Dietary lipids induce PPARd and BCL6 to repress macrophage IL-23 induction after  intestinal injury and LPS exposure

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Unresolved tissue damage is a common feature of Inflammatory Bowel Disease (IBD) that facilitates disease progression. Here, we showed that high animal fat diets (HFD), an environmental risk factor associated with IBD pathogenesis, suppress intestinal macrophage production of critical tissue repair responses after damage. This includes reduced IL-23 production, which drives downstream production of the IL-22, which is needed for barrier repair. Indicating that dietary lipids interfere with responses to microbial molecules needed to induce barrier protective functions, we found oleic acid could directly suppress macrophage Il23a induction after lipopolysaccharide (LPS) treatment. Deleting the lipid transporter CD36 on macrophages restored the Il23a and Il22response, reducing intestinal damage in HFD-fed DSS-treated mice. We found that CD36-mediated intracellular lipid accumulation, mainly oleic acid, in macrophages leads to peroxisome proliferator-activated receptor delta (PPARd)release of the transcriptional repressor protein B-cell lymphoma 6 (BCL6). BCL6 suppresses Il23a transcription in microbe-exposed macrophages. The studies suggest dietary lipid modulation of the macrophage PPARd/BCL6 transcriptional repressor complex is a key mechanism of fat-associated defects in intestinal damage repair and immune dysregulation. Overall, our findings provide new insights into dietary lipid contribution to intestinal disease progression and identify new potential therapeutic targets to decrease diet-associated risk for IBD.
Full text 152,646 characters · extracted from preprint-html · click to expand
Dietary lipids induce PPARd and BCL6 to repress macrophage IL-23 induction after intestinal injury and LPS exposure | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Dietary lipids induce PPARd and BCL6 to repress macrophage IL-23 induction after intestinal injury and LPS exposure Ashleigh M. Gil, Daniel F. Zegarra-Ruiz, Wan-Jung Wu, Kendra Norwood, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6557500/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 27 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Unresolved tissue damage is a common feature of Inflammatory Bowel Disease (IBD) that facilitates disease progression. Here, we showed that high animal fat diets (HFD), an environmental risk factor associated with IBD pathogenesis, suppress intestinal macrophage production of critical tissue repair responses after damage. This includes reduced IL-23 production, which drives downstream production of the IL-22, which is needed for barrier repair. Indicating that dietary lipids interfere with responses to microbial molecules needed to induce barrier protective functions, we found oleic acid could directly suppress macrophage Il23a induction after lipopolysaccharide (LPS) treatment. Deleting the lipid transporter CD36 on macrophages restored the Il23a and Il22 response, reducing intestinal damage in HFD-fed DSS-treated mice. We found that CD36-mediated intracellular lipid accumulation, mainly oleic acid, in macrophages leads to peroxisome proliferator-activated receptor delta (PPARd)release of the transcriptional repressor protein B-cell lymphoma 6 (BCL6). BCL6 suppresses Il23a transcription in microbe-exposed macrophages. The studies suggest dietary lipid modulation of the macrophage PPARd/BCL6 transcriptional repressor complex is a key mechanism of fat-associated defects in intestinal damage repair and immune dysregulation. Overall, our findings provide new insights into dietary lipid contribution to intestinal disease progression and identify new potential therapeutic targets to decrease diet-associated risk for IBD. Biological sciences/Immunology/Innate immune cells Biological sciences/Immunology/Mucosal immunology Health sciences/Gastroenterology/Gastrointestinal diseases/Inflammatory bowel disease Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Excess consumption of diets high in animal fat causes intestinal mucosal barrier dysfunction and is associated with an increased risk for the development and pathogenesis of inflammatory bowel disease (IBD). However, how animal fat-rich diets drive risk for IBD development and contribute to IBD pathogenesis is incompletely understood. Most evidence highlights that animal-sourced high-fat diets (HFDs) drive IBD progression by inducing changes in microbial composition and epithelial damage that elicit tissue-damaging immune responses. However, little is known about the direct effects of the diet on immune functions that may influence IBD pathogenesis. Disease progression in IBD can be partly attributed to inefficient repair of the damaged intestinal barrier. Repair after intestinal injury heavily relies on intestinal immune cell production of antimicrobial and reparative cytokines 1 – 5 . Macrophages are among the first immune cells to respond to damaged tissue sites, including the intestine. Macrophage recognition of damage signals, including microbial products, and appropriate corresponding cytokine responses are critical to repairing the damaged intestinal epithelial barrier 1 – 5 . Loss of the appropriate macrophage cytokine responses to intestinal damage can result in defective tissue repair 1 – 5 . Highlighting the influence of diet on immune cell function in intestinal repair, we previously demonstrated that lipids found in the HFD directly impair macrophage clearance of apoptotic neutrophils, a key inducer of macrophage IL-10 production needed to support repair 2 , 6 . While this study links diet with defective macrophage tissue repair functions, we did not address if HFD exposure impacted additional macrophage reparative functions, further limiting intestinal damage repair. Microbial breach of the intestinal epithelium is a key damage signal that induces macrophage antimicrobial and barrier repair cytokine responses. Among these responses is macrophage production of IL-23, which induces IL-22 production by T cells and innate lymphoid cells to support microbial clearance and epithelial wound closure 4 , 7 , 8 . Alterations of the IL-23/IL-22 pathways are associated with IBD pathogenesis 9 . Additional microbial-induced macrophage cytokines, TNF and IL-10, play a key role in microbial clearance and barrier repair, and dysregulation of these signals is also associated with intestinal damage and IBD pathogenesis. It is unclear whether the diet directly influences macrophage production of antimicrobial reparative cytokine responses during intestinal injury and the resulting impact on intestinal healing. In this study, we used acute HFD feeding in a dextran sodium sulfate (DSS) mouse model of colitis in combination with in vitro lipid treatment assays in bone-marrow-derived macrophage (BMDM) cultures to define the direct impact of dietary lipids on macrophage antimicrobial cytokine responses needed to support intestinal damage repair. We show that macrophage Il23a and downstream induction of Il22 are lost in the cecum of HFD-fed mice with intestinal injury induced by DSS treatment. Using in vitro studies, we identified that the unsaturated dietary lipid oleic acid, the primary lipid in the HFD, suppressed macrophage expression and production of Il23a in response to LPS. This effect also extended to LPS-induced cytokines Tnf and Il10 . In vitro, lipid and LPS treatment revealed that intracellular accumulation of oleic acid and increased expression of the lipid receptor and transporter CD36 in macrophages corresponded with decreased Il23a , Tnf , and Il10 responses to LPS. We further find that macrophage-specific deletion of CD36 attenuated intestinal injury and restored Il23a , Il22 , Tnf , and Il10 responses in HFD-fed DSS-treated mice. Analysis of pathways downstream of CD36-mediated lipid transport revealed a role for an intracellular lipid sensor/transcriptional repressor complex formed by PPARd and BCL6 in inhibiting macrophage cytokine production. In vitro inhibition of PPARd or BCL6 restored Il23a , but not Tnf and Il10 , expression in oleic acid and LPS-treated macrophages, highlighting oleic acid in contrast palmitic acid had no impact on macrophage Il23a , Tnf , and Il10 response to LPS, demonstrating lipid-specific influences on macrophage responses to microbial signals. Collectively, our studies reveal that, during HFD feeding, lipid accrual in macrophages leads to loss of the IL-23-IL-22 response after intestinal damage due to induction of the PPARd/BCL6 transcriptional repressive complex, supporting defective intestinal damage repair. Results Intestinal IL-23 and IL-22 reparative responses are lost in HFD-fed DSS-treated mice To assess the influence of HFD feeding on antimicrobial responses after intestinal damage, we used our previous model of feeding male C57BL/6 mice with a 10% low-fat diet (LFD) or 60% high-fat diet (HFD) for one week followed by treatment with 2% DSS in the drinking water for 5 days to induce intestinal injury 2 . Mice placed on LFD or HFD alone had equivalent weight gain (Fig. 1 a). After 5 days of DSS exposure, LFD and HFD mice showed similar decreases in body weight and comparable intestinal damage as measured by colitis score (Fig. 1 b,c). On day 9, four days post-DSS treatment, improved body weight and resolution of intestinal damage were seen in LFD-fed DSS-treated mice (Figs. 1 b,c). However, HFD-feeding in mice exposed to DSS resulted in continued body weight loss and sustained intestinal pathology after DSS treatment (Fig. 1 b,c). In agreement with our previous findings, these defects were localized to the cecum and recapitulated our prior observations of HFD-induced defects in intestinal damage repair 2 . We previously reported that intestinal healing defects in HFD fed DSS treated mice were associated with decreased mucus production and increased intestinal microbial-epithelial interactions 2 . By IF staining for the mucus protein mucin 2 (MUC2) and fluorescence in situ hybridization (FISH) to detect microbe-epithelial interactions, we found comparable mucus production and bacterial distance from the intestinal epithelium with both diets alone on day 0 (Fig. 1 d-f). Equivalent disruption of the mucus layer was seen in both diet groups on day 5 of DSS treatment, corresponding with similarly increased bacteria-epithelial interactions (Fig. 1 d-f). In contrast, on day 9 after DSS treatment, we found decreased mucus and increased microbial-intestinal epithelial interactions in HFD compared to LFD-fed mice (Fig. 1 d-f), recapitulating our previous findings 2 . Goblet cell mucus production is critical in preventing bacterial-intestinal epithelial cell (IEC) interactions, which further elicit tissue-damaging immune responses and impede damage resolution 10 , 11 . Macrophage production of the cytokine IL-23 induces T cell and ILC production of the cytokine IL-22, which induces goblet cell proliferation and mucus secretion 10 , 12 . We used qPCR to determine whether Il23a and Il22 were normally induced in the cecum of LFD and HFD-fed control and DSS-treated mice. We saw no difference in Il23a or Il22 expression between HFD and LFD-fed mice (Fig. 1 g,h). After DSS treatment, cecal Il23a and Il22 expression were significantly induced in LFD-fed mice (Fig. 1 g,h). However, Il23a and Il22 responses were severely blunted in DSS-treated HFD-fed mice (Fig. 1 g,h). There were no significant differences in the cecal expression of the Il12a subunit of IL-12 or the Il12b subunit of IL-23 in LFD and HFD-fed mice after DSS treatment ( Supplementary Fig. 1a,b ). These findings suggest that a blunted IL-23 and IL-22 response contributed to decreased mucus production and increased bacterial-epithelial interactions in HFD-fed DSS-treated mice. IL-22 overexpression ameliorates intestinal damage repair defects in HFD DSS mice IL-22 supports mucosal healing by inducing IEC migration needed for wound closure and antimicrobial mucus production 12 – 15 . We next determined whether overexpression of IL-22 during the injury recovery phase after DSS treatment could attenuate the repair defects seen in HFD-fed DSS-treated mice. Using a hydrodynamic delivery method, mice were administered a control or IL-22 overexpression plasmid. Overexpression of IL-22 protected HFD mice from increased body weight change and intestinal pathology compared to a control plasmid (Fig. 2 a-c). These effects corresponded with increased mucus production and decreased association of microbes with the intestinal epithelium (Fig. 2 d-f). While we saw increased cecal Il23a expression in HFD-fed DSS-treated mice in response to IL-22 overexpression, we did not see restoration of cecal Il22 production (Fig. 2 g,h). Il12p40 expression also remained similar between groups, whereas Il12p35 expression increased ( Supplementary Fig. 2a,b ). Taken together, these data suggest that reduced IL-22 induction in HFD-fed DSS-treated mice contributed to the loss of intestinal mucus production and defective intestinal damage repair. Dietary lipids suppress macrophage IL-23 response to intestinal damage and LPS Within the intestine, macrophages serve as one source of IL-23 that drives IL-22 production by innate lymphoid cells and T cells 4 . We sorted cecal macrophages from mice fed HFD or LFD and treated with DSS as above, and measured Il23a gene expression by qPCR. We found significantly reduced Il23a expression in cecal macrophages from HFD compared to LFD-fed mice (Fig. 3 a). This data paralleled the decreased cecal Il23a expression we found in HFD-fed mice above (Fig. 1 g). Dietary lipids are well-known for their direct impact on macrophage function in diet-associated diseases such as obesity and atherosclerosis 16 – 19 . We previously demonstrated that the unsaturated lipid oleic acid, comprising 50% of the HFD, impaired macrophage tissue repair functions such as clearance of apoptotic neutrophils, demonstrating this effect as contributing to defective healing of intestinal damage in HFD-fed mice 2 . We postulated that the oleic acid could also directly influence macrophage IL-23 responses to microbes or microbial signals encountered during intestinal injury. To investigate this question, we assessed Il23a gene expression in bone-marrow-derived macrophages (BMDMs) left untreated, treated with oleic acid alone, LPS alone, or co-treated with oleic acid and LPS for 2, 4, and 6 h. Il23a was not expressed in untreated or oleic acid singly treated BMDMs throughout the time course (Fig. 3 b). A robust induction of Il23a was seen in BMDMs exposed to LPS following 2, 4, and 6 h of treatment (Fig. 3 b). Il23a expression was severely blunted in oleic acid and LPS co-treated cultures (Fig. 3 b). Oleic acid co-exposure had similar repressive effects on Tnf and Il10 expression (Fig. 3 b). Dose-dependent effects of oleic acid demonstrated that the suppresses effects on Il23a , Tnf , and Il10 were concentration dependent ( Supplementary Fig. 3a-d ). When performing similar assays using the saturated lipid palmitic acid, which comprises ~ 49% of the lipids in the HFD, we found that palmitic acid alone did not induce Il23a , Tnf , and Il10 expression in BMDMs (Fig. 3 c). Co-treatment with palmitic acid and LPS resulted in reduced expression of Tnf at all time points, and Il23a and Il10 expression were reduced at 6 h post-treatment (Fig. 3 c). Suppressive effects of palmitic acid on LPS-induced TNF were concentration dependent ( Supplementary Fig. 4a-d ). These findings demonstrate that lipids in the HFD alter macrophage cytokine expression in response to microbial stimuli and suggest lipid-specific regulation of LPS-induced macrophage expression of Il23a , Tnf , and Il10 . Macrophage CD36 modulates intestinal repair responses Macrophage uptake of lipids through the scavenger receptor CD36 is associated with altered macrophage functions and disease pathogenesis in obesity and atherosclerosis 16 – 19 . We observed that diet alone did not alter CD36 expression in the cecum (Fig. 4 a). After DSS treatment, CD36 expression increased in the cecum of LFD-fed mice but remained low in the cecum of HFD-fed mice (Fig. 4 a). We also found lower gene and surface level protein expression of CD36 in sorted cecal macrophages from HFD compared to LFD-fed mice (Fig. 4 b,c). Using our in vitro lipid and LPS time course assay, we evaluated whether dietary lipid influences on BMDM Il23a , Tnf , and Il10 expression corresponded with changes in CD36 expression. Untreated or LPS-alone exposed BMDMs displayed similar levels of CD36 expression (Fig. 4 d). Oleic acid exposure alone or with LPS markedly increased CD36 expression at 2 and 4 h, with expression decreasing at 6 h in the oleic acid and LPS co-treated groups (Fig. 4 d). Palmitic acid treatment alone or in the presence of LPS resulted in decreased CD36 expression at 6 h post-treatment (Fig. 4 e). We next asked how intracellular lipid accumulation corresponded to CD36 expression. We used immunofluorescence to measure the accumulation of the neutral lipid dye BODIPY alongside CD36 expression in