The freshwater fish genus Thymallus (Thymallidae) in the upper OB-Irtysh River: its evolutionary history and implications for conservation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The freshwater fish genus Thymallus (Thymallidae) in the upper OB-Irtysh River: its evolutionary history and implications for conservation Wenjie Peng, Haoxiang Han, Bo Ma This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4063125/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Quaternary geological and climatic events in central Asia have influenced the evolutionary history of populations of endemic species, and patterns in their distribution. We investigate species of grayling ( Thymallus ) from the upper OB-Irtysh River, Xinjiang, China, using mitochondrial DNA sequences and 10 microsatellite markers. Phylogenetic analyses attribute this species to Thymallus brevicephalus , and validate its divergence from a sister taxon, the Mongolian grayling ( Thymallus brevirostris ) through geomorphological changes caused by uplift of the Altai Mountains. Microsatellite analysis using STRUCTURE and pairwise FST analysis reveals significant genetic differentiation between eastern and western T. brevicephalus populations, which we estimate to have diverged approximately 0.81 million years ago (MY). High haplotype and low nucleotide diversities, and patterns of population history, indicate the western population of T. brevicephalus has slowly expanded following the Last Glacial Maximum approximately 0.4–0.1 MY. Hardy–Weinberg disequilibrium and within-population inbreeding coefficients identify a founder effect in this species. The origin of T. brevicephalus corresponds to the uplift of the Altai Mountains. Simultaneously, internal differentiation and population expansion occurred during repeated Quaternary climatic glacial–interglacial cycles. If management of T. brevicephalus , an endemic fish species in the upper Irtysh River in the Altai Mountains, was an option, we recommend establishing two management units separated by the Crane River. Release activities should be carried out independently for the eastern and western populations, and international cooperation in conservation efforts should be strengthened. Altai Mountains biogeography Conserv Genet OB-Irtysh River Pleistocene Thymallus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Geological and climatic events alter the habitat and distributions of species, and their survival and reproduction (Jens-Christian et al. 2015 ; Wiens and Donoghue 2004 ). Because the distributions of freshwater fish are affected by watercourse constraints, geological and climatic changes to these waterways can lead to species differentiation through isolation, or range expansion through increased connectivity of drainage systems (Capobianco and Friedman 2019 ). Understanding interactions among geological, climatic changes, and drainage systems, as well as their relationships with freshwater fish species, is important for understanding the mechanisms that affect their diversity, and to devise appropriate conservation strategies. Phylogeographic studies on freshwater fish have become focal points in regions such as North America (Ginson et al. 2015 ; Janosik et al. 2023 ), the Qinghai–Tibet Plateau (Guo et al. 2019 ; Liang et al. 2017 ; Zhang et al. 2017 ), and in Siberia (Secci-Petretto et al. 2023 ; Skog et al. 2014 ). Graylings in the genus Thymallus (Teleostei: Thymallidae) are widely distributed across Eurasia and North America, and they are renowned for their conservative reproductive behavior. These fish repeatedly spawn at the same locations, and their migratory capabilities are highly limited (Gönczi 1989 ; Northcote 1995 ; Nykänen et al. 2001 ). Consequently, the distribution patterns of Thymallus species are highly unique. Within a single river system, Thymallus populations often display high levels of genetic differentiation, as reported for the Amur (Froufe et al. 2003a ; Ma et al. 2012 ; Weiss et al. 2020a ), Yenisei (Andrushchenko et al. 2023 ; Knizhin et al. 2006a ; Knizhin and Weiss 2009 ), and Lena (Knizhin et al. 2006b ; Weiss et al. 2006 ) rivers. This phenomenon can even extend into a single lake, such as, for example, the Hoton Nur Lake in western Mongolia (Slynko et al. 2010 ) and Lake Saimaa in eastern Finland (Koskinen et al. 2001 ; Koskinen et al. 2002a ). Significant morphological differences also exist among Thymallus in Lake Baikal (Knizhin et al. 2006c ; Knizhin et al. 2006d ). Thymallus is a model taxon to study for systematic geographic applications and phylogeographic studies. From a biological perspective, this taxon can reflect historical geological and climatic changes. The Altai Mountains, at the junction of China, Kazakhstan, Mongolia, and Russia, have undergone two episodes of mountain-building and uplift. During the late Pliocene to early Pleistocene, there were distinct differential uplift movements which led to a significant increase in topographical differences between mountainous and plain areas, and contributed to the formation of mountainous terrain. From the middle Pleistocene to Holocene, intermittent uplift dominated (especially during the middle Pleistocene) when the entire mountain range was substantially uplifted, shaping the modern outline of the Altai Mountains. This uplift, a result of intermittent tectonic activity, played a critical role in forming the contemporary landscape of these mountains (Huangfu et al. 2023 ; Zang et al. 2015 ; Zhao et al. 2013 ). The upper Irtysh River basin forms a comb-shaped drainage system, where northern and southern tributaries converge into a main channel. After flowing into Lake Zaysan, the river continues northward to join the Ob River, forming the Ob-Irtysh River, until it eventually reaches the Arctic Ocean. Because of our incomplete understanding of the diversity and geographical distribution of Thymallus species, the relationship between geological and climatic change and this diversity is not well understood. This is especially true in the Altai Mountains region, where at least three Thymallus species might occur (Weiss et al. 2021 ). To the northwest of these mountains, the Upper Ob grayling ( Thymallus nikolskyi ) occurs in the Ob River basin—a species that may share a common ancestor with Thymallus svetovidovi in the Yenisei River basin (Dyldin et al. 2017 ). In the Kobdo Basin, to the northeast of the Altai Mountains in Mongolia, the Mongolian grayling ( T. brevirostris ) occurs. While T. brevirostris differs from other grayling taxa in jaw length, development of teeth, head form, and some biological parameters (Knizhin et al. 2008 ), few studies have focused on genetic variation in graylings in the southern Altai Mountains. T. brevicephalus occurs in the upper tributaries of Irtysh River, centered around Lake Markakol, within Kazakhstan, and it is considered to be a sister species of T. brevirostris in the northern part of the Altai Mountains (Weiss et al. 2020b ), although morphological and ecological data are limited. Additionally, Thymallus occurs in the upper Irtysh River in China, where it is typically referred to as Thymallus arcticus grubei , or the Arctic grayling (Guo et al. 2012 ; Liu et al. 2016 ; Ren et al. 2002 ). We perform a molecular phylogenetic analysis using mitochondrial and microsatellite data on graylings from the upper Irtysh River, in the southern foothills of the central section of the Altai Mountains. To better understand patterns in distribution and population genetic structure of these fishes in these mountains, we integrate original data with mitochondrial data obtained from the literature. Additionally, we consider geological and climatic events to further explore the evolutionary history of this taxon in this region. Materials and Methods Fishes (161 individuals) were captured in October 2019 from 10 locations in the Irtysh River basin, Xinjiang, China (Fig. 1, Table 1 ). Genomic DNA was extracted using an Ezup Column Animal Genomic DNA Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd. Extracted DNA was stored at 4°C for less than a week, until further use. Table 1 Sample locations including species, sample location, sample population code, drainage basin, number of individuals screened for both mtDNA and microsatellite loci, and geographical coordinates for Thymallus samples in this study Sample location Sample code Number of individuals mtDNA microsatellite Lat. (N) Long. (E) Kayiertesi River KY 25 12 47°38′31″ 89°44′55″ Karaertis River KL 25 45 47°58′53″ 88°40′10″ Crane River KE 16 14 47°54′38″ 88°7′25″ Hongqi Reservoir HQ 15 – 48°4′33″ 87°7′38″ Burqin River BE 15 – 47°47′26″ 87°5′49″ Chonghuer Reservoir CE 15 – 48°4′33″ 87°7′38″ Hemu River HM 13 – 48°40′14″ 87°32′57″ Kanas River KN 15 27 48°47′8″ 87°1′56″ Akkaba River BH 7 – 48°30′11″ 86°36′9″ Kara-Kaba River HB 15 13 48°43′17″ 86°46′23″ To amplify Cyt b gene sequences, we used L14724 (5'-GACTTGAAAAACCACCGTTG-3') and H15915 (5'-CTCCGATCTCCGGATTACAAGAC-3') primers. For the CR (Dloop) gene sequence we used D-loop-F (5'-ACCCCTGGCTCCCAAAGC-3') and D-loop-R (5'-ATCTTAGCATCTTCAGTG-3') primers. A 25 µL PCR reaction system was established with 1 µL of each upstream and downstream primer (concentration 10 pmol/µL), 0.2 µL of polymerase, 2.5 µL of dNTP, 2.5 µL of buffer, 1.5 µL of Mg 2+ , 2 µL of DNA template (concentration 50 ng/µL), supplemented with double-distilled (dd) H 2 O to 25 µL. The PCR program entailed pre-denaturation at 94°C for 4 min, denaturation at 94°C for 55 s, annealing at 60°C for 45 s, an extension at 72°C for 30 s, and a final extension at 72°C for 7 min, for 30 cycles. After the reaction, 3 µL of PCR product was collected, and after confirming that the CR product displayed clear and bright bands after 1% agarose gel electrophoresis, purification and sequencing were conducted by Sangon Biotech (Shanghai) Co., Ltd. Table 2 Microsatellite loci Locus Repeat motif Primer sequence (5′–3′) Ta (°C) Single ClaTet1 (GACA)13 F: GAGCCCATCATCACTGAGAAAGA 60°C R: CTGCTACCCACAAACCCCTG 4Plex BFRO004 (GT)11 F: GCTCCAGTGAGGGTGACCAG 58°C R: AGGCCACTGATTGAGCAGAG BFRO010 (AC)17 F: GGA CGG AGC CAG CAT CAC 58°C R: GTTTCTTGATTTCATAATCAGGTCAATAGTCAT Tar103 (ATCC)7TCC(ATCC)14 F: CAGTCGGGCGTCATCACGGGGATCAATAAAGTATCC 58°C R: CTTCACTGTCGCTGTGAGTAC Tth445 (GATA)20 F: TGA CGG CTA CAG GAA TTGT 58°C R: GTTTCTTCCACAGAGGGTTCTACATTG 5Plex Tar100 (CTTT)5CTTC(CTTT)18 F: CAGTCGGGCGTCATCATTTGGATGTGTCAGACCTG 58°C R: GAGAAAGCAAGGAGAAATCAC Tar101 (CTTT)22 F: CAGAGCACACCAAGCAGAG 58°C R: GTTTCTTAGGGCAAGTCATTCCAGTC Tar110 (TAGA)30 F: GCAATAACAATTCCATGAGAAG 58°C R: GTTTCTTCTCCTCTGATTCCAAGAAATG Tar112 (TATC)7 F: CAGTCGGGCGTCATCACCTGGGAATCAACAAAGTATC 58°C R: AGGAGGTTCAGTGAGTGTTTC Tth313 (GAGT)22 F: AAACCAGTCCAAGCGAGAG 58°C R: GTTTCTTCTCCTGTTTATCACATGA Microsatellite sequences are detailed in Table 2, as cited from previous studies (Weiss et al. 2020b ). A 25 µL PCR reaction system was established containing 0.5 µL of each forward and reverse primer, 0.5 µL of dNTP (mix), 2.5 µL of Taq Buffer (with MgCl 2 ), 0.2 µL of Taq polymerase, and supplemented with ddH 2 O to 25 µL. PCR amplification was performed using an ABI VeritiTM 96-well PCR machine, with pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, an extension at 72°C for 30 s, repeated for 10 cycles; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and an extension at 72°C for 30 s was repeated for 30 cycles; with a final extension at 72°C for 10 min. The size of the microsatellite loci was determined using a 3730xl DNA Analyzer. mtDNA data analysis The CR (Dloop) sequences were aligned with those of T. brevicephalus (N = 33) from existing literature, T. brevirostris sequences (N = 27), those of T. nikolskyi (N = 3) (Knizhin et al. 2008 ; Weiss et al. 2020b ), and six outgroup taxa (Froufe et al. 2003b ; Jacobsen et al. 2012 ; Koskinen et al. 2002b ; Wang et al. 2019 ); 230 sequences were obtained. Multiple sequence alignment was performed using the ClustalW method in MEGA 11.0.13 (Larkin et al. 2007 ; Tamura et al. 2021 ), and haplotype analysis was conducted using DnaSP 6.12.03 (Rozas et al. 2017 ). The best nucleotide substitution models for Maximum Likelihood estimation (ML) and Bayesian Inference (BI) were identified as HKY + Gamma using MEGA 11.0.13 and MrModeltest 2 (Nylander 2004 ; Tamura et al. 2021 ). ML estimation analysis with 1000 iterations was performed using the HKY + G model in raxmlGUI 2.0 (Edler et al. 2021 ). BI was conducted in MrBayes 3.2.7, with the number of runs set to 2 × 10 7 (Ronquist et al. 2012 ). Haplotype networks were generated using PopArt1.7 (Leigh and Bryant 2015 ), with undefined states masked. To gain further insights into relationships among Thymallus species in the upper Irtysh River, the obtained 166 Cyt b sequences were trimmed and overlaid with the CR (Dloop) sequences. Using the same methodology, a combined sequence analysis of haplotypes was conducted to generate a haplotype network. To estimate divergence times between species, a time-calibrated Cyt b + CR phylogeny was constructed using BEAUti in BEAST 1.10.4. This BI phylogenetic analysis employed the HKY + G substitution model (Drummond and Rambaut 2007 ). A molecular clock was modeled using uncorrelated relaxed molecular clock priors, specifically lognormal distributions (Suchard and Rambaut 2009 ). The tree prior was modeled using the birth–death process. The mtDNA molecular clock calibration for Salmoniformes species was set at 1% per MY, with a relative death rate following a normal distribution (mean 0.01, SD 0.002). Two divergence times were specified: the most recent common ancestor of Salmoniformes around 50 MY (lognormal distribution, offset 50, mean 10, SD 1) and the period around 0.13 MY when Thymallus baicalensis entered Lake Baikal (normal distribution, mean 0.12, SD 0.1) (Koskinen et al. 2002b ; Weiss et al. 2021 ). Iterations were run 30 × 10 6 times, with sampling conducted every 3000 iterations. Generated data were assessed for convergence and effective sample sizes (> 200) using Tracer v1.7.2 (Rambaut et al. 2018 ). The final tree was constructed using TreeAnnotator v1.10.4, exported in FigTree v1.4.4 (Rambaut 2012), and optimized on the iTOL (Letunic and Bork 2021 ). To further investigate if Thymallus species in the upper Irtysh River were conspecific, and to explore differences between them and other species, we used DnaSP v6.12.03 to compute nucleotide diversity (Rozas et al. 2017 ). Additionally, MEGA v11.0.13 was used to estimate inter-population genetic distances based on Kimura 2-parameter and Tamura–Nei models (Tamura et al. 2021 ). Analysis of molecular variance (AMOVA) was performed using Arlequin 3.5 to detect genetic variation among geographic populations or groups, and genetic variation indices (FCT, variance among groups relative to total variance; FSC, variance among populations within groups; FST, variance among populations) (Excoffier and Lischer 2010 ). The significance of covariance at different levels of genetic structure was tested through 1000 resampling iterations. Tajima’s D test and Fu’s Fs test in Arlequin 3.5 software (Excoffier and Lischer 2010 ), as well as the sum of squared deviation (SSD) and Harpending’s raggedness index (r), were used to infer population historical dynamics. Mismatch distribution plots were observed using DnaSP v6.12.03 (Rozas et al. 2017 ). BEAST 2.7.4 (Drummond and Rambaut 2007 ) using Bayesian Skyline Plot (BSPs) was used to infer historical dynamics and approximate time ranges of the effective sample size for each genetic lineage, with parameter settings consistent with those used in divergence time analysis. Finally, Tracer 1.5 software was used to visualize and edit the historical dynamics of effective population size (Rambaut et al. 2018 ). Nuclear microsatellite genotyping and data analysis Preliminary analysis indicates that Thymallus populations in the upper Irtysh River are conspecific. Because of maternal inheritance of mtDNA (Wallace 2007 ), we used 10 microsatellite loci markers for supplementary phylogenetic reconstruction to further understand genetic relationships between populations. Using FSTAT v2.9.3.2 (Goudet 2001 ), we calculated the number of alleles per locus, deviations based on the FIS values for Hardy–Weinberg equilibrium, and deviations from Linkage Equilibrium. ARLEQUIN v3.5.2.2 was used to calculate observed and expected heterozygosity, as well as to perform analyses based on the infinite allele model (FST), stepwise mutation model (RST), and AMOVA (Excoffier and Lischer 2010 ). GenAlEx was used to calculate Nei’s genetic distance among populations. Principal coordinates analysis (PCoA) was performed based on genetic distances between populations and individuals (Peakall and Smouse 2012 ). A clustering tree was constructed based on Nei’s genetic distance using MEGA (Tamura et al. 2021 ). Overall genetic structure was assessed using the Bayesian clustering method in STRUCTURE v2.3 (Porras-Hurtado et al. 2013 ). Prior values of K (number of populations) were assumed between 1 and 5. STRUCTURE was run for 100,000 iterations, with the first 50,000 iterations discarded as burn-in, and five independent MCMC replicates were performed for each K value. The Delta K statistic method (Earl and vonHoldt 2005) were used to determine the most suitable K value. After obtaining output results, K matrices from multiple runs were merged using CLUMPP (Jakobsson and Rosenberg 2007 ); the visualization was optimized using Distruct (Rosenberg 2004 ). To further decipher the potential genetic structure of Thymallus in the upper Irtysh River, a cluster analysis was conducted using the stochastic optimization method in BAPS 6.0 (Corander et al. 2008 ; Corander and Marttinen 2006 ). BAPS analysis parameters were initially set to K = 1 to 5, with each K value repeated 10 times; the maximum Log marginal likelihood [Log(ML)] value determines the best K. For population