung W/D ratio. \u003cstrong\u003eh\u003c/strong\u003e-\u003cstrong\u003ek\u003c/strong\u003e BALF levels of IL-6, TNF-α, IL-1β, and MCP-1 were measured. H\u0026amp;E: hematoxylin and eosin; IL: interleukin; LPS: lipopolysaccharide. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns = not significant. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/af45e452bb02e6f428ae73e5.png"},{"id":49977925,"identity":"78cfd641-20ad-4bfb-9a65-36a485a6d709","added_by":"auto","created_at":"2024-01-22 14:57:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5677425,"visible":true,"origin":"","legend":"\u003cp\u003eLPS instillation activates neutrophils to generate NETs in mice. \u003cstrong\u003ea\u003c/strong\u003e-\u003cstrong\u003ed\u003c/strong\u003e Quantification of cfDNA, MPO-DNA, citH3-DNA, and NE-DNA complexes of BALF from LPS-treated mice at 3 h, 6 h, 12 h, and 24 h (n = 5 in each group). \u003cstrong\u003ee\u003c/strong\u003e Immunofluorescence staining of MPO (red), NE (green), and DAPI (blue) in BMDNs of LPS-treated mice vs controls at 24 h after LPS stimulation. Scale bars, 50 μm. \u003cstrong\u003ef-g\u003c/strong\u003e The protein expressions of MPO, NE in the lung from LPS-treated mice (n = 5) and control mice (n = 5) were detected by western blot analysis. \u003cstrong\u003eh, I \u003c/strong\u003eThe protein phosphorylation of ERK, JNK, and p38 was measured for 24 h by western blotting (n=5). GAPDH was included as a reference gene. DAPI: 4'-6 diamidino-2-phenylindole; SD: standard deviation. All values are the mean ± SD. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns = not significant. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/b425701dd187be685b60c54f.png"},{"id":49977930,"identity":"029673e9-dda2-4a2c-97f8-d23f8d4a2f3c","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1641191,"visible":true,"origin":"","legend":"\u003cp\u003eNET-mediated inflammation promotes inflammatory response in an NE-dependent way. \u003cstrong\u003ea\u003c/strong\u003e The structure of inhaled NE inhibitor AK0705. \u003cstrong\u003eb\u003c/strong\u003eBrief procedures of LPS-induced ALI mice trials. \u003cstrong\u003ec\u003c/strong\u003e The levels of total proteins in BALF. \u003cstrong\u003ed \u003c/strong\u003eBALF levels of IL-6, TNF-α, IL-1β, and MCP-1. \u003cstrong\u003ee \u003c/strong\u003eThe mRNA expressions of IL-6, TNF-α, IL-1β, and MCP-1 in the lung. \u003cstrong\u003ef\u003c/strong\u003eQuantification of cell-free DNA in BALF. \u003cstrong\u003eg \u003c/strong\u003eAlterations of NE activities in BALF. Data are presented as means of ± SD of 3 technical replicates. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns = not significant. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/bd751dc28567a47b50d15ff9.png"},{"id":49977929,"identity":"a453410a-e5b9-4c82-a35c-8a4930f7746d","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7255317,"visible":true,"origin":"","legend":"\u003cp\u003eInhaled NE inhibitor attenuates the release of NET to alleviate NET formation and inflammation in mice. \u003cstrong\u003ea \u003c/strong\u003eRepresentative image of immunofluorescence staining for MPO (green), citH3(red), and DAPI (blue) in lung tissue. Scale bars, 100 μm. \u003cstrong\u003eb, c\u003c/strong\u003e Western blotting analysis for NET markers MPO, NE, and citH3 in the lung (n = 5). \u003cstrong\u003ed \u003c/strong\u003eBALF of control, LPS-treated, and LPS+AK0705-treated mice were collected, and the LDH cytotoxicity assay was performed. \u003cstrong\u003ee \u003c/strong\u003eRepresentative immunofluorescence images of NET generation in BMDNs from PBS, LPS-stimulated, and LPS+AK0705-treated mice. NETs were stained by MPO (red), NE (green), and DNA (blue). Scale bars, 200 μm. \u003cstrong\u003ef, g\u003c/strong\u003e Western blotting analysis of MPO, NE, and citH3 in the BMDNs from PBS, LPS, and LPS+AK0705-treated mice at 72 h (n = 5). GAPDH was included as a reference gene. Densitometric analysis of MPO/GAPDH, NE/GAPDH, and citH3/GAPDH was shown. Data are presented as means mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns = not significant. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/55319c1faa679d94e4dec6c8.png"},{"id":49977932,"identity":"0bca224b-74db-437b-87d9-94600f25f4b1","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":9627051,"visible":true,"origin":"","legend":"\u003cp\u003eLPS-induced pyroptosis depends on NE, PAD4, ROS and AK0705 inhibits pyroptosis in LPS-induced ALI mice. \u003cstrong\u003ea, b \u003c/strong\u003eThe\u003cstrong\u003e \u003c/strong\u003eexpression\u003cstrong\u003e \u003c/strong\u003eof NLRP3, Caspase-1, Cleaved Caspase-1, Caspase-11, GSDMD-FL, GSDMD-NT, proIL-1β, IL-1β in lung tissue. \u003cstrong\u003ec \u003c/strong\u003eThe W/D ratio. \u003cstrong\u003ed\u003c/strong\u003e The total protein in BALF. \u003cstrong\u003ee \u003c/strong\u003eThe cell-free BALF of the IL-6, TNF-α, IL-1β, and MCP-1 levels.\u003cstrong\u003e f \u003c/strong\u003emRNA levels of IL-6, TNF-α, IL-1β, and MCP-1 in lung. \u003cstrong\u003eg \u003c/strong\u003eThe BALF of cfDNA, MPO-DNA, citH3-DNA, and NE-DNA levels were measured. \u003cstrong\u003eh \u003c/strong\u003eRepresentative images of immunohistochemical staining for neutrophil (Ly6G), macrophage (F4/80), and histology images are presented for upregulation in the LPS-treated mice lung tissues at 72 h post. Scale bars, 50 μm. \u003cstrong\u003ei\u003c/strong\u003eThe lung injury score. Results were expressed as mean ± SD. SD: standard deviation. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns= not significant when compared with LPS+AK0705 group. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/e89262c686526880db981804.png"},{"id":49977931,"identity":"e9c5ac07-887d-4ad3-903e-debbc091ee01","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6035085,"visible":true,"origin":"","legend":"\u003cp\u003eLPS-induced NETosis activates MAPK/ AKT/NLRP3 pathway axis in mice. a, b The percentage of positive cells was quantified (n=3) in image of immunohistochemical staining for neutrophil (Ly6G), macrophage (F4/80) histology. \u003cstrong\u003ec \u003c/strong\u003eImmunofluorescence staining for NE (green), MPO (red), and DAPI (blue) in lung tissue. \u003cstrong\u003ed \u003c/strong\u003eERK, JNK, p38, and AKT were measured in lung tissue at 72 h using western blot. \u003cstrong\u003ee, f\u003c/strong\u003eDensitometric analysis of p-ERK/total ERK, p-JNK/total JNK, p-p38/total p38, and p-Akt/total Akt. Data expressed as the mean ± SD. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, ns = not significant vs. the LPS group. Source data are provided as a Source Data file.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/3cf2dfcf10e97333a7365a17.png"},{"id":49977924,"identity":"395d4ee8-e23c-45cd-92a0-bf4c69c69ea6","added_by":"auto","created_at":"2024-01-22 14:57:02","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":3863336,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic\u003cstrong\u003e \u003c/strong\u003ediagram depicting the mechanism by which AK0705 alleviates the LPS-induced pyroptosis in ALI.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/64fedf562f14397f16590797.png"},{"id":51008493,"identity":"cb04b97b-e751-4503-ad3c-98532d89e606","added_by":"auto","created_at":"2024-02-12 15:54:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4293803,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/6e1ed7c4-cc64-4be1-a5df-016e3e9ce44a.pdf"},{"id":49977926,"identity":"2523388b-b3ca-48be-b367-5ddf60baad8f","added_by":"auto","created_at":"2024-01-22 14:57:03","extension":"docx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":22066884,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-3875684/v1/df77bf146b1ae6590a23c580.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Inhaled Neutrophil Elastase Inhibitor Alleviates Lipopolysaccharide Triggers Neutrophil Extracellular Trap-Mediated Acute Lung Injury via the MAPK/AKT/NLRP3 Pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003e\u0026nbsp;\u0026nbsp;Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is an acute, diffuse, inflammatory lung injury precipitated by a predisposing risk factor such as pneumonia, nonpulmonary vascular and epithelial permeability, lung edema, and gravity-dependent atelectasis, all of which contribute to the injury of lung tissue. Histological findings vary but can include intra-alveolar edema, inflammation, hyaline membrane formation, and alveolar hemorrhage [1]. The cellular and molecular mechanisms of ALI/ARDS are still unclear. A better understanding of the mechanism of ALI/ARDS will be useful in finding cellular and molecular targets for preventing and treating the disease.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Leukocytosis and neutrophils are hallmarks of acute infection [2]. Neutrophilia predicts poor outcomes in patients with COVID-19 [3], and our previous study revealed that the neutrophil-to-lymphocyte ratio is a prognostic marker in ARDS patients [4]. Neutrophils are recruited early to sites of infection, where they kill pathogens (bacteria, fungi, and viruses) by oxidative burst and phagocytosis [5]. However, neutrophils have another, much less recognized means of killing pathogens: the formation of neutrophil extracellular traps (NETs) [6]. Recent studies have demonstrated that this special form of extracellular DNA deposition is a mechanism by which neutrophils trap bacteria in a web-like structure of DNA with histones, granule proteins such as myeloperoxidase (MPO) and neutrophil elastase (NE)\u0026nbsp;[6, 7]. These NETs are mixed with neutrophil-derived nuclear proteins, leading to ensnaring pathogens [2, 6, 8-10]. Aberrant NET formation is linked to pulmonary diseases, particularly ARDS [2]. Neutrophils from patients with pneumonia-associated ARDS appear \u0026ldquo;primed\u0026rdquo; to form NETs, and the level of NETs in their blood correlates with their disease severity and mortality [11, 12]. NETs are released primarily through a cell death process termed NETosis [13]. Neutrophil death by NET extrusion (NETosis) pathway that is different from apoptosis and necrosis [6, 14]. During NETosis, in contrast to other forms of cell death, the nucleus disintegrates before the cytoplasmic membrane is compromised, and chromatin is released into the extracellular space [15]. NET release begins with the activation of peptidyl arginine deiminase 4 (encoded by PAD4), which causes histone citrullination, extensive chromatin decondensation, and the nuclear localization of granular enzymes such as myeloperoxidase (MPO) and neutrophil elastase (NE) [16, 17]. NETs are a double-edged sword, as they are beneficial for fighting infection but can be pathogenic because they expose autoantigens [15]. NET formation is a regulated process, although the signals involved are incompletely understood, and the specific role of NETs in ARDS/ALI also remains unknown.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Intensive inflammatory responses and oxidative stress are regarded as important physiologic mechanisms of ALI/ARDS [12]. Macrophages, resident immune cells, act as the first line of immune defense in the lung. They exert immediate protective responses against toxic substances together with alveolar epithelial cells. In ALI/ARDS, pulmonary macrophages are mainly proinflammatory (M1) macrophages that produce high levels of mediators of inflammation (tumor necrosis factor (TNF)-\u0026alpha;, interleukin (IL)-1\u0026beta;, etc.) and reactive oxygen species (ROS), thereby evoking a cytokine storm and severe lung injury [18]. Particularly, the NLR family pyrin domain\u0026ndash;containing 3 (NLRP3) inflammasome is commonly activated by the overproduction of ROS. In response to various toxic stimuli, the NLRP3 inflammasome oligomerizes with apoptosis-associated speck-like protein containing CARD (ASC), which allows the NLRP3 inflammasome to link with Caspase-1 to form an active inflammasome (NLRP3, ASC, and Caspase-1) that produces matured IL-1\u0026beta; [19, 20]. Moreover, activated Caspase-1 actuates the formation of the N-terminal domain of gasdermin D (GSDMD-Nterm), which triggers the release of inflammatory molecules (IL-1\u0026beta;, TNF-\u0026alpha;, lactate dehydrogenase (LDH), etc.), begins pyroptosis and further amplifies the cytokine storm [15, 21, 22]. As potential drivers of an amplified inflammatory storm in ARDS, neutrophils crosstalk with macrophages to activate the NLRP3 inflammasome by inducing NET formation in a PAD4-, NE-, and ROS-dependent manner, leading to a vicious loop accelerating the inflammatory response [15]. Caspase-11- and GSDMD-deficient mice are protected from septic shock induced by LPS, demonstrating the importance of pyroptosis in driving LPS-induced inflammation\u003cem\u003e\u0026nbsp;in vivo\u003c/em\u003e [23, 24]. However, the precise mechanisms regulating NET formation in ARDS have not been completely elucidated.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Although the signaling pathways that regulate NETosis are not fully understood, growing evidence has shown that mitogen-activated protein kinases (MAPKs) are important int NET formation. ROS are the key to the development of suicidal NETosis [25]. ROS can also activate some key enzymes, such as MPO, NE, and PAD4, thus promoting the formation of NETs [26]. More importantly, the excessive production of ROS damages the cellular macromolecules proteins, lipids, and DNA. ROS can induce phosphorylation of c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase 1/2 (ERK1/2), and the p38 MAPK family of serine/threonine kinases. Because of the important role of MAPK and Akt in the initiation of NETosis [27], we examined the expression of these kinases in LPS-induced ALI mice.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Based on the above, NE may play a vital role in the pathogenesis of ALI [28, 29] and the early stage of ARDS with NET-mediated cytokine storm [30]. As a potent proteolytic enzyme, NE can damage surrounding tissues, contributing to organ and tissue dysfunction [31, 32]. NE activities are significantly increased in the serum and lungs of animal models [33, 34]. Sivelestat, a recombinant NE inhibitor, reduces ALI in animal models [33, 34] as well as humans [35]. Here, we show a small-molecule NE inhibitor, AK0705, blocks NET formation \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. We suspect that AK0705, like sivelestat, is a potential inhalation drug. \u003cem\u003eVia\u003c/em\u003e inhalation, drugs may exert their therapeutic effects on the lungs directly [36]. Through inhalation, pharmaceutical agents can be delivered to the lungs to protect against ALI/ARDS [37, 38].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; There have been no definitive studies on whether the inhaled NE inhibitor AK0705 inhibits LPS-induced oxidative stress and pyroptosis by activating the MAPK/NLRP3 signaling axis \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein\u003c/em\u003e \u003cem\u003evitro\u003c/em\u003e. Overall, our findings reveal a mechanism through which LPS contributes to neutrophil-mediated inflammation, highlighting the importance of NETs as a therapeutic target in ALI/ARDS and showing the role of a potent inhaled NE inhibitor, AK0705, in improving clinical outcomes.\u0026nbsp;\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003ch3\u003eClinical Samples\u003c/h3\u003e\n\u003cp\u003eA total of 22 ARDS patients (17 active ARDS patients and 5 control patients) were consecutively included in the present study, and BALF samples were collected from all participants after obtaining informed consent. All BALF samples were immediately stored at -80 \u0026deg;C after collection. The biological samples of ARDS patients and healthy donors were obtained under a protocol approved by the Institutional Research Ethics Committee of Zhongshan Hospital (ID: 2011-212), Shanghai, China. Informed consent was provided by all participants.\u003c/p\u003e\n\u003ch3\u003eMice\u003c/h3\u003e\n\u003cp\u003eMale C57BL/6 mice, aged 8-12 weeks and weighing 18-22 g, were purchased from JSJ Laboratory Animals (Shanghai, China). The mice were kept in a controlled environment with a 12-hour light/dark cycle, provided with free access to mouse chow and water. The ambient temperature was maintained at 22-24 \u0026deg;C with humidity levels between 50-70%. After acclimatizing for one week, the mice were housed in specific pathogen-free conditions at the Animal Center of Zhongshan Hospital, Fudan University.\u003c/p\u003e\n\u003cp\u003eThe mice were anesthetized by intraperitoneal injection of Avertin (Sigma-Aldrich). Subsequently, LPS from \u003cem\u003eEscherichia coli\u003c/em\u003e 0111:B4 (5 mg/kg; cat#L4391, Sigma-Aldrich, St.Louis, MO, USA) dissolved in phosphate-buffered saline (PBS) to induce endometritis or only PBS with an equal volume was delivered intratracheally. The size of the lung was measured, and BALF were harvested for flow cytometry and cytokine analysis. Lung samples were collected, fixed in 4% paraformaldehyde, and embedded in paraffin. Additional lung samples were stored at -80 \u0026deg;C.\u003c/p\u003e\n\u003cp\u003eIn some experiments, to inhibit NET formation, CI-amidine (20mg/kg, HY-100574A, MCE, China, i.p.) was given 24 h and 1 h before LPS stimulation, once daily. DPI (1mg/kg, D2926, Sigma-Aldrich, USA, i.p.) was given 0.5 h before LPS stimulation, once daily. Additionally, sivelestat (50mg/kg, HY-17443, MCE China) was administered at 3 h after LPS stimulation, twice a day. All experimental procedures were conducted in accordance with institutional guidelines and approved by the Animal Care and Use Committee of Zhongshan Hospital.\u003c/p\u003e\n\u003ch3\u003eIsolation and Stimulation of Mouse Bone Marrow-derived Neutrophils\u003c/h3\u003e\n\u003cp\u003eBMDNs were isolated by density gradient centrifugation using Ficoll-Paque PLUS (GE Healthcare, Tokyo, Japan). Total bone marrow cells were collected from tibias and femurs, and the RBCs were lysed. Mature neutrophils were purified by centrifugation for 30 min at 300 \u003cstrong\u003e\u0026times;\u003c/strong\u003e \u003cem\u003eg\u003c/em\u003e without braking on a Ficoll opaque PLUS. BMDNs were collected in the bottom layer. The total number of cells was counted. Collected neutrophils were seeded onto 4-well chamber slides (1 \u003cstrong\u003e\u0026times;\u003c/strong\u003e 10\u003csup\u003e6\u003c/sup\u003e cells/mL) and cultured in RPMI 1640 supplemented with 10% FBS for 3.5 hours at 37 \u0026deg;C with stimulation from LPS (100 ng/ml), NE inhibitor AK0705 (20\u0026nbsp;\u0026mu;M). Cells were fixed, blocked, and incubated with primary antibodies overnight at 4 \u0026deg;C and then with secondary antibodies for 60 minutes at 25\u0026nbsp;℃.\u0026nbsp;After mounting with DAPI stain solution NETs could be observed under a\u0026nbsp;FV3000\u0026nbsp;confocal microscope (Olympus).\u003c/p\u003e\n\u003ch3\u003eQuantification of Cell-free DNA and NETs-DNA Complexes\u003c/h3\u003e\n\u003cp\u003eCell-free DNA was quantified using the Quant-iT PicoGreen double-stranded DNA (dsDNA) assay kit (Invitrogen, USA), following the manufacturer\u0026apos;s instructions. BALF was added to each well, followed by a 10-minute incubation. MPO-DNA, NE-DNA, and\u0026nbsp;citH3-DNA\u0026nbsp;complexes were quantified using the Quanti-iT PicoGreen assay. Anti-MPO monoclonal antibody (ab25989, 1:1000; Abcam,), anti-NE antibody (ab68672, 1:1000; Abcam), and anti-citH3 antibody (ab5103, 1:1000; Abcam) were coated onto 96-well microtiter plates overnight at 4 \u0026deg;C. After blocking in 1% BSA for 90 minutes at room temperature, BALF was added to each well and incubated overnight at 4 \u0026deg;C. PicoGreen was used to detect cell-free DNA and NET-DNA complexes.\u003c/p\u003e\n\u003ch3\u003eNET Detection and Quantification\u003c/h3\u003e\n\u003cp\u003eAfter stimulation, neutrophils or BMDNs were fixed with 4% paraformaldehyde for 30 min at room temperature (RT) and washed three times with 1% PBS-Tween (PBST) for 15 min. After washing, the cells were blocked in 1% BSA at RT. Protein staining was performed using an\u0026nbsp;anti-MPO antibody (ab208670, 1:100; Abcam), a mouse monoclonal anti-NE antibody (sc-55549, 1:50; Santa Cruz) overnight at 4 \u0026deg;C. After three washes, the cells were placed in florescent secondary antibodies (goat anti-rabbit Alexa Flour\u0026reg; 488 or 594) for 1 h incubation at\u0026nbsp;RT. The cells were again washed three times with 1% PBST for 15 min. After desiccation, the cells were counterstained with 4\u0026apos;-6 diamidino-2-phenylindole (2 ug/mL, DAPI, Servicebio, Wuhan, China) for 8 min. After three washes, images were obtained using FV3000 confocal system (Olympus).\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eAnalysis of Bronchoalveolar Lavage Fluid (BALF)\u003c/h3\u003e\n\u003cp\u003eFollowing terminal anesthesia with avertin, the BALF was collected by 1 ml of PBS into the trachea and lungs through a 22-inch intravenous catheter. The supernatant of BALF was collected by centrifugation at\u0026nbsp;\u003cstrong\u003e\u0026times;\u003c/strong\u003e 500 \u003cem\u003eg\u003c/em\u003e for 10 min at 4 \u0026deg;C and then stored at -80 \u0026deg;C for further analysis. Total numbers in BALF were counted using\u0026nbsp;CellDrop\u0026reg; (DeNovix, Wilmington, DE, USA). Total protein levels in BALF were determined using the Enhanced BCA Protein Assay Kit (EpiZyme). According to the manufacturer\u0026rsquo;s protocols, cytokine levels in BALF or serum were detected using an enzyme-linked immunosorbent assay (ELISA) DuoSet kit (R\u0026amp;D System). Kits were used for measuring IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and monocyte chemotactic protein-1 (MCP-1).\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eNeutrophil Elastase Activity Assay\u003c/h3\u003e\n\u003cp\u003eNE activity was quantified neutrophil elastase activity assay kit (ab204730, Abcam). Standards or BALFs from mice were plated in a 96-well plate. 2 ul of neutrophil elastase substrate was added to each well, and measure output was on a fluorescent microplate reader at Ex/Em = 380/500 nm in a kinetic mode, every 2-3 minutes, for 10-20 minutes at 37 \u0026deg;C protected from light.\u003c/p\u003e\n\u003ch3\u003ePulmonary Edema Evaluation\u003c/h3\u003e\n\u003cp\u003eAfter wiping out the blood, the lungs were excised and weighed as the wet weight, which was then fired in a 60 \u0026deg;C oven to obtain the constant dry weight. Lung inflammation score grading from 0 to 4 was calculated by two independent pathologists blinded to the groups as previously described. Pulmonary edema was calculated as lung wet-to-dry ratio.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eHistology, Immunohistochemistry and Immunofluorescence of lung\u003c/h3\u003e\n\u003cp\u003eLung tissue sections were stained with H\u0026amp;E staining. The histopathology was assessed in a double-blind manner according to the following criteria [39]: the presence of exudates, hyperemia or congestion, neutrophilic infiltrates, intra-alveolar hemorrhage or debris, and cellular hyperplasia. Each item was graded on a four-point scale from 0 to 3: 0 (normal lungs), 1 (mild injury), 2 (moderate injury), 3 (severe injury). To detect neutrophils and macrophages in the lung tissue using immunochemistry, paraffin-embedded mouse lung sections were stained by antibodies against Ly6G (GB11229, 1:1000, Servicebio), F4/80 (GB11027, 1:1000, Servicebio). To detect NET formation in the lung tissue, lung tissues were removed and fixed in 4% paraformaldehyde at 4\u0026deg;C for 3 days, then dehydrated in 30% sucrose, and finally embedded in paraffin. The tissues were then cut into 5 \u0026mu;m-thick serial sections and incubated with anti-citH3 (ab5103, 1:200; Abcam), anti-MPO antibody (ab25989 or ab208670, 1:100; Abcam), and anti-NE (sc-55549, 1:50; Santa Cruz), and DAPI was used to detect DNA. Then stained with an Alexa Fluor\u0026reg; 488 or 594 conjugate secondary antibody (1:1000, dilution). Finally, slides were visualized using an Olympus FV3000 confocal microscope.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eLactate Dehydrogenase (LDH) Assay\u003c/h3\u003e\n\u003cp\u003eThe mouse BALF was collected, and then subjected to detection according to the instruction of LDH assay kit (Beyotime, Shanghai, China). The LDH activity was calculated in the samples. LDH activity (U/L) = [(measured optical density (OD) value \u0026ndash; control OD value/standard OD value \u0026ndash; blank OD value)] \u0026times; concentration of the standard (0.22 \u0026mu;mol/mL) \u0026times; 1000. \u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eQunatitative real-time reverse transcriptase-PCR (qRT-PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from lung tissues using TRIzol reagent (Byeotime) and quantified by NanoDrop (Thermo Fisher Scientific, Shanghai, China). The reverse transcription of RNA into cDNA was performed using the BeyoRT\u0026trade; first strand cDNA synthesis kit (Beyotime). The qRT-PCR reactions on cDNA were carried out using SYBR Green PCR Master Mix (Solarbio, Beijing, China) and 0.2 \u0026mu;M primers and analyzed using the Applied Biosystems 7500HT Real-Time PCR System (Foster City, CA, USA). The PCR conditions were as follows: initial denaturation at 95 \u0026deg;C for 5 min, followed by 33 cycles of denaturation at 95 \u0026deg;C for 40 s, primer annealing at 52 \u0026deg;C for 30 s, and extension was conducted at 72 \u0026deg;C for 10 min. Data were normalized to GAPDH and expressed as fold change over control. Primer sequences were listed in Table 1.\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\" colspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003eSequences\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eof\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ePrimers Used for Reverse Transcription Quantitative PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eGene (mouse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003eSequence (5\u0026apos;\u0026rarr;3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eIL-6 in forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- CTGCAAGAGACTTCCATCCAG - 3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eIL-6 in reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- AGTGGTATAGACAGGTCTGTTGG - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eTNF-\u0026alpha; in forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- CCCTCACACTCAGATCATCTTCT - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eTNF-\u0026alpha; in reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GCTACGACGTGGGCTACAG - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eIL-1\u0026beta; in forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GCAACTGTTCCTGAACTCAACT - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eIL-1\u0026beta; in reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- ATCTTTTGGGGTCCGTCAACT - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eMCP-1 in forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- CTCTCTCTTCCTCCACCACCAT- 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eMCP-1 in reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- AGCCGGCAACTGTGAACAG - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH in forward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- ACATGGCCTCCAAGGAGTAAGAA- 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"39.24050632911393%\" valign=\"top\"\u003e\n \u003cp\u003eGAPDH in reverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"60.75949367088607%\" valign=\"top\"\u003e\n \u003cp\u003e5\u0026rsquo;- GGGATAGGGCCTCTCTTGCT - 3\u0026rsquo;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003ch3\u003eFlow Cytometry\u003c/h3\u003e\n\u003cp\u003eBALF leukocytes were stained for 30 min at 4 \u0026deg;C using fluorescently labeled antibodies: PerCP-conjugated anti-mouse CD45 (30-F11 clone, 557235, 1:100, BD), FITC-conjugated anti-mouse CD11b (M1/70 clone, 101206, 1:100, Biolegend), PE-Cy7-conjugated anti-mouse Ly6G (1A8 clone, 1:100, 560601, BD), PE-conjugated anti-mouse F4/80 (BM8 clone, 550992, 1:100, BD). All assays were performed by Arial II flow cytometers (BD Bioscience, San Jose, CA, USA) and analyzed with FlowJo software (version10.0, Three Star, Inc., Ashland, OR, USA).\u003c/p\u003e\n\u003ch3\u003eWestern Blotting\u003c/h3\u003e\n\u003cp\u003eMouse lungs and BMDNs were lysed in RIPA lysis buffer (EpiZyme) containing protease inhibitor cocktails (Roche Diagnostics, Mannheim, Germany) and phosSTOP (Roche Diagnostics). The protein lysates were separated on 10% or 15% SDS/PAGE gel and transferred onto a polyvinylidene fluoride membrane. Membranes and lung tissues were blocked with 3% bovine serum albumin (BSA; Sigma-Aldrich) for 1 h at room temperature and incubated with primary antibodies overnight at 4 \u0026deg;C. Upon washing the blots for 5 min with TBST (100mM Tris-HCl, pH7.5, 0.1% Tween 20) 3 times, blots were incubated with secondary antibodies at a dilution of 1:20000 for 2 h at room temperature. Followed by HRP-conjugated anti-rabbit IgG (Beyotime) or HRP-conjugated anti-mouse IgG (1:5000), and the signals were detected by ECL assays (Epizyme).\u003c/p\u003e\n\u003cp\u003eThe following antibodies were used: Anti-MPO (ab25989, 1:1000; Abcam), Anti-NE (ab68672, 1:1000; Abcam), Anti-citH3 (ab5103, 1:1000; Abcam), Anti-NLRP3 (#13158, 1:1000; Cell Signaling Technology), Anti-Caspase-1 (#2225, 1:1000; Cell Signaling Technology), Anti-Cleaved Caspase-1 (#4199, 1:1000; Cell Signaling Technology), Anti-Caspase-11 (#14340, 1:1000; Cell Signaling Technology), Anti-Gasdermin D (#69469, 1:1000; Cell Signaling Technology), IL-1\u0026beta; (ab229696, 1:1000; Abcam), Anti-Erk1/2 (#4695, 1:1000; Cell Signaling Technology), Anti-pERK1/2 (#4370, 1:1000; Cell Signaling Technology), Anti-JNK (#9252, 1:1000; Cell Signaling Technology), Anti-pJNK (#4668, 1:1000; Cell Signaling Technology), Anti-p38 MAPK (#8690, 1:1000; Cell Signaling Technology), Anti-p-p38 MAPK (#4511, 1:1000; Cell Signaling Technology), Anti-Akt (#4691, 1:1000; Cell Signaling Technology), Anti-p-Akt (#13038, 1:1000; Cell Signaling Technology), Anti-mouse IgG HRP-linked (#7076, 1:1000; Cell Signaling Technology), and Anti-rabbit IgG HRP-linked (#7074, 1:1000; Cell Signaling Technology). Anti-GAPDH (ab8245, 1:1000; Abcam) was used as an internal control. The signals were detected by ECL assays (Epizyme). Bands were quantitated using ImageJ (v1.48 \u0026amp; v1.53c, Bio-Rad, USA), and results are expressed as fold change relative to the internal control.\u003c/p\u003e\n\u003ch3\u003eStatistical analysis\u003c/h3\u003e\n\u003cp\u003eAll data were statistically analyzed using GraphPad Prism 8.0 (GraphPad Software, San Diego, CA, USA). Quantitative data are expressed as the means \u0026plusmn; SD (standard deviation). An independent-sample \u003cem\u003et\u003c/em\u003e-test was used to compare the two groups. One-way or two-way analysis of variance (ANOVA) followed by Tukey\u0026rsquo;s post-hoc test for multiple comparisons. The correlation was determined using the Spearman correlation analysis.\u003cem\u003e\u0026nbsp;p\u003c/em\u003e value \u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003ch3\u003eThe Levels of Inflammatory Cytokines and NETs are Highly Expressed in the BALF of ARDS\u003c/h3\u003e\n\u003cp\u003eTo understand the role of NET formation in ALI/ARDS, proinflammatory cytokines and chemokines were detected in BALF by ELISA. As shown in Fig. 1a-d, in the ARDS patients, IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1 were significantly upregulated compared with matched control patients (healthy control, n=5). We detected circulating levels of cfDNA, MPO-DNA, citH3-DNA, and NE-DNA in ARDS patients were significantly higher than those in healthy controls (fig. 1e-h). While cell-free DNA and MPO-DNA, citH3-DN, and NE-DNA showed significant positive correlation (fig. 1i-l). In summary, cytokines, cell-free DNA and, to a lesser extent, MPO/DNA, NE/DNA, and citH3/DNA demonstrate significant correlations with NET formation in the occurrence and progression of inflammation in BALF of ARDS patients. Additionally, the results show that NETs predominantly composed of cfDNA, MPO, and NE may promote the progression of inflammation by regulating NETosis in ARDS.\u003c/p\u003e\n\u003ch3\u003eLPS Leads to an Early/Rapid NETosis-mediated Inflammation with Increased Neutrophil Infiltration\u003c/h3\u003e\n\u003cp\u003eWhen we investigated the pathogenetic role of NET-mediated inflammation, LPS-stimulated mice demonstrated obvious neutrophil increases followed by a mild increase in macrophage infiltration in BALF compared to PBS-instilled mice (fig. 1a-d). The number of neutrophils began to rise at 3 h and rose significantly at 24 h (fig. 2a-b). The percentage of macrophages did not significantly change (fig. 2c). H\u0026amp;E staining confirmed that neutrophil infiltration in the lungs of LPS-treated mice started at 3 h, reaching a peak at 6 h post instillation (fig. 2e). LPS-stimulated mice developed extensive alveolar damage with abundant inflammatory cell infiltration (fig. e-f). In addition, obvious pulmonary edema was evoked by LPS stimulation, while the ratio of wet/dry (W/D) lung was significantly increased in LPS-stimulated mice at 6 h (fig. 2g). Consistent with hyperinflammation, LPS-stimulated mice developed elevated levels of BALF proinflammatory total proteins and cytokines after 3 h, including IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1, which were markedly elevated by 6 h and persisted beyond 24 h poststimulation (fig. 2h-k). Taken together, these data indicate that LPS drives lung inflammation, mainly manifesting as excessive release of cytokines, neutrophilia, lung edema, and neutrophil infiltration in the lungs of mice. Importantly, neutrophils are required for LPS-triggered NET formation-mediated systemic inflammation and lung injury. Additionally, LPS induces an early/rapid NETosis-mediated inflammation with increased neutrophil infiltration.\u003c/p\u003e\n\u003ch3\u003eLPS Stimulation Activates Neutrophils to generate NETs and the MAPK /AKT Signaling Pathway in Mice\u003c/h3\u003e\n\u003cp\u003eTo examine the existence of NETs in LPS-induced lung injury, we evaluated the expression of NET-specific markers, including MPO-DNA, citH3-DNA, and NE-DNA complexes and cfDNA, in the BALF of mice 3 h, 6 h, 12 h, and 24 h after LPS stimulation (fig. 3a-d). As indicated in fig. 3a-d, the expression of MPO, citH3, and NE progressively increased to be significantly higher than baseline at 6 h. After LPS instillation, the production of NETs was highest at 6 h and had fallen significantly at 12 h and 24 h (fig. 3a-d). Since mice treated with LPS for 6 h begins to show significant inflammatory phenotype and the lung damage, we selected the first inhalation of AK0705 at 3 h after LPS stimulation. Next, we isolated BMDNs from LPS-treated mice exhibited an increased capacity for releasing extracellular DNA. We identified NETs as cloud-like structures colocalized with DNA, MPO, and NE with the disintegration of BMDNs with a weak DAPI signal on immunohistochemistry (fig. 3e). Further, western blot analysis (fig. 3f, g) indicated that LPS instillation activates neutrophils to generate NETs in mice. In addition, compared to control mice, lung tissues collected 24 h after LPS stimulation from mice had significantly higher levels of phosphorylated JNK, ERK, p38, and Akt than control mice (fig. 3h, i), suggesting activation of the MAPK pathway in mice in response to LPS-induced inflammation. In conclusion, these results indicate that LPS induces NET formation \u003cem\u003evia\u003c/em\u003e activating the MAPK/AKT axis.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003eInhaled NE inhibitor AK0705 Attenuates LPS-Stimulated Cytokine Release and NET Release in Mice\u003c/h3\u003e\n\u003cp\u003eAK0705 is a potential first-in-class drug targeting an enzyme that plays an important role in respiratory inflammation and is being developed to treat a broad spectrum of respiratory diseases (fig. 4a). Oxidative stress and the subsequent inflammatory responses are the major causes of LPS-induced lung epithelial cell apoptosis. Therefore, we determined whether the inhaled NE inhibitor AK0705 could prevent NET-mediated lung epithelial apoptosis. To determine the effect of AK0705 on pulmonary injury, mice were challenged with LPS to induce lung injury with or without AK0705 treatment for 3 days (fig. 4b). The BCA assay showed that LPS stimulation induced significant increases in total protein levels of BALF compared to PBS, LPS+AK0705-treated groups, while inhaled AK0705 significantly downregulated total protein levels in BALF compared to LPS-stimulated mice (Fig. 4c). The BALF levels of the proinflammatory cytokines IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1 were significantly decreased in LPS+AK0705-treated mice compared with LPS-stimulated mice (fig. 4d). By quantitative real-time polymerase chain reaction (qRT-PCR) analysis, in the LPS+AK0705 treatment group, the mRNA expression levels of IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1 were significantly lower than those in the LPS stimulation group (fig. 4e). To determine whether NET marker levels decreased in LPS+AK0705-treated mice, we compared the levels of NET markers in the BALF of LPS-stimulated and LPS+AK0705-treated mice using the PicoGreen assay (fig. 4f). As found above, LPS+AK0705-treated mice harvested on day 3 had significantly downregulated cfDNA, MPO-DNA, NE-DNA, and citH3-DNA levels in BALF compared with LPS-only-stimulated mice (fig. 4f). In addition, we observed that the activity of NE increased in LPS-stimulated mice in BALF, while reduction in the activity of NE in LPS+AK0705-treated mice (fig. 4g). However, the involvement of NE in the signaling driving NET formation is still under investigation. In summary, these results indicate that AK0705 may alleviate the inflammatory response and NET formation in an NE-dependent manner.\u003c/p\u003e\n\u003ch3\u003eAK0705 Suppresses the Formation of NET in LPS-Stimulated Neutrophils \u003cem\u003eIn Vivo\u003c/em\u003e and \u003cem\u003eIn Vitro\u003c/em\u003e\u003c/h3\u003e\n\u003cp\u003eThe LPS-induced mouse model of ALI was successfully established. Significant elevation of NET markers, including MPO, NE, and citH3 was detected by immunofluorescence staining and western blotting, both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e (fig. 5a-g). Higher expression of NET markers was observed in experimental LPS-stimulated mice than in LPS+AK0705-treated or control mice, as assessed by immunostaining (fig. 5a). Interestingly, we observed that the lung tissue level of MPO was significantly upregulated in LPS-stimulated mice compared with LPS+AK0705-treated or healthy control mice (fig. 5b, c). However, there were no significant differences in citH3 levels between LPS-stimulated and LPS+AK0705-treated or control mice (fig. 5b, c). As a biomarker of pyroptosis, LDH release was significantly increased in BALF of LPS-stimulated mice. AK0705 significantly inhibited LPS-induced LDH release from LPS-stimulated mice (fig. 5d). Furthermore, enhanced NET formation was displayed by immunofluorescence staining of MPO and NE in BMDNs from LPS-stimulated mice when compared with BMDNs from LPS+AK0705-treated or PBS-treated mice (fig. 5e). When we isolated BMDNs from 72-h-LPS-treated mice, we observed significantly increased expression of the NET markers MPO, NE, and citH3, as measured by western blot (fig. 5f, g). Collectively, the results indicate that treatment with the NE inhibitor AK0705 downregulates the expression of NET markers \u003cem\u003ein vivo\u0026nbsp;\u003c/em\u003eand \u003cem\u003ein vitro\u003c/em\u003e in LPS-induced ALI.\u003c/p\u003e\n\u003ch3\u003eAK0705 Inhibits NLRP3 Inflammasome-Mediated Pyroptosis and LPS-NET-Cytokine Loop in Mice\u003c/h3\u003e\n\u003cp\u003eIt has been reported in the literature that the NLRP3/GSDMD signaling pathway is closely associated with the expression of NETosis and pyroptosis, western blot analysis result indicated that AK0705 decreased the levels of NLRP3/GSDMD, GSDMD-NT, IL-1\u0026beta; after LPS stimulation. In this study, we explored the GSDMD-NLRP3 signaling pathway, western blot analysis showed that GSDMD-NLRP3 signaling proteins were significantly upregulated in LPS-stimulated mice compared to controls or LPS+AK0705-treated mice (fig. 6a, b). Next, we treated LPS-stimulated mice with AK0705, sivelestat (an NE inhibitor), Cl-amidine (a PAD4 inhibitor), and DPI (an NADPH oxidase inhibitor) to demonstrate the indispensable roles of NE, PAD4 and ROS in LPS-induced NET formation. AK0705, sivelestat, Cl-amidine, and DPI significantly downregulated the W/D ratio of lungs (fig. 6c) and total protein levels of BALF when compared to LPS-stimulated mice (fig. 6d). Decreased BALF levels of IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1 were also observed (fig. 6e). The mRNA levels of IL-6, TNF-\u0026alpha;, IL-1\u0026beta;, and MCP-1 were significantly lower than LPS-treated mice (fig. 6f). Importantly, AK0705, sivelestat, Cl-amidine, and DPI each significantly blocked NET formation in BALF (fig. 6g). H\u0026amp;E staining and Immunohistochemical showed that Ly6G and F4/80 markers of lung inflammatory cell expression were significantly downregulated in all the above inhibitor-treated mice compared to LPS-stimulated mice, along with the downregulation of lung injury scores compared to LPS-stimulated mice (fig. 6h, i), the percentage of positive cells was quantified (5 fields per mouse, n=3) (fig. 7a, b). All inhibitors abrogated LPS-induced NET formation and inflammation, as confirmed by cell-free DNA, MPO-DNA, citH3-DNA, and NE-DNA (fig. 6c-i). In summary, these results demonstrate that LPS promotes NET formation and the inflammatory response in an NE-, PAD4-, and ROS-dependent manner.\u003c/p\u003e\n\u003ch3\u003eLPS-Induced NETosis is Dependent on NE, PAD4, ROS and\u0026nbsp;Contributes to Increased NET Formation by Activating the MAPK/AKT/NLRP3 Pathway\u0026nbsp;Axis in Mice\u003c/h3\u003e\n\u003cp\u003eWe observed less deposition in the lungs of LPS-stimulated mice treated with AK0705, sivelestat, Cl-amidine, or DPI (fig. 7c), all inhibitors significantly reduced LPS-induced NET formation. Then, to further investigate the molecular changes in LPS-treated NET-mediated ALI, considering the important mitogen-activated protein kinases (MAPK) and Akt in the initiation of NETosis, we continue to detect the expression of MAPK and Akt signaling proteins. Interestingly, inhibition of NET release by NE inhibitors like sivelestat or AK0705, the PAD4 inhibitor Cl-amidine, and DPI administration effectively reversed the suppression of MAPK/AKT in LPS-induced ALI mice (fig. 7d-f). Notably, as shown in Fig. 7d and Fig. 6a, the inhaled NE inhibitor AK0705 attenuated NET formation by downregulating the MAPK/AKT/NLRP3 pathway in LPS-induced NET-mediated ALI. Collectively, these results indicate that LPS promotes NET formation by activating the MAPK/AKT/NLRP3 pathway in LPS-induced ALI mice.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eInflammation and cytokine storms, as key pathogenic mechanisms, aid in the development of ALI/ARDS in vulnerable hosts during infection. Thus, targeting the inflammatory storm may reduce the severity of ALI/ARDS. In addition, the cytokine storm activates the immune system and leads to uncontrollable pulmonary inflammation. Importantly, ARDS is characterized by hyperactivation with enhanced NET formation. We investigated whether LPS could play a pathogenic role in ALI/ARDS through NET formation. Using clinical samples and mouse models, we comprehensively assessed the proinflammatory effect of NET-mediated inflammation. We showed that LPS activated neutrophils to form NETs and contributed to the cytokine storm and lung inflammation. LPS activated neutrophils to facilitate ERK, JNK, p38, and AKT activation, thus enhancing neutrophil infiltration in the lung with abundant NET formation. Importantly, our findings also revealed that treatment with inhaled NE, PAD4, or NADPH inhibitors significantly reduced neutrophil infiltration in the lung and ameliorated the inflammatory response.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; The term \u0026ldquo;cytokine storm\u0026rdquo; was first used to describe the pathogenesis of graft-versus-host disease (GVHD) and was later demonstrated to be associated with various infectious, autoimmune, and inflammatory diseases [40]. The cytokine storm is characterized by increased production of IL-1\u0026beta;, IL-6, TNF-\u0026alpha;, MCP1, and other cytokines. These inflammatory mediators activate the immune system and lead to life-threatening uncontrollable inflammation [41]. However, the understanding of cytokine storm is still in the early stage. COVID-19, a virus-induced respiratory disease, has brought attention to cytokine storms [42]. In severe COVID-19 patients, a hyperinflammatory status with a massive release of proinflammatory cytokines has been proven, which shows that neutrophilia predicts poor outcomes in patients with severe COVID-19 [43]. In addition, inflammation and cytokine storms, as key pathogenic mechanisms, aid in developing ALI/ARDS in some vulnerable hosts during COVID-19 infections. Thus, targeting the inflammatory storm may reduce the severity of ALI/ARDS.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Notably, NETs can facilitate the production of inflammatory mediators and further be enhanced by these mediators, leading to a vicious uncontrollable, inflammatory loop [44]. Although it has yet to be determined whether NETs contribute to the amplified inflammatory process in ARDS patients, there is accumulating evidence to indicate inflammatory cytokines in the ARDS niche that can interact with NETs [45]. Indeed, a NET-cytokine loop exists in various diseases, including COVID-19, atherosclerosis, and systemic lupus erythematosus (SLE) [2, 46, 47]. Despite recent advances in exploring the role of neutrophils and NETs in the pathophysiology of ALI/ARDS, little is known about the underlying mechanism. Herein, our observation is that the levels of NET components in BALF were associated with the clinical outcome of ARDS patients. Although we have not tested NET formation in COVID-19, the LPS\u0026ndash;NET\u0026ndash;cytokine storm loop may be validated in the future, since enhanced NET formation and a hyperinflammatory state are features of patients with severe ARDS.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Considering that many endogenous pathways are involved in NETosis, we investigated the underlying molecular mechanisms of LPS-induced NET formation [15]. Previous studies have shown that the generation of ROS is needed for NET formation in ARDS [48]. In addition, several studies have suggested that PAD4 or NE inhibitors prevent NETosis in human neutrophils and mice [49, 50]. In contrast, NETosis induced by different physiological stimuli is very diverse in terms of the engaged pathways. In addition, granulocyte-macrophage colony-stimulating factor (GM-CSF) and TNF can induce NETosis in a ROS-independent but PAD4-dependent way [51]. We analyzed these biological processes in LPS-stimulated neutrophils and found that NE, PAD4, and ROS were essential molecules for LPS-induced NET formation. MAPKs and Akt are at the center of two important signaling pathways that have been closely linked to NETosis, and GSDMD is an important signaling pathway that has been closely linked to pyroptosis. Our study shows that the inhaled NE inhibitor AK0705 attenuated LPS-induced NET-mediated inflammation by downregulating the ERK/JNK/p38 MAPK, Akt, and NLRP3-GSDMD signaling pathways.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Herein, we demonstrated, first, that the inhaled NE inhibitor AK0705 blocks NET formation in the lungs of mice undergoing experimental LPS stimulation. Following induction with LPS, NETs were primarily expressed during the inflammatory period and were observed in the alveolar and interstitial space. Second, we demonstrated that LPS-induced NETs depend on neutrophil infiltration and activation both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. Third, inhaled NE inhibitors led to reduced formation of NETs and proinflammatory mediators and prevented further deterioration of lung damage. Finally, we found that LPS-induced NETosis depended on NE, PAD4, and ROS in the development of lung inflammation. We analyzed these biological processes in LPS-stimulated lungs and discovered the important role of the inhaled NE inhibitor AK0705. We also found that NE, PAD4, and ROS are essential targets for LPS-induced NET formation. Furthermore, MAPK, Akt, and NLRP3-GSDMD are three important signaling pathways that have been closely linked to NETosis. This study shows that the ERK, JNK, Akt, and NLRP3 axes are activated in the lungs after LPS stimulation.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Neutrophils, the earliest effector cells, are mainly involved in the inflammatory response in ALI. During ALI, excessively or continuously activated neutrophils from peripheral lymphoid organs can enter inflammatory sites by crossing pulmonary vascular endothelial cells and alveolar epithelial cells. There they produce ROS, proteolytic enzymes, and arachidonic acid metabolites [52], causing the basement membrane and alveolar-capillary barrier to be destroyed, alveolar-capillary permeability to increase, and eventually inflammatory cell entry into the lung interstitium and alveolar cavity to occur, accompanied by the formation of pulmonary edema [53]. MPO is a characteristic enzyme expressed by neutrophils, and its content in each neutrophil is constant (approximately 5% of dry cell weight). Therefore, MPO can also be utilized as a neutrophil marker [54, 55]. Furthermore, neutrophils play an important role in the pathogenesis of ALI \u003cem\u003evia\u003c/em\u003e NE [28]. It has been suggested that NE may play a key role in the increase in pulmonary epithelial and microvascular permeability in ALI [56]. Our results showed that NE activity in lung tissue was significantly increased in ARDS patients and LPS-stimulated mice. AK0705 inhalation markedly reduced NE activity in lung tissues. Additionally, it benefited the mice by inhibiting NE activities and reducing lung inflammation, edema, proinflammatory cytokines, and NET markers. In our study, the effect of AK0705, which was delivered by inhalation on LPS-induced ALI rather than that of AK0705 administered intravenously. These findings suggest that when delivered \u003cem\u003evia\u003c/em\u003e the inhalation route, more NE inhibitors can reach the lung directly than by the intravenous routes [36]. AK0705 is a small-molecule NE inhibitor, and NE activity may indirectly reflect the quantity of AK0705 that is inhaled into the alveoli. In the AK0705 inhalation group, NE activity was markedly inhibited in lung tissues compared with that in the LPS-stimulated group. These results indicate that AK0705 can be inhaled into the lung and effectively suppress NE activity in lung tissues. Overly increased NE activity in the lungs may play a vital role in the pathogenesis of LPS-induced ALI in mice. However, the physiological effect of inhaled AK0705 and LPS-stimulated neutrophil interactions remains unknown. The mechanism by which AK0705 is internalized by neutrophils and lungs will be investigated in our future studies.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; Lung involvement is very common in ARDS and other diseases. Importantly, excessive activation of neutrophils and NETs is implicated in numerous pathologies in many other diseases [50, 57]. In addition, NETs exacerbate inflammatory cascades and sterile inflammation in lung ischemia and reperfusion injury [58, 59]. In the present study, we observed that LPS stimulation induced lung neutrophilic inflammation, which was ameliorated by neutrophil depletion and suppression of NET formation. This indicates a dominant role of NETs as inflammatory mediators in LPS-related lung inflammation. There are several limitations to our study. First, we did not test combined therapy in LPS-stimulated mice\u003cem\u003e\u0026nbsp;in vivo\u003c/em\u003e. Second, it is still unclear whether membrane AK0705 receptor (mAK0705R) exists on the neutrophil membrane or whether mAK0705R is involved in LPS tolerance. Third, we demonstrated the pathogenic role of LPS in animal models and to some extent in patients of ARDS, but additional research is needed to verify the link between NETs and neutrophils in other hyperinflammatory conditions.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our findings demonstrate the underlying relationship between hyperinflammation and NET formation. LPS induces the release of NETs in an NE-dependent manner, which contribute to lung inflammation. Accordingly, abolishing NETs or inhibiting NE activity could abrogate the LPS-induced hyperinflammatory process. Our study highlights the important role of the LPS\u0026ndash;NE\u0026ndash;NET and NET-MAPK/NLRP3 pathway in the overwhelming inflammatory response. This pathway could become a therapeutic target against the ARDS spectrum.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eACKNOWLEDGEMENTS\u003c/p\u003e\n\u003cp\u003eThe authors appreciated the help of Zhongshan Hospital Affiliated to Fudan University.\u003c/p\u003e\n\u003cp\u003eAUTHOR CONTRIBUTION\u003c/p\u003e\n\u003cp\u003eYS, XT, and NF provided financial support. YS, XT, and NA designed the project and approved the final manuscript.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eNA and NF conducted all experiments and drafted the manuscript. ML, TP, and JS have made important contributions to the analysis and interpretation of data. CZ, YC, and CC conducted the experiments and provided valuable advice. The authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003eFUNDING\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China(82130001, 82272243), the National key R\u0026amp;D plan (2020YFC2003700)， Shanghai Municipal Science and Technology Major Project (20Z11901000, 20DZ2261200, 20XD1401200, 22Y11900800), Science and Technology Commission of Shanghai Municipality (20Z11901000, 20DZ2261200, 20XD1401200, 22Y11900800), Clinical Research Plan of SHDC (SHDC2020CR5010-002), Shanghai Municipal Key Clinical Specialty (shslczdzk02201), Shanghai Municipal Health Commission and Shanghai Municipal Administrator of Traditional Chinese Medicine (ZY(2021-2023)-0207-01). This work was also sponsored by grants from the Clinical Medicine Foundation of Jiangsu University (JLY20180124); and Shanghai Municipal Health Commission (20204Y0082).\u003c/p\u003e\n\u003cp\u003eDATA AVAILABILITY\u003c/p\u003e\n\u003cp\u003eAll the data supporting the findings of this study are available within the article and its supplementary information files or can be obtained from the corresponding author upon reasonable request. Source data are provided with this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval and Consent to Participate\u0026nbsp;\u003c/strong\u003eThe studies involving human participants were reviewed and approved by the Institutional Research Ethics Committee of Zhongshan Hospital (ID: 2011-212), Shanghai, China. Informed consent was provided by all participants.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eAnimal ethics approval was obtained from the Animal Care and Use Committee of Zhongshan Hospital.\u003c/p\u003e\n\u003cp\u003eCompeting interests The authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMatthay, M.A., et al. 2024. A New Global Definition of Acute Respiratory Distress Syndrome. Am J Respir Crit Care Med. 209(1):37-47. https://doi.org/10.1164/rccm.202303-0558ws.\u003c/li\u003e\n\u003cli\u003eBarnes, B.J., et al. 2020. Targeting potential drivers of COVID-19: Neutrophil extracellular traps. J Exp Med. 217(6):e20200652. https://doi.org/10.1084/jem.20200652.\u003c/li\u003e\n\u003cli\u003eWang, D., et al. 2020. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA. 323(11):1061-1069. https://doi.org/10.1001/jama.2020.1585.\u003c/li\u003e\n\u003cli\u003eWang, Y., D. Zhang, and Y. Song. 2018. Neutrophil-to-Lymphocyte Ratio as a Prognostic Marker in Acute Respiratory Distress Syndrome Patients: A Retrospective Study. American Journal of Respiratory and Critical Care Medicine. 10(1):273-282. https://doi.org/10.21037/jtd.2017.12.131.\u003c/li\u003e\n\u003cli\u003eSchonrich, G. and M.J. Raftery. 2016. Neutrophil Extracellular Traps Go Viral. Front Immunol. 7:366. https://doi.org/10.3389/fimmu.2016.00366.\u003c/li\u003e\n\u003cli\u003eBrinkmann, V., et al. 2004. Neutrophil extracellular traps kill bacteria. Science. 303(5663):1532-5. https://doi.org/10.1126/science.1092385.\u003c/li\u003e\n\u003cli\u003ePires, R.H., S.B. Felix, and M. Delcea. 2016. The architecture of neutrophil extracellular traps investigated by atomic force microscopy. Nanoscale. 8(29):14193-202. https://doi.org/10.1039/c6nr03416k.\u003c/li\u003e\n\u003cli\u003eChapman, E.A., et al. 2019. Caught in a Trap? Proteomic Analysis of Neutrophil Extracellular Traps in Rheumatoid Arthritis and Systemic Lupus Erythematosus. Front Immunol. 10:423. https://doi.org/10.3389/fimmu.2019.00423.\u003c/li\u003e\n\u003cli\u003ePetretto, A., et al. 2019. Neutrophil extracellular traps (NET) induced by different stimuli: A comparative proteomic analysis. PLoS One. 14(7):e0218946. https://doi.org/10.1371/journal.pone.0218946.\u003c/li\u003e\n\u003cli\u003eHaider, P., et al. 2020. Neutrophil Extracellular Trap Degradation by Differently Polarized Macrophage Subsets. Arterioscler Thromb Vasc Biol. 40(9):2265-2278. https://doi.org/10.1161/atvbaha.120.314883.\u003c/li\u003e\n\u003cli\u003eAdrover, J.M., et al. 2020. Programmed \u0026apos;disarming\u0026apos; of the neutrophil proteome reduces the magnitude of inflammation. Nat Immunol. 21(2):135-144. https://doi.org/10.1038/s41590-019-0571-2.\u003c/li\u003e\n\u003cli\u003eEbrahimi, F., et al. 2018. Markers of neutrophil extracellular traps predict adverse outcome in community-acquired pneumonia: secondary analysis of a randomised controlled trial. Eur Respir J. 51(4):1701389. https://doi.org/10.1183/13993003.01389-2017.\u003c/li\u003e\n\u003cli\u003eFuchs, T.A., et al. 2007. Novel cell death program leads to neutrophil extracellular traps. J Cell Biol. 176(2):231-41. https://doi.org/10.1083/jcb.200606027.\u003c/li\u003e\n\u003cli\u003eBrinkmann, V. and A. Zychlinsky. 2012. Neutrophil extracellular traps: is immunity the second function of chromatin? J Cell Biol. 198(5):773-83. https://doi.org/10.1083/jcb.201203170.\u003c/li\u003e\n\u003cli\u003eSollberger, G., et al. 2018. Gasdermin D plays a vital role in the generation of neutrophil extracellular traps. Sci Immunol. 3(26):eaar6689. https://doi.org/10.1126/sciimmunol.aar6689.\u003c/li\u003e\n\u003cli\u003ePapayannopoulos, V. 2018. Neutrophil extracellular traps in immunity and disease. Nat Rev Immunol. 18(2):134-147. https://doi.org/10.1038/nri.2017.105.\u003c/li\u003e\n\u003cli\u003ePapayannopoulos, V., et al. 2010. Neutrophil elastase and myeloperoxidase regulate the formation of neutrophil extracellular traps. J Cell Biol. 191(3):677-91. https://doi.org/10.1083/jcb.201006052.\u003c/li\u003e\n\u003cli\u003eChen, X., et al. 2020. Macrophage polarization and its role in the pathogenesis of acute lung injury/acute respiratory distress syndrome. Inflamm Res. 69(9):883-895. https://doi.org/10.1007/s00011-020-01378-2. \u003c/li\u003e\n\u003cli\u003eAbderrazak, A., et al. 2015. NLRP3 inflammasome: from a danger signal sensor to a regulatory node of oxidative stress and inflammatory diseases. Redox Biol. 4:296-307. https://doi.org/10.1016/j.redox.2015.01.008.\u003c/li\u003e\n\u003cli\u003eGross, O., et al. 2011. The inflammasome: an integrated view. Immunol Rev. 243(1):136-51.. https://doi.org/10.1111/j.1600-065x.2011.01046.x.\u003c/li\u003e\n\u003cli\u003eSwanson, K.V., M. Deng, and J.P. Ting. 2019. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat Rev Immunol. 19(8):477-489. https://doi.org/10.1038/s41577-019-0165-0.\u003c/li\u003e\n\u003cli\u003eJia, C., et al. 2019. Endothelial cell pyroptosis plays an important role in Kawasaki disease via HMGB1/RAGE/cathespin B signaling pathway and NLRP3 inflammasome activation. Cell Death Dis. 10(10):778. https://doi.org/10.1038/s41419-019-2021-3.\u003c/li\u003e\n\u003cli\u003eKayagaki, N., et al. 2015. Caspase-11 cleaves gasdermin D for non-canonical inflammasome signaling. Nature. 526(7575):666-71. https://doi.org/10.1038/nature15541.\u003c/li\u003e\n\u003cli\u003eKayagaki, N., et al. 2011. Non-canonical inflammasome activation targets caspase-11. Nature. 479(7371):117-21. https://doi.org/10.1038/nature10558.\u003c/li\u003e\n\u003cli\u003eWinterbourn, C.C., A.J. Kettle, and M.B. Hampton. 2016. Reactive Oxygen Species and Neutrophil Function. Annu Rev Biochem. 85:765-92. https://doi.org/10.1146/annurev-biochem-060815-014442.\u003c/li\u003e\n\u003cli\u003eLv, X., et al. 2021. Tetrachlorobenzoquinone exhibits immunotoxicity by inducing neutrophil extracellular traps through a mechanism involving ROS-JNK-NOX2 positive feedback loop. Environ Pollut. 268(Pt B):115921. https://doi.org/10.1016/j.envpol.2020.115921. \u003c/li\u003e\n\u003cli\u003eJia, J., et al. 2022. Ferritin triggers neutrophil extracellular trap-mediated cytokine storm through Msr1 contributing to adult-onset Still\u0026apos;s disease pathogenesis. Nat Commun. 13(1):6804. https://doi.org/10.1038/s41467-022-34560-7.\u003c/li\u003e\n\u003cli\u003eKinoshita, M., S. Ono, and H. Mochizuki. 2000. Neutrophils mediate acute lung injury in rabbits: role of neutrophil elastase. Eur Surg Res. 32(6):337-46. https://doi.org/10.1159/000052215.\u003c/li\u003e\n\u003cli\u003eIshii, T., et al. 2010. Neutrophil elastase contributes to acute lung injury induced by bilateral nephrectomy. Am J Pathol. 177(4):1665-73. https://doi.org/10.2353/ajpath.2010.090793.\u003c/li\u003e\n\u003cli\u003eBernard, G.R., et al. 1994. The American-European Consensus Conference on ARDS. Definitions, mechanisms, relevant outcomes, and clinical trial coordination. Am J Respir Crit Care Med. 149(3 Pt 1):818-24. https://doi.org/10.1164/ajrccm.149.3.7509706.\u003c/li\u003e\n\u003cli\u003eCarden, D., et al. 1998. Neutrophil elastase promotes lung microvascular injury and proteolysis of endothelial cadherins. Am J Physiol. 275(2):H385-92.https://doi.org/10.1152/ajpheart.1998.275.2.h385.\u003c/li\u003e\n\u003cli\u003eHarada, N., K. Okajima, and H. Isobe. 2008. Role of neutrophil elastase in development of pulmonary vascular injury and septic shock in rats. Shock. 30(4):379-87. https://doi.org/10.1097/shk.0b013e3181673e2c.\u003c/li\u003e\n\u003cli\u003eHagio, T., et al., Sivelestat, a specific neutrophil elastase inhibitor, prevented phorbol myristate acetate-induced acute lung injury in conscious rabbits. Pulm Pharmacol Ther, 2005. 18(4): p. 285-90.\u003c/li\u003e\n\u003cli\u003eHashimoto, S., et al. 2008. Neutrophil elastase activity in acute lung injury and respiratory distress syndrome. Respirology. 18(4):285-90. https://doi.org/10.1016/j.pupt.2004.12.013.\u003c/li\u003e\n\u003cli\u003eAikawa, N., et al. 2011. Reevaluation of the efficacy and safety of the neutrophil elastase inhibitor, Sivelestat, for the treatment of acute lung injury associated with systemic inflammatory response syndrome; a phase IV study. Pulm Pharmacol Ther. 24(5):549-54. https://doi.org/10.1016/j.pupt.2011.03.001.\u003c/li\u003e\n\u003cli\u003eKropp, J., et al. 2001. Inhalation of [123I]alpha1-protease inhibitor: toward a new therapeutic concept of alpha1-protease inhibitor deficiency? J Nucl Med. 42(5):744-51.\u003c/li\u003e\n\u003cli\u003eBueltmann, M., et al. 2009. Inhaled milrinone attenuates experimental acute lung injury. Intensive Care Med. 35(1):171-8. https://doi.org/10.1007/s00134-008-1344-9.\u003c/li\u003e\n\u003cli\u003eYen, C.C., et al. 2011. Aerosolized human extracellular superoxide dismutase prevents hyperoxia-induced lung injury. PLoS One. 6(10):e26870. https://doi.org/10.1371/journal.pone.0026870.\u003c/li\u003e\n\u003cli\u003eHirano, Y., et al. 2015. Neutralization of osteopontin attenuates neutrophil migration in sepsis-induced acute lung injury. Crit Care. 19(1):53. https://doi.org/10.1186/s13054-015-0782-3.\u003c/li\u003e\n\u003cli\u003eChousterman, B.G., F.K. Swirski, and G.F. Weber. 2017. Cytokine storm and sepsis disease pathogenesis. Semin Immunopathol. 39(5): p. 517-528. https://doi.org/10.1007/s00281-017-0639-8.\u003c/li\u003e\n\u003cli\u003eGrom, A.A., A. Horne, and F. De Benedetti. 2016. Macrophage activation syndrome in the era of biologic therapy. Nat Rev Rheumatol. 12(5):259-68. https://doi.org/10.1038/nrrheum.2015.179.\u003c/li\u003e\n\u003cli\u003eMangalmurti, N. and C.A. Hunter. 2020. Cytokine Storms: Understanding COVID-19. Immunity. 53(1):19-25. https://doi.org/10.1016/j.immuni.2020.06.017.\u003c/li\u003e\n\u003cli\u003eLiu, Y., et al. 2020. Neutrophil-to-lymphocyte ratio as an independent risk factor for mortality in hospitalized patients with COVID-19. J Infect. 81(1):e6-e12. https://doi.org/10.1016/j.jinf.2020.04.002.\u003c/li\u003e\n\u003cli\u003eDelgado-Rizo, V., et al. 2017. Neutrophil Extracellular Traps and Its Implications in Inflammation: An Overview. Front Immunol. 8:81. https://doi.org/10.3389/fimmu.2017.00081.\u003c/li\u003e\n\u003cli\u003eKhongthaw, B., et al. 2022. Lycopene: a therapeutic strategy against coronavirus disease 19 (COVID-19). Inflammopharmacology. 30(6):1955-1976. https://doi.org/10.1007/s10787-022-01061-4.\u003c/li\u003e\n\u003cli\u003eJorch, S.K. and P. Kubes. 2017. An emerging role for neutrophil extracellular traps in noninfectious disease. Nat Med. 23(3):279-287. https://doi.org/10.1038/nm.4294.\u003c/li\u003e\n\u003cli\u003eMiddleton, E.A., et al. 2020. Neutrophil extracellular traps contribute to immunothrombosis in COVID-19 acute respiratory distress syndrome. Blood. 136(10):1169-1179. https://doi.org/10.1182/blood.2020007008.\u003c/li\u003e\n\u003cli\u003eRizvi, Z.A., et al. 2022. Prophylactic treatment of Glycyrrhiza glabra mitigates COVID-19 pathology through inhibition of pro-inflammatory cytokines in the hamster model and NETosis. Front Immunol. 13:945583. https://doi.org/10.3389/fimmu.2022.945583.\u003c/li\u003e\n\u003cli\u003eKnight, J.S., et al. 2015. Peptidylarginine deiminase inhibition disrupts NET formation and protects against kidney, skin and vascular disease in lupus-prone MRL/lpr mice. Ann Rheum Dis. 74(12):2199-206. https://doi.org/10.1136/annrheumdis-2014-205365.\u003c/li\u003e\n\u003cli\u003eOkeke, E.B., et al. 2020. Inhibition of neutrophil elastase prevents neutrophil extracellular trap formation and rescues mice from endotoxic shock. Biomaterials. 238:119836. https://doi.org/10.1016/j.biomaterials.2020.119836.\u003c/li\u003e\n\u003cli\u003eTatsiy, O. and P.P. McDonald. 2018. Physiological Stimuli Induce PAD4-Dependent, ROS-Independent NETosis, With Early and Late Events Controlled by Discrete Signaling Pathways. Front Immunol. 9:2036. https://doi.org/10.3389/fimmu.2018.02036.\u003c/li\u003e\n\u003cli\u003eNova, Z., H. Skovierova, and A. Calkovska. 2019. Alveolar-Capillary Membrane-Related Pulmonary Cells as a Target in Endotoxin-Induced Acute Lung Injury. Int J Mol Sci. 20(4):831. https://doi.org/10.3390/ijms20040831.\u003c/li\u003e\n\u003cli\u003eBorges, L., et al. 2020. COVID-19 and Neutrophils: The Relationship between Hyperinflammation and Neutrophil Extracellular Traps. Mediators Inflamm. 2020:8829674. https://doi.org/10.1155/2020/8829674.\u003c/li\u003e\n\u003cli\u003eAratani, Y. 2018. Myeloperoxidase: Its role for host defense, inflammation, and neutrophil function. Arch Biochem Biophys. 640:47-52. https://doi.org/10.1016/j.abb.2018.01.004.\u003c/li\u003e\n\u003cli\u003eNair, A., et al. 2019. Conceptual Evolution of Cell Signaling. Int J Mol Sci. 20(13):3292. https://doi.org/10.3390/ijms20133292.\u003c/li\u003e\n\u003cli\u003eMiyazaki, Y., et al. 1998. Effects of a neutrophil elastase inhibitor (ONO-5046) on acute pulmonary injury induced by tumor necrosis factor alpha (TNFalpha) and activated neutrophils in isolated perfused rabbit lungs. Am J Respir Crit Care Med. 157(1):89-94. https://doi.org/10.1164/ajrccm.157.1.9612021.\u003c/li\u003e\n\u003cli\u003eHonda, M. and P. Kubes. 2018. Neutrophils and neutrophil extracellular traps in the liver and gastrointestinal system. Nat Rev Gastroenterol Hepatol. 15(4):206-221. https://doi.org/10.1038/nrgastro.2017.183.\u003c/li\u003e\n\u003cli\u003eRen, J., et al. 2021. Platelet TLR4-ERK5 Axis Facilitates NET-Mediated Capturing of Circulating Tumor Cells and Distant Metastasis after Surgical Stress. Cancer Res. 81(9):2373-2385. https://doi.org/10.1158/0008-5472.can-20-3222.\u003c/li\u003e\n\u003cli\u003eSorvillo, N., et al. 2019. Extracellular DNA NET-Works With Dire Consequences for Health. Circ Res. 125(4):470-488. https://doi.org/10.1161/circresaha.119.314581.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"neutrophil extracellular traps, acute lung injury, neutrophil elastase, AK0705, pyroptosis, NETosis","lastPublishedDoi":"10.21203/rs.3.rs-3875684/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3875684/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS), an overwhelming inflammatory condition, is characterized by systemic inflammation and multiorgan dysfunction. Neutrophil extrusion of neutrophil extracellular traps (NETs) and concomitant cell death process (NETosis) provides host defense, while neutrophil elastase (NE), a serine protease stored in the azurophilic granules of neutrophils, contributes to NETs for entrapping extracellular pathogens. Importantly, excess NETs and NETosis mediated pyroptosis in the etiopathogenesis. However, the exact mechanism underlying NE-mediated NET formation contributed to pyroptosis during ALI/ARDS remains unclear. In this study, we reported that neutrophils were susceptible to NETosis in the lungs of ARDS patients. We investigated the effects and the underlying mechanisms of an inhaled NE inhibitor AK0705 on lipopolysaccharide (LPS)-induced ALI in mice. The inflammatory cytokines assessments, pathologic examination, and detection of NETs indicated that inhalation of AK0705 ameliorated LPS-induced lung injury, and suppressed the secretion of IL-6, TNF-α, IL-1β, and MCP-1 in bronchoalveolar lavage fluid (BALF). Furthermore, the results of cell-free DNA, myeloperoxidase (MPO), citrullinated histone (citH3), NE level, and NE activity showed that AK0705 significantly inhibited LPS-induced NET formation. Western blot revealed that AK0705 effectively inhibited LPS-triggered pyroptosis by downregulating MAPK/AKT/NLRP3 signaling pathway. In conclusion, our investigation demonstrated for the first time that AK0705 could protect against LPS-induced ALI by promoting a reduction of NET formation and suppressing pyroptosis. These data suggest that targeting NETs, especially NE, using AK0705 is a promising approach to prevent NET formation in the progression of ALI/ALRDS.","manuscriptTitle":"Inhaled Neutrophil Elastase Inhibitor Alleviates Lipopolysaccharide Triggers Neutrophil Extracellular Trap-Mediated Acute Lung Injury via the MAPK/AKT/NLRP3 Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-22 14:56:56","doi":"10.21203/rs.3.rs-3875684/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b8edea4f-0a96-4642-a301-e83b54fd8da9","owner":[],"postedDate":"January 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-02-12T15:45:43+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-22 14:56:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3875684","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3875684","identity":"rs-3875684","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}