oleic acid and oleic acid LPS co-treated BMDMs. At 4h post-treatment, we found accumulation of BODIPY along with increased BMDM expression of CD36 (Fig. 4 f). In contrast, at 6 h post-treatment, while we still saw BODIPY accumulation, CD36 expression had decreased (Fig. 4 g). These findings suggest a potential link between CD36-mediated macrophage uptake of lipids and lost macrophage cytokine responses to microbial signals. Macrophage-specific deletion of CD36 restores the IL-23-IL-22 response in HFD DSS mice We next investigated the role of CD36 in modulating macrophage IL-23-IL-22 responses in HFD mice with intestinal injury. We used HFD feeding and DSS exposure in control (MacCD36 WT ) mice and mice with macrophage-specific deletion of CD36 (MacCD36 KO ) induced by Tamoxifen administration. HFD-fed MacCD36 KO mice showed improved body weight change and decreased histopathology compared to WT after DSS treatment (Fig. 5 a-c). Improved outcomes corresponded with increased MUC2 levels and decreased bacterial-epithelial interactions in the cecum of HFD MacCD36 KO mice compared to MacCD36 WT mice (Fig. 5 d-f). We next examined cecal Il23a and Il22 expression and found increased gene expression of Il23 and Il22 in HFD-fed MacCD36 KO compared to WT mice after DSS treatment (Fig. 5 g). Furthermore, HFD-fed MacCD36 KO DSS-treated mice displayed significantly increased gene expression of Tnf and Il10 (Fig. 5 g). These results demonstrated that loss of macrophage CD36 preserves antimicrobial responses to intestinal injury in HFD-fed mice and protects against intestinal damage repair defects seen after HFD feeding. The PPARd and BCL6 transcriptional repressor complex governs oleic-acid repression of macrophage IL-23 responses to LPS The above findings suggest that diminished IL-23-IL-22 responses in HFD DSS mice could result from CD36-mediated macrophage uptake of lipids. CD36 lipid transport and signaling transduction functions, including cytokine production, influence macrophage functions. Next, we sought to identify potential downstream modulators of CD36-mediated oleic acid-induced suppression of macrophage IL-23 and IL-22 responses to intestinal damage in HFD DSS mice. We began our assessment with the intracellular lipid-responsive transcriptional and lipid metabolism regulators, peroxisome proliferator-activator receptors, PPARg and PPARd 20 – 22 . PPARg and PPARd can transcriptionally regulate a specific subset of macrophage cytokine responses to microbial stimuli such as LPS 22 . We postulated that PPAR activity downstream of CD36-mediated oleic acid accumulation in macrophages modulated the IL-23 response to LPS. First, we assessed cecal expression of Pparg and Ppard in LFD-fed and HFD-fed mice before and after DSS exposure. Before DSS treatment, cecal Pparg and Ppard expression were similar between both diet groups ( Supplementary Fig. 5a and Fig. 6 a). In response to DSS treatment, Pparg expression was slightly increased but to similar levels in both diet groups ( Supplementary Fig. 5a ). Interestingly, the expression of Ppard was significantly induced in HFD-fed compared to LFD-fed mice in response to DSS treatment (Fig. 6 a), corresponding with decreased cecal Il23a and Il22 in HFD-fed mice in response to DSS treatment (Fig. 1 g,h). These above results led us to investigate whether the transcriptional response of Pparg and Ppard in BMDMs exposed to lipids and LPS paralleled changes in cecal Pparg and Ppard in HFD-fed mice exposed to DSS. In our lipid and LPS time course assay, after 2 h of exposure, BMDM Pparg expression slightly increased in oleic acid alone, LPS, and oleic acid/LPS treated groups compared to no treatment but was similarly expressed in all groups at 4 and 6 h post-treatment ( Supplementary Fig. 5b ). When using palmitic acid as the dietary lipid source in these assays, no significant difference in Pparg expression was observed throughout the time course ( Supplementary Fig. 5c ). In contrast to Pparg , oleic acid treatment alone or with LPS enhanced Ppard gene expression in BMDMs at 2 and 4 h compared to no treatment or LPS-alone treatment, with only oleic-alone treatment remaining significant 6 h (Fig. 6 b). These oleic acid-induced changes in Ppard expression nicely corresponded with increased cecal Ppard expression in HFD-fed DSS treated mice (Fig. 6 a) and decreased expression of Il23a , Tnf , and Il10 in oleic acid/LPS-treated BMDMs (Fig. 3 b). Ppard expression was not influenced by palmitic acid treatments (Fig. 6 c). As lipid effects on BMDM Il23a , Tnf , and Il10 response to LPS were concentration-dependent, we next assessed the dose-dependent responses of Ppard and Pparg in BMDMs treated with oleic and palmitic acid at 4 h. Oleic acid concentrations of 100 µM or 200 µM had no or a mild impact on Ppard and Pparg gene expression ( Supplementary Fig. 6a,b ). At 300 µM and 400 µM, oleic acid alone or with LPS significantly increased Ppard gene expression compared to no treatment or LPS treatment alone, but had no impact on Pparg gene expression ( Supplementary Fig. 6c,d ). Palmitic acid slightly decreased Ppard expression at 100 µM in the presence of LPS but did not influence Pparg expression at any concentration or Ppard expression at 200 µM and above ( Supplementary Fig. 7a,d ). Collectively, these findings demonstrated that Ppard induction by high concentrations of oleic acid corresponded with oleic acid inhibition of BMDM Il23a , Tnf , and Il10 response to LPS. To gain insight into whether oleic acid induction of Ppard translated to PPARd repression of Il23a , Tnf , and Il10 in BMDMs in response to LPS, we co-exposed lipid and LPS-treated BMDMs with or without the potent irreversible small molecule PPARd inhibitor GSK-3787 23 . As expected, oleic acid suppressed LPS-induced Il23a , Tnf , and Il10 gene expression levels compared to LPS treatment alone (Fig. 6 d). Interestingly, inhibition of PPARd restored BMDM Il23a expression response to LPS but not expression of Tnf or Il10 (Fig. 6 d). These data demonstrate that PPARd governs oleic acid repression of macrophage Il23a expression response to microbial signals in vitro and suggest an alternate regulatory mechanism modulates oleic acid suppression of Tnf and Il10 in macrophages. Furthermore, these data imply that increased PPARd activity in macrophages could contribute to the loss of IL-23 and IL-22 signaling in HFD mice with intestinal damage. PPARd influences on macrophage cytokine responses can be mediated by the transcriptional repressor B cell lymphoma 6 (BCL6) 24 . Liganded PPARd releases BCL6 to repress NFkB target genes 24 , 25 , such as IL-23 26 . We first used immunofluorescence staining to assess BCL6 expression levels in non-treated, oleic acid alone, LPS alone, or oleic acid and LPS co-exposed BMDMs. BCL6 expression levels assessed by mean fluorescence intensity (MFI) demonstrated that oleic acid treatment alone or with LPS significantly increased BCL6 protein levels in BMDMs compared to no treatment or LPS (Fig. 6 e). To determine the contribution of BCL6 in oleic acid repression of macrophage cytokine response to LPS, we co-exposed untreated, oleic acid alone, LPS alone, or oleic acid/LPS-treated BMDMs with the BCL6 small molecule inhibitor 79 − 6 27 . As with antagonism of PPARd, inhibition of BCL6 restored macrophage Il23a , but not Tnf and Il10 , response to LPS (Fig. 6 f). These findings demonstrate that oleic acid modulation of BCL6 activity through PPARd represses macrophage IL-23 response to LPS and highlight direct lipid-specific regulation of macrophage antimicrobial IL-23 response. Discussion High animal fat diets are a risk factor for IBD, and the excessive lipid content of the HFD is well-known to directly alter immune functions to support the development or pathogenesis of diet-associated diseases such as obesity and atherosclerosis 28 – 34 . Yet, whether the direct influences of HFD lipids on intestinal immune reparative functions also contribute to the pathogenesis of IBD is less understood. Our findings provide evidence that direct effects of HFD lipids on macrophage antimicrobial and tissue reparative functions support defects in intestinal damage repair, which could further exacerbate IBD pathogenesis. Previous reports demonstrate a link between HFD-induced and genetic obesity and the loss of the IL-23-IL-22 responses in an infectious model of colitis using Citrobacter rodentium infection in mice 35 . In these studies, obese mice were unable to clear Citrobacter infection, where pathogen clearance is dependent on IL-23 and IL-22 signaling, and sustained more intestinal damage. As with our studies, administration of IL-22 resolved intestinal damage after epithelial damage and pathogen infection. Although not investigated in these studies, the lack of IL-22 responses to Citrobacter infection in the context of HFD-induced obesity was suggested to be due to the loss of dendritic cell IL-23. Our findings show that reduced macrophage IL-23 response to intestinal injury after HFD feeding also underlies unresolved damage in mice with intestinal injury. These previously published findings and our current study highlight how dietary fats govern critical innate immune responses, notably IL-23 and IL-22 responses, to intestinal injury or pathogen infection and dictate the host’s ability to resolve intestinal injury. Identification of additional macrophage reparative functions modulated by the lipids could further increase our understanding of the connection between HFD consumption and IBD risk. Our ex vivo and in vitro studies provide evidence that specific lipids in the HFD directly repress macrophage antimicrobial and reparative cytokine responses to intestinal damage. Our findings reveal that the intracellular presence of the dietary lipid oleic acid in BMDMs drove repressed Il23a, Tnf , and Il10 responses to LPS, mirroring our in vivo findings. Oleic acid, an unsaturated fatty acid, produces an anti-inflammatory phenotype in macrophages 36 – 38 . In general, the anti-inflammatory effects of oleic acid are suggested to benefit some aspects of IBD, such as dampening inflammatory responses 39 – 41 . However, our studies indicate that although oleic acid may have beneficial anti-inflammatory effects, these same responses interfere with protective functions, like IL-23 production, downstream of microbial signals needed to support the healing of the intestinal epithelial lining, which may further exacerbate intestinal damage. Interestingly, the saturated lipid palmitic acid, which is associated with an inflammatory macrophage phenotype and IBD 38 , 41 , 42 , only directly influenced macrophage Tnf responses to LPS and not cytokines such as Il23a and Il10 that influence repair. As dietary fat association with altered IBD risk is complex, continued study is needed to understand how dietary lipid components influence various intestinal cell types, intestinal repair process, damage, and inflammation in the gut. Specific to our studies, future use of single-source lipid-enriched diets compared to complex combinations of lipids is needed to understand the complex influence of specific lipid components and combinations of lipids on macrophage antimicrobial reparative responses in IBD. CD36 modulation of the intracellular lipid content in macrophages directly influences the pathogenesis of atherosclerosis and obesity 18 , 43 , 44 . Our in vivo studies suggest that macrophage CD36 similarly contributes to the pathogenesis of IBD by facilitating the transport and accumulation of diet-derived lipids in macrophages, altering macrophage responses to microbial signals. The restoration of Il23a , Il22 , Tnf , and Il10 we see in mice with macrophage-specific CD36 deletion suggests that CD36-mediated lipid transport and signaling transduction play critical roles in intestinal immune microbial defense and repair response. In the intestine, there is evidence that CD36 plays a role in intestinal barrier function, as global loss of CD36 in mice impairs the small intestinal barrier and induces subclinical inflammation under normal dietary conditions 45 . More recent studies demonstrate a role for CD36-mediated transport of long-chain fatty acids by intestinal epithelial cells in driving colonic inflammation 42 . Collectively, these findings highlight the important role of CD36 in modulating inflammatory and repair responses in the intestine. How CD36 influences the function of various intestinal cell types and the impact on intestinal disease pathogenesis should be further studied. PPARd serves as an intracellular lipid sensor that modulates lipid-induced inflammatory responses in macrophages 20 , 25 , 33 . Our in vitro studies reveal that increased macrophage PPARd activity induced by intracellular oleic acid accumulation precludes LPS-induced macrophage production of IL-23. Limiting PPARd activity attenuated the loss of macrophage IL-23 response to LPS. This phenotype mirrored our in vivo findings of lost cecal macrophage IL-23, suggesting that excessive PPARd activity drives lost macrophage reparative antimicrobial responses and perpetuated defects in intestinal healing. PPARd effects on macrophage inflammatory response are mediated through the transcriptional repressor BCL6 24 . Lipid-liganded PPARd releases BCL6 to repress many NFkB target genes 24 . With relevance to the antimicrobial response needed to promote intestinal damage, BCL6 deficiency in macrophages increases LPS-induced IL-23 production and IL-22 production from TH17 cells 26 . Our studies show that BCL6 transcriptional repressive activities downstream of lipid activation of PPARd suppress macrophage IL-23 induction after LPS treatment. Targeting BCL6 in T cells is suggested as a potential druggable target for IBD due to increased BCL6 expression in this population correlating with IBD pathogenesis and specific IBD subtypes 46 – 48 . Our studies suggest that modulation of macrophage BCL6 may be beneficial to improve intestinal immune damage repair responses. More in-depth studies will help define the role of BCL6 in modulating intestinal healing. Developing strategies to regulate the PPARd and BCL6 activity to promote the reparative effects of IL-23 and IL-22 may be a novel treatment strategy for restoring barrier integrity and slow diet-driven IBD occurrence and progression. Materials and Methods Experimental Animals All animal experiments were performed with approved protocols by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center. All animal research reported in this paper is in accordance with ARRIVE guidelines 49 . Animals used in this study were C57BL/6J (JAX #000664), CX 3 CR1 + GFP/+ (JAX # 005582), CX 3 CR1-CreERT2 (JAX# 021160), and CD36flox tm1.1Ijg/J (JAX # 032276) purchased from Jackson Labs. Littermate controls were used for each experiment and mice were randomly assigned to experimental groups. Animals were housed under standard specific pathogen-free (SPF) conditions at Baylor College of Medicine or Memorial Sloan Kettering Cancer Center animal facility. All lines were backcrossed for at least 12 generations to the C57BL/6J background. To generate MacCD36 ko mice, CD36 fl/fl mice were crossed with CX 3 CR1-CreERT2, and mice (CX 3 CR1CreERT2 and control) were injected i.p. with 0.2mg with (Z)-4- Hydroxytamoxifen, 98% Z isomer (4OHT, Sigma) every 3 days starting on Day 0 of DSS treatments. Tamoxifen was resuspended to 20mg/ml in ETOH with heating to 37°C. 4OHT was diluted to 0.2mg in a 100ul corn oil (Sigma). At least 4 mice per group between 6 and 8 weeks of age were used for all mouse experiments. Multiple combined experiments were used to assess statistical significance. Acute diet feeding and intestinal injury Mice were fed 10% kcal low fat diet (LFD) (Research Diets, D12450B) or 60% kcal high-fat diet (HFD) (Research Diets, D12492) ad libitium for one week prior to treatment with 2% Dextran sodium sulfate (DSS, ThermoFisher, AAJ1448922) in drinking water for 5 days followed by plain drinking water. Histology Mouse cecums were fixed in Carnoy’s fixation for 1–2 days before being placed in methanol prior to paraffin embedding. Samples were deparaffinized, cut into 4µM sections, and stained with hematoxylin. Images were taken with a Nikon Ti Eclipse microscope. Sections from 4–6 mice were used for blinded colitis scoring according to established criteria 50 , 51 and as previously described 2 . Immunofluorescence tissue staining Before antibody IF staining, Fluorescence In Situ Hybridization (FISH) staining was performed prior to immunofluorescence staining as described in 2 , 52 using the following UNI519 universal primer-probe sequence: /5Alex594N/GTATTACCGCGGCTGCTG (Integrated DNA Technologies (IDT). Sections were washed 1x with PBS and 1x with MilliQ water. Sections were permeabilized, blocked, and stained overnight at 4°C with the following primary antibodies at a 1:100 dilution: MUC2 (polyclonal, Cloud Clone Cat# PAA705Mu02). After 2X wash with 1x TBST and 1X wash with 1x PBS, sections were stained with a 1:200 dilution of the secondary antibody anti-rabbit Alexa 488 (Cell signaling Cat# 4412) for 1 h. Sections were washed 1X with 1x PBS and stained with DAPI (Sigma Aldrich Cat# D9542) and mounted using Aqua Mount (Polysciences Cat# 18606-100) anti-fade mounting media and coverslipped. Images were taken on Nikon Ti Eclipse microscope using 20x and 40x objectives, and images were processed using FIJI. Quantification of immunofluorescence staining MUC2 and FISH. Three images from 4 mice per group were used to quantify MUC2 intensity and bacterial encroachment. For MUC2 intensity, Image J was used to set a threshold and mask for each image, and pixel intensity was measured using the Image J measuring tool. Bacterial encroachment was measured as the distance between the closest bacteria to the intestinal epithelium using the Image J measuring tool. Gene expression RNA from whole cecum (0.5 in.), sorted cecal macrophages, or cultured BMDMs was isolated using Trizol (Invitrogen) according to the manufacturer's instructions. iScript reverse transcription kit (Bio-rad Laboratories) was used to synthesized cDNA. Real-time quantitative qPCR was performed using SYBR Green Supermix (Bio-rad Laboratories) using a CFX384 Touch real-time PCR machine. Thermocycling program was 95°C for 2 min followed by 40 cycles at 95°C for 15 s, 60°C for 30s, and 72°C for 30s. The following primers were used: mouse Il23a-F: CCAGCAGCTCTCTCGGAATCT, mouse Il23a-R: AAGCAGAACTGGCTGTTGTC, mouse Il22-F: CATGCAGGAGGTGGTACCTT, mouse Il22-R: CAGACGCAAGCATTTCTCAG mouse Il10-F: CCAGCTGGACAACATACTGCT, mouse Il10-R: AACCCCACAAGAGTTCTTTCAAA, mouse Gapdh -F: AATGTGTCCGTCGTGGATCT, mouse Gapdh: CATCGAAGGTGGAAGAGTGG, mouse Tnf-F: AGGGTCTGGGCCATAGAACT, mouse Tnf-R: CCACCACGCTCTTCTGTCTAC, mouse Cd36-F: AACACTGTGATTGTACCTG, mouse Cd36-R: TCAATAAGCATGTCTCCGAC, mouse Pparg F: GCATGGTGCCTTCGCTGA, mouse Pparg-R: TGGCATCTCTGTGTCAACCATG, mouse Ppard-F: TTGAGCCCAAGTTCGAGTTTG, mouse Ppard-R: CGGTCTCCACACAGAATGATG. Relative expression of target gene was determined using the delta delta CT method. Gapdh was used as an internal control. Overexpression of IL-22 One day after the start of DSS treatment, mice were administered a Plasmid DNA control or IL-22 overexpression plasmid (InVivoGen) intravenously (i.v.) at 10µg DNA/mouse diluted in TransIT-EE Hydrodynamic Delivery solution (Mirus) at 0.1 ml/g body weight 1 day after the start of DSS treatment 4 , 53 . Lamina propria cell isolation Isolation of lamina propria cells was performed as previously described 2 , 54 , 55 . In short, after the luminal contents were removed, the sections were treated with 1mM DTT and 30mM EDTA, followed by 30mM EDTA, both for 10min at 37 degrees to remove mucus and epithelial cells. Tissues were digested in 200U/ml collagenase 8 (Sigma-Aldrich C-2139) and 150µg/ml DNase (Sigma DN25) in RPMI supplemented with 10% FBS while shaking at 37°C for 1 h. Lamina propria cells were isolated using a 40%/80% Percoll (Sigma Aldrich) gradient. Flow cytometry and FACS sorting The following antibodies were used for flow staining and or sorting from CX 3 CR1 + GFP/+ (JAX # 005582) mice: MHC II (M5/114.15.2, BioLegend Cat# 107620), CD11b (M1/70, Biolegend Cat# 101226), CD11c (N418, Biolegend, Cat# 117317), Ly6C (AL-21, BD PharMingen Cat#560525), CD45 (30-F11, Biolegend Cat#103149), DAPI (Sigma-Aldrich Cat# D9542). Monocyte-derived macrophages were defined as CX 3 CR1 hi CD11b + MHCII + Ly6c neg . CD36 (HM36, Biolegend CA#102606) was used to assess CD36 mean fluorescence intensity in cecal macrophages by flow cytometry. Flow cytometry and analysis were performed with an LSR II (BD) and FlowJo software (Tree Star). Dead cells were excluded using the Live/Dead fixable aqua dead cell stain kit (Invitrogen). Macrophages were sorted on a FACSAria Cell sorter (BD Biosciences). Bone marrow-derived macrophages (BMDMs) Bone marrow cells were collected from 6 to 8-week-old male and female C57BL/6 male and female mice and differentiated into BMDMs by culturing in BMDM media for 6 days as previously described 2 , 56 . BMDM media: 50% DMEM (Corning) supplemented with 20% FBS, 30% L cell (ATCC CRL-2648) media, 2mM glutamine, 1 mM pyruvate, 1 unit/ml pen/strep, and 55µM β-ME. BMDM media was supplemented every 3 days. Confirmation of macrophage differentiation was assessed by IF staining using the murine macrophage marker F480 (Abcam ab6640). All assays were performed in DMEM supplemented with 10% FBS, 1 unit/ml pen/strep, and 1 mM HEPES. LPS and lipid treatments of BMDMs and BODIPY staining Fatty acids were dissolved in ethanol as described 30 . BMDMs were treated with 100, 200, 300, or 400µm oleic acid or palmitic acid (Nu-Chek Prep) or an equivalent amount of solvent (ethanol) alone or co-treated with 10ng/ml LPS (Millipore Sigma, L4391) for 2, 4, or 6 h. BMDMs were either collected for gene expression analysis, or stained with primary antibodies: DAPI (Invitrogen D1306), F480 (Abcam ab6640), CD36 (abcam ab252922), BCL6 (Invitrogen PA5-27390); secondary antibodies: Cell Signaling anti-rat Alexa 488 (4416), anti-rat Alexa 647 (4414), R&D systems NorthernLights: NL-555 anti-rabbit (NL007), NL-637 anti-rabbit (NL005), NL-493 anti-rabbit (NL009); and 1um of of the neutral lipid stain BODIPY 493/503 (Invitrogen, D3922) for 30 at RT after immunostaining to assess lipid uptake. Automated Cell Counting . Microscopy images were processed with Fiji/ImageJ v.2.3.0/1.53f using a custom macro to quantify fluorescence in individual cells 57 . Briefly, images underwent background correction using the rolling-ball algorithm. Cell boundaries and nuclei were identified to create separate masks: the cell mask was generated using the F480 fluorescence channel, the nuclei mask was generated using the DAPI signal, and the cytoplasmic mask was derived by subtracting the nuclei mask from the cell mask. Fluorescence thresholds for each marker were set manually based on representative images from oleic-treated wells. Thresholds were set separately for two sets of measurements: (1) green (BODIPY), red (CD36), blue (DAPI), and magenta (F480) channels for measuring sample with CD36 MFI and BODIPY, and (2) green (BODIPY), red (F480), blue (DAPI), and magenta (BCL6) channels for measuring sample with BCL6 MFI. For each mask (cell, nucleus, cytoplasm), individual area measurements and the average fluorescence intensities for CD36, BODIPY, and BCL6 were recorded. The number of cells per image was estimated by counting individual DAPI-stained nuclei. Finally, an R script summarized fluorescence intensities for each mask and computed the mean fluorescence per cell by dividing the total fluorescence intensity by the estimated cell number. Analyses were performed using GraphPad Prism version 10.0. The ImageJ macro is available online at: https://bitbucket.org/the-samuel-lab/mcalester-2022/ . PPARd and BCL6 antagonist treatments BMDMs were treated with or without LPS and oleic acid as above, in the presence of 50um PPARd antagonist GSK-3787(Abcam ab144575) or BCL6 small molecule inhibitor 79 − 6 (Sigma197345) for 4 h. BMDMs were then collected for gene expression analysis. Statistical analysis One-way analysis of variance (ANOVA) with Tukey’s posttest or unpaired Student’s t test was performed using a 95% confidence interval. All data are presented as mean ± SEM. All analyses were performed using GraphPad Prism version 10.0. Differences were considered to be significant at P values of less than 0.05. Declarations Data availability statement The datasets used and/or analyzed during current study are available from the corresponding author upon reasonable request. Contributions A.A.H.M. designed experiments and wrote the manuscript with the input from all co-authors. A.G., D.F.Z.R., G.E.D., and A.A.H.M performed, designed, and analyzed the experiments. W.-J.W., K.N., and A.M.J performed experiments. A.A.H.M, A.A., B.S.S. designed the automated counting script. All experiments were performed in accordance with approved protocols by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center. Acknowledgements This work was supported by institutional NIDDK K01DK121934 (A.A.H.M.), the Texas Medical Center Digestive Disease Center Cellular and Molecular Morphology Core and Pilot Fund NIH P30 DK056338 (A.A.H.M.), NIH R01AI125264 (G.E.D.), This project was supported by the Cytometry and Cell Sorting Core at Baylor College of Medicine with funding from the CPRIT Core Facility Support Award (CPRIT-RP240432), the NIH (CA125123 and OD036336) and the assistance of Joel M. Sederstrom. Address correspondence to : Andrea A. Hill McAlester, Department of Pathology and Immunology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Phone:1-713-798-1738. Email: [email protected] Competing interests The authors declare no competing interests Ethics declarations All experiments were performed in accordance with relevant guidelines and regulations. The Study protocols was approved by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center. References Quiros, M. et al. Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling. Journal of Clinical Investigation 127 , 3510–3520 (2017). Hill, A. A. et al. Acute high-fat diet impairs macrophage-supported intestinal damage resolution. Jci Insight 8 , e164489 (2023). Ruiz, D. F. Z. et al. Microbiota manipulation to increase macrophage IL-10 improves colitis and limits colitis-associated colorectal cancer. Gut Microbes 14 , 2119054 (2022). Longman, R. S. et al. CX₃CR1 + mononuclear phagocytes support colitis-associated innate lymphoid cell production of IL-22. Journal of Experimental Medicine 211 , 1571–1583 (2014). Wu, W.-J. H. et al. Interleukin-1β secretion induced by mucosa-associated gut commensal bacteria promotes intestinal barrier repair. Gut Microbes 14 , 2014772 (2022). Filardy, A. A. et al. Proinflammatory Clearance of Apoptotic Neutrophils Induces an IL-12lowIL-10high Regulatory Phenotype in Macrophages. J Immunol 185 , 2044–2050 (2010). Aden, K. et al. Epithelial IL-23R Signaling Licenses Protective IL-22 Responses in Intestinal Inflammation. Cell Rep. 16 , 2208–2218 (2016). Zheng, Y. et al. Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. Nature Medicine 14 , 282–289 (2008). Sewell, G. W. & Kaser, A. Interleukin-23 in the Pathogenesis of Inflammatory Bowel Disease and Implications for Therapeutic Intervention. J Crohn’s Colitis 16 , ii3–ii19 (2022). Grondin, J. A., Kwon, Y. H., Far, P. M., Haq, S. & Khan, W. I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning From Clinical and Experimental Studies. Front Immunol 11 , 2054 (2020). Bergstrom, K. S. B. et al. Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa. PLoS Pathogens 6 , e1000902 (2010). Sugimoto, K. et al. IL-22 ameliorates intestinal inflammation in a mouse model of ulcerative colitis. J. Clin. Investig. 118 , 534–544 (2008). Pickert, G. et al. STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. Journal of Experimental Medicine 206 , 1465–1472 (2009). Zenewicz, L. A. et al. Innate and Adaptive Interleukin-22 Protects Mice from Inflammatory Bowel Disease. Immunity 29 , 947–957 (2008). Brand, S. et al. IL-22 is increased in active Crohn’s disease and promotes proinflammatory gene expression and intestinal epithelial cell migration. Am. J. Physiol.-Gastrointest. Liver Physiol. 290 , G827–G838 (2006). Chen, Y., Zhang, J., Cui, W. & Silverstein, R. L. CD36, a signaling receptor and fatty acid transporter that regulates immune cell metabolism and fate. J Exp Med 219 , e20211314 (2022). Silverstein, R. L. & Febbraio, M. CD36, a Scavenger Receptor Involved in Immunity, Metabolism, Angiogenesis, and Behavior. Sci Signal 2 , re3 (2009). Zhao, L., Varghese, Z., Moorhead, J. F., Chen, Y. & Ruan, X. Z. CD36 and lipid metabolism in the evolution of atherosclerosis. Br. Méd. Bull. 126 , 101–112 (2018). Nozaki, S. et al. Reduced uptake of oxidized low density lipoproteins in monocyte-derived macrophages from CD36-deficient subjects. J. Clin. Investig. 96 , 1859–1865 (1995). Chawla, A. et al. PPARδ is a very low-density lipoprotein sensor in macrophages. Proc. Natl. Acad. Sci. 100 , 1268–1273 (2003). Chawla, A. et al. PPAR-γ dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat. Med. 7 , 48–52 (2001). Chawla, A. Control of Macrophage Activation and Function by PPARs. Circ. Res. 106 , 1559–1569 (2010). Palkar, P. S. et al. Cellular and Pharmacological Selectivity of the Peroxisome Proliferator-Activated Receptor-β/δ Antagonist GSK3787. Mol. Pharmacol. 78 , 419–430 (2010). Barish, G. D. et al. Bcl-6 and NF-κB cistromes mediate opposing regulation of the innate immune response. Genes Dev. 24 , 2760–2765 (2010). Lee, C.-H. et al. Transcriptional Repression of Atherogenic Inflammation: Modulation by PPARδ. Science 302 , 453–457 (2003). Mondal, A., Sawant, D. & Dent, A. L. Transcriptional Repressor BCL6 Controls Th17 Responses by Controlling Gene Expression in Both T Cells and Macrophages. J. Immunol. 184 , 4123–4132 (2010). Cerchietti, L. C. et al. A Small-Molecule Inhibitor of BCL6 Kills DLBCL Cells In Vitro and In Vivo. Cancer Cell 17 , 400–411 (2010). Lumeng, C. N., Bodzin, J. L. & Saltiel, A. R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117 , 175–184 (2007). Chan, K. L. et al. Palmitoleate Reverses High Fat-induced Proinflammatory Macrophage Polarization via AMP-activated Protein Kinase (AMPK)*. J Biol Chem 290 , 16979–16988 (2015). Hill, A. A. et al. Activation of NF-κB drives the enhanced survival of adipose tissue macrophages in an obesogenic environment. Mol Metab 4 , 665–677 (2015). Hill, A. A., Bolus, W. R. & Hasty, A. H. A decade of progress in adipose tissue macrophage biology. Immunol. Rev. 262 , 134–152 (2014). Davanso, M. R., Crisma, A. R., Murata, G., Newsholme, P. & Curi, R. Impact of Dietary Fatty Acids on Macrophage Lipid Metabolism, Signaling and Function. Immunometabolism 2 , (2020). Bojic, L. A. et al. Activation of Peroxisome Proliferator-Activated Receptor δ Inhibits Human Macrophage Foam Cell Formation and the Inflammatory Response Induced by Very Low-Density Lipoprotein. Arter., Thromb., Vasc. Biol. 32 , 2919–2928 (2018). Yan, J. & Horng, T. Lipid Metabolism in Regulation of Macrophage Functions. Trends Cell Biol. 30 , 979–989 (2020). Wang, X. et al. Interleukin-22 alleviates metabolic disorders and restores mucosal immunity in diabetes. Nature 514 , 237–241 (2015). Camell, C. & Smith, C. W. Dietary Oleic Acid Increases M2 Macrophages in the Mesenteric Adipose Tissue. PLoS ONE 8 , e75147 (2013). Santa-María, C. et al. Update on Anti-Inflammatory Molecular Mechanisms Induced by Oleic Acid. Nutrients 15 , 224 (2023). Karasawa, T. et al. Saturated Fatty Acids Undergo Intracellular Crystallization and Activate the NLRP3 Inflammasome in Macrophages. Arter., Thromb., Vasc. Biol. 38 , 744–756 (2018). Silva, P. S. A. de, Luben, R., Shrestha, S. S., Khaw, K. T. & Hart, A. R. Dietary arachidonic and oleic acid intake in ulcerative colitis etiology. Eur. J. Gastroenterol. Hepatol. 26 , 11–18 (2014). Ma, C., Vasu, R. & Zhang, H. The Role of Long‐Chain Fatty Acids in Inflammatory Bowel Disease. Mediat. Inflamm. 2019 , 8495913 (2019). Yan, D. et al. Fatty acids and lipid mediators in inflammatory bowel disease: from mechanism to treatment. Front. Immunol. 14 , 1286667 (2023). Wei, Y. et al. Dietary long-chain fatty acids promote colitis by regulating palmitoylation of STAT3 through CD36-mediated endocytosis. Cell Death Dis. 15 , 60 (2024). Kennedy, D. J. et al. A CD36-dependent pathway enhances macrophage and adipose tissue inflammation and impairs insulin signalling. Cardiovasc Res 89 , 604–613 (2011). Rahaman, S. O. et al. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 4 , 211–221 (2006). Cifarelli, V. et al. CD36 Deficiency Impairs the Small Intestinal Barrier and Induces Subclinical Inflammation in Mice. Cell Mol Gastroenterology Hepatology 3 , 82–98 (2017). Yang, Y. et al. Case Report: IL-21 and Bcl-6 Regulate the Proliferation and Secretion of Tfh and Tfr Cells in the Intestinal Germinal Center of Patients With Inflammatory Bowel Disease. Front. Pharmacol. 11 , 587445 (2021). Verstockt, B. et al. Distinct transcriptional signatures in purified circulating immune cells drive heterogeneity in disease location in IBD. BMJ Open Gastroenterol. 10 , e001003 (2023). Cao, S. et al. Mucosal Single-Cell Profiling of Crohn’s-Like Disease of the Pouch Reveals Unique Pathogenesis and Therapeutic Targets. Gastroenterology 167 , 1399-1414.e2 (2024). Kilkenny, C., Browne, W. J., Cuthill, I. C., Emerson, M. & Altman, D. G. Improving Bioscience Research Reporting: The ARRIVE Guidelines for Reporting Animal Research. PLoS Biol. 8 , e1000412 (2010). Kim, J. J., Shajib, M. S., Manocha, M. M. & Khan, W. I. Investigating Intestinal Inflammation in DSS-induced Model of IBD. J Vis Exp (2012) doi:10.3791/3678. Erben, U. et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Patho 7 , 4557–76 (2014). Langendijk, P. S. et al. Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples. Appl Environ Microb 61 , 3069–3075 (1995). Qiu, J. et al. The Aryl Hydrocarbon Receptor Regulates Gut Immunity through Modulation of Innate Lymphoid Cells. Immunity 36 , 92–104 (2012). Kim, M. et al. Critical Role for the Microbiota in CX3CR1+ Intestinal Mononuclear Phagocyte Regulation of Intestinal T Cell Responses. Immunity 49 , 151-163.e5 (2018). Diehl, G. E. et al. Microbiota restricts trafficking of bacteria to mesenteric lymph nodes by CX(3)CR1(hi) cells. Nature 494 , 116–120 (2013). Trouplin, V. et al. Bone Marrow-derived Macrophage Production. J Vis Exp e50966 (2013) doi:10.3791/50966. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9 , 676–682 (2012). Additional Declarations No competing interests reported. Supplementary Files SupplementaryMaterials.pdf Cite Share Download PDF Status: Published Journal Publication published 27 Jul, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 19 Jun, 2025 Reviews received at journal 19 Jun, 2025 Reviews received at journal 09 Jun, 2025 Reviewers agreed at journal 27 May, 2025 Reviewers agreed at journal 27 May, 2025 Reviewers invited by journal 27 May, 2025 Editor assigned by journal 27 May, 2025 Editor invited by journal 15 May, 2025 Submission checks completed at journal 15 May, 2025 First submitted to journal 29 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6557500","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":462622100,"identity":"f3342bc1-50a0-4f95-baf2-39bef3cbf518","order_by":0,"name":"Ashleigh M. Gil","email":"","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ashleigh","middleName":"M.","lastName":"Gil","suffix":""},{"id":462622101,"identity":"56ed7a1d-f5be-4e83-96b2-f865dce1433f","order_by":1,"name":"Daniel F. Zegarra-Ruiz","email":"","orcid":"","institution":"University of Virginia","correspondingAuthor":false,"prefix":"","firstName":"Daniel","middleName":"F.","lastName":"Zegarra-Ruiz","suffix":""},{"id":462622102,"identity":"71c214ce-6142-43f7-b368-4d11d2018204","order_by":2,"name":"Wan-Jung Wu","email":"","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wan-Jung","middleName":"","lastName":"Wu","suffix":""},{"id":462622103,"identity":"71246944-ee65-4d55-9c45-14fcb6d18ef4","order_by":3,"name":"Kendra Norwood","email":"","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kendra","middleName":"","lastName":"Norwood","suffix":""},{"id":462622104,"identity":"41ea547d-7d43-438c-b218-58d8c652783c","order_by":4,"name":"Adrien Assie","email":"","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Adrien","middleName":"","lastName":"Assie","suffix":""},{"id":462622105,"identity":"04b8812a-2159-4b8b-92a1-9c002ae78ebb","order_by":5,"name":"Buck S. Samuel","email":"","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Buck","middleName":"S.","lastName":"Samuel","suffix":""},{"id":462622106,"identity":"c0f865f7-2300-4fce-8c95-96dc223dd036","order_by":6,"name":"Angela M. Major","email":"","orcid":"","institution":"Texas Children’s Hospital","correspondingAuthor":false,"prefix":"","firstName":"Angela","middleName":"M.","lastName":"Major","suffix":""},{"id":462622107,"identity":"e366a1cb-9c02-401b-ba19-eba37161887e","order_by":7,"name":"Gretchen E. Diehl","email":"","orcid":"","institution":"Memorial Sloan Kettering Cancer Center","correspondingAuthor":false,"prefix":"","firstName":"Gretchen","middleName":"E.","lastName":"Diehl","suffix":""},{"id":462622108,"identity":"565a3c52-a1f2-4ff6-b075-aced246283ff","order_by":8,"name":"Andrea A. Hill McAlester","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuElEQVRIiWNgGAWjYHACxgMgkl8CzGEmTg9QiwGD5AyStRjcIFaLbvvhBwc+/PkjZ3y7+ekGhgrrxAZCWszOpBkcnNlmYGx255jZDYYz6URoucFgcJi3wSBx240cthuMbYeJ0cL+4fCfPwb1m2eAtPwjSguPwWEGNoMEAwmQlgZitJzJKTjY22ZsOAPkl4Rj6caEtRw/vvHBjz9y8vyzm5/d+FBjLUtQCypIIE35KBgFo2AUjAJcAADqg0YN5TsoaQAAAABJRU5ErkJggg==","orcid":"","institution":"Baylor College of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Andrea","middleName":"A. Hill","lastName":"McAlester","suffix":""}],"badges":[],"createdAt":"2025-04-29 14:38:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6557500/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6557500/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-12448-y","type":"published","date":"2025-07-27T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83605178,"identity":"f84b6245-4006-4de5-9369-3cfb847d8780","added_by":"auto","created_at":"2025-05-29 10:27:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":786155,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-23 and IL-22 responses are lost in HFD mice with unresolved intestinal damage.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC57BL/6 mice were fed LFD or HFD for one week. Mice were then left untreated or treated with 2% DSS in the drinking water for 5 days. (\u003cstrong\u003ea\u003c/strong\u003e) Body weight (n = 8 mice/group). The following panels are measurements in the cecum of mice in panel (\u003cstrong\u003ea\u003c/strong\u003e). (\u003cstrong\u003eb\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eRepresentative H\u0026amp;E staining and (\u003cstrong\u003ec\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eblinded colitis score on the indicated day before or post-DSS treatment (n = 8 mice/group). (\u003cstrong\u003ed\u003c/strong\u003e) Immunofluorescence staining for mucus (MUC2, green), bacteria (FISH, red), nuclei (Dapi, blue), and quantification of MUC2 (\u003cstrong\u003ee\u003c/strong\u003e) and bacterial distance from intestinal epithelial cells (\u003cstrong\u003ef\u003c/strong\u003e) in LFD and HFD mice on the indicated day before or post-DSS treatment (n = 4 mice/group). An average measurement of 4 high-powered field (HPF) images per mouse was used for image quantification. The scale bar equals 100 microns (50 microns for the inset). Relative cecal gene expression of (\u003cstrong\u003eg\u003c/strong\u003e) \u003cem\u003eIl23a \u003c/em\u003eand (\u003cstrong\u003eh\u003c/strong\u003e) \u003cem\u003eIl22 \u003c/em\u003ein non-DSS and DSS-treated (day 7) LFD and HFD mice (n = 4 LFD and HFD, n = 5 LFD D7 and n = 9 HFD D7 mice/group). Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;0.001, ***P\u0026lt;0.001, ****P\u0026lt;0.0001. Statistical comparisons were performed using One-way ANOVA with Uncorrected Fisher’s LSD multiple comparisons test; if not indicated, a comparison is not significant.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/bf94cfa7f7f2066e4fa0e38f.png"},{"id":83605180,"identity":"8b6d26ed-c264-4684-9294-e07772b1c188","added_by":"auto","created_at":"2025-05-29 10:27:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":389002,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIL-22 overexpression sufficiently attenuates unresolved intestinal damage in HFD mice.\u003c/strong\u003e (\u003cstrong\u003ea\u003c/strong\u003e) Body weight of HFD DSS mice with hydrodynamic delivery of control or IL-22 expressing plasmid (n = 5 control n = 8 IL-22 mice/group). The following panels are measurements in the cecum of mice in panel (\u003cstrong\u003ea\u003c/strong\u003e). (\u003cstrong\u003eb\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eRepresentative H\u0026amp;E staining and (\u003cstrong\u003ec\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eblinded colitis score on the indicated day before or post-DSS treatment (n = 5 mice/group). (\u003cstrong\u003ed\u003c/strong\u003e) Representative staining for and quantification of (\u003cstrong\u003ee\u003c/strong\u003e) MUC2 intensity and (\u003cstrong\u003ef\u003c/strong\u003e) bacterial encroachment (n = 4 mice/group). For all imaging, an average of 4 HPF images were taken per mouse. Relative cecal gene expression of (\u003cstrong\u003eg\u003c/strong\u003e)\u003cem\u003eIl23\u003c/em\u003e and (\u003cstrong\u003eh\u003c/strong\u003e) \u003cem\u003eIl22\u003c/em\u003e in non-DSS and DSS (day 7) treated LFD and HFD mice (n = 5 mice/group). Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001. Statistical comparisons were performed using Student's \u003cem\u003et\u003c/em\u003e test or One-way ANOVA with Tukey multiple comparisons test and if not indicated, a comparison is not significant. The scale bar equals 100 or 50 microns as indicated.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/42101657bb8d5cf0b94c9990.png"},{"id":83604668,"identity":"60bcccea-97da-4d04-92b5-04e7d551ad44","added_by":"auto","created_at":"2025-05-29 10:19:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":36226,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOleic acid impairs macrophage IL-23 response to intestinal damage and LPS. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) \u003cem\u003eIl23\u003c/em\u003e gene expression in flow-sorted macrophages from the cecum of LFD and HFD at day 7 post-DSS treatment (n = 4 mice/group). (\u003cstrong\u003eb\u003c/strong\u003e) \u003cem\u003eIl23\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003egene expression in BMDMs left un-treated (DMEM) or after treatment with oleic acid (400 μM), LPS (10ng/ml), or oleic acid/LPS (400mm, 10ng/ml) for 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown is two experiments). (\u003cstrong\u003ec\u003c/strong\u003e) \u003cem\u003eIl23\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e gene expression in BMDMs left un-treated (DMEM) or after treatment with palmitic acid (400 μM), LPS (10 ng/ml), or palmitic acid/LPS (400 μM / 10 ng/ml) for 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown is two experiments). Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;0.01 ***P\u0026lt;0.001, ****P\u0026lt;0.00001. Statistical comparisons were performed using Student's \u003cem\u003et\u003c/em\u003e test or One-way ANOVA multiple comparisons with Uncorrected Fisher’s LSD, and if not indicated, a comparison is not significant.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/fabcbd48bb0b698432326ceb.png"},{"id":83604670,"identity":"7e5c876a-6730-4527-8a0a-d879e1c612f2","added_by":"auto","created_at":"2025-05-29 10:19:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":206619,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCD36-mediated lipid uptake modulates macrophage antimicrobial response to intestinal damage and LPS. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) CD36 gene expression in the cecum of LFD or HFD mice before or at day 7 post-DSS treatment (n = 4 LFD and HFD, n = 5 LFD DSS and n = 9 HFD DSS mice/group). (\u003cstrong\u003eb\u003c/strong\u003e) CD36 gene expression (n = 6 mice per group) and (\u003cstrong\u003ec\u003c/strong\u003e) mean fluorescent intensity (MFI) of CD36 surface level expression in flow-sorted macrophages from the cecum of LFD and HFD mice at day 7 post-DSS treatment (n = 5 mice LFD and n = 4 mice HFD). (\u003cstrong\u003ed\u003c/strong\u003e) CD36 gene expression in non-treated, oleic acid, LPS, or oleic acid/LPS treated BMDMs at 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown represents two experiments). (\u003cstrong\u003ee\u003c/strong\u003e) CD36 gene expression in non-treated, palmitic acid, LPS, or palmitic acid/LPS treated BMDMs at 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown represents two experiments).\u003c/p\u003e\n\u003cp\u003eIF staining for and MFI quantification of CD36 (red) and neutral lipid staining BODIPY (green) in BMDMs exposed to the treatment conditions in (d) for (\u003cstrong\u003ef\u003c/strong\u003e) 4 or (\u003cstrong\u003eg\u003c/strong\u003e) 6 h (n = 3 experimental replicates and 2 experiments). For all imaging and quantification, an average of 10 HPF images were taken per sample.\u003cstrong\u003e \u003c/strong\u003e\u0026nbsp;Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001. Statistical comparisons were performed using One-way ANOVA multiple comparisons with Uncorrected Fisher’s LSD or Tukey’s multiple comparisons, or Student's \u003cem\u003et\u003c/em\u003e test and if not indicated, a comparison is not significant. The scale bar equals 100 microns as indicated.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/f64b58b37b572b9926a08478.png"},{"id":83604669,"identity":"eea2e346-e393-49e1-baf1-693ebf25986d","added_by":"auto","created_at":"2025-05-29 10:19:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":632170,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMacrophage-specific loss of CD36 restores reparative antimicrobial responses in HFD DSS mice. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Body weight (n = 8 MacCD36\u003csup\u003eWT\u003c/sup\u003e and n = 12 MacCD36\u003csup\u003eKO\u003c/sup\u003e), (\u003cstrong\u003eb\u003c/strong\u003e) representative H\u0026amp;E, and (\u003cstrong\u003ec\u003c/strong\u003e) blinded colitis scores of MacCD36\u003csup\u003eWT\u003c/sup\u003e and MacCD36\u003csup\u003eKO\u003c/sup\u003e HFD DSS-treated mice (day 9) (n = 6 mice/group). (\u003cstrong\u003ed\u003c/strong\u003e) Representative staining for and quantification of (\u003cstrong\u003ee\u003c/strong\u003e) MUC2 intensity and (\u003cstrong\u003ef\u003c/strong\u003e) bacterial encroachment (n = 6 mice/group). For all imaging, an average of 4 HPF images were taken per mouse. Relative cecal gene expression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eIl22\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e of mice in MacCD36\u003csup\u003eWT\u003c/sup\u003e and MacCD36\u003csup\u003eKO\u003c/sup\u003e HFD DSS-treated mice (day 9) (n =6 mice/group). Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001. Statistical comparisons were performed using Student's \u003cem\u003et\u003c/em\u003e test, and if not indicated, a comparison is not significant.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/5e0ffa5c9697536eaecc87be.png"},{"id":83605179,"identity":"cc02dc07-377f-45c3-b010-3c6ea1446095","added_by":"auto","created_at":"2025-05-29 10:27:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":168868,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDietary lipid activation of PPARd and BCL6 suppresses macrophage IL-23 response to LPS. \u003c/strong\u003e(\u003cstrong\u003ea\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eCecal gene expression\u003cstrong\u003e \u003c/strong\u003eof \u003cem\u003ePpard\u003c/em\u003e in LFD and HFD mice before and after (Day 7) DSS treatment.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eb\u003c/strong\u003e) Gene expression of \u003cem\u003ePpard\u003c/em\u003ein BMDMs left untreated or treated with oleic acid (400μM), LPS, or oleic acid/LPS (400 μM /10 ng/ml) at 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown represents two experiments). (\u003cstrong\u003ec\u003c/strong\u003e) Gene expression of \u003cem\u003ePpard\u003c/em\u003e in BMDMs left untreated or treated with palmitic acid (400 μM), LPS, or palmitic acid/LPS (400 μM / 10 ng/ml) at 2, 4, and 6 h (n = 3 experimental replicates/ treatment group, data shown represents two experiments). (\u003cstrong\u003ed\u003c/strong\u003e) Gene expression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e in BMDMs left untreated or treated with oleic acid, LPS, or oleic acid/LPS in the presence or absence of PPARd antagonist GSK-3787 (50 μM) for 4 h (n = 3 experimental replicates/ treatment group, data shown represents two experiments). (\u003cstrong\u003ee\u003c/strong\u003e) Representative images of nuclei (DAPI), BCL6 (red) in BMDMs (F480, green), and MFI quantification of nuclear and cytoplasmic BCL6 (n = 3 experimental replicates and 2 experiments). \u0026nbsp;(\u003cstrong\u003ef\u003c/strong\u003e) Gene expression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e in BMDMs left untreated or treated with oleic acid, LPS, or oleic acid/LPS in the presence or absence of BCL6 antagonist 79-6 (50 μM) for 4 6h (n = 3 experimental replicates/ treatment group, data shown represents two experiments). Data are presented as mean ± SEM. *P\u0026lt;0.05, **P\u0026lt;.01, ***P\u0026lt;.001, ****P\u0026lt;.0001. Statistical comparisons were performed using One-way ANOVA with Bonferroni or Uncorrected Fisher’s LSD multiple comparisons, and if not indicated, a comparison is not significant.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/cfcff951a559f885b6201629.png"},{"id":87756917,"identity":"3528436b-08f0-4331-a760-8c37760df672","added_by":"auto","created_at":"2025-07-28 16:10:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3489236,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/b2a82672-6916-489e-9a1e-6ed57bb7193e.pdf"},{"id":83604673,"identity":"c76cfae4-16be-4451-adea-98eefded028c","added_by":"auto","created_at":"2025-05-29 10:19:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":617438,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6557500/v1/215916b9ebc760f4df04ed01.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dietary lipids induce PPARd and BCL6 to repress macrophage IL-23 induction after intestinal injury and LPS exposure","fulltext":[{"header":"Introduction","content":"\u003cp\u003eExcess consumption of diets high in animal fat causes intestinal mucosal barrier dysfunction and is associated with an increased risk for the development and pathogenesis of inflammatory bowel disease (IBD). However, how animal fat-rich diets drive risk for IBD development and contribute to IBD pathogenesis is incompletely understood. Most evidence highlights that animal-sourced high-fat diets (HFDs) drive IBD progression by inducing changes in microbial composition and epithelial damage that elicit tissue-damaging immune responses. However, little is known about the direct effects of the diet on immune functions that may influence IBD pathogenesis.\u003c/p\u003e \u003cp\u003eDisease progression in IBD can be partly attributed to inefficient repair of the damaged intestinal barrier. Repair after intestinal injury heavily relies on intestinal immune cell production of antimicrobial and reparative cytokines \u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Macrophages are among the first immune cells to respond to damaged tissue sites, including the intestine. Macrophage recognition of damage signals, including microbial products, and appropriate corresponding cytokine responses are critical to repairing the damaged intestinal epithelial barrier \u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Loss of the appropriate macrophage cytokine responses to intestinal damage can result in defective tissue repair \u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Highlighting the influence of diet on immune cell function in intestinal repair, we previously demonstrated that lipids found in the HFD directly impair macrophage clearance of apoptotic neutrophils, a key inducer of macrophage IL-10 production needed to support repair \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. While this study links diet with defective macrophage tissue repair functions, we did not address if HFD exposure impacted additional macrophage reparative functions, further limiting intestinal damage repair.\u003c/p\u003e \u003cp\u003eMicrobial breach of the intestinal epithelium is a key damage signal that induces macrophage antimicrobial and barrier repair cytokine responses. Among these responses is macrophage production of IL-23, which induces IL-22 production by T cells and innate lymphoid cells to support microbial clearance and epithelial wound closure \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Alterations of the IL-23/IL-22 pathways are associated with IBD pathogenesis \u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Additional microbial-induced macrophage cytokines, TNF and IL-10, play a key role in microbial clearance and barrier repair, and dysregulation of these signals is also associated with intestinal damage and IBD pathogenesis. It is unclear whether the diet directly influences macrophage production of antimicrobial reparative cytokine responses during intestinal injury and the resulting impact on intestinal healing.\u003c/p\u003e \u003cp\u003eIn this study, we used acute HFD feeding in a dextran sodium sulfate (DSS) mouse model of colitis in combination with in vitro lipid treatment assays in bone-marrow-derived macrophage (BMDM) cultures to define the direct impact of dietary lipids on macrophage antimicrobial cytokine responses needed to support intestinal damage repair. We show that macrophage \u003cem\u003eIl23a\u003c/em\u003e and downstream induction of \u003cem\u003eIl22\u003c/em\u003e are lost in the cecum of HFD-fed mice with intestinal injury induced by DSS treatment. Using in vitro studies, we identified that the unsaturated dietary lipid oleic acid, the primary lipid in the HFD, suppressed macrophage expression and production of \u003cem\u003eIl23a\u003c/em\u003e in response to LPS. This effect also extended to LPS-induced cytokines \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e. In vitro, lipid and LPS treatment revealed that intracellular accumulation of oleic acid and increased expression of the lipid receptor and transporter CD36 in macrophages corresponded with decreased \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e responses to LPS. We further find that macrophage-specific deletion of CD36 attenuated intestinal injury and restored \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eIl22\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e responses in HFD-fed DSS-treated mice. Analysis of pathways downstream of CD36-mediated lipid transport revealed a role for an intracellular lipid sensor/transcriptional repressor complex formed by PPARd and BCL6 in inhibiting macrophage cytokine production. In vitro inhibition of PPARd or BCL6 restored \u003cem\u003eIl23a\u003c/em\u003e, but not \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e, expression in oleic acid and LPS-treated macrophages, highlighting oleic acid in contrast palmitic acid had no impact on macrophage \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e response to LPS, demonstrating lipid-specific influences on macrophage responses to microbial signals. Collectively, our studies reveal that, during HFD feeding, lipid accrual in macrophages leads to loss of the IL-23-IL-22 response after intestinal damage due to induction of the PPARd/BCL6 transcriptional repressive complex, supporting defective intestinal damage repair.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal IL-23 and IL-22 reparative responses are lost in HFD-fed DSS-treated mice\u003c/h2\u003e \u003cp\u003eTo assess the influence of HFD feeding on antimicrobial responses after intestinal damage, we used our previous model of feeding male C57BL/6 mice with a 10% low-fat diet (LFD) or 60% high-fat diet (HFD) for one week followed by treatment with 2% DSS in the drinking water for 5 days to induce intestinal injury\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Mice placed on LFD or HFD alone had equivalent weight gain (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). After 5 days of DSS exposure, LFD and HFD mice showed similar decreases in body weight and comparable intestinal damage as measured by colitis score (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb,c). On day 9, four days post-DSS treatment, improved body weight and resolution of intestinal damage were seen in LFD-fed DSS-treated mice (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb,c). However, HFD-feeding in mice exposed to DSS resulted in continued body weight loss and sustained intestinal pathology after DSS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb,c). In agreement with our previous findings, these defects were localized to the cecum and recapitulated our prior observations of HFD-induced defects in intestinal damage repair \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe previously reported that intestinal healing defects in HFD fed DSS treated mice were associated with decreased mucus production and increased intestinal microbial-epithelial interactions \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. By IF staining for the mucus protein mucin 2 (MUC2) and fluorescence in situ hybridization (FISH) to detect microbe-epithelial interactions, we found comparable mucus production and bacterial distance from the intestinal epithelium with both diets alone on day 0 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f). Equivalent disruption of the mucus layer was seen in both diet groups on day 5 of DSS treatment, corresponding with similarly increased bacteria-epithelial interactions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f). In contrast, on day 9 after DSS treatment, we found decreased mucus and increased microbial-intestinal epithelial interactions in HFD compared to LFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f), recapitulating our previous findings \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGoblet cell mucus production is critical in preventing bacterial-intestinal epithelial cell (IEC) interactions, which further elicit tissue-damaging immune responses and impede damage resolution \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Macrophage production of the cytokine IL-23 induces T cell and ILC production of the cytokine IL-22, which induces goblet cell proliferation and mucus secretion\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. We used qPCR to determine whether \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e were normally induced in the cecum of LFD and HFD-fed control and DSS-treated mice. We saw no difference in \u003cem\u003eIl23a\u003c/em\u003e or \u003cem\u003eIl22\u003c/em\u003e expression between HFD and LFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg,h). After DSS treatment, cecal \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e expression were significantly induced in LFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg,h). However, \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e responses were severely blunted in DSS-treated HFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg,h). There were no significant differences in the cecal expression of the \u003cem\u003eIl12a\u003c/em\u003e subunit of IL-12 or the \u003cem\u003eIl12b\u003c/em\u003e subunit of IL-23 in LFD and HFD-fed mice after DSS treatment (\u003cb\u003eSupplementary Fig.\u0026nbsp;1a,b\u003c/b\u003e). These findings suggest that a blunted IL-23 and IL-22 response contributed to decreased mucus production and increased bacterial-epithelial interactions in HFD-fed DSS-treated mice.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIL-22 overexpression ameliorates intestinal damage repair defects in HFD DSS mice\u003c/h3\u003e\n\u003cp\u003eIL-22 supports mucosal healing by inducing IEC migration needed for wound closure and antimicrobial mucus production \u003csup\u003e\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. We next determined whether overexpression of IL-22 during the injury recovery phase after DSS treatment could attenuate the repair defects seen in HFD-fed DSS-treated mice. Using a hydrodynamic delivery method, mice were administered a control or IL-22 overexpression plasmid. Overexpression of IL-22 protected HFD mice from increased body weight change and intestinal pathology compared to a control plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c). These effects corresponded with increased mucus production and decreased association of microbes with the intestinal epithelium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed-f). While we saw increased cecal \u003cem\u003eIl23a\u003c/em\u003e expression in HFD-fed DSS-treated mice in response to IL-22 overexpression, we did not see restoration of cecal \u003cem\u003eIl22\u003c/em\u003e production (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg,h). \u003cem\u003eIl12p40\u003c/em\u003e expression also remained similar between groups, whereas \u003cem\u003eIl12p35\u003c/em\u003e expression increased (\u003cb\u003eSupplementary Fig.\u0026nbsp;2a,b\u003c/b\u003e). Taken together, these data suggest that reduced IL-22 induction in HFD-fed DSS-treated mice contributed to the loss of intestinal mucus production and defective intestinal damage repair.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eDietary lipids suppress macrophage IL-23 response to intestinal damage and LPS\u003c/h3\u003e\n\u003cp\u003eWithin the intestine, macrophages serve as one source of IL-23 that drives IL-22 production by innate lymphoid cells and T cells \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. We sorted cecal macrophages from mice fed HFD or LFD and treated with DSS as above, and measured \u003cem\u003eIl23a\u003c/em\u003e gene expression by qPCR. We found significantly reduced \u003cem\u003eIl23a\u003c/em\u003e expression in cecal macrophages from HFD compared to LFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). This data paralleled the decreased cecal \u003cem\u003eIl23a\u003c/em\u003e expression we found in HFD-fed mice above (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eDietary lipids are well-known for their direct impact on macrophage function in diet-associated diseases such as obesity and atherosclerosis \u003csup\u003e\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. We previously demonstrated that the unsaturated lipid oleic acid, comprising 50% of the HFD, impaired macrophage tissue repair functions such as clearance of apoptotic neutrophils, demonstrating this effect as contributing to defective healing of intestinal damage in HFD-fed mice \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. We postulated that the oleic acid could also directly influence macrophage IL-23 responses to microbes or microbial signals encountered during intestinal injury.\u003c/p\u003e \u003cp\u003eTo investigate this question, we assessed \u003cem\u003eIl23a\u003c/em\u003e gene expression in bone-marrow-derived macrophages (BMDMs) left untreated, treated with oleic acid alone, LPS alone, or co-treated with oleic acid and LPS for 2, 4, and 6 h. \u003cem\u003eIl23a\u003c/em\u003e was not expressed in untreated or oleic acid singly treated BMDMs throughout the time course (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). A robust induction of \u003cem\u003eIl23a\u003c/em\u003e was seen in BMDMs exposed to LPS following 2, 4, and 6 h of treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). \u003cem\u003eIl23a\u003c/em\u003e expression was severely blunted in oleic acid and LPS co-treated cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Oleic acid co-exposure had similar repressive effects on \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Dose-dependent effects of oleic acid demonstrated that the suppresses effects on \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e were concentration dependent (\u003cb\u003eSupplementary Fig.\u0026nbsp;3a-d\u003c/b\u003e). When performing similar assays using the saturated lipid palmitic acid, which comprises\u0026thinsp;~\u0026thinsp;49% of the lipids in the HFD, we found that palmitic acid alone did not induce \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e expression in BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Co-treatment with palmitic acid and LPS resulted in reduced expression of \u003cem\u003eTnf\u003c/em\u003e at all time points, and \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e expression were reduced at 6 h post-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Suppressive effects of palmitic acid on LPS-induced TNF were concentration dependent (\u003cb\u003eSupplementary Fig.\u0026nbsp;4a-d\u003c/b\u003e). These findings demonstrate that lipids in the HFD alter macrophage cytokine expression in response to microbial stimuli and suggest lipid-specific regulation of LPS-induced macrophage expression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e.\u003c/p\u003e\n\u003ch3\u003eMacrophage CD36 modulates intestinal repair responses\u003c/h3\u003e\n\u003cp\u003eMacrophage uptake of lipids through the scavenger receptor CD36 is associated with altered macrophage functions and disease pathogenesis in obesity and atherosclerosis \u003csup\u003e\u003cspan additionalcitationids=\"CR17 CR18\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. We observed that diet alone did not alter CD36 expression in the cecum (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). After DSS treatment, CD36 expression increased in the cecum of LFD-fed mice but remained low in the cecum of HFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). We also found lower gene and surface level protein expression of CD36 in sorted cecal macrophages from HFD compared to LFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb,c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUsing our in vitro lipid and LPS time course assay, we evaluated whether dietary lipid influences on BMDM \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e expression corresponded with changes in CD36 expression. Untreated or LPS-alone exposed BMDMs displayed similar levels of CD36 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Oleic acid exposure alone or with LPS markedly increased CD36 expression at 2 and 4 h, with expression decreasing at 6 h in the oleic acid and LPS co-treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Palmitic acid treatment alone or in the presence of LPS resulted in decreased CD36 expression at 6 h post-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). We next asked how intracellular lipid accumulation corresponded to CD36 expression. We used immunofluorescence to measure the accumulation of the neutral lipid dye BODIPY alongside CD36 expression in oleic acid and oleic acid LPS co-treated BMDMs. At 4h post-treatment, we found accumulation of BODIPY along with increased BMDM expression of CD36 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef). In contrast, at 6 h post-treatment, while we still saw BODIPY accumulation, CD36 expression had decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eg). These findings suggest a potential link between CD36-mediated macrophage uptake of lipids and lost macrophage cytokine responses to microbial signals.\u003c/p\u003e\n\u003ch3\u003eMacrophage-specific deletion of CD36 restores the IL-23-IL-22 response in HFD DSS mice\u003c/h3\u003e\n\u003cp\u003eWe next investigated the role of CD36 in modulating macrophage IL-23-IL-22 responses in HFD mice with intestinal injury. We used HFD feeding and DSS exposure in control (MacCD36\u003csup\u003eWT\u003c/sup\u003e) mice and mice with macrophage-specific deletion of CD36 (MacCD36\u003csup\u003eKO\u003c/sup\u003e) induced by Tamoxifen administration. HFD-fed MacCD36\u003csup\u003eKO\u003c/sup\u003e mice showed improved body weight change and decreased histopathology compared to WT after DSS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c). Improved outcomes corresponded with increased MUC2 levels and decreased bacterial-epithelial interactions in the cecum of HFD MacCD36\u003csup\u003eKO\u003c/sup\u003e mice compared to MacCD36\u003csup\u003eWT\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-f). We next examined cecal \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e expression and found increased gene expression of \u003cem\u003eIl23\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e in HFD-fed MacCD36\u003csup\u003eKO\u003c/sup\u003e compared to WT mice after DSS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg). Furthermore, HFD-fed MacCD36\u003csup\u003eKO\u003c/sup\u003e DSS-treated mice displayed significantly increased gene expression of \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg). These results demonstrated that loss of macrophage CD36 preserves antimicrobial responses to intestinal injury in HFD-fed mice and protects against intestinal damage repair defects seen after HFD feeding.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe PPARd and BCL6 transcriptional repressor complex governs oleic-acid repression of macrophage IL-23 responses to LPS\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe above findings suggest that diminished IL-23-IL-22 responses in HFD DSS mice could result from CD36-mediated macrophage uptake of lipids. CD36 lipid transport and signaling transduction functions, including cytokine production, influence macrophage functions. Next, we sought to identify potential downstream modulators of CD36-mediated oleic acid-induced suppression of macrophage IL-23 and IL-22 responses to intestinal damage in HFD DSS mice. We began our assessment with the intracellular lipid-responsive transcriptional and lipid metabolism regulators, peroxisome proliferator-activator receptors, PPARg and PPARd \u003csup\u003e\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. PPARg and PPARd can transcriptionally regulate a specific subset of macrophage cytokine responses to microbial stimuli such as LPS \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. We postulated that PPAR activity downstream of CD36-mediated oleic acid accumulation in macrophages modulated the IL-23 response to LPS.\u003c/p\u003e \u003cp\u003eFirst, we assessed cecal expression of \u003cem\u003ePparg\u003c/em\u003e and \u003cem\u003ePpard\u003c/em\u003e in LFD-fed and HFD-fed mice before and after DSS exposure. Before DSS treatment, cecal \u003cem\u003ePparg\u003c/em\u003e and \u003cem\u003ePpard\u003c/em\u003e expression were similar between both diet groups (\u003cb\u003eSupplementary Fig.\u0026nbsp;5a and\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea). In response to DSS treatment, \u003cem\u003ePparg\u003c/em\u003e expression was slightly increased but to similar levels in both diet groups (\u003cb\u003eSupplementary Fig.\u0026nbsp;5a\u003c/b\u003e). Interestingly, the expression of \u003cem\u003ePpard\u003c/em\u003e was significantly induced in HFD-fed compared to LFD-fed mice in response to DSS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea), corresponding with decreased cecal \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003e in HFD-fed mice in response to DSS treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg,h).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese above results led us to investigate whether the transcriptional response of \u003cem\u003ePparg\u003c/em\u003e and \u003cem\u003ePpard\u003c/em\u003e in BMDMs exposed to lipids and LPS paralleled changes in cecal \u003cem\u003ePparg\u003c/em\u003e and \u003cem\u003ePpard\u003c/em\u003e in HFD-fed mice exposed to DSS. In our lipid and LPS time course assay, after 2 h of exposure, BMDM \u003cem\u003ePparg\u003c/em\u003e expression slightly increased in oleic acid alone, LPS, and oleic acid/LPS treated groups compared to no treatment but was similarly expressed in all groups at 4 and 6 h post-treatment (\u003cb\u003eSupplementary Fig.\u0026nbsp;5b\u003c/b\u003e). When using palmitic acid as the dietary lipid source in these assays, no significant difference in \u003cem\u003ePparg\u003c/em\u003e expression was observed throughout the time course (\u003cb\u003eSupplementary Fig.\u0026nbsp;5c\u003c/b\u003e). In contrast to \u003cem\u003ePparg\u003c/em\u003e, oleic acid treatment alone or with LPS enhanced \u003cem\u003ePpard\u003c/em\u003e gene expression in BMDMs at 2 and 4 h compared to no treatment or LPS-alone treatment, with only oleic-alone treatment remaining significant 6 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb). These oleic acid-induced changes in \u003cem\u003ePpard\u003c/em\u003e expression nicely corresponded with increased cecal \u003cem\u003ePpard\u003c/em\u003e expression in HFD-fed DSS treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea) and decreased expression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e in oleic acid/LPS-treated BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). \u003cem\u003ePpard\u003c/em\u003e expression was not influenced by palmitic acid treatments (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eAs lipid effects on BMDM \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e response to LPS were concentration-dependent, we next assessed the dose-dependent responses of \u003cem\u003ePpard\u003c/em\u003e and \u003cem\u003ePparg\u003c/em\u003e in BMDMs treated with oleic and palmitic acid at 4 h. Oleic acid concentrations of 100 \u0026micro;M or 200 \u0026micro;M had no or a mild impact on \u003cem\u003ePpard\u003c/em\u003e and \u003cem\u003ePparg\u003c/em\u003e gene expression (\u003cb\u003eSupplementary Fig.\u0026nbsp;6a,b\u003c/b\u003e). At 300 \u0026micro;M and 400 \u0026micro;M, oleic acid alone or with LPS significantly increased \u003cem\u003ePpard\u003c/em\u003e gene expression compared to no treatment or LPS treatment alone, but had no impact on \u003cem\u003ePparg\u003c/em\u003e gene expression (\u003cb\u003eSupplementary Fig.\u0026nbsp;6c,d\u003c/b\u003e). Palmitic acid slightly decreased \u003cem\u003ePpard\u003c/em\u003e expression at 100 \u0026micro;M in the presence of LPS but did not influence \u003cem\u003ePparg\u003c/em\u003e expression at any concentration or \u003cem\u003ePpard\u003c/em\u003e expression at 200 \u0026micro;M and above (\u003cb\u003eSupplementary Fig.\u0026nbsp;7a,d\u003c/b\u003e). Collectively, these findings demonstrated that \u003cem\u003ePpard\u003c/em\u003e induction by high concentrations of oleic acid corresponded with oleic acid inhibition of BMDM \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e response to LPS.\u003c/p\u003e \u003cp\u003eTo gain insight into whether oleic acid induction of \u003cem\u003ePpard\u003c/em\u003e translated to PPARd repression of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e in BMDMs in response to LPS, we co-exposed lipid and LPS-treated BMDMs with or without the potent irreversible small molecule PPARd inhibitor GSK-3787 \u003csup\u003e23\u003c/sup\u003e. As expected, oleic acid suppressed LPS-induced \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e gene expression levels compared to LPS treatment alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed). Interestingly, inhibition of PPARd restored BMDM \u003cem\u003eIl23a\u003c/em\u003e expression response to LPS but not expression of \u003cem\u003eTnf\u003c/em\u003e or \u003cem\u003eIl10\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed). These data demonstrate that PPARd governs oleic acid repression of macrophage \u003cem\u003eIl23a\u003c/em\u003e expression response to microbial signals in vitro and suggest an alternate regulatory mechanism modulates oleic acid suppression of \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e in macrophages. Furthermore, these data imply that increased PPARd activity in macrophages could contribute to the loss of IL-23 and IL-22 signaling in HFD mice with intestinal damage.\u003c/p\u003e \u003cp\u003ePPARd influences on macrophage cytokine responses can be mediated by the transcriptional repressor B cell lymphoma 6 (BCL6) \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. Liganded PPARd releases BCL6 to repress NFkB target genes \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, such as IL-23 \u003csup\u003e26\u003c/sup\u003e. We first used immunofluorescence staining to assess BCL6 expression levels in non-treated, oleic acid alone, LPS alone, or oleic acid and LPS co-exposed BMDMs. BCL6 expression levels assessed by mean fluorescence intensity (MFI) demonstrated that oleic acid treatment alone or with LPS significantly increased BCL6 protein levels in BMDMs compared to no treatment or LPS (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee). To determine the contribution of BCL6 in oleic acid repression of macrophage cytokine response to LPS, we co-exposed untreated, oleic acid alone, LPS alone, or oleic acid/LPS-treated BMDMs with the BCL6 small molecule inhibitor 79\u0026thinsp;\u0026minus;\u0026thinsp;6 \u003csup\u003e27\u003c/sup\u003e. As with antagonism of PPARd, inhibition of BCL6 restored macrophage \u003cem\u003eIl23a\u003c/em\u003e, but not \u003cem\u003eTnf\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e, response to LPS (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef). These findings demonstrate that oleic acid modulation of BCL6 activity through PPARd represses macrophage IL-23 response to LPS and highlight direct lipid-specific regulation of macrophage antimicrobial IL-23 response.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eHigh animal fat diets are a risk factor for IBD, and the excessive lipid content of the HFD is well-known to directly alter immune functions to support the development or pathogenesis of diet-associated diseases such as obesity and atherosclerosis \u003csup\u003e\u003cspan additionalcitationids=\"CR29 CR30 CR31 CR32 CR33\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Yet, whether the direct influences of HFD lipids on intestinal immune reparative functions also contribute to the pathogenesis of IBD is less understood. Our findings provide evidence that direct effects of HFD lipids on macrophage antimicrobial and tissue reparative functions support defects in intestinal damage repair, which could further exacerbate IBD pathogenesis. Previous reports demonstrate a link between HFD-induced and genetic obesity and the loss of the IL-23-IL-22 responses in an infectious model of colitis using \u003cem\u003eCitrobacter rodentium\u003c/em\u003e infection in mice\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. In these studies, obese mice were unable to clear \u003cem\u003eCitrobacter\u003c/em\u003e infection, where pathogen clearance is dependent on IL-23 and IL-22 signaling, and sustained more intestinal damage. As with our studies, administration of IL-22 resolved intestinal damage after epithelial damage and pathogen infection. Although not investigated in these studies, the lack of IL-22 responses to \u003cem\u003eCitrobacter\u003c/em\u003e infection in the context of HFD-induced obesity was suggested to be due to the loss of dendritic cell IL-23. Our findings show that reduced macrophage IL-23 response to intestinal injury after HFD feeding also underlies unresolved damage in mice with intestinal injury. These previously published findings and our current study highlight how dietary fats govern critical innate immune responses, notably IL-23 and IL-22 responses, to intestinal injury or pathogen infection and dictate the host\u0026rsquo;s ability to resolve intestinal injury. Identification of additional macrophage reparative functions modulated by the lipids could further increase our understanding of the connection between HFD consumption and IBD risk.\u003c/p\u003e \u003cp\u003eOur ex vivo and in vitro studies provide evidence that specific lipids in the HFD directly repress macrophage antimicrobial and reparative cytokine responses to intestinal damage. Our findings reveal that the intracellular presence of the dietary lipid oleic acid in BMDMs drove repressed \u003cem\u003eIl23a, Tnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e responses to LPS, mirroring our in vivo findings. Oleic acid, an unsaturated fatty acid, produces an anti-inflammatory phenotype in macrophages \u003csup\u003e\u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. In general, the anti-inflammatory effects of oleic acid are suggested to benefit some aspects of IBD, such as dampening inflammatory responses \u003csup\u003e\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e. However, our studies indicate that although oleic acid may have beneficial anti-inflammatory effects, these same responses interfere with protective functions, like IL-23 production, downstream of microbial signals needed to support the healing of the intestinal epithelial lining, which may further exacerbate intestinal damage. Interestingly, the saturated lipid palmitic acid, which is associated with an inflammatory macrophage phenotype and IBD \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, only directly influenced macrophage \u003cem\u003eTnf\u003c/em\u003e responses to LPS and not cytokines such as \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl10\u003c/em\u003e that influence repair. As dietary fat association with altered IBD risk is complex, continued study is needed to understand how dietary lipid components influence various intestinal cell types, intestinal repair process, damage, and inflammation in the gut. Specific to our studies, future use of single-source lipid-enriched diets compared to complex combinations of lipids is needed to understand the complex influence of specific lipid components and combinations of lipids on macrophage antimicrobial reparative responses in IBD.\u003c/p\u003e \u003cp\u003eCD36 modulation of the intracellular lipid content in macrophages directly influences the pathogenesis of atherosclerosis and obesity \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e,\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e,\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. Our in vivo studies suggest that macrophage CD36 similarly contributes to the pathogenesis of IBD by facilitating the transport and accumulation of diet-derived lipids in macrophages, altering macrophage responses to microbial signals. The restoration of \u003cem\u003eIl23a\u003c/em\u003e, \u003cem\u003eIl22\u003c/em\u003e, \u003cem\u003eTnf\u003c/em\u003e, and \u003cem\u003eIl10\u003c/em\u003e we see in mice with macrophage-specific CD36 deletion suggests that CD36-mediated lipid transport and signaling transduction play critical roles in intestinal immune microbial defense and repair response. In the intestine, there is evidence that CD36 plays a role in intestinal barrier function, as global loss of CD36 in mice impairs the small intestinal barrier and induces subclinical inflammation under normal dietary conditions \u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. More recent studies demonstrate a role for CD36-mediated transport of long-chain fatty acids by intestinal epithelial cells in driving colonic inflammation \u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Collectively, these findings highlight the important role of CD36 in modulating inflammatory and repair responses in the intestine. How CD36 influences the function of various intestinal cell types and the impact on intestinal disease pathogenesis should be further studied.\u003c/p\u003e \u003cp\u003ePPARd serves as an intracellular lipid sensor that modulates lipid-induced inflammatory responses in macrophages \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Our in vitro studies reveal that increased macrophage PPARd activity induced by intracellular oleic acid accumulation precludes LPS-induced macrophage production of IL-23. Limiting PPARd activity attenuated the loss of macrophage IL-23 response to LPS. This phenotype mirrored our in vivo findings of lost cecal macrophage IL-23, suggesting that excessive PPARd activity drives lost macrophage reparative antimicrobial responses and perpetuated defects in intestinal healing. PPARd effects on macrophage inflammatory response are mediated through the transcriptional repressor BCL6 \u003csup\u003e24\u003c/sup\u003e. Lipid-liganded PPARd releases BCL6 to repress many NFkB target genes \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. With relevance to the antimicrobial response needed to promote intestinal damage, BCL6 deficiency in macrophages increases LPS-induced IL-23 production and IL-22 production from TH17 cells \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Our studies show that BCL6 transcriptional repressive activities downstream of lipid activation of PPARd suppress macrophage IL-23 induction after LPS treatment. Targeting BCL6 in T cells is suggested as a potential druggable target for IBD due to increased BCL6 expression in this population correlating with IBD pathogenesis and specific IBD subtypes \u003csup\u003e\u003cspan additionalcitationids=\"CR47\" citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Our studies suggest that modulation of macrophage BCL6 may be beneficial to improve intestinal immune damage repair responses. More in-depth studies will help define the role of BCL6 in modulating intestinal healing. Developing strategies to regulate the PPARd and BCL6 activity to promote the reparative effects of IL-23 and IL-22 may be a novel treatment strategy for restoring barrier integrity and slow diet-driven IBD occurrence and progression.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eExperimental Animals\u003c/h2\u003e\n \u003cp\u003eAll animal experiments were performed with approved protocols by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center. All animal research reported in this paper is in accordance with ARRIVE guidelines \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e. Animals used in this study were C57BL/6J (JAX #000664), CX\u003csub\u003e3\u003c/sub\u003eCR1\u003csup\u003e+\u003c/sup\u003e GFP/+ (JAX # 005582), CX\u003csub\u003e3\u003c/sub\u003eCR1-CreERT2 (JAX# 021160), and CD36flox tm1.1Ijg/J (JAX # 032276) purchased from Jackson Labs. Littermate controls were used for each experiment and mice were randomly assigned to experimental groups. Animals were housed under standard specific pathogen-free (SPF) conditions at Baylor College of Medicine or Memorial Sloan Kettering Cancer Center animal facility. All lines were backcrossed for at least 12 generations to the C57BL/6J background. To generate MacCD36\u003csup\u003eko\u003c/sup\u003e mice, CD36\u003csup\u003efl/fl\u003c/sup\u003e mice were crossed with CX\u003csub\u003e3\u003c/sub\u003eCR1-CreERT2, and mice (CX\u003csub\u003e3\u003c/sub\u003eCR1CreERT2 and control) were injected i.p. with 0.2mg with (Z)-4- Hydroxytamoxifen, 98% Z isomer (4OHT, Sigma) every 3 days starting on Day 0 of DSS treatments. Tamoxifen was resuspended to 20mg/ml in ETOH with heating to 37\u0026deg;C. 4OHT was diluted to 0.2mg in a 100ul corn oil (Sigma). At least 4 mice per group between 6 and 8 weeks of age were used for all mouse experiments. Multiple combined experiments were used to assess statistical significance.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eAcute diet feeding and intestinal injury\u003c/h2\u003e\n \u003cp\u003eMice were fed 10% kcal low fat diet (LFD) (Research Diets, D12450B) or 60% kcal high-fat diet (HFD) (Research Diets, D12492) ad libitium for one week prior to treatment with 2% Dextran sodium sulfate (DSS, ThermoFisher, AAJ1448922) in drinking water for 5 days followed by plain drinking water.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eHistology\u003c/h2\u003e\n \u003cp\u003eMouse cecums were fixed in Carnoy\u0026rsquo;s fixation for 1\u0026ndash;2 days before being placed in methanol prior to paraffin embedding. Samples were deparaffinized, cut into 4\u0026micro;M sections, and stained with hematoxylin. Images were taken with a Nikon Ti Eclipse microscope. Sections from 4\u0026ndash;6 mice were used for blinded colitis scoring according to established criteria \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e and as previously described \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunofluorescence tissue staining\u003c/h2\u003e\n \u003cp\u003eBefore antibody IF staining, Fluorescence In Situ Hybridization (FISH) staining was performed prior to immunofluorescence staining as described in\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e using the following UNI519 universal primer-probe sequence: /5Alex594N/GTATTACCGCGGCTGCTG (Integrated DNA Technologies (IDT). Sections were washed 1x with PBS and 1x with MilliQ water. Sections were permeabilized, blocked, and stained overnight at 4\u0026deg;C with the following primary antibodies at a 1:100 dilution: MUC2 (polyclonal, Cloud Clone Cat# PAA705Mu02). After 2X wash with 1x TBST and 1X wash with 1x PBS, sections were stained with a 1:200 dilution of the secondary antibody anti-rabbit Alexa 488 (Cell signaling Cat# 4412) for 1 h. Sections were washed 1X with 1x PBS and stained with DAPI (Sigma Aldrich Cat# D9542) and mounted using Aqua Mount (Polysciences Cat# 18606-100) anti-fade mounting media and coverslipped. Images were taken on Nikon Ti Eclipse microscope using 20x and 40x objectives, and images were processed using FIJI.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eQuantification of immunofluorescence staining\u003c/h2\u003e\n \u003cp\u003e\u003cstrong\u003eMUC2 and FISH.\u003c/strong\u003e Three images from 4 mice per group were used to quantify MUC2 intensity and bacterial encroachment. For MUC2 intensity, Image J was used to set a threshold and mask for each image, and pixel intensity was measured using the Image J measuring tool. Bacterial encroachment was measured as the distance between the closest bacteria to the intestinal epithelium using the Image J measuring tool.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eGene expression\u003c/h2\u003e\n \u003cp\u003eRNA from whole cecum (0.5 in.), sorted cecal macrophages, or cultured BMDMs was isolated using Trizol (Invitrogen) according to the manufacturer\u0026apos;s instructions. iScript reverse transcription kit (Bio-rad Laboratories) was used to synthesized cDNA. Real-time quantitative qPCR was performed using SYBR Green Supermix (Bio-rad Laboratories) using a CFX384 Touch real-time PCR machine. Thermocycling program was 95\u0026deg;C for 2 min followed by 40 cycles at 95\u0026deg;C for 15 s, 60\u0026deg;C for 30s, and 72\u0026deg;C for 30s. The following primers were used: mouse Il23a-F: CCAGCAGCTCTCTCGGAATCT, mouse Il23a-R: AAGCAGAACTGGCTGTTGTC, mouse Il22-F: CATGCAGGAGGTGGTACCTT, mouse Il22-R: CAGACGCAAGCATTTCTCAG mouse Il10-F: CCAGCTGGACAACATACTGCT, mouse Il10-R: AACCCCACAAGAGTTCTTTCAAA, mouse Gapdh -F: AATGTGTCCGTCGTGGATCT, mouse Gapdh: CATCGAAGGTGGAAGAGTGG, mouse Tnf-F: AGGGTCTGGGCCATAGAACT, mouse Tnf-R: CCACCACGCTCTTCTGTCTAC, mouse Cd36-F: AACACTGTGATTGTACCTG, mouse Cd36-R: TCAATAAGCATGTCTCCGAC, mouse Pparg F: GCATGGTGCCTTCGCTGA, mouse Pparg-R: TGGCATCTCTGTGTCAACCATG, mouse Ppard-F: TTGAGCCCAAGTTCGAGTTTG, mouse Ppard-R: CGGTCTCCACACAGAATGATG. Relative expression of target gene was determined using the delta delta CT method. Gapdh was used as an internal control.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eOverexpression of IL-22\u003c/h2\u003e\n \u003cp\u003eOne day after the start of DSS treatment, mice were administered a Plasmid DNA control or IL-22 overexpression plasmid (InVivoGen) intravenously (i.v.) at 10\u0026micro;g DNA/mouse diluted in TransIT-EE Hydrodynamic Delivery solution (Mirus) at 0.1 ml/g body weight 1 day after the start of DSS treatment \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eLamina propria cell isolation\u003c/h2\u003e\n \u003cp\u003eIsolation of lamina propria cells was performed as previously described \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e54\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. In short, after the luminal contents were removed, the sections were treated with 1mM DTT and 30mM EDTA, followed by 30mM EDTA, both for 10min at 37 degrees to remove mucus and epithelial cells. Tissues were digested in 200U/ml collagenase 8 (Sigma-Aldrich C-2139) and 150\u0026micro;g/ml DNase (Sigma DN25) in RPMI supplemented with 10% FBS while shaking at 37\u0026deg;C for 1 h. Lamina propria cells were isolated using a 40%/80% Percoll (Sigma Aldrich) gradient.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eFlow cytometry and FACS sorting\u003c/h2\u003e\n \u003cp\u003eThe following antibodies were used for flow staining and or sorting from CX\u003csub\u003e3\u003c/sub\u003eCR1\u003csup\u003e+\u003c/sup\u003e GFP/+ (JAX # 005582) mice: MHC II (M5/114.15.2, BioLegend Cat# 107620), CD11b (M1/70, Biolegend Cat# 101226), CD11c (N418, Biolegend, Cat# 117317), Ly6C (AL-21, BD PharMingen Cat#560525), CD45 (30-F11, Biolegend Cat#103149), DAPI (Sigma-Aldrich Cat# D9542). Monocyte-derived macrophages were defined as CX\u003csub\u003e3\u003c/sub\u003eCR1\u003csup\u003ehi\u003c/sup\u003e CD11b\u003csup\u003e+\u003c/sup\u003e MHCII\u003csup\u003e+\u003c/sup\u003e Ly6c\u003csup\u003eneg\u003c/sup\u003e. CD36 (HM36, Biolegend CA#102606) was used to assess CD36 mean fluorescence intensity in cecal macrophages by flow cytometry. Flow cytometry and analysis were performed with an LSR II (BD) and FlowJo software (Tree Star). Dead cells were excluded using the Live/Dead fixable aqua dead cell stain kit (Invitrogen). Macrophages were sorted on a FACSAria Cell sorter (BD Biosciences).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eBone marrow-derived macrophages (BMDMs)\u003c/h2\u003e\n \u003cp\u003eBone marrow cells were collected from 6 to 8-week-old male and female C57BL/6 male and female mice and differentiated into BMDMs by culturing in BMDM media for 6 days as previously described \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e. BMDM media: 50% DMEM (Corning) supplemented with 20% FBS, 30% L cell (ATCC CRL-2648) media, 2mM glutamine, 1 mM pyruvate, 1 unit/ml pen/strep, and 55\u0026micro;M \u0026beta;-ME. BMDM media was supplemented every 3 days. Confirmation of macrophage differentiation was assessed by IF staining using the murine macrophage marker F480 (Abcam ab6640). All assays were performed in DMEM supplemented with 10% FBS, 1 unit/ml pen/strep, and 1 mM HEPES.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eLPS and lipid treatments of BMDMs and BODIPY staining\u003c/h2\u003e\n \u003cp\u003eFatty acids were dissolved in ethanol as described \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. BMDMs were treated with 100, 200, 300, or 400\u0026micro;m oleic acid or palmitic acid (Nu-Chek Prep) or an equivalent amount of solvent (ethanol) alone or co-treated with 10ng/ml LPS (Millipore Sigma, L4391) for 2, 4, or 6 h. BMDMs were either collected for gene expression analysis, or stained with primary antibodies: DAPI (Invitrogen D1306), F480 (Abcam ab6640), CD36 (abcam ab252922), BCL6 (Invitrogen PA5-27390); secondary antibodies: Cell Signaling anti-rat Alexa 488 (4416), anti-rat Alexa 647 (4414), R\u0026amp;D systems NorthernLights: NL-555 anti-rabbit (NL007), NL-637 anti-rabbit (NL005), NL-493 anti-rabbit (NL009); and 1um of of the neutral lipid stain BODIPY 493/503 (Invitrogen, D3922) for 30 at RT after immunostaining to assess lipid uptake.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAutomated Cell Counting\u003c/strong\u003e. Microscopy images were processed with Fiji/ImageJ v.2.3.0/1.53f using a custom macro to quantify fluorescence in individual cells \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. Briefly, images underwent background correction using the rolling-ball algorithm. Cell boundaries and nuclei were identified to create separate masks: the cell mask was generated using the F480 fluorescence channel, the nuclei mask was generated using the DAPI signal, and the cytoplasmic mask was derived by subtracting the nuclei mask from the cell mask. Fluorescence thresholds for each marker were set manually based on representative images from oleic-treated wells. Thresholds were set separately for two sets of measurements: (1) green (BODIPY), red (CD36), blue (DAPI), and magenta (F480) channels for measuring sample with CD36 MFI and BODIPY, and (2) green (BODIPY), red (F480), blue (DAPI), and magenta (BCL6) channels for measuring sample with BCL6 MFI. For each mask (cell, nucleus, cytoplasm), individual area measurements and the average fluorescence intensities for CD36, BODIPY, and BCL6 were recorded. The number of cells per image was estimated by counting individual DAPI-stained nuclei. Finally, an R script summarized fluorescence intensities for each mask and computed the mean fluorescence per cell by dividing the total fluorescence intensity by the estimated cell number. Analyses were performed using GraphPad Prism version 10.0. The ImageJ macro is available online at: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bitbucket.org/the-samuel-lab/mcalester-2022/\u003c/span\u003e\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003ePPARd and BCL6 antagonist treatments\u003c/h2\u003e\n \u003cp\u003eBMDMs were treated with or without LPS and oleic acid as above, in the presence of 50um PPARd antagonist GSK-3787(Abcam ab144575) or BCL6 small molecule inhibitor 79\u0026thinsp;\u0026minus;\u0026thinsp;6 (Sigma197345) for 4 h. BMDMs were then collected for gene expression analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eOne-way analysis of variance (ANOVA) with Tukey\u0026rsquo;s posttest or unpaired Student\u0026rsquo;s t test was performed using a 95% confidence interval. All data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. All analyses were performed using GraphPad Prism version 10.0. Differences were considered to be significant at P values of less than 0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA.A.H.M. \u0026nbsp;designed experiments and wrote the manuscript with the input from all co-authors. A.G., D.F.Z.R., G.E.D., and A.A.H.M performed, designed, and analyzed the experiments. W.-J.W., K.N., and A.M.J performed experiments. A.A.H.M, A.A., B.S.S. designed the automated counting script. All experiments were performed in accordance with approved protocols by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by institutional NIDDK K01DK121934 (A.A.H.M.), the Texas Medical Center Digestive Disease Center Cellular and Molecular Morphology Core and Pilot Fund NIH P30 DK056338 (A.A.H.M.), NIH R01AI125264 (G.E.D.), This project was supported by the Cytometry and Cell Sorting Core at Baylor College of Medicine with funding from the CPRIT Core Facility Support Award (CPRIT-RP240432), the NIH (CA125123 and OD036336) and the assistance of Joel M. Sederstrom.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAddress correspondence to\u003c/strong\u003e: Andrea A. Hill McAlester, Department of Pathology and Immunology, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Phone:1-713-798-1738. Email: [email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed in accordance with relevant guidelines and regulations. The Study\u0026nbsp;protocols was approved by the Institutional Animal Care and Usage Committee at Baylor College of Medicine and Memorial Sloan Kettering Cancer Center.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eQuiros, M. \u003cem\u003eet al.\u003c/em\u003e Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling. \u003cem\u003eJournal of Clinical Investigation\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e, 3510\u0026ndash;3520 (2017).\u003c/li\u003e\n\u003cli\u003eHill, A. A. \u003cem\u003eet al.\u003c/em\u003e Acute high-fat diet impairs macrophage-supported intestinal damage resolution. \u003cem\u003eJci Insight\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e164489 (2023).\u003c/li\u003e\n\u003cli\u003eRuiz, D. F. Z. \u003cem\u003eet al.\u003c/em\u003e Microbiota manipulation to increase macrophage IL-10 improves colitis and limits colitis-associated colorectal cancer. \u003cem\u003eGut Microbes\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 2119054 (2022).\u003c/li\u003e\n\u003cli\u003eLongman, R. S. \u003cem\u003eet al.\u003c/em\u003e CX₃CR1\u003csup\u003e+\u003c/sup\u003e mononuclear phagocytes support colitis-associated innate lymphoid cell production of IL-22. \u003cem\u003eJournal of Experimental Medicine\u003c/em\u003e \u003cstrong\u003e211\u003c/strong\u003e, 1571\u0026ndash;1583 (2014).\u003c/li\u003e\n\u003cli\u003eWu, W.-J. H. \u003cem\u003eet al.\u003c/em\u003e Interleukin-1\u0026beta; secretion induced by mucosa-associated gut commensal bacteria promotes intestinal barrier repair. \u003cem\u003eGut Microbes\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 2014772 (2022).\u003c/li\u003e\n\u003cli\u003eFilardy, A. A. \u003cem\u003eet al.\u003c/em\u003e Proinflammatory Clearance of Apoptotic Neutrophils Induces an IL-12lowIL-10high Regulatory Phenotype in Macrophages. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e185\u003c/strong\u003e, 2044\u0026ndash;2050 (2010).\u003c/li\u003e\n\u003cli\u003eAden, K. \u003cem\u003eet al.\u003c/em\u003e Epithelial IL-23R Signaling Licenses Protective IL-22 Responses in Intestinal Inflammation. \u003cem\u003eCell Rep.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2208\u0026ndash;2218 (2016).\u003c/li\u003e\n\u003cli\u003eZheng, Y. \u003cem\u003eet al.\u003c/em\u003e Interleukin-22 mediates early host defense against attaching and effacing bacterial pathogens. \u003cem\u003eNature Medicine\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 282\u0026ndash;289 (2008).\u003c/li\u003e\n\u003cli\u003eSewell, G. W. \u0026amp; Kaser, A. Interleukin-23 in the Pathogenesis of Inflammatory Bowel Disease and Implications for Therapeutic Intervention. \u003cem\u003eJ Crohn\u0026rsquo;s Colitis\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, ii3\u0026ndash;ii19 (2022).\u003c/li\u003e\n\u003cli\u003eGrondin, J. A., Kwon, Y. H., Far, P. M., Haq, S. \u0026amp; Khan, W. I. Mucins in Intestinal Mucosal Defense and Inflammation: Learning From Clinical and Experimental Studies. \u003cem\u003eFront Immunol\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 2054 (2020).\u003c/li\u003e\n\u003cli\u003eBergstrom, K. S. B. \u003cem\u003eet al.\u003c/em\u003e Muc2 protects against lethal infectious colitis by disassociating pathogenic and commensal bacteria from the colonic mucosa. \u003cem\u003ePLoS Pathogens\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, e1000902 (2010).\u003c/li\u003e\n\u003cli\u003eSugimoto, K. \u003cem\u003eet al.\u003c/em\u003e IL-22 ameliorates intestinal inflammation in a mouse model of ulcerative colitis. \u003cem\u003eJ. Clin. Investig.\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, 534\u0026ndash;544 (2008).\u003c/li\u003e\n\u003cli\u003ePickert, G. \u003cem\u003eet al.\u003c/em\u003e STAT3 links IL-22 signaling in intestinal epithelial cells to mucosal wound healing. \u003cem\u003eJournal of Experimental Medicine\u003c/em\u003e \u003cstrong\u003e206\u003c/strong\u003e, 1465\u0026ndash;1472 (2009).\u003c/li\u003e\n\u003cli\u003eZenewicz, L. A. \u003cem\u003eet al.\u003c/em\u003e Innate and Adaptive Interleukin-22 Protects Mice from Inflammatory Bowel Disease. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 947\u0026ndash;957 (2008).\u003c/li\u003e\n\u003cli\u003eBrand, S. \u003cem\u003eet al.\u003c/em\u003e IL-22 is increased in active Crohn\u0026rsquo;s disease and promotes proinflammatory gene expression and intestinal epithelial cell migration. \u003cem\u003eAm. J. Physiol.-Gastrointest. Liver Physiol.\u003c/em\u003e \u003cstrong\u003e290\u003c/strong\u003e, G827\u0026ndash;G838 (2006).\u003c/li\u003e\n\u003cli\u003eChen, Y., Zhang, J., Cui, W. \u0026amp; Silverstein, R. L. CD36, a signaling receptor and fatty acid transporter that regulates immune cell metabolism and fate. \u003cem\u003eJ Exp Med\u003c/em\u003e \u003cstrong\u003e219\u003c/strong\u003e, e20211314 (2022).\u003c/li\u003e\n\u003cli\u003eSilverstein, R. L. \u0026amp; Febbraio, M. CD36, a Scavenger Receptor Involved in Immunity, Metabolism, Angiogenesis, and Behavior. \u003cem\u003eSci Signal\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, re3 (2009).\u003c/li\u003e\n\u003cli\u003eZhao, L., Varghese, Z., Moorhead, J. F., Chen, Y. \u0026amp; Ruan, X. Z. CD36 and lipid metabolism in the evolution of atherosclerosis. \u003cem\u003eBr. Méd. Bull.\u003c/em\u003e \u003cstrong\u003e126\u003c/strong\u003e, 101\u0026ndash;112 (2018).\u003c/li\u003e\n\u003cli\u003eNozaki, S. \u003cem\u003eet al.\u003c/em\u003e Reduced uptake of oxidized low density lipoproteins in monocyte-derived macrophages from CD36-deficient subjects. \u003cem\u003eJ. Clin. Investig.\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 1859\u0026ndash;1865 (1995).\u003c/li\u003e\n\u003cli\u003eChawla, A. \u003cem\u003eet al.\u003c/em\u003e PPAR\u0026delta; is a very low-density lipoprotein sensor in macrophages. \u003cem\u003eProc. Natl. Acad. Sci.\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 1268\u0026ndash;1273 (2003).\u003c/li\u003e\n\u003cli\u003eChawla, A. \u003cem\u003eet al.\u003c/em\u003e PPAR-\u0026gamma; dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. \u003cem\u003eNat. Med.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 48\u0026ndash;52 (2001).\u003c/li\u003e\n\u003cli\u003eChawla, A. Control of Macrophage Activation and Function by PPARs. \u003cem\u003eCirc. Res.\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 1559\u0026ndash;1569 (2010).\u003c/li\u003e\n\u003cli\u003ePalkar, P. S. \u003cem\u003eet al.\u003c/em\u003e Cellular and Pharmacological Selectivity of the Peroxisome Proliferator-Activated Receptor-\u0026beta;/\u0026delta; Antagonist GSK3787. \u003cem\u003eMol. Pharmacol.\u003c/em\u003e \u003cstrong\u003e78\u003c/strong\u003e, 419\u0026ndash;430 (2010).\u003c/li\u003e\n\u003cli\u003eBarish, G. D. \u003cem\u003eet al.\u003c/em\u003e Bcl-6 and NF-\u0026kappa;B cistromes mediate opposing regulation of the innate immune response. \u003cem\u003eGenes Dev.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 2760\u0026ndash;2765 (2010).\u003c/li\u003e\n\u003cli\u003eLee, C.-H. \u003cem\u003eet al.\u003c/em\u003e Transcriptional Repression of Atherogenic Inflammation: Modulation by PPAR\u0026delta;. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e302\u003c/strong\u003e, 453\u0026ndash;457 (2003).\u003c/li\u003e\n\u003cli\u003eMondal, A., Sawant, D. \u0026amp; Dent, A. L. Transcriptional Repressor BCL6 Controls Th17 Responses by Controlling Gene Expression in Both T Cells and Macrophages. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cstrong\u003e184\u003c/strong\u003e, 4123\u0026ndash;4132 (2010).\u003c/li\u003e\n\u003cli\u003eCerchietti, L. C. \u003cem\u003eet al.\u003c/em\u003e A Small-Molecule Inhibitor of BCL6 Kills DLBCL Cells In Vitro and In Vivo. \u003cem\u003eCancer Cell\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 400\u0026ndash;411 (2010).\u003c/li\u003e\n\u003cli\u003eLumeng, C. N., Bodzin, J. L. \u0026amp; Saltiel, A. R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e117\u003c/strong\u003e, 175\u0026ndash;184 (2007).\u003c/li\u003e\n\u003cli\u003eChan, K. L. \u003cem\u003eet al.\u003c/em\u003e Palmitoleate Reverses High Fat-induced Proinflammatory Macrophage Polarization via AMP-activated Protein Kinase (AMPK)*. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e290\u003c/strong\u003e, 16979\u0026ndash;16988 (2015).\u003c/li\u003e\n\u003cli\u003eHill, A. A. \u003cem\u003eet al.\u003c/em\u003e Activation of NF-\u0026kappa;B drives the enhanced survival of adipose tissue macrophages in an obesogenic environment. \u003cem\u003eMol Metab\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 665\u0026ndash;677 (2015).\u003c/li\u003e\n\u003cli\u003eHill, A. A., Bolus, W. R. \u0026amp; Hasty, A. H. A decade of progress in adipose tissue macrophage biology. \u003cem\u003eImmunol. Rev.\u003c/em\u003e \u003cstrong\u003e262\u003c/strong\u003e, 134\u0026ndash;152 (2014).\u003c/li\u003e\n\u003cli\u003eDavanso, M. R., Crisma, A. R., Murata, G., Newsholme, P. \u0026amp; Curi, R. Impact of Dietary Fatty Acids on Macrophage Lipid Metabolism, Signaling and Function. \u003cem\u003eImmunometabolism\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, (2020).\u003c/li\u003e\n\u003cli\u003eBojic, L. A. \u003cem\u003eet al.\u003c/em\u003e Activation of Peroxisome Proliferator-Activated Receptor \u0026delta; Inhibits Human Macrophage Foam Cell Formation and the Inflammatory Response Induced by Very Low-Density Lipoprotein. \u003cem\u003eArter., Thromb., Vasc. Biol.\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, 2919\u0026ndash;2928 (2018).\u003c/li\u003e\n\u003cli\u003eYan, J. \u0026amp; Horng, T. Lipid Metabolism in Regulation of Macrophage Functions. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 979\u0026ndash;989 (2020).\u003c/li\u003e\n\u003cli\u003eWang, X. \u003cem\u003eet al.\u003c/em\u003e Interleukin-22 alleviates metabolic disorders and restores mucosal immunity in diabetes. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e514\u003c/strong\u003e, 237\u0026ndash;241 (2015).\u003c/li\u003e\n\u003cli\u003eCamell, C. \u0026amp; Smith, C. W. Dietary Oleic Acid Increases M2 Macrophages in the Mesenteric Adipose Tissue. \u003cem\u003ePLoS ONE\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e75147 (2013).\u003c/li\u003e\n\u003cli\u003eSanta-Mar\u0026iacute;a, C. \u003cem\u003eet al.\u003c/em\u003e Update on Anti-Inflammatory Molecular Mechanisms Induced by Oleic Acid. \u003cem\u003eNutrients\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 224 (2023).\u003c/li\u003e\n\u003cli\u003eKarasawa, T. \u003cem\u003eet al.\u003c/em\u003e Saturated Fatty Acids Undergo Intracellular Crystallization and Activate the NLRP3 Inflammasome in Macrophages. \u003cem\u003eArter., Thromb., Vasc. Biol.\u003c/em\u003e \u003cstrong\u003e38\u003c/strong\u003e, 744\u0026ndash;756 (2018).\u003c/li\u003e\n\u003cli\u003eSilva, P. S. A. de, Luben, R., Shrestha, S. S., Khaw, K. T. \u0026amp; Hart, A. R. Dietary arachidonic and oleic acid intake in ulcerative colitis etiology. \u003cem\u003eEur. J. Gastroenterol. Hepatol.\u003c/em\u003e \u003cstrong\u003e26\u003c/strong\u003e, 11\u0026ndash;18 (2014).\u003c/li\u003e\n\u003cli\u003eMa, C., Vasu, R. \u0026amp; Zhang, H. The Role of Long‐Chain Fatty Acids in Inflammatory Bowel Disease. \u003cem\u003eMediat. Inflamm.\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, 8495913 (2019).\u003c/li\u003e\n\u003cli\u003eYan, D. \u003cem\u003eet al.\u003c/em\u003e Fatty acids and lipid mediators in inflammatory bowel disease: from mechanism to treatment. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 1286667 (2023).\u003c/li\u003e\n\u003cli\u003eWei, Y. \u003cem\u003eet al.\u003c/em\u003e Dietary long-chain fatty acids promote colitis by regulating palmitoylation of STAT3 through CD36-mediated endocytosis. \u003cem\u003eCell Death Dis.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 60 (2024).\u003c/li\u003e\n\u003cli\u003eKennedy, D. J. \u003cem\u003eet al.\u003c/em\u003e A CD36-dependent pathway enhances macrophage and adipose tissue inflammation and impairs insulin signalling. \u003cem\u003eCardiovasc Res\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 604\u0026ndash;613 (2011).\u003c/li\u003e\n\u003cli\u003eRahaman, S. O. \u003cem\u003eet al.\u003c/em\u003e A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. \u003cem\u003eCell Metab.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 211\u0026ndash;221 (2006).\u003c/li\u003e\n\u003cli\u003eCifarelli, V. \u003cem\u003eet al.\u003c/em\u003e CD36 Deficiency Impairs the Small Intestinal Barrier and Induces Subclinical Inflammation in Mice. \u003cem\u003eCell Mol Gastroenterology Hepatology\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 82\u0026ndash;98 (2017).\u003c/li\u003e\n\u003cli\u003eYang, Y. \u003cem\u003eet al.\u003c/em\u003e Case Report: IL-21 and Bcl-6 Regulate the Proliferation and Secretion of Tfh and Tfr Cells in the Intestinal Germinal Center of Patients With Inflammatory Bowel Disease. \u003cem\u003eFront. Pharmacol.\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 587445 (2021).\u003c/li\u003e\n\u003cli\u003eVerstockt, B. \u003cem\u003eet al.\u003c/em\u003e Distinct transcriptional signatures in purified circulating immune cells drive heterogeneity in disease location in IBD. \u003cem\u003eBMJ Open Gastroenterol.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e001003 (2023).\u003c/li\u003e\n\u003cli\u003eCao, S. \u003cem\u003eet al.\u003c/em\u003e Mucosal Single-Cell Profiling of Crohn\u0026rsquo;s-Like Disease of the Pouch Reveals Unique Pathogenesis and Therapeutic Targets. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cstrong\u003e167\u003c/strong\u003e, 1399-1414.e2 (2024).\u003c/li\u003e\n\u003cli\u003eKilkenny, C., Browne, W. J., Cuthill, I. C., Emerson, M. \u0026amp; Altman, D. G. Improving Bioscience Research Reporting: The ARRIVE Guidelines for Reporting Animal Research. \u003cem\u003ePLoS Biol.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, e1000412 (2010).\u003c/li\u003e\n\u003cli\u003eKim, J. J., Shajib, M. S., Manocha, M. M. \u0026amp; Khan, W. I. Investigating Intestinal Inflammation in DSS-induced Model of IBD. \u003cem\u003eJ Vis Exp\u003c/em\u003e (2012) doi:10.3791/3678.\u003c/li\u003e\n\u003cli\u003eErben, U. \u003cem\u003eet al.\u003c/em\u003e A guide to histomorphological evaluation of intestinal inflammation in mouse models. \u003cem\u003eInt J Clin Exp Patho\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 4557\u0026ndash;76 (2014).\u003c/li\u003e\n\u003cli\u003eLangendijk, P. S. \u003cem\u003eet al.\u003c/em\u003e Quantitative fluorescence in situ hybridization of Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in fecal samples. \u003cem\u003eAppl Environ Microb\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 3069\u0026ndash;3075 (1995).\u003c/li\u003e\n\u003cli\u003eQiu, J. \u003cem\u003eet al.\u003c/em\u003e The Aryl Hydrocarbon Receptor Regulates Gut Immunity through Modulation of Innate Lymphoid Cells. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 92\u0026ndash;104 (2012).\u003c/li\u003e\n\u003cli\u003eKim, M. \u003cem\u003eet al.\u003c/em\u003e Critical Role for the Microbiota in CX3CR1+ Intestinal Mononuclear Phagocyte Regulation of Intestinal T Cell Responses. \u003cem\u003eImmunity\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 151-163.e5 (2018).\u003c/li\u003e\n\u003cli\u003eDiehl, G. E. \u003cem\u003eet al.\u003c/em\u003e Microbiota restricts trafficking of bacteria to mesenteric lymph nodes by CX(3)CR1(hi) cells. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e494\u003c/strong\u003e, 116\u0026ndash;120 (2013).\u003c/li\u003e\n\u003cli\u003eTrouplin, V. \u003cem\u003eet al.\u003c/em\u003e Bone Marrow-derived Macrophage Production. \u003cem\u003eJ Vis Exp\u003c/em\u003e e50966 (2013) doi:10.3791/50966.\u003c/li\u003e\n\u003cli\u003eSchindelin, J. \u003cem\u003eet al.\u003c/em\u003e Fiji: an open-source platform for biological-image analysis. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 676\u0026ndash;682 (2012).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6557500/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6557500/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eUnresolved tissue damage is a common feature of Inflammatory Bowel Disease (IBD) that facilitates disease progression. Here, we showed that high animal fat diets (HFD), an environmental risk factor associated with IBD pathogenesis, suppress intestinal macrophage production of critical tissue repair responses after damage. This includes reduced IL-23 production, which drives downstream production of the IL-22, which is needed for barrier repair. Indicating that dietary lipids interfere with responses to microbial molecules needed to induce barrier protective functions, we found oleic acid could directly suppress macrophage \u003cem\u003eIl23a\u003c/em\u003e induction after lipopolysaccharide (LPS) treatment. Deleting the lipid transporter CD36 on macrophages restored the \u003cem\u003eIl23a\u003c/em\u003e and \u003cem\u003eIl22\u003c/em\u003eresponse, reducing intestinal damage in HFD-fed DSS-treated mice. We found that CD36-mediated intracellular lipid accumulation, mainly oleic acid, in macrophages leads to peroxisome proliferator-activated receptor delta (PPARd)release of the transcriptional repressor protein B-cell lymphoma 6 (BCL6). BCL6 suppresses \u003cem\u003eIl23a\u003c/em\u003e transcription in microbe-exposed macrophages. The studies suggest dietary lipid modulation of the macrophage PPARd/BCL6 transcriptional repressor complex is a key mechanism of fat-associated defects in intestinal damage repair and immune dysregulation. Overall, our findings provide new insights into dietary lipid contribution to intestinal disease progression and identify new potential therapeutic targets to decrease diet-associated risk for IBD.\u003c/p\u003e","manuscriptTitle":"Dietary lipids induce PPARd and BCL6 to repress macrophage IL-23 induction after intestinal injury and LPS exposure","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-29 10:19:04","doi":"10.21203/rs.3.rs-6557500/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-19T09:03:36+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-19T06:33:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-09T05:57:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"324535882949753367921502683498575213646","date":"2025-05-27T15:30:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"155000331895107192880139528104255995172","date":"2025-05-27T11:04:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-27T10:43:14+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-27T10:39:10+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-05-15T11:19:41+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-15T05:14:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-04-29T14:31:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"230754d1-c8a5-4e59-b9d6-725112ae30de","owner":[],"postedDate":"May 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":49121827,"name":"Biological sciences/Immunology/Innate immune cells"},{"id":49121828,"name":"Biological sciences/Immunology/Mucosal immunology"},{"id":49121829,"name":"Health sciences/Gastroenterology/Gastrointestinal diseases/Inflammatory bowel disease"}],"tags":[],"updatedAt":"2025-07-28T16:08:08+00:00","versionOfRecord":{"articleIdentity":"rs-6557500","link":"https://doi.org/10.1038/s41598-025-12448-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-07-27 15:57:03","publishedOnDateReadable":"July 27th, 2025"},"versionCreatedAt":"2025-05-29 10:19:04","video":"","vorDoi":"10.1038/s41598-025-12448-y","vorDoiUrl":"https://doi.org/10.1038/s41598-025-12448-y","workflowStages":[]},"version":"v1","identity":"rs-6557500","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6557500","identity":"rs-6557500","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00