admixture analysis, the number of iterations was set to 1000; other settings remained at default values. To further understand divergence time and population history, we used the Approximate Bayesian Computation (ABC) algorithm implemented in the diyabcGUIv1.2.1 package (Collin et al. 2021 ). Population parameters for five hypothetical evolutionary scenarios were simulated and compared to observed data using Linear Discriminant Analysis (Cornuet et al. 2014 ). We used default uniform and wide priors for all parameters. Results Phylogenetic analysis All 161 samples were successfully sequenced for both CR and Cyt b genes. The CR gene was 1072 bp in length, with 14 variable and parsimony informative sites, resulting in 18 haplotypes. Upon combining our sequences with CR sequences from T. brevicephalus and T. brevirostris , a total of 220 sequences were generated, with 28 variable sites, 22 of which were parsimony informative, resulting in 28 CR haplotypes. The Cyt b gene was 1105 bp long, with 4 variable sites, all being parsimony informative, resulting in 4 Cyt b haplotypes. Concatenating each sample into a 2177 bp sequence in the format of 5'-Cyt b + CR-3’ for phylogenetic analysis yielded 17 variable sites, all of which were parsimony informative. The concatenated dataset resulted in a total of 26 mtDNA haplotypes, indicating high haplotype diversity (0.907) and low nucleotide diversity (0.00202) (Table 3 ). Table 3 Genetic diversity indices for 10 populations of Thymallus brevicephalus based on Cyt b, CR, and concatenated Cyt b + CR sequence data sets Sequence Population n S h Hd k π Cyt b HB 15 1 2 0.248 0.24762 0.00022 BH 7 1 2 0.571 0.57143 0.00052 KN 15 2 2 0.133 0.26667 0.00024 CE 15 2 2 0.533 1.06667 0.00097 BE 15 2 2 0.514 1.02857 0.00093 HM 13 2 2 0.462 0.92308 0.00084 HQ 15 2 2 0.514 1.02857 0.00093 KE 16 2 2 0.5 1 0.0009 KL 25 0 0 0 0 0 KY 25 1 2 0.453 0.45333 0.00041 Total 161 4 4 0.456 0.823414 0.00074 CR HB 15 4 4 0.686 1.25714 0.00117 BH 7 2 3 0.762 0.95238 0.00089 KN 15 7 8 0.848 2.34286 0.00219 CE 15 6 5 0.81 2.68571 0.00251 BE 15 6 5 0.79 2.4381 0.00227 HM 13 5 4 0.744 1.97436 0.00184 HQ 15 6 5 0.819 2.41905 0.00226 KE 16 9 7 0.825 3.09167 0.00288 KL 25 2 3 0.477 0.5 0.00047 KY 25 4 5 0.607 1.02 0.00095 Total 161 14 18 0.884 3.60621 0.00336 Cyt b + CR HB 15 5 4 0.686 1.50476 0.00069 BH 7 2 3 0.762 0.95238 0.00089 KN 15 7 8 0.848 2.34286 0.00219 CE 15 6 5 0.81 0.68571 0.00251 BE 15 6 5 0.79 2.4381 0.00227 HM 13 5 4 0.744 1.97436 0.00184 HQ 15 6 5 0.819 2.41905 0.00226 KE 16 9 7 0.825 3.09167 0.00288 KL 25 2 3 0.477 0.5 0.00047 KY 25 4 5 0.607 1.02 0.00095 Total 161 17 26 0.907 4.40357 0.00202 Two phylogenetic methods were used to construct trees with identical topological structures (Fig. 2 ). Images illustrate node-support values obtained from tree-building methods. Following divergence of Thymallus tugarinae in the easternmost Eurasian continent, two Thymallus species within the Baikal Lake region split, forming a distinct branch with Thymallus species from the Altai–Sayan Mountains. The two Thymallus species in the upper Irtysh River may be conspecific ( T. brevicephalus ) and form a clear geographical structure pattern internally. These findings receive robust support from bootstrap values. Notably, T. brevicephalus from the upper Irtysh River in China and Kazakhstan form a clade, which then clusters with T. brevirostris from east of the Altai Mountains. According to the time-calibrated CR phylogenetic estimation (Fig. 3 ), the divergence time between T. brevirostris and T. brevicephalus is estimated at 0.81 MY (0.57–1.08). The time to the most recent common ancestor for the clade A and B within T. brevicephalus is estimated to be 0.48 MY (0.30–0.71), with a divergence time of 0.39 MY (0.18–0.60) within clade A and 0.28 Ma (0.13–0.47) within clade B. Tamura-Nei and Kimura 2-parameter genetic distance values (Table 4 ) reveal two populations within T. brevicephalus , with the average genetic distance between downstream group A from Kazakhstan and China and upstream group B being 0.00505; the average genetic distance between T. brevicephalus clade A from Kazakhstan and China is 0.00226. Table 4 Tamura-Nei genetic distance (below diagonal), Kimura 2-parameter genetic distance values between pairs of populations (above diagonal) based on the CR sequence data set Clade A(CN) A(KZ) B T. brevirostris T: nikolskyi T. brevicephalus A(CN) 0.00226 0.00514 0.00601 0.01923 T. brevicephalus A(KZ) 0.00226 0.00497 0.00636 0.01972 T. brevicephalus B 0.00514 0.00496 0.00623 0.01990 T. brevirostris 0.00601 0.00636 0.00623 0.01768 T: nikolskyi 0.01919 0.01967 0.01985 0.01764 Mismatch distribution analysis based on CR and Cyt b + CR sequences indicates a unimodal distribution for T. brevicephalus as a whole (Fig. 4 a, d) and for clade A (Fig. 4 b, e). BSP analysis (Fig. 5 a, b) reveals sustained expansion events for both the entire T. brevicephalus population and clade A over an extended period (0.4–0.1 MY). Negative Fu’s Fs and Tajima’s D values also corroborate these population expansion events (Table 5 ). Table 5 Mismatch distribution and neutrality test for five populations of T. brevicephalus based on the CR and concatenated Cyt b + CR sequence data sets Sequence haplotype clade SSD r Tajima’s D Fu’s Fs CR Total 0.0045 0.0123 −1.011 −5.975 Clade A 0.0037 0.0214 −1.280 −2.848 Clade B 0.0001 0.0527 −0.141 −1.468 Cyt b + CR Total 0.0093 0.0179 1.240 −5.066 Clade A 0.0068 0.0185 0.811 −4.319 Clade B 0.0091 0.0897 −0.829 −0.745 The CR haplotype network (Fig. 6 a) identifies only two mutational steps between T. brevirostris and T. brevicephalus . No shared haplotypes in Crane River (KE) occur between its eastern and western branches. Within the upper Irtysh River, T. brevicephalus populations differentiate into two branches along Crane River, where the most common T. brevicephalus haplotype is shared among individuals from all locations west of Crane River (Kal, Rur, Kka, BH, KN, BE, CE, HM, HQ, KE), excepting Kara-Kaba River (HB). Haplotype I2 is inferred to be an ancestral haplotype for the western branch. Individuals from Crane River and its eastern counterparts (KL, KY) share no haplotypes with the western branch. To clarify the geographic structure of T. brevicephalus , analysis of the Cyt b + CR haplotype network (Fig. 6 b) reveals the Crane River population shares no haplotypes with the eastern branch, and for the combined haplotype network to provide a clearer distinction between the eastern and western branches. Genetic diversity and genetic structure of microsatellite data AMOVA (Table 6 ) reveals the major source of genetic variation to come from within geographic populations (92.61%), rather than among them (7.39%), indicating significant population differentiation (fixation index = 0.073, P < 0.001). When the five populations are divided into western and eastern groups, AMOVA results for the two groups reveal 4.21% of genetic variation comes from between the western and eastern regions (FCT = 0.042). Additionally, 91.36% of genetic variation is attributed to individual variation within geographic populations (fixation index = 0.086, P < 0.001), and 4.43% of it arises among geographic populations within regions (FSC = 0.04628, P < 0.001). AMOVA results indicate significant genetic differentiation among T. brevicephalus populations in the upper Irtysh River, with a certain degree of genetic divergence between western and eastern populations. Table 6 Molecular variance (AMOVA) for T. brevicephalus population genetic variation based on Cyt b, CR and concatenated Cyt b + CR sequence data sets, and nuclear DNA microsatellite variation Source of variation df Variance component Percentage of variation Fixation index Cyt b Among populations 9 0.12191 28.73 FST = 0.28733*** Within populations 151 0.30238 71.27 — Between regions (west/east) 1 0.07056 15.31 FCT = 0.15310 Among populations within regions 8 0.08796 19.08 FSC = 0.22534*** Within populations 151 0.30238 65.61 FST = 0.34394*** CR Among populations 9 1.0214 53.49 FST = 0.53485*** Within populations 151 0.88828 46.51 — Between regions (west/east) 1 1.82666 63.82 FCT = 0.63924 Among populations within regions 8 0.14259 4.99 FSC = 0.13832*** Within populations 151 0.88828 31.09 FST = 0.68914*** Cyt b + CR Among populations 9 1.13727 49.01 FST = 0.49011*** Within populations 151 1.18318 50.99 — Between regions (west/east) 1 1.87709 56.98 FCT = 0.56977 Among populations within regions 8 0.2342 7.11 FSC = 0.16523*** Within populations 151 1.18318 35.91 FST = 0.64086*** Microsatellites Among populations 4 0.23145 7.39 FST = 0.07393*** Within populations 217 2.89927 92.61 — Between regions (west/east) 1 0.13354 4.21 FCT = 0.04208 Among populations within regions 3 0.14069 4.43 FSC = 0.04628*** Within populations 217 2.89927 91.36 FST = 0.08641*** **P < 0.01, ***P < 0.001; FST, genetic differences among populations; FCT, genetic differences among groups defined a priori; FSC: genetic differences among populations within groups. Nei’s unbiased pairwise genetic distance values range 0.073–0.752 (Table 7 ). The average genetic distance within the eastern population (0.24) and average genetic distance within the western population (0.34) are both below the average genetic distance between the eastern and western populations (0.62). Pairwise FST values (Table 7 ) range 0.021–0.084. The average genetic distance within the eastern population (0.040) and average genetic distance within the western population (0.043) are both below the average genetic distance between the two populations (0.065). Table 7 Matrix of pairwise FST values (below diagonal) and Nei’s unbiased genetic distances (above diagonal) among five T. brevicephalus populations based on microsatellite data HB KN KE KL KY HB 0.388 0.550 0.692 0.752 KN 0.046373 0.073 0.457 0.575 KE 0.061698 0.020806 0.554 0.691 KL 0.069356 0.044378 0.05596 0.244 KY 0.084104 0.061803 0.074891 0.040979 For T. brevicephalus , at four microsatellite sampling locations (HB, KN, KE, KY), significant deviations from Hardy–Weinberg equilibrium are observed (Table 8 ). There are 41 loci that significantly deviate from this equilibrium (P < 0.05), suggesting that populations may not adhere to random mating and could be influenced by factors such as genetic mutations and migration. Table 8 P-values for Hardy–Weinberg equilibrium chi-square tests at ten microsatellite loci for five T. brevicephalus populations HB KN KE KL KY ClaTet1 0.5232 0.5956 0.0148 0.5104 0.2589 BFRO004 0.0399 0.2758 0.1645 0.0005 0.8125 BFRO010 0.4549 0.0373 0.001 0 0.1578 Tar100 0.7809 0.0016 0.0011 0.0448 0.0666 Tar101 0.5605 0 0 0 0.6783 Tar103 0.0028 0.0509 0.0009 0.0011 0.5048 Tar110 0.2827 0 0.0002 0 0.0925 Tar112 0.2093 0.4205 0 0 0.1032 Tth313 0.0464 0.429 0.0104 0.0264 0.2891 Tth445 0.1862 0.6825 0 0.031 0.0031 The average expected heterozygosity for all sampling locations is relatively high, ranging 0.748 (KN) to 0.860 (KY). Average observed heterozygosity for all sampling locations is also high, ranging 0.623 (KL) to 0.677 (KE). Mean expected heterozygosity values are higher than mean observed heterozygosity values, and all populations exhibit positive FIS values, indicating a higher proportion of homozygotes than heterozygotes (Table 9 ). This suggests a lack of sufficient heterozygotes within the populations, potentially indicating a level of inbreeding. Table 9 Genetic statistical summaries of microsatellite analysis for five T. brevicephalus populations Sample code NA AR HO HE FIS HB 10 2.963 0.64615 0.82154 0.07347 KN 12 4.77 0.66666 0.87592 0.13775 KE 7.7 4.92 0.67727 0.84642 0.10068 KL 11.6 3.005 0.62321 0.80107 0.09643 KY 6.5 2 0.58333 0.7721 0.02566 The Neighbor-joining clustering tree based on Nei’s unbiased genetic distances (Fig. 7a) reveals the five populations to form two branches, with KL and KY clustering together, and with KN, KE, and HB forming another cluster. The PCoA plot further supports the inferred divergence between eastern and western clades of the Irtysh River population. Based on pairwise genetic distances between individuals (Fig. 7b) and variances along the first (8.94%) and second (7.21%) axes, individuals from HB, KN, and KE mainly cluster in quadrants 1 and 2, while KL and KY individuals predominantly cluster in quadrants 3 and 4, displaying a left–right distribution. Similar results are observed in the PCoA plot based on genetic distances between populations (Fig. 7c), where populations from HB, KN, and KE are situated to the right of the y-axis, while KL and KY populations are positioned to its left. STRUCTURE analysis indicates that the highest posterior probability was observed at ΔK = 2 (Fig. 8a), supporting K = 2 as the optimal solution. Consequently, we present the clustering model (Fig. 8c), revealing that individuals belonging to the western populations of T. brevicephalus (HB, KN, KE) form one cluster, while individuals from the eastern populations (KL, KY) constitute another, with membership coefficients > 96.4% for all individuals. BAPS analysis reveals the Log(ML) statistic to peak at K = 3 (Fig. 8b). While there was some evidence of a third color cluster in KE and KN, the overall pattern (Fig. 8d) of differentiation is consistent with the STRUCTURE model. This suggests that KE and to a lesser extent KN populations exhibit higher levels of genetic differentiation, which appears to be unique. This pattern aligns with conclusions drawn from clustering tree and PCoA analyses, supporting the existence of two groups among the five populations of T. brevicephalus . Linear discriminant analysis results from DIYABC, with observed values distributed within the range of scenario 1 (Fig. 9), indicate that the initial split occurred between the western populations KE, KN, and HB and the eastern populations KL and KY (t1). Among the western populations, HB was the first to split (t2), followed by splits of KN and KE. Eastern populations split at time point t45. Discussion Speciation resulting from uplift of the Altai Mountains Combining geographical distribution and divergence time, T. brevirostris and T. brevicephalus were geographically isolated on the northern and southern sides of the Altai Mountains at approximately 0.81 MY. This isolation is attributed to geological changes induced by the second uplift of the Altai Mountains since the Middle Pleistocene (1.00 MY) (Bolikhovskaya and Shunkov 2014;Pan et al. 2007 ; Zang et al. 2015 ). This geological shift caused changes in drainage system patterns and the migration of main river channels, which likely affected regional fish habitat, and isolated T. brevirostris and T. brevicephalus on opposite sides of the Altai Mountains. Many mountainous regions globally exhibit noticeable disparities in drainage systems and ecosystems on either side, which are often attributed to the results of tilting movements. For instance, Thymallus in the Baikal Lake basin have distributions affected by rearrangement of river systems and the formation of watersheds because of mountain uplift (Knizhin et al. 2006d ; Koskinen et al. 2002b ). The rapid uplift of the Qinling Mountains has led to river capture-related events, resulting in fish dispersion and the formation of isolated habitats in the north and south ( Liu et al. 2014 ; Chen et al. 2022 ). During this period, the Altai Mountains moved, with one end of the fault block forming a near-upright tilted structure, and on the southern slope there is a continuous mountain massif. The asymmetric north–south topography created distinct environments for fish. The steep and short northern slope of the Altai Mountains lies adjacent to the large Mongolian Kobdo Basin. T. brevirostris underwent divergent evolution within the basin, and developed a phenotype that included well-developed jaws and teeth as probable adaptations to harsher environmental conditions (Knizhin et al. 2008 ). The characteristics exhibited by T. brevicephalus in these river valleys resemble those of other Thymallus species that inhabit similar environments (Kavanagh et al. 2010 ). Glacial-interglacial cycles and genetic diversity in response to Quaternary climatic events In the Altai Mountains of China during the Quaternary period there was significant glacial activity. This included the Burqin Glaciation during the Middle Pleistocene, the second-to-last glaciation at the end of the Middle Pleistocene, and the Last Glacial Maximum during the Late Pleistocene (Pan et al. 2007 ; Zang et al. 2015 ). During glacial periods in this region, glacial refugia likely led to significant population fragmentation and lineage differentiation. We combined mitochondrial and nuclear genetic data to resolve genetic structure of T. brevicephalus in the upper Irtysh River. We report two distinct populations in this area, with the Crane River acting as a natural boundary to them in the upstream region. Moderate genetic differentiation exists between eastern (Karaertis and Kayiertesi rivers) and western (Kara-Kaba, Akkaba, Kanas River, Burqin, Hemu and Crane rivers, and Chonghuer and Hongqi reservoirs) populations. We hypothesize that differences in these lineages are associated with the occurrence of refuges, a concept supported by various theories. For example, two spatially separated lineages of Thymallus in Lena River may have arisen through prevalence of a Polar continental shelf ice sheet during the Siberian Pleistocene, which isolated Thymallus populations in glacial refugia in the Lena Delta and middle reaches of Lena River (Weiss et al. 2006 ). In Europe, the European grayling ( Thymallus thymallus ) exhibits significant genetic differences over relatively short geographical distances, a phenomenon attributed to glaciation-mediated processes (Gum et al. 2005 ; Koskinen et al. 2002c ). Similarly, in North America, T. arcticus underwent genetic differentiation during a Pleistocene glacial period because of refugia formation (Redenbach and Taylor 1999 ; Stamford and Taylor 2004 ). The estimated divergence time indicates that the eastern and western T. brevicephalus lineages first split approximately 0.48 MY. During the continuous uplift of the Altai Mountains, the region experienced its first Quaternary glaciation. As the Altai Mountains froze, their southern slope was influenced by the MIS12 Burqin Glaciation (0.47 ± 0.051 MY) (Devyatkin 1981 ; Jiang 2012 ), during which time the climate cooled significantly, and many glaciers developed. A substantial body of evidence suggests that moderate differentiation occurred between the eastern and western populations during this time, with detailed evidence from DIYABC indicating that T. brevicephalus populations survived in river valleys between glacial intervals. For instance, the ancestral haplotype I2 of the western population likely resided in refuges such as the Kanas River valley or the Kara-Kaba River valley. Green toads ( Bufo viridis subgroup) which also require freshwater for breeding activities, have been found in this region, indicating the potential existence of glacial refuges in later Pleistocene stages (Zhang et al. 2008 ). During interglacial periods, formerly fragmented populations in the Altai region expanded their distributions, triggering founder effects (Guo et al. 2019 ). The mismatch distribution and BSP indicate that T. brevicephalus experienced extensive postglacial colonization from separate refugia from ~ 0.4–0.1 MY. Significant negative Fu’s Fs and Tajima’s D values also provide evidence for population expansion, with the diffusion pattern in the haplotype network further supporting this inference. These phenomena are likely associated with an interglacial following a glacial period, when water temperatures rose, and Glacial Lake Outburst Floods resulted from glacial meltwater (Agatova et al. 2019 ; Bohorquez et al. 2019 ; Herget et al. 2020 ) to create conditions for eastward and westward population expansion. High haplotype and low nucleotide diversities reflect the process of population expansion in T. brevicephalus following a glacial period. While haplotype diversity increased, there was insufficient accumulation of nucleotide variation, leading to a founder effect produced by a single or few populations. Additionally, a contact zone (Larson et al. 2013 ; Wen and Fu 2021 ) was identified in the central Altai Mountains, specifically in Crane River. The haplotype network indicates that the population in this contact zone (KE) possesses haplotypes from both populations A and B. Analyses such as AR, HO, HE, and BAPS consistently reveal the Crane River population, with mixed ancestry, exhibits levels of genetic diversity higher than those observed in other populations. Conservation and Management Considerations: Research Implications The unique environment presented by the Altai Mountains has fostered a rich diversity of flora and fauna, making it one of the most abundant natural gene pools in Central Asia. However, over the past 50 years anthropogenic disturbances such as overfishing, mineral resource development, tourism, and the construction of roads and hydropower stations have posed an increasing threat to the habitats of rare and endangered wildlife in the Altai region. Of concern is that the salmonid Stenodus leucichthys , which shares migratory habits with T. brevicephalus , was the primary catch in the upper reaches of the Irtysh River during the 1960s. However, downstream hydroelectric facility construction in the OB River and Irtysh River prevents upstream migration of this species to spawn in China (Freyhof and Emma 2011 ; Poursaeid and Falahatkar 2012 ). Consequently, S. leucichthys has disappeared within China and is now considered to be regionally extinct. To mitigate the adverse impacts caused by sharp increases in human activity, and to protect the genetic resources of aquatic species and their habitats, the Chinese government established several aquatic germplasm resource protection zones in the upper Irtysh River. Within these zones artificial breeding and enhancement efforts occur, including the artificial propagation and release of various rare aquatic organisms such as T. brevicephalus to ensure their viability. The moderate level of genetic differentiation between eastern and western populations suggests that T. brevicephalus exhibits a conservative behavioral pattern typical of the genus (Gönczi 1989 ; Northcote 1995 ; Nykänen et al. 2001 ). Among the six haplotypes found in Karaertis and Kayiertesi river populations of the eastern group, only two are shared. This indicates that gene flow between adjacent rivers for T. brevicephalus is rare, a phenomenon that is even more pronounced at the species level. For instance, significant phenotypic and genetic divergence between T. brevicephalus on the southern and T. brevirostris on the northern slopes of the Altai Mountains suggests substantial differentiation. Additionally, T. nikolskyi , which shares the Ob-Irtysh River system with T. brevicephalus , also exhibits a complete absence of gene flow despite there being no drainage basin isolation. These unique life history traits have significant implications for the conservation and management of both intra- and inter-species diversity within this genus. Conservation must consider genetic characteristics of species. We demonstrate relatively low overall genetic diversity in T. brevicephalus , and relatively poor diversity within each geographical population, indicating a need to manage this species. Observed genetic differences between eastern and western populations suggest that individuals from the upper Irtysh River in China and those in Lake Markokol, Kazakhstan, belong to a single population, with the Kara-Kaba River serving as a natural boundary between the two countries. International cooperation in conservation is therefore required to protect fish resources throughout this area. Management units refer to taxonomic units with a common ancestor and some degree of genetic independence, while evolutionarily significant units need to demonstrate significantly different genetic compositions, exhibit reciprocal monophyly in lineage relationships, and show clear isolation from other populations. Currently, T. brevicephalus has developed a moderate degree of genetic differentiation. Given the existence of a contact zone, T. brevicephalus has yet to achieve complete geographic isolation. Following the principles proposed by Moritz ( 1994 ) and Waples ( 1991 ), we recommend that two separate management units are established to best conserve this species, and that these be divided by the Crane River. Declarations Funding This work was supported by Special Funds for Basic Research Operating Costs of Chinese Academy of Fishery Sciences(NO.2023TD07)and Normalized monitoring of fishery resources and environment in key waters of Northwest, Ministry of Agriculture and Rural Affairs, China Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions All authors contributed to the study conceptualization and design. Material preparation and data collection were carried out by Bo Ma, Haoxiang Han and Wenjie Peng, and analysis was performed by Wenjie Peng and Bo Ma. The first draft of the manuscript was written by Wenjie Peng and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data Availability The datasets generated during and analysed during the current study are available in the GenBank (PP425404 - PP425725) Compliance with Ethical Standards welfare of animals This study has passed the application for ethical review of experimental animal welfare at the Heilongjiang Fisheries Research Institute (20190820-001) and normalized monitoring of fishery resources and environment in key waters of Northwest, Ministry of Agriculture and Rural Affairs, China References Agatova AR, Nepop RK, Khazin LB, et al (2019) New Chronological, Paleontological, and Geochemical Data on the Formation of Glacier-Dammed Lakes in the Kurai Depression (Southeastern Russian Altai) at the End of the Late Pleistocene. Doklady Earth Sciences 488:1134–1136. https://doi.org/10.1134/s1028334x19090228 Andrushchenko P, Zuev I, Kislitsina N, et al (2023) Summer Time Distribution of Sedentary and Migratory Individuals of the Baikal Grayling T. baicalensis in the Tributaries of the Thermally Altered Section of the Yenisei River. Journal of Siberian Federal University Biology 15:491–506. https://doi.org/10.17516/1997-1389-0400 Bohorquez P, Jimenez-Ruiz PJ, Carling PA (2019) Revisiting the dynamics of catastrophic late Pleistocene glacial-lake drainage, Altai Mountains, central Asia. Earth-Science Reviews 197:102892. https://doi.org/10.1016/j.earscirev.2019.102892 Bolikhovskaya NS, Shunkov MV (2014) Pleistocene Environments of Northwestern Altai: Vegetation and Climate. Archaeology, Ethnology and Anthropology of Eurasia 42:2–17. https://doi.org/10.1016/j.aeae.2015.01.001 Capobianco A, Friedman M (2019) Vicariance and dispersal in southern hemisphere freshwater fish clades: a palaeontological perspective. Biol Rev 94:662–699. https://doi.org/10.1111/brv.12473 Chen T, Jiao L, Ni L (2022) The phylogeographical pattern of the Amur minnow Rhynchocypris lagowskii (Cypriniformes: Cyprinidae) in the Qinling Mountains. Ecol Evol 12:e8924. https://doi.org/10.1002/ece3.8924 Collin FD, Durif G, Raynal L, et al (2021) Extending approximate Bayesian computation with supervised machine learning to infer demographic history from genetic polymorphisms using DIYABC Random Forest. Mol Ecol Resour 21:2598–2613. https://doi.org/10.1111/1755-0998.13413 Corander J, Marttinen P (2006) Bayesian identification of admixture events using multilocus molecular markers. Mol Ecol 15:2833–43. https://doi.org/10.1111/j.1365-294X.2006.02994.x Corander J, Marttinen P, Sirén J, Tang J (2008) Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC Bioinf 9:539. https://doi.org/10.1186/1471-2105-9-539 Cornuet JM, Pudlo P, Veyssier J, et al (2014) DIYABC v2.0: a software to make approximate Bayesian computation inferences about population history using single nucleotide polymorphism, DNA sequence and microsatellite data. Bioinformatics 30:1187–1189. https://doi.org/10.1093/bioinformatics/btt763 Devyatkin E. B (1981) Cenozoic of Inner Asia (stratigraphy, geochronology, correlation). Science, Moscow Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Ecol Evol 7:214. https://doi.org/10.1186/1471-2148-7-214 Dyldin Y, Hanel L, Romanov V, Plesnik J (2017) A review of the genus Thymallus (Pisces: Salmoniformes, Salmonidae, Thymallinae) with taxonomic notes. Bulletin Lampetra 8:103–126 Earl DA, vonHoldt BM (2012) STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 4:359–361 Edler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373–377. https://doi.org/10.1111/2041-210X.13512 Excoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564–7. https://doi.org/10.1111/j.1755-0998.2010.02847.x Freyhof J and Emma GE (2011) European Red List of freshwater fishes. Publications Office of the European Union, Luxembourg Froufe E, Alekseyev S, Knizhin I, et al (2003a) Comparative phylogeography of salmonid fishes (Salmonidae) reveals late to post-Pleistocene exchange between three now-disjunct river basins in Siberia. Divers Distrib 9:269–282. https://doi.org/10.1046/j.1472-4642.2003.00024.x Froufe E, Knizhin I, Koskinen MT, et al (2003b) Identification of reproductively isolated lineages of Amur grayling ( Thymallus grubii Dybowski 1869): concordance between phenotypic and genetic variation. Mol Ecol 12:2345–55. https://doi.org/10.1046/j.1365-294x.2003.01901.x Ginson R, Walter RP, Mandrak NE, et al (2015) Hierarchical analysis of genetic structure in the habitat-specialist Eastern Sand Darter ( Ammocrypta pellucida ). Ecol Evol 5:695–708. https://doi.org/10.1002/ece3.1392 Gönczi AP (1989) A study of physical parameters at the spawning sites of the european grayling ( Thymallus thymallus L . ). Regulated Rivers: Research & Management 3:221–224. https://doi.org/10.1002/rrr.3450030121 Goudet J-M (2001) FSTAT, a program to estimate and test gene diversities and fixation indices, version 2.9. 3. http://www2. unil. ch/popgen/softwares/fstat. htm. Gum B, Gross R, Kuehn R (2005) Mitochondrial and nuclear DNA phylogeography of European grayling ( Thymallus thymallus ): evidence for secondary contact zones in central Europe. Mol Ecol 14:1707–1725. https://doi.org/10.1111/j.1365-294X.2005.02520.x Guo XZ, Zhang GR, Wei KJ, et al (2019) Phylogeography of the threatened tetraploid fish, Schizothorax waltoni , in the Yarlung Tsangpo River on the southern Qinghai-Tibet Plateau: implications for conservation. Sci Rep 9:2704. https://doi.org/10.1038/s41598-019-39128-y Guo Y, Zhang RM, Cai LG (2012) Fishes of Xinjiang. Xinjiang Science and Technology Press, Urumqi Herget J, Agatova AR, Carling PA, Nepop RK (2020) Altai megafloods—The temporal context. Earth-Science Reviews 200:102995. https://doi.org/10.1016/j.earscirev.2019.102995 Huangfu PP, Fan W, Li Z-H, et al (2023) Linkage between the India–Asia collision and far-field reactivation of the Altai mountains. Palaeogeography, Palaeoclimatology, Palaeoecology 616:111478. https://doi.org/10.1016/j.palaeo.2023.111478 Jacobsen MW, Hansen MM, Orlando L, et al (2012) Mitogenome sequencing reveals shallow evolutionary histories and recent divergence time between morphologically and ecologically distinct European whitefish ( Coregonus spp.). Mol Ecol 21:2727–2742. https://doi.org/10.1111/j.1365-294X.2012.05561.x Jakobsson M, Rosenberg NA (2007) CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23:1801–1806. https://doi.org/10.1093/bioinformatics/btm233 Janosik AM, Whitaker JM, Johnston CE (2023) Phylogeography and population structure of the Rock Darter species complex, Etheostoma rupestre (Teleostomi: Percidae) across the Mobile River Basin. Hydrobiologia 850:761–773. https://doi.org/10.1007/s10750-022-05122-1 Jens-Christian S, Wolf L, Signe N, et al (2015) The Influence of Paleoclimate on Present-Day Patterns in Biodiversity and Ecosystems. Annu Rev Ecol Evol S46:551–572. https://doi.org/10.1146/annurev-ecolsys-112414-054314 Jiang HL (2012) A Study on Quaternary Glacial Evolution Sequences in the Kanas River, Altai Mountains - Application on Dating of Optically Stimulated Luminescence. Dissertation, Northwest Normal University Kavanagh KD, Haugen TO, Gregersen F, et al (2010) Contemporary temperature-driven divergence in a Nordic freshwater fish under conditions commonly thought to hinder adaptation. BMC Evol Biol 10:350. https://doi.org/10.1186/1471-2148-10-350 Knizhin IB, Bogdanov BE, Vasil’eva EA (2006a) Biological and morphological characteristic of the Arctic grayling Thymallus arcticus (Thymallidae) from Alpine Lakes of the basin of the upper reaches of the Angara River. J Ichthyol 46:709–721. https://doi.org/10.1134/S0032945206090037 Knizhin IB, Kirillov AF, Weiss SJ (2006b) On the diversity and taxonomic status of graylings ( Thymallus Thymallidae ) from the Lena River. J Ichthyol 46:234–246. https://doi.org/10.1134/S0032945206030039 Knizhin IB, Weiss SJ (2009) A new species of grayling Thymallus svetovidovi sp. nova (Thymallidae) from the Yenisei basin and its position in the genus Thymallus. J Ichthyol 49:1–9. https://doi.org/10.1134/S0032945209010019 Knizhin IB, Weiss SJ, Bogdanov BE, et al (2006c) Finding a new form of the grayling Thymallus arcticus (thymallidae) in the basin of lake baikal. J Ichthyol 46:34–43. https://doi.org/10.1134/S003294520601005X Knizhin IB, Weiss SJ, Bogdanov BE, et al (2008) Graylings (Thymallidae) of water bodies in western Mongolia: Morphological and genetic diversity. J Ichthyol 48:714–735. https://doi.org/10.1134/S0032945208090038 Knizhin IB, Weiss SJ, Sušnik S (2006d) Graylings of Baikal Lake basin (Thymallus, Thymallidae): Diversity of forms and their taxonomic status. J Ichthyol 46:418–435. https://doi.org/10.1134/S0032945206060026 Koskinen MT, Knizhin I, Primmer CR, et al (2002a) Mitochondrial and nuclear DNA phylogeography of Thymallus spp. (grayling) provides evidence of ice-age mediated environmental perturbations in the world’s oldest body of fresh water, Lake Baikal. Mol Ecol 11:2599–2611. https://doi.org/10.1046/j.1365-294X.2002.01642.x Koskinen M, Nilsson J, Veselov AJ, et al (2002b) Microsatellite data resolve phylogeographic patterns in European grayling, Thymallus thymallus , Salmonidae. Heredity 88:391–401. https://doi.org/10.1038/sj.hdy.6800072 Koskinen MT, Piironen J, Primmer CR (2001) Interpopulation genetic divergence in European grayling ( Thymallus thymallus , Salmonidae) at a microgeographic scale: implications for conservation. Conserv Genet 2:133–143. https://doi.org/10.1023/A:1011814528664 Koskinen MT, Sundell P, Piironen J, Primmer CR (2002c) Genetic assessment of spatiotemporal evolutionary relationships and stocking effects in grayling ( Thymallus thymallus , Salmonidae). Ecol Lett 5:193–205. https://doi.org/10.1046/j.1461-0248.2002.00302.x Larkin MA, Blackshields G, Brown NP, et al (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–8. https://doi.org/10.1093/bioinformatics/btm404 Larson EL, White TA, Ross CL, Harrison RG (2013) Gene flow and the maintenance of species boundaries. Mol Ecol 23:1668–1678. https://doi.org/10.1111/mec.12601 Leigh JW, Bryant D (2015) popart: full-feature software for haplotype network construction. Methods Ecol Evol 6:1110–1116. https://doi.org/10.1111/2041-210X.12410 Letunic I, Bork P (2021) Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res 49:W293-w296. https://doi.org/10.1093/nar/gkab301 Liang Y, He D, Jia Y, et al (2017) Phylogeographic studies of schizothoracine fishes on the central Qinghai-Tibet Plateau reveal the highest known glacial microrefugia. Sci Rep 7:10983. https://doi.org/10.1038/s41598-017-11198-w Liu H, Li Y, Liu X, et al (2014) Phylogeographic structure of Brachymystax lenok tsinlingensis (Salmonidae) populations in the Qinling Mountains, Shaanxi, based on mtDNA control region. Mitochondrial DNA Part A 26:532–537. https://doi.org/10.3109/19401736.2013.865168 Liu YG, Li YY, Meng W, Liu LX (2016) The complete mitochondrial DNA sequence of Xinjiang arctic grayling Thymallus arcticus grubei . Mitochondrial DNA Part B 1:724–725. https://doi.org/10.1080/23802359.2016.1229589 Ma B, Lui T, Zhang Y, Chen J (2012) Phylogeography and Population Genetic Structure of Amur Grayling Thymallus grubii in the Amur Basin. Asian-Australasian journal of animal sciences 25:935–44. https://doi.org/10.5713/ajas.2011.11500 Moritz C (1994) Defining ‘Evolutionarily Significant Units’ for conservation. Trends Ecol Evol 9:373–375. https://doi.org/10.1016/0169-5347(94)90057-4 Northcote TG (1995) Comparative biology and management of Arctic and European grayling (Salmonidae, Thymallus). Rev Fish Biol Fish 5:141–194. https://doi.org/10.1007/BF00179755 Nykänen M, Huusko A, Mäki-Petäys A (2001) Seasonal changes in the habitat use and movements of adult European grayling in a large subarctic river. J Fish Biol 58:506–519. https://doi.org/10.1111/j.1095-8649.2001.tb02269.x Nylander J (2004) MrModeltest V2. Program Distributed by the Author. Bioinformatics 24:581–583 Pan S, Zhang W, Zhou GH, Zhang W (2007) Effect of lilted Uplift and Strike Sip Shear Structure of AltaiMountains on Ergisi and Wiungu River Basin Envron ment. Geological Science and Technology Information 26:19–24. https://doi.org/1000-7849(2007)02-0019-06 Peakall R, Smouse PE (2012) GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28:2537–2539. https://doi.org/10.1093/bioinformatics/bts460 Porras-Hurtado L, Ruiz Y, Santos C, et al (2013) An overview of STRUCTURE: applications, parameter settings, and supporting software. Front Genet 4:98. https://doi.org/10.3389/fgene.2013.00098 Poursaeid S, Falahatkar B (2012) Threatened fishes of the world: Stenodus leucichthys leucichthys Güldenstädt, 1772 (Salmonidae). AQUA: International Journal of Ichthyology 18: 31-34. Rambaut A, Drummond AJ, Xie D, et al (2018) Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst Biol 67:901–904. https://doi.org/10.1093/sysbio/syy032 Redenbach Z, Taylor EB (1999) Zoogeographical implications of variation in mitochondrial DNA of Arctic grayling ( Thymallus arcticus ). Mol Ecol 8:23–35. https://doi.org/10.1046/j.1365-294x.1999.00516.x Ren ML, Guo Y, Zhang RM (2002) Fisheries Resources and Fishery of the Irtysh River in China. Xinjiang Science and Technology Press, Urumqi Ronquist F, Teslenko M, van der Mark P, et al (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42. https://doi.org/10.1093/sysbio/sys029 Rosenberg NA (2004) distruct: a program for the graphical display of population structure. Molecular Ecology Notes 4:137–138. https://doi.org/10.1046/j.1471-8286.2003.00566.x Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, et al (2017) DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol Biol Evol 34:3299–3302. https://doi.org/10.1093/molbev/msx248 Secci-Petretto G, Englmaier GK, Weiss SJ, et al (2023) Evaluating a species phylogeny using ddRAD SNPs: Cyto-nuclear discordance and introgression in the salmonid genus Thymallus (Salmonidae). Mol Phylogenet 178:107654. https://doi.org/10.1016/j.ympev.2022.107654 Skog A, Vøllestad LA, Stenseth NC, et al (2014) Circumpolar phylogeography of the northern pike ( Esox lucius ) and its relationship to the Amur pike ( E. reichertii ). Front Zool 11:67. https://doi.org/10.1186/s12983-014-0067-8 Slynko YV, Mendsaykhan B, Kas’anov AN (2010) On Intraspecies Forms of the Mongolian grayling ( Thymallus brevirostris Kessl.) from Hoton Nur Lake (Western Mongolia). J Ichthyol 50:28–37. https://doi.org/10.1134/S0032945210010042 Stamford MD, Taylor EB (2004) Phylogeographical lineages of Arctic grayling ( Thymallus arcticus ) in North America: divergence, origins and affinities with Eurasian Thymallus. Mol Ecol 13:1533–1549. https://doi.org/10.1111/j.1365-294X.2004.02174.x Suchard MA, Rambaut A (2009) Many-core algorithms for statistical phylogenetics. Bioinformatics 25:1370–6. https://doi.org/10.1093/bioinformatics/btp244 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022–3027. https://doi.org/10.1093/molbev/msab120 Wallace DC (2007) Why do we still have a maternally inherited mitochondrial DNA? Insights from evolutionary medicine. Annu Rev Biochem 76:781–821. https://doi.org/10.1146/annurev.biochem.76.081205.150955 Wang EZ, liao XL, Yang Z, et al (2019) Comparative analysis of mitochondrial genomes in Hucho taimen distributed in Amur and Irtysh River systems. Journal of Hydroecology 40:75–82. https://doi.org/10.15928/j.1674-3075.2019.04.010 Waples RS (1991) Pacific Salmon, Oncorhynchus spp., and the Definition of "Species" Under the Endangered Species Act. Marine Fisheries Review 53:11–22. Weiss S, Grimm J, Gonçalves DV, et al (2020a) Comparative genetic analysis of grayling ( Thymallus spp. Salmonidae) across the paleohydrologically dynamic river drainages of the Altai-Sayan mountain region. Hydrobiologia 847:2823–2844. https://doi.org/10.1007/s10750-020-04273-3 Weiss S, Knizhin I, Kirillov A, Froufe E (2006) Phenotypic and genetic differentiation of two major phylogeographical lineages of arctic grayling Thymallus arcticus in the Lena River, and surrounding Arctic drainages. Biological Journal of the Linnean Society 88:511–525. https://doi.org/10.1111/j.1095-8312.2006.00621.x Weiss S, Secci-Petretto G, Antonov A, Froufe E (2020b) Multiple species of grayling ( Thymallus sp.) found in sympatry in a remote tributary of the Amur River. Zool Scr 49:117–128. https://doi.org/10.1111/zsc.12393 Weiss SJ, Gonçalves DV, Secci-Petretto G, et al (2021) Global systematic diversity, range distributions, conservation and taxonomic assessments of graylings (Teleostei: Salmonidae; Thymallus spp.).Org Divers Evol 21:25–42. https://doi.org/10.1007/s13127-020-00468-7 Wen G, Fu J (2021) Isolation and reconnection: Demographic history and multiple contact zones of the green odorous frog ( Odorrana margaretae ) around the Sichuan Basin. Mol Ecol 30:4103–4117. https://doi.org/10.1111/mec.16021 Wiens JJ, Donoghue MJ (2004) Historical biogeography, ecology and species richness. Trends Ecol Evol 19:639–644. https://doi.org/10.1016/j.tree.2004.09.011 Zang W, Fu Y, Liu B, et al (2015) Geomorphological process of late Quaternary glaciers in Kanas river valley of the Altay Mountains. Acta Geographica Sinica 70:739–750. https://doi.org/10.11821/dlxb201505006 Zhang F, Zhu L, Zhang L, et al (2017) Phylogeography of freshwater fishes of the Qilian Mountains area ( Triplophysa leptosoma , Cobitidae: Cypriniformes). Environ Biol Fish100:1383–1396. https://doi.org/10.1007/s10641-017-0650-x Zhang YJ, Stöck M, Zhang P, et al (2008) Phylogeography of a widespread terrestrial vertebrate in a barely-studied Palearctic region: green toads ( Bufo viridis subgroup) indicate glacial refugia in Eastern Central Asia. Genetica 134:353–365. https://doi.org/10.1007/s10709-008-9243-0 Zhao J, Xiufeng Y, Harbor J, et al (2013) Quaternary glacial chronology of the Kanas River valley, Altai Mountains, China. Quat Int 311:44–53. https://doi.org/10.1016/j.quaint.2013.07.047 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4063125","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":278637174,"identity":"9ca9e5d1-20bb-4b8a-a887-a7fa7faa4aa8","order_by":0,"name":"Wenjie Peng","email":"","orcid":"","institution":"Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Wenjie","middleName":"","lastName":"Peng","suffix":""},{"id":278637178,"identity":"8356db92-fbb9-4e27-8040-8c9fd819a318","order_by":1,"name":"Haoxiang Han","email":"","orcid":"","institution":"Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences","correspondingAuthor":false,"prefix":"","firstName":"Haoxiang","middleName":"","lastName":"Han","suffix":""},{"id":278637179,"identity":"d898b820-9b95-4e88-8509-c082ab74f347","order_by":2,"name":"Bo Ma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuElEQVRIiWNgGAWjYBACAxDB2MAgx8befoA0LcZ8PGcSSNOSOE/CwYA4Leb8Z0w3/Nxhk94mwZDA8KNiG2EtljNyzG72nknLbZNuPMDYc+Y2EQ67wWN2g7ftcG6bzIEEZsY2YrScP2N282/b4XQ2iQQDIrUcyDG7DbQlgQQtN9LKbsueSTNsAwbyQeL8cv7wtptvd9jIy7e3H3zwo4IILQwMHIjoOECMeiBgf0CkwlEwCkbBKBixAACJo0CZ8NlJqAAAAABJRU5ErkJggg==","orcid":"","institution":"Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences","correspondingAuthor":true,"prefix":"","firstName":"Bo","middleName":"","lastName":"Ma","suffix":""}],"badges":[],"createdAt":"2024-03-10 08:16:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4063125/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4063125/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52780259,"identity":"2e360e12-8564-4ef5-aeae-ad2fbdf4b332","added_by":"auto","created_at":"2024-03-15 16:57:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1015419,"visible":true,"origin":"","legend":"\u003cp\u003eStudy area; upper right, the Earth, indicating study area location. Sampling points are differentiated by color: red, samples from the upper Irtysh River within China; yellow, samples from Kazakhstan territory along the upper Irtysh River; green, samples from Kobdo Basin, Mongolia; blue, samples from the upper Ob River, Russia. The figure also includes the approximate distribution ranges of \u003cem\u003eThymallus\u003c/em\u003e species: red (left) represents \u003cem\u003eT. brevicephalus\u003c/em\u003e group A; red (right) represents \u003cem\u003eT. brevicepahlus\u003c/em\u003e group B, green represents \u003cem\u003eT. brevirostris\u003c/em\u003e, and blue, \u003cem\u003eT. nikolskyi\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/9ef40ea0d9dc016ede1d33b6.png"},{"id":52779908,"identity":"ffdd2a20-de5d-4f6d-b39f-3b4a72fb97c3","added_by":"auto","created_at":"2024-03-15 16:49:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":168216,"visible":true,"origin":"","legend":"\u003cp\u003eBl and ML phylogenetic reconstructions using the mtDNA CR region sequences. Branch support values indicate Bayesian posterior probabilities (left side of nodes) and maximum likelihood values (right side of nodes); an asterisk (*) denotes values ³ 90%. Species distribution, as shown in Figure 1, is color-coded. The geographic location of haplotypes on each branch is consistent with Table 1\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/ca7276c5597c727954fe970c.png"},{"id":52779906,"identity":"90230de9-239e-4948-b97f-8140b6784eae","added_by":"auto","created_at":"2024-03-15 16:49:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":52951,"visible":true,"origin":"","legend":"\u003cp\u003eTime-calibrated Bayesian phylogenetic tree based on mtDNA CR region sequences. Blue shaded bars indicate 95% highest posterior density (HPD) intervals for node ages; the scale represents millions of years from present\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/65a82af92bc601f46ce3ac67.png"},{"id":52780258,"identity":"1a42d114-b90d-4c28-b5f8-9b889eeb75de","added_by":"auto","created_at":"2024-03-15 16:57:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":75955,"visible":true,"origin":"","legend":"\u003cp\u003eObserved and expected mismatch distributions in \u003cem\u003eThymallus brevicephalus\u003c/em\u003e. CR sequences (a–c): (a) total haplotypes, (b) clade A, (c) clade B; Cyt b + CR sequences (d–f): (d) total haplotypes, (e) clade A, (f) clade B; columnar lines represent observed distribution curves; solid lines represent expected distribution curves\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/1ee606ec3a3740606ade0026.png"},{"id":52779912,"identity":"73377dc9-f8ee-47ef-9709-b7588609f83c","added_by":"auto","created_at":"2024-03-15 16:49:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":39733,"visible":true,"origin":"","legend":"\u003cp\u003eBayesian Skyline Plots (BSP) for \u003cem\u003eT. brevicephalus\u003c/em\u003e: (a) all populations, (b) clade A, (c) clade \u0026nbsp;B. Axes: X, time in millions of years before present; Y (log scale), estimated effective population size (Ne) of females multiplied by generation time. The solid line indicates the median population size estimate, and the 95% Highest Posterior Density interval is shaded in the color of the distribution range\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/d9a9e543b9510c65145ae620.png"},{"id":52779914,"identity":"b462db82-26fc-4fa7-8089-490eae9d585d","added_by":"auto","created_at":"2024-03-15 16:49:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":191037,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ea,\u003c/strong\u003e Control Region (CR) haplotype network for \u003cem\u003eT. brevirostris\u003c/em\u003eand \u003cem\u003eT. brevicephalus\u003c/em\u003e; \u003cstrong\u003eb,\u003c/strong\u003e Cyt b + CR haplotype network for Irtysh River grayling. Haplotype circle diameter represents the observed number of individuals. Colors correspond to different regions; black circles represent unobserved intermediate haplotypes. Small bars crossing lines indicate numbers of mutational steps between adjacent haplotypes\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/f5b2c15e9124df327aa643f1.png"},{"id":52780260,"identity":"3fa44ddf-37b8-44b5-a663-e5cc83e51682","added_by":"auto","created_at":"2024-03-15 16:57:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":42466,"visible":true,"origin":"","legend":"\u003cp\u003eGenetic relationships among T\u003cem\u003e. brevicephalus\u003c/em\u003e populations HB, KN, KE, and KL in the upper Irtysh River using 10 microsatellite loci. (a) NJ clustering tree based on Nei’s unbiased genetic distances; (b) displays the Principal Coordinate Analysis (PCoA) based on pairwise genetic distances between individuals; (c) shows the PCoA based on pairwise genetic distances between populations\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/5729ac16326b4c84884acd54.png"},{"id":52779910,"identity":"8870c816-5451-434f-8b3f-b7d21d523bad","added_by":"auto","created_at":"2024-03-15 16:49:49","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":32544,"visible":true,"origin":"","legend":"\u003cp\u003eCluster analysis of five \u003cem\u003eT. brevicephalus\u003c/em\u003e populations in the upper Irtysh River based on 10 microsatellite loci. (a) Inferred optimal K value in STRUCTURE; (b) inferred optimal K in BAPS; (c) allocation test histogram using STRUCTURE (K = 2); (d) allocation test histogram using BAPS (K = 3). Each individual is represented by a vertical colored line, with each color corresponding to a genetic cluster\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/99f0a5b862971c4e3b255c1f.png"},{"id":52780261,"identity":"f25b83c1-c543-4caa-a342-1f91d491e688","added_by":"auto","created_at":"2024-03-15 16:57:49","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":219649,"visible":true,"origin":"","legend":"\u003cp\u003eStatistical scenarios for modeling five populations of \u003cem\u003eT. brevicephalus\u003c/em\u003e in the upper Irtysh River using DIY-ABC. It includes the projection of each scenario on the linear discriminant analysis (LDA) axis and corresponding positions of observed values\u003c/p\u003e","description":"","filename":"image9.png","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/425092924079a3b182b14f6f.png"},{"id":54323972,"identity":"8c3dadd2-6d7f-4a83-ba05-2eb4d156fb07","added_by":"auto","created_at":"2024-04-08 20:22:36","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2719151,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4063125/v1/4a2acba7-cc9e-4aee-8d0f-c9898a5d785a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The freshwater fish genus Thymallus (Thymallidae) in the upper OB-Irtysh River: its evolutionary history and implications for conservation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGeological and climatic events alter the habitat and distributions of species, and their survival and reproduction (Jens-Christian et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Wiens and Donoghue \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Because the distributions of freshwater fish are affected by watercourse constraints, geological and climatic changes to these waterways can lead to species differentiation through isolation, or range expansion through increased connectivity of drainage systems (Capobianco and Friedman \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Understanding interactions among geological, climatic changes, and drainage systems, as well as their relationships with freshwater fish species, is important for understanding the mechanisms that affect their diversity, and to devise appropriate conservation strategies.\u003c/p\u003e \u003cp\u003ePhylogeographic studies on freshwater fish have become focal points in regions such as North America (Ginson et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Janosik et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), the Qinghai\u0026ndash;Tibet Plateau (Guo et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Liang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and in Siberia (Secci-Petretto et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Skog et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Graylings in the genus \u003cem\u003eThymallus\u003c/em\u003e (Teleostei: Thymallidae) are widely distributed across Eurasia and North America, and they are renowned for their conservative reproductive behavior. These fish repeatedly spawn at the same locations, and their migratory capabilities are highly limited (G\u0026ouml;nczi \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Northcote \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Nyk\u0026auml;nen et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Consequently, the distribution patterns of \u003cem\u003eThymallus\u003c/em\u003e species are highly unique. Within a single river system, \u003cem\u003eThymallus\u003c/em\u003e populations often display high levels of genetic differentiation, as reported for the Amur (Froufe et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2003a\u003c/span\u003e; Ma et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Weiss et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2020a\u003c/span\u003e), Yenisei (Andrushchenko et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Knizhin et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2006a\u003c/span\u003e; Knizhin and Weiss \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), and Lena (Knizhin et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2006b\u003c/span\u003e; Weiss et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) rivers. This phenomenon can even extend into a single lake, such as, for example, the Hoton Nur Lake in western Mongolia (Slynko et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) and Lake Saimaa in eastern Finland (Koskinen et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Koskinen et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2002a\u003c/span\u003e). Significant morphological differences also exist among \u003cem\u003eThymallus\u003c/em\u003e in Lake Baikal (Knizhin et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2006c\u003c/span\u003e; Knizhin et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2006d\u003c/span\u003e). \u003cem\u003eThymallus\u003c/em\u003e is a model taxon to study for systematic geographic applications and phylogeographic studies. From a biological perspective, this taxon can reflect historical geological and climatic changes.\u003c/p\u003e \u003cp\u003eThe Altai Mountains, at the junction of China, Kazakhstan, Mongolia, and Russia, have undergone two episodes of mountain-building and uplift. During the late Pliocene to early Pleistocene, there were distinct differential uplift movements which led to a significant increase in topographical differences between mountainous and plain areas, and contributed to the formation of mountainous terrain. From the middle Pleistocene to Holocene, intermittent uplift dominated (especially during the middle Pleistocene) when the entire mountain range was substantially uplifted, shaping the modern outline of the Altai Mountains. This uplift, a result of intermittent tectonic activity, played a critical role in forming the contemporary landscape of these mountains (Huangfu et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zang et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhao et al. \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The upper Irtysh River basin forms a comb-shaped drainage system, where northern and southern tributaries converge into a main channel. After flowing into Lake Zaysan, the river continues northward to join the Ob River, forming the Ob-Irtysh River, until it eventually reaches the Arctic Ocean.\u003c/p\u003e \u003cp\u003eBecause of our incomplete understanding of the diversity and geographical distribution of \u003cem\u003eThymallus\u003c/em\u003e species, the relationship between geological and climatic change and this diversity is not well understood. This is especially true in the Altai Mountains region, where at least three \u003cem\u003eThymallus\u003c/em\u003e species might occur (Weiss et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). To the northwest of these mountains, the Upper Ob grayling (\u003cem\u003eThymallus nikolskyi\u003c/em\u003e) occurs in the Ob River basin\u0026mdash;a species that may share a common ancestor with \u003cem\u003eThymallus svetovidovi\u003c/em\u003e in the Yenisei River basin (Dyldin et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In the Kobdo Basin, to the northeast of the Altai Mountains in Mongolia, the Mongolian grayling (\u003cem\u003eT. brevirostris\u003c/em\u003e) occurs.\u003c/p\u003e \u003cp\u003eWhile \u003cem\u003eT. brevirostris\u003c/em\u003e differs from other grayling taxa in jaw length, development of teeth, head form, and some biological parameters (Knizhin et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), few studies have focused on genetic variation in graylings in the southern Altai Mountains. \u003cem\u003eT. brevicephalus\u003c/em\u003e occurs in the upper tributaries of Irtysh River, centered around Lake Markakol, within Kazakhstan, and it is considered to be a sister species of \u003cem\u003eT. brevirostris\u003c/em\u003e in the northern part of the Altai Mountains (Weiss et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e), although morphological and ecological data are limited. Additionally, \u003cem\u003eThymallus\u003c/em\u003e occurs in the upper Irtysh River in China, where it is typically referred to as \u003cem\u003eThymallus arcticus grubei\u003c/em\u003e, or the Arctic grayling (Guo et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ren et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2002\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWe perform a molecular phylogenetic analysis using mitochondrial and microsatellite data on graylings from the upper Irtysh River, in the southern foothills of the central section of the Altai Mountains. To better understand patterns in distribution and population genetic structure of these fishes in these mountains, we integrate original data with mitochondrial data obtained from the literature. Additionally, we consider geological and climatic events to further explore the evolutionary history of this taxon in this region.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003c/p\u003e \u003cp\u003eFishes (161 individuals) were captured in October 2019 from 10 locations in the Irtysh River basin, Xinjiang, China (Fig.\u0026nbsp;1, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Genomic DNA was extracted using an Ezup Column Animal Genomic DNA Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd. Extracted DNA was stored at 4\u0026deg;C for less than a week, until further use.\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSample locations including species, sample location, sample population code, drainage basin, number of individuals screened for both mtDNA and microsatellite loci, and geographical coordinates for Thymallus samples in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample location\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSample code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eNumber of individuals\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003emtDNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003emicrosatellite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eLat. (N)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eLong. (E)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKayiertesi River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47\u0026deg;38\u0026prime;31\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e89\u0026deg;44\u0026prime;55\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKaraertis River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47\u0026deg;58\u0026prime;53\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e88\u0026deg;40\u0026prime;10\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrane River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47\u0026deg;54\u0026prime;38\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e88\u0026deg;7\u0026prime;25\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHongqi Reservoir\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;4\u0026prime;33\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e87\u0026deg;7\u0026prime;38\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBurqin River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47\u0026deg;47\u0026prime;26\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e87\u0026deg;5\u0026prime;49\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eChonghuer Reservoir\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;4\u0026prime;33\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e87\u0026deg;7\u0026prime;38\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHemu River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;40\u0026prime;14\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e87\u0026deg;32\u0026prime;57\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKanas River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;47\u0026prime;8\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e87\u0026deg;1\u0026prime;56\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAkkaba River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026ndash;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;30\u0026prime;11\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e86\u0026deg;36\u0026prime;9\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKara-Kaba River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48\u0026deg;43\u0026prime;17\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e86\u0026deg;46\u0026prime;23\u0026Prime;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTo amplify Cyt b gene sequences, we used L14724 (5'-GACTTGAAAAACCACCGTTG-3') and H15915 (5'-CTCCGATCTCCGGATTACAAGAC-3') primers. For the CR (Dloop) gene sequence we used D-loop-F (5'-ACCCCTGGCTCCCAAAGC-3') and D-loop-R (5'-ATCTTAGCATCTTCAGTG-3') primers.\u003c/p\u003e \u003cp\u003eA 25 \u0026micro;L PCR reaction system was established with 1 \u0026micro;L of each upstream and downstream primer (concentration 10 pmol/\u0026micro;L), 0.2 \u0026micro;L of polymerase, 2.5 \u0026micro;L of dNTP, 2.5 \u0026micro;L of buffer, 1.5 \u0026micro;L of Mg\u003csup\u003e2+\u003c/sup\u003e, 2 \u0026micro;L of DNA template (concentration 50 ng/\u0026micro;L), supplemented with double-distilled (dd) H\u003csub\u003e2\u003c/sub\u003eO to 25 \u0026micro;L. The PCR program entailed pre-denaturation at 94\u0026deg;C for 4 min, denaturation at 94\u0026deg;C for 55 s, annealing at 60\u0026deg;C for 45 s, an extension at 72\u0026deg;C for 30 s, and a final extension at 72\u0026deg;C for 7 min, for 30 cycles. After the reaction, 3 \u0026micro;L of PCR product was collected, and after confirming that the CR product displayed clear and bright bands after 1% agarose gel electrophoresis, purification and sequencing were conducted by Sangon Biotech (Shanghai) Co., Ltd.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c4\" namest=\"c1\"\u003e \u003cp\u003eTable\u0026nbsp;2 Microsatellite loci\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLocus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRepeat motif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTa (\u0026deg;C)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSingle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eClaTet1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(GACA)13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: GAGCCCATCATCACTGAGAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e60\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: CTGCTACCCACAAACCCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"7\" rowspan=\"8\"\u003e \u003cp\u003e4Plex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBFRO004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(GT)11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: GCTCCAGTGAGGGTGACCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: AGGCCACTGATTGAGCAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBFRO010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(AC)17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: GGA CGG AGC CAG CAT CAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GTTTCTTGATTTCATAATCAGGTCAATAGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTar103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(ATCC)7TCC(ATCC)14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: CAGTCGGGCGTCATCACGGGGATCAATAAAGTATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: CTTCACTGTCGCTGTGAGTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTth445\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(GATA)20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: TGA CGG CTA CAG GAA TTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GTTTCTTCCACAGAGGGTTCTACATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e5Plex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTar100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(CTTT)5CTTC(CTTT)18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: CAGTCGGGCGTCATCATTTGGATGTGTCAGACCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GAGAAAGCAAGGAGAAATCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTar101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(CTTT)22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: CAGAGCACACCAAGCAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GTTTCTTAGGGCAAGTCATTCCAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTar110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(TAGA)30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: GCAATAACAATTCCATGAGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GTTTCTTCTCCTCTGATTCCAAGAAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTar112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(TATC)7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: CAGTCGGGCGTCATCACCTGGGAATCAACAAAGTATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: AGGAGGTTCAGTGAGTGTTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTth313\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e(GAGT)22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eF: AAACCAGTCCAAGCGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e58\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eR: GTTTCTTCTCCTGTTTATCACATGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMicrosatellite sequences are detailed in Table\u0026nbsp;2, as cited from previous studies (Weiss et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e). A 25 \u0026micro;L PCR reaction system was established containing 0.5 \u0026micro;L of each forward and reverse primer, 0.5 \u0026micro;L of dNTP (mix), 2.5 \u0026micro;L of Taq Buffer (with MgCl\u003csub\u003e2\u003c/sub\u003e), 0.2 \u0026micro;L of Taq polymerase, and supplemented with ddH\u003csub\u003e2\u003c/sub\u003eO to 25 \u0026micro;L. PCR amplification was performed using an ABI VeritiTM 96-well PCR machine, with pre-denaturation at 95\u0026deg;C for 5 min; denaturation at 94\u0026deg;C for 30 s, annealing at 60\u0026deg;C for 30 s, an extension at 72\u0026deg;C for 30 s, repeated for 10 cycles; denaturation at 94\u0026deg;C for 30 s, annealing at 55\u0026deg;C for 30 s, and an extension at 72\u0026deg;C for 30 s was repeated for 30 cycles; with a final extension at 72\u0026deg;C for 10 min. The size of the microsatellite loci was determined using a 3730xl DNA Analyzer.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003emtDNA data analysis\u003c/h2\u003e \u003cp\u003eThe CR (Dloop) sequences were aligned with those of \u003cem\u003eT. brevicephalus\u003c/em\u003e (N\u0026thinsp;=\u0026thinsp;33) from existing literature, \u003cem\u003eT. brevirostris\u003c/em\u003e sequences (N\u0026thinsp;=\u0026thinsp;27), those of \u003cem\u003eT. nikolskyi\u003c/em\u003e (N\u0026thinsp;=\u0026thinsp;3) (Knizhin et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Weiss et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2020b\u003c/span\u003e), and six outgroup taxa (Froufe et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2003b\u003c/span\u003e; Jacobsen et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Koskinen et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2002b\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); 230 sequences were obtained. Multiple sequence alignment was performed using the ClustalW method in MEGA 11.0.13 (Larkin et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Tamura et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and haplotype analysis was conducted using DnaSP 6.12.03 (Rozas et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The best nucleotide substitution models for Maximum Likelihood estimation (ML) and Bayesian Inference (BI) were identified as HKY\u0026thinsp;+\u0026thinsp;Gamma using MEGA 11.0.13 and MrModeltest 2 (Nylander \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Tamura et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). ML estimation analysis with 1000 iterations was performed using the HKY\u0026thinsp;+\u0026thinsp;G model in raxmlGUI 2.0 (Edler et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). BI was conducted in MrBayes 3.2.7, with the number of runs set to 2 \u0026times; 10\u003csup\u003e7\u003c/sup\u003e (Ronquist et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Haplotype networks were generated using PopArt1.7 (Leigh and Bryant \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), with undefined states masked. To gain further insights into relationships among \u003cem\u003eThymallus\u003c/em\u003e species in the upper Irtysh River, the obtained 166 Cyt b sequences were trimmed and overlaid with the CR (Dloop) sequences. Using the same methodology, a combined sequence analysis of haplotypes was conducted to generate a haplotype network.\u003c/p\u003e \u003cp\u003eTo estimate divergence times between species, a time-calibrated Cyt b\u0026thinsp;+\u0026thinsp;CR phylogeny was constructed using BEAUti in BEAST 1.10.4. This BI phylogenetic analysis employed the HKY\u0026thinsp;+\u0026thinsp;G substitution model (Drummond and Rambaut \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). A molecular clock was modeled using uncorrelated relaxed molecular clock priors, specifically lognormal distributions (Suchard and Rambaut \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). The tree prior was modeled using the birth\u0026ndash;death process. The mtDNA molecular clock calibration for Salmoniformes species was set at 1% per MY, with a relative death rate following a normal distribution (mean 0.01, SD 0.002). Two divergence times were specified: the most recent common ancestor of Salmoniformes around 50 MY (lognormal distribution, offset 50, mean 10, SD 1) and the period around 0.13 MY when \u003cem\u003eThymallus baicalensis\u003c/em\u003e entered Lake Baikal (normal distribution, mean 0.12, SD 0.1) (Koskinen et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2002b\u003c/span\u003e; Weiss et al. \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Iterations were run 30 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e times, with sampling conducted every 3000 iterations. Generated data were assessed for convergence and effective sample sizes (\u0026gt;\u0026thinsp;200) using Tracer v1.7.2 (Rambaut et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The final tree was constructed using TreeAnnotator v1.10.4, exported in FigTree v1.4.4 (Rambaut 2012), and optimized on the iTOL (Letunic and Bork \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo further investigate if \u003cem\u003eThymallus\u003c/em\u003e species in the upper Irtysh River were conspecific, and to explore differences between them and other species, we used DnaSP v6.12.03 to compute nucleotide diversity (Rozas et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Additionally, MEGA v11.0.13 was used to estimate inter-population genetic distances based on Kimura 2-parameter and Tamura\u0026ndash;Nei models (Tamura et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Analysis of molecular variance (AMOVA) was performed using Arlequin 3.5 to detect genetic variation among geographic populations or groups, and genetic variation indices (FCT, variance among groups relative to total variance; FSC, variance among populations within groups; FST, variance among populations) (Excoffier and Lischer \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). The significance of covariance at different levels of genetic structure was tested through 1000 resampling iterations.\u003c/p\u003e \u003cp\u003eTajima\u0026rsquo;s D test and Fu\u0026rsquo;s Fs test in Arlequin 3.5 software (Excoffier and Lischer \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), as well as the sum of squared deviation (SSD) and Harpending\u0026rsquo;s raggedness index (r), were used to infer population historical dynamics. Mismatch distribution plots were observed using DnaSP v6.12.03 (Rozas et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). BEAST 2.7.4 (Drummond and Rambaut \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) using Bayesian Skyline Plot (BSPs) was used to infer historical dynamics and approximate time ranges of the effective sample size for each genetic lineage, with parameter settings consistent with those used in divergence time analysis. Finally, Tracer 1.5 software was used to visualize and edit the historical dynamics of effective population size (Rambaut et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eNuclear microsatellite genotyping and data analysis\u003c/h2\u003e \u003cp\u003ePreliminary analysis indicates that \u003cem\u003eThymallus\u003c/em\u003e populations in the upper Irtysh River are conspecific. Because of maternal inheritance of mtDNA (Wallace \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2007\u003c/span\u003e), we used 10 microsatellite loci markers for supplementary phylogenetic reconstruction to further understand genetic relationships between populations. Using FSTAT v2.9.3.2 (Goudet \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), we calculated the number of alleles per locus, deviations based on the FIS values for Hardy\u0026ndash;Weinberg equilibrium, and deviations from Linkage Equilibrium. ARLEQUIN v3.5.2.2 was used to calculate observed and expected heterozygosity, as well as to perform analyses based on the infinite allele model (FST), stepwise mutation model (RST), and AMOVA (Excoffier and Lischer \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). GenAlEx was used to calculate Nei\u0026rsquo;s genetic distance among populations. Principal coordinates analysis (PCoA) was performed based on genetic distances between populations and individuals (Peakall and Smouse \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). A clustering tree was constructed based on Nei\u0026rsquo;s genetic distance using MEGA (Tamura et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOverall genetic structure was assessed using the Bayesian clustering method in STRUCTURE v2.3 (Porras-Hurtado et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Prior values of K (number of populations) were assumed between 1 and 5. STRUCTURE was run for 100,000 iterations, with the first 50,000 iterations discarded as burn-in, and five independent MCMC replicates were performed for each K value. The Delta K statistic method (Earl and vonHoldt 2005) were used to determine the most suitable K value. After obtaining output results, K matrices from multiple runs were merged using CLUMPP (Jakobsson and Rosenberg \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2007\u003c/span\u003e); the visualization was optimized using Distruct (Rosenberg \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo further decipher the potential genetic structure of \u003cem\u003eThymallus\u003c/em\u003e in the upper Irtysh River, a cluster analysis was conducted using the stochastic optimization method in BAPS 6.0 (Corander et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Corander and Marttinen \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). BAPS analysis parameters were initially set to K\u0026thinsp;=\u0026thinsp;1 to 5, with each K value repeated 10 times; the maximum Log marginal likelihood [Log(ML)] value determines the best K. For population admixture analysis, the number of iterations was set to 1000; other settings remained at default values.\u003c/p\u003e \u003cp\u003eTo further understand divergence time and population history, we used the Approximate Bayesian Computation (ABC) algorithm implemented in the diyabcGUIv1.2.1 package (Collin et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Population parameters for five hypothetical evolutionary scenarios were simulated and compared to observed data using Linear Discriminant Analysis (Cornuet et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). We used default uniform and wide priors for all parameters.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analysis\u003c/h2\u003e \u003cp\u003eAll 161 samples were successfully sequenced for both CR and Cyt b genes. The CR gene was 1072 bp in length, with 14 variable and parsimony informative sites, resulting in 18 haplotypes. Upon combining our sequences with CR sequences from \u003cem\u003eT. brevicephalus\u003c/em\u003e and \u003cem\u003eT. brevirostris\u003c/em\u003e, a total of 220 sequences were generated, with 28 variable sites, 22 of which were parsimony informative, resulting in 28 CR haplotypes. The Cyt b gene was 1105 bp long, with 4 variable sites, all being parsimony informative, resulting in 4 Cyt b haplotypes. Concatenating each sample into a 2177 bp sequence in the format of 5'-Cyt b\u0026thinsp;+\u0026thinsp;CR-3\u0026rsquo; for phylogenetic analysis yielded 17 variable sites, all of which were parsimony informative. The concatenated dataset resulted in a total of 26 mtDNA haplotypes, indicating high haplotype diversity (0.907) and low nucleotide diversity (0.00202) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenetic diversity indices for 10 populations of Thymallus brevicephalus based on Cyt b, CR, and concatenated Cyt b\u0026thinsp;+\u0026thinsp;CR sequence data sets\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePopulation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003en\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eS\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eh\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHd\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ek\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eπ\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyt b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.248\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.24762\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00022\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.57143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00052\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.26667\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00024\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.533\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.06667\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00097\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.02857\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00093\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.462\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.92308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00084\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.02857\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00093\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.0009\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.453\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.45333\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00041\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.456\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.823414\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00074\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.686\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.25714\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00117\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.762\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.95238\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00089\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.848\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.34286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00219\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.68571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00251\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.4381\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.744\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.97436\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00184\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.819\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.41905\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00226\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.825\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.09167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00288\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.477\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00047\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.607\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00095\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.884\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.60621\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00336\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyt b\u0026thinsp;+\u0026thinsp;CR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.686\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.50476\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00069\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.762\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.95238\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00089\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.848\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.34286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00219\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.68571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00251\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.4381\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.744\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.97436\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00184\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHQ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.819\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.41905\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00226\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.825\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.09167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00288\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.477\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00047\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.607\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00095\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.907\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4.40357\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.00202\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTwo phylogenetic methods were used to construct trees with identical topological structures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Images illustrate node-support values obtained from tree-building methods. Following divergence of \u003cem\u003eThymallus tugarinae\u003c/em\u003e in the easternmost Eurasian continent, two \u003cem\u003eThymallus\u003c/em\u003e species within the Baikal Lake region split, forming a distinct branch with \u003cem\u003eThymallus\u003c/em\u003e species from the Altai\u0026ndash;Sayan Mountains. The two \u003cem\u003eThymallus\u003c/em\u003e species in the upper Irtysh River may be conspecific (\u003cem\u003eT. brevicephalus\u003c/em\u003e) and form a clear geographical structure pattern internally. These findings receive robust support from bootstrap values. Notably, \u003cem\u003eT. brevicephalus\u003c/em\u003e from the upper Irtysh River in China and Kazakhstan form a clade, which then clusters with \u003cem\u003eT. brevirostris\u003c/em\u003e from east of the Altai Mountains.\u003c/p\u003e\u003cp\u003eAccording to the time-calibrated CR phylogenetic estimation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e), the divergence time between \u003cem\u003eT. brevirostris\u003c/em\u003e and \u003cem\u003eT. brevicephalus\u003c/em\u003e is estimated at 0.81 MY (0.57\u0026ndash;1.08). The time to the most recent common ancestor for the clade A and B within \u003cem\u003eT. brevicephalus\u003c/em\u003e is estimated to be 0.48 MY (0.30\u0026ndash;0.71), with a divergence time of 0.39 MY (0.18\u0026ndash;0.60) within clade A and 0.28 Ma (0.13\u0026ndash;0.47) within clade B.\u003c/p\u003e \u003cp\u003eTamura-Nei and Kimura 2-parameter genetic distance values (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e4\u003c/span\u003e) reveal two populations within \u003cem\u003eT. brevicephalus\u003c/em\u003e, with the average genetic distance between downstream group A from Kazakhstan and China and upstream group B being 0.00505; the average genetic distance between \u003cem\u003eT. brevicephalus\u003c/em\u003e clade A from Kazakhstan and China is 0.00226.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTamura-Nei genetic distance (below diagonal), Kimura 2-parameter genetic distance values between pairs of populations (above diagonal) based on the CR sequence data set\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClade\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eA(CN)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eA(KZ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eT. brevirostris\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eT: nikolskyi\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT. brevicephalus\u003c/em\u003e A(CN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00226\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.00514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00601\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01923\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT. brevicephalus\u003c/em\u003e A(KZ)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00226\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.00497\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00636\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01972\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT. brevicephalus\u003c/em\u003e B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00514\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00496\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.00623\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01990\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT. brevirostris\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.00601\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.00636\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.00623\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01768\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eT: nikolskyi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.01919\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.01967\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.01985\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.01764\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eMismatch distribution analysis based on CR and Cyt b\u0026thinsp;+\u0026thinsp;CR sequences indicates a unimodal distribution for \u003cem\u003eT. brevicephalus\u003c/em\u003e as a whole (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, d) and for clade A (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, e).\u003c/p\u003e \u003cp\u003eBSP analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e5\u003c/span\u003ea, b) reveals sustained expansion events for both the entire \u003cem\u003eT. brevicephalus\u003c/em\u003e population and clade A over an extended period (0.4\u0026ndash;0.1 MY). Negative Fu\u0026rsquo;s Fs and Tajima\u0026rsquo;s D values also corroborate these population expansion events (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMismatch distribution and neutrality test for five populations of T. brevicephalus based on the CR and concatenated Cyt b\u0026thinsp;+\u0026thinsp;CR sequence data sets\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehaplotype clade\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSSD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003er\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTajima\u0026rsquo;s D\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFu\u0026rsquo;s Fs\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0045\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026minus;1.011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;5.975\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eClade A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0037\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026minus;1.280\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;2.848\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eClade B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0527\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026minus;0.141\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;1.468\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyt b\u0026thinsp;+\u0026thinsp;CR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1.240\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;5.066\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eClade A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0068\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.811\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;4.319\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eClade B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.0091\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0897\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026minus;0.829\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026minus;0.745\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe CR haplotype network (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003ea) identifies only two mutational steps between \u003cem\u003eT. brevirostris\u003c/em\u003e and \u003cem\u003eT. brevicephalus\u003c/em\u003e. No shared haplotypes in Crane River (KE) occur between its eastern and western branches. Within the upper Irtysh River, \u003cem\u003eT. brevicephalus\u003c/em\u003e populations differentiate into two branches along Crane River, where the most common \u003cem\u003eT. brevicephalus\u003c/em\u003e haplotype is shared among individuals from all locations west of Crane River (Kal, Rur, Kka, BH, KN, BE, CE, HM, HQ, KE), excepting Kara-Kaba River (HB). Haplotype I2 is inferred to be an ancestral haplotype for the western branch. Individuals from Crane River and its eastern counterparts (KL, KY) share no haplotypes with the western branch. To clarify the geographic structure of \u003cem\u003eT. brevicephalus\u003c/em\u003e, analysis of the Cyt b\u0026thinsp;+\u0026thinsp;CR haplotype network (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e6\u003c/span\u003eb) reveals the Crane River population shares no haplotypes with the eastern branch, and for the combined haplotype network to provide a clearer distinction between the eastern and western branches.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGenetic diversity and genetic structure of microsatellite data\u003c/h2\u003e \u003cp\u003eAMOVA (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e6\u003c/span\u003e) reveals the major source of genetic variation to come from within geographic populations (92.61%), rather than among them (7.39%), indicating significant population differentiation (fixation index\u0026thinsp;=\u0026thinsp;0.073, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). When the five populations are divided into western and eastern groups, AMOVA results for the two groups reveal 4.21% of genetic variation comes from between the western and eastern regions (FCT\u0026thinsp;=\u0026thinsp;0.042). Additionally, 91.36% of genetic variation is attributed to individual variation within geographic populations (fixation index\u0026thinsp;=\u0026thinsp;0.086, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and 4.43% of it arises among geographic populations within regions (FSC\u0026thinsp;=\u0026thinsp;0.04628, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). AMOVA results indicate significant genetic differentiation among \u003cem\u003eT. brevicephalus\u003c/em\u003e populations in the upper Irtysh River, with a certain degree of genetic divergence between western and eastern populations.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMolecular variance (AMOVA) for T. brevicephalus population genetic variation based on Cyt b, CR and concatenated Cyt b\u0026thinsp;+\u0026thinsp;CR sequence data sets, and nuclear DNA microsatellite variation\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSource of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edf\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVariance component\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePercentage of variation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFixation index\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCyt b\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.12191\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.28733***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.30238\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e71.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBetween regions (west/east)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.07056\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFCT\u0026thinsp;=\u0026thinsp;0.15310\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations within regions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.08796\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFSC\u0026thinsp;=\u0026thinsp;0.22534***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.30238\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e65.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.34394***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.0214\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e53.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.53485***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.88828\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e46.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBetween regions (west/east)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.82666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e63.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFCT\u0026thinsp;=\u0026thinsp;0.63924\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations within regions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.14259\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFSC\u0026thinsp;=\u0026thinsp;0.13832***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.88828\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.68914***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCyt b\u0026thinsp;+\u0026thinsp;CR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.13727\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e49.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.49011***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.18318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e50.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBetween regions (west/east)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.87709\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFCT\u0026thinsp;=\u0026thinsp;0.56977\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations within regions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.2342\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFSC\u0026thinsp;=\u0026thinsp;0.16523***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.18318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e35.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.64086***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMicrosatellites\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.23145\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.07393***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.89927\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e92.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026mdash;\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBetween regions (west/east)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.13354\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFCT\u0026thinsp;=\u0026thinsp;0.04208\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmong populations within regions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.14069\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFSC\u0026thinsp;=\u0026thinsp;0.04628***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWithin populations\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e217\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2.89927\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e91.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFST\u0026thinsp;=\u0026thinsp;0.08641***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e**P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001; FST, genetic differences among populations; FCT, genetic differences among groups defined a priori; FSC: genetic differences among populations within groups.\u003c/p\u003e \u003cp\u003eNei\u0026rsquo;s unbiased pairwise genetic distance values range 0.073\u0026ndash;0.752 (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The average genetic distance within the eastern population (0.24) and average genetic distance within the western population (0.34) are both below the average genetic distance between the eastern and western populations (0.62). Pairwise FST values (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e7\u003c/span\u003e) range 0.021\u0026ndash;0.084. The average genetic distance within the eastern population (0.040) and average genetic distance within the western population (0.043) are both below the average genetic distance between the two populations (0.065).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMatrix of pairwise FST values (below diagonal) and Nei\u0026rsquo;s unbiased genetic distances (above diagonal) among five T. brevicephalus populations based on microsatellite data\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.388\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.550\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.692\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.752\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.046373\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.073\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.457\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.575\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.061698\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.020806\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.554\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.691\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.069356\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.044378\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.05596\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.244\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.084104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.061803\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.074891\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.040979\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor \u003cem\u003eT. brevicephalus\u003c/em\u003e, at four microsatellite sampling locations (HB, KN, KE, KY), significant deviations from Hardy\u0026ndash;Weinberg equilibrium are observed (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e8\u003c/span\u003e). There are 41 loci that significantly deviate from this equilibrium (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), suggesting that populations may not adhere to random mating and could be influenced by factors such as genetic mutations and migration.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eP-values for Hardy\u0026ndash;Weinberg equilibrium chi-square tests at ten microsatellite loci for five T. brevicephalus populations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClaTet1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.5232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5956\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0148\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.5104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.2589\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBFRO004\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0399\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.2758\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.1645\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.8125\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBFRO010\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.4549\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0373\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.1578\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTar100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.7809\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0016\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0666\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTar101\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.5605\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.6783\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTar103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0028\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.0509\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0009\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0011\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.5048\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTar110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2827\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0925\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTar112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.2093\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.4205\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.1032\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTth313\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.0464\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0104\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0264\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.2891\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTth445\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0.1862\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.6825\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.031\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0031\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe average expected heterozygosity for all sampling locations is relatively high, ranging 0.748 (KN) to 0.860 (KY). Average observed heterozygosity for all sampling locations is also high, ranging 0.623 (KL) to 0.677 (KE). Mean expected heterozygosity values are higher than mean observed heterozygosity values, and all populations exhibit positive FIS values, indicating a higher proportion of homozygotes than heterozygotes (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e9\u003c/span\u003e). This suggests a lack of sufficient heterozygotes within the populations, potentially indicating a level of inbreeding.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 9\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenetic statistical summaries of microsatellite analysis for five T. brevicephalus populations\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAR\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHO\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHE\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eFIS\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.963\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.64615\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.82154\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.07347\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.66666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.87592\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.13775\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.67727\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.84642\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.10068\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.62321\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.80107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.09643\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKY\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.58333\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.7721\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.02566\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e The Neighbor-joining clustering tree based on Nei\u0026rsquo;s unbiased genetic distances (Fig.\u0026nbsp;7a) reveals the five populations to form two branches, with KL and KY clustering together, and with KN, KE, and HB forming another cluster. The PCoA plot further supports the inferred divergence between eastern and western clades of the Irtysh River population. Based on pairwise genetic distances between individuals (Fig.\u0026nbsp;7b) and variances along the first (8.94%) and second (7.21%) axes, individuals from HB, KN, and KE mainly cluster in quadrants 1 and 2, while KL and KY individuals predominantly cluster in quadrants 3 and 4, displaying a left\u0026ndash;right distribution. Similar results are observed in the PCoA plot based on genetic distances between populations (Fig.\u0026nbsp;7c), where populations from HB, KN, and KE are situated to the right of the y-axis, while KL and KY populations are positioned to its left.\u003c/p\u003e \u003cp\u003eSTRUCTURE analysis indicates that the highest posterior probability was observed at ΔK\u0026thinsp;=\u0026thinsp;2 (Fig.\u0026nbsp;8a), supporting K\u0026thinsp;=\u0026thinsp;2 as the optimal solution. Consequently, we present the clustering model (Fig.\u0026nbsp;8c), revealing that individuals belonging to the western populations of \u003cem\u003eT. brevicephalus\u003c/em\u003e (HB, KN, KE) form one cluster, while individuals from the eastern populations (KL, KY) constitute another, with membership coefficients\u0026thinsp;\u0026gt;\u0026thinsp;96.4% for all individuals. BAPS analysis reveals the Log(ML) statistic to peak at K\u0026thinsp;=\u0026thinsp;3 (Fig.\u0026nbsp;8b). While there was some evidence of a third color cluster in KE and KN, the overall pattern (Fig.\u0026nbsp;8d) of differentiation is consistent with the STRUCTURE model. This suggests that KE and to a lesser extent KN populations exhibit higher levels of genetic differentiation, which appears to be unique. This pattern aligns with conclusions drawn from clustering tree and PCoA analyses, supporting the existence of two groups among the five populations of \u003cem\u003eT. brevicephalus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eLinear discriminant analysis results from DIYABC, with observed values distributed within the range of scenario 1 (Fig.\u0026nbsp;9), indicate that the initial split occurred between the western populations KE, KN, and HB and the eastern populations KL and KY (t1). Among the western populations, HB was the first to split (t2), followed by splits of KN and KE. Eastern populations split at time point t45.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSpeciation resulting from uplift of the Altai Mountains\u003c/h2\u003e \u003cp\u003e Combining geographical distribution and divergence time, \u003cem\u003eT. brevirostris\u003c/em\u003e and \u003cem\u003eT. brevicephalus\u003c/em\u003e were geographically isolated on the northern and southern sides of the Altai Mountains at approximately 0.81 MY. This isolation is attributed to geological changes induced by the second uplift of the Altai Mountains since the Middle Pleistocene (1.00 MY) (Bolikhovskaya and Shunkov 2014;Pan et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Zang et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). This geological shift caused changes in drainage system patterns and the migration of main river channels, which likely affected regional fish habitat, and isolated \u003cem\u003eT. brevirostris\u003c/em\u003e and \u003cem\u003eT. brevicephalus\u003c/em\u003e on opposite sides of the Altai Mountains.\u003c/p\u003e \u003cp\u003eMany mountainous regions globally exhibit noticeable disparities in drainage systems and ecosystems on either side, which are often attributed to the results of tilting movements. For instance, \u003cem\u003eThymallus\u003c/em\u003e in the Baikal Lake basin have distributions affected by rearrangement of river systems and the formation of watersheds because of mountain uplift (Knizhin et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2006d\u003c/span\u003e; Koskinen et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2002b\u003c/span\u003e). The rapid uplift of the Qinling Mountains has led to river capture-related events, resulting in fish dispersion and the formation of isolated habitats in the north and south ( Liu et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). During this period, the Altai Mountains moved, with one end of the fault block forming a near-upright tilted structure, and on the southern slope there is a continuous mountain massif. The asymmetric north\u0026ndash;south topography created distinct environments for fish. The steep and short northern slope of the Altai Mountains lies adjacent to the large Mongolian Kobdo Basin. \u003cem\u003eT. brevirostris\u003c/em\u003e underwent divergent evolution within the basin, and developed a phenotype that included well-developed jaws and teeth as probable adaptations to harsher environmental conditions (Knizhin et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The characteristics exhibited by \u003cem\u003eT. brevicephalus\u003c/em\u003e in these river valleys resemble those of other \u003cem\u003eThymallus\u003c/em\u003e species that inhabit similar environments (Kavanagh et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eGlacial-interglacial cycles and genetic diversity in response to Quaternary climatic events\u003c/h2\u003e \u003cp\u003eIn the Altai Mountains of China during the Quaternary period there was significant glacial activity. This included the Burqin Glaciation during the Middle Pleistocene, the second-to-last glaciation at the end of the Middle Pleistocene, and the Last Glacial Maximum during the Late Pleistocene (Pan et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Zang et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). During glacial periods in this region, glacial refugia likely led to significant population fragmentation and lineage differentiation.\u003c/p\u003e \u003cp\u003eWe combined mitochondrial and nuclear genetic data to resolve genetic structure of \u003cem\u003eT. brevicephalus\u003c/em\u003e in the upper Irtysh River. We report two distinct populations in this area, with the Crane River acting as a natural boundary to them in the upstream region. Moderate genetic differentiation exists between eastern (Karaertis and Kayiertesi rivers) and western (Kara-Kaba, Akkaba, Kanas River, Burqin, Hemu and Crane rivers, and Chonghuer and Hongqi reservoirs) populations. We hypothesize that differences in these lineages are associated with the occurrence of refuges, a concept supported by various theories. For example, two spatially separated lineages of \u003cem\u003eThymallus\u003c/em\u003e in Lena River may have arisen through prevalence of a Polar continental shelf ice sheet during the Siberian Pleistocene, which isolated \u003cem\u003eThymallus\u003c/em\u003e populations in glacial refugia in the Lena Delta and middle reaches of Lena River (Weiss et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In Europe, the European grayling (\u003cem\u003eThymallus thymallus\u003c/em\u003e) exhibits significant genetic differences over relatively short geographical distances, a phenomenon attributed to glaciation-mediated processes (Gum et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Koskinen et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2002c\u003c/span\u003e). Similarly, in North America, \u003cem\u003eT. arcticus\u003c/em\u003e underwent genetic differentiation during a Pleistocene glacial period because of refugia formation (Redenbach and Taylor \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Stamford and Taylor \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe estimated divergence time indicates that the eastern and western \u003cem\u003eT. brevicephalus\u003c/em\u003e lineages first split approximately 0.48 MY. During the continuous uplift of the Altai Mountains, the region experienced its first Quaternary glaciation. As the Altai Mountains froze, their southern slope was influenced by the MIS12 Burqin Glaciation (0.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.051 MY) (Devyatkin \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1981\u003c/span\u003e; Jiang \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), during which time the climate cooled significantly, and many glaciers developed. A substantial body of evidence suggests that moderate differentiation occurred between the eastern and western populations during this time, with detailed evidence from DIYABC indicating that \u003cem\u003eT. brevicephalus\u003c/em\u003e populations survived in river valleys between glacial intervals. For instance, the ancestral haplotype I2 of the western population likely resided in refuges such as the Kanas River valley or the Kara-Kaba River valley. Green toads (\u003cem\u003eBufo viridis\u003c/em\u003e subgroup) which also require freshwater for breeding activities, have been found in this region, indicating the potential existence of glacial refuges in later Pleistocene stages (Zhang et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDuring interglacial periods, formerly fragmented populations in the Altai region expanded their distributions, triggering founder effects (Guo et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The mismatch distribution and BSP indicate that \u003cem\u003eT. brevicephalus\u003c/em\u003e experienced extensive postglacial colonization from separate refugia from ~\u0026thinsp;0.4\u0026ndash;0.1 MY. Significant negative Fu\u0026rsquo;s Fs and Tajima\u0026rsquo;s D values also provide evidence for population expansion, with the diffusion pattern in the haplotype network further supporting this inference. These phenomena are likely associated with an interglacial following a glacial period, when water temperatures rose, and Glacial Lake Outburst Floods resulted from glacial meltwater (Agatova et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Bohorquez et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Herget et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) to create conditions for eastward and westward population expansion.\u003c/p\u003e \u003cp\u003eHigh haplotype and low nucleotide diversities reflect the process of population expansion in \u003cem\u003eT. brevicephalus\u003c/em\u003e following a glacial period. While haplotype diversity increased, there was insufficient accumulation of nucleotide variation, leading to a founder effect produced by a single or few populations. Additionally, a contact zone (Larson et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Wen and Fu \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) was identified in the central Altai Mountains, specifically in Crane River. The haplotype network indicates that the population in this contact zone (KE) possesses haplotypes from both populations A and B. Analyses such as AR, HO, HE, and BAPS consistently reveal the Crane River population, with mixed ancestry, exhibits levels of genetic diversity higher than those observed in other populations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eConservation and Management Considerations: Research Implications\u003c/h2\u003e \u003cp\u003eThe unique environment presented by the Altai Mountains has fostered a rich diversity of flora and fauna, making it one of the most abundant natural gene pools in Central Asia. However, over the past 50 years anthropogenic disturbances such as overfishing, mineral resource development, tourism, and the construction of roads and hydropower stations have posed an increasing threat to the habitats of rare and endangered wildlife in the Altai region. Of concern is that the salmonid \u003cem\u003eStenodus leucichthys\u003c/em\u003e, which shares migratory habits with \u003cem\u003eT. brevicephalus\u003c/em\u003e, was the primary catch in the upper reaches of the Irtysh River during the 1960s. However, downstream hydroelectric facility construction in the OB River and Irtysh River prevents upstream migration of this species to spawn in China (Freyhof and Emma \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Poursaeid and Falahatkar \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Consequently, \u003cem\u003eS. leucichthys\u003c/em\u003e has disappeared within China and is now considered to be regionally extinct. To mitigate the adverse impacts caused by sharp increases in human activity, and to protect the genetic resources of aquatic species and their habitats, the Chinese government established several aquatic germplasm resource protection zones in the upper Irtysh River. Within these zones artificial breeding and enhancement efforts occur, including the artificial propagation and release of various rare aquatic organisms such as \u003cem\u003eT. brevicephalus\u003c/em\u003e to ensure their viability.\u003c/p\u003e \u003cp\u003eThe moderate level of genetic differentiation between eastern and western populations suggests that \u003cem\u003eT. brevicephalus\u003c/em\u003e exhibits a conservative behavioral pattern typical of the genus (G\u0026ouml;nczi \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1989\u003c/span\u003e; Northcote \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Nyk\u0026auml;nen et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Among the six haplotypes found in Karaertis and Kayiertesi river populations of the eastern group, only two are shared. This indicates that gene flow between adjacent rivers for \u003cem\u003eT. brevicephalus\u003c/em\u003e is rare, a phenomenon that is even more pronounced at the species level. For instance, significant phenotypic and genetic divergence between \u003cem\u003eT. brevicephalus\u003c/em\u003e on the southern and \u003cem\u003eT. brevirostris\u003c/em\u003e on the northern slopes of the Altai Mountains suggests substantial differentiation. Additionally, \u003cem\u003eT. nikolskyi\u003c/em\u003e, which shares the Ob-Irtysh River system with \u003cem\u003eT. brevicephalus\u003c/em\u003e, also exhibits a complete absence of gene flow despite there being no drainage basin isolation. These unique life history traits have significant implications for the conservation and management of both intra- and inter-species diversity within this genus.\u003c/p\u003e \u003cp\u003eConservation must consider genetic characteristics of species. We demonstrate relatively low overall genetic diversity in \u003cem\u003eT. brevicephalus\u003c/em\u003e, and relatively poor diversity within each geographical population, indicating a need to manage this species. Observed genetic differences between eastern and western populations suggest that individuals from the upper Irtysh River in China and those in Lake Markokol, Kazakhstan, belong to a single population, with the Kara-Kaba River serving as a natural boundary between the two countries. International cooperation in conservation is therefore required to protect fish resources throughout this area.\u003c/p\u003e \u003cp\u003eManagement units refer to taxonomic units with a common ancestor and some degree of genetic independence, while evolutionarily significant units need to demonstrate significantly different genetic compositions, exhibit reciprocal monophyly in lineage relationships, and show clear isolation from other populations. Currently, \u003cem\u003eT. brevicephalus\u003c/em\u003e has developed a moderate degree of genetic differentiation. Given the existence of a contact zone, \u003cem\u003eT. brevicephalus\u003c/em\u003e has yet to achieve complete geographic isolation. Following the principles proposed by Moritz (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e1994\u003c/span\u003e) and Waples (\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e1991\u003c/span\u003e), we recommend that two separate management units are established to best conserve this species, and that these be divided by the Crane River.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Special Funds for Basic Research Operating Costs of Chinese Academy of Fishery Sciences(NO.2023TD07)and Normalized monitoring of fishery resources and environment in key waters of Northwest, Ministry of Agriculture and Rural Affairs, China\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conceptualization and design. Material preparation and data collection were carried out by Bo Ma, Haoxiang Han and Wenjie Peng, and analysis was performed by Wenjie Peng and Bo Ma. The first draft of the manuscript was written by Wenjie Peng and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and analysed during the current study are available in the GenBank \u0026nbsp;(PP425404 - PP425725)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompliance with Ethical Standards\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ewelfare of animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has passed the application for ethical review of experimental animal welfare at the Heilongjiang Fisheries Research Institute (20190820-001) and normalized monitoring of fishery resources and environment in key waters of Northwest, Ministry of Agriculture and Rural Affairs, China\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAgatova AR, Nepop RK, Khazin LB, et al (2019) New Chronological, Paleontological, and Geochemical Data on the Formation of Glacier-Dammed Lakes in the Kurai Depression (Southeastern Russian Altai) at the End of the Late Pleistocene. Doklady Earth Sciences 488:1134\u0026ndash;1136. https://doi.org/10.1134/s1028334x19090228\u003c/li\u003e\n\u003cli\u003eAndrushchenko P, Zuev I, Kislitsina N, et al (2023) Summer Time Distribution of Sedentary and Migratory Individuals of the Baikal Grayling \u003cem\u003eT. baicalensis\u003c/em\u003e in the Tributaries of the Thermally Altered Section of the Yenisei River. Journal of Siberian Federal University Biology 15:491\u0026ndash;506. https://doi.org/10.17516/1997-1389-0400\u003c/li\u003e\n\u003cli\u003eBohorquez P, Jimenez-Ruiz PJ, Carling PA (2019) Revisiting the dynamics of catastrophic late Pleistocene glacial-lake drainage, Altai Mountains, central Asia. Earth-Science Reviews 197:102892. https://doi.org/10.1016/j.earscirev.2019.102892\u003c/li\u003e\n\u003cli\u003eBolikhovskaya NS, Shunkov MV (2014) Pleistocene Environments of Northwestern Altai: Vegetation and Climate. Archaeology, Ethnology and Anthropology of Eurasia 42:2\u0026ndash;17. https://doi.org/10.1016/j.aeae.2015.01.001\u003c/li\u003e\n\u003cli\u003eCapobianco A, Friedman M (2019) Vicariance and dispersal in southern hemisphere freshwater fish clades: a palaeontological perspective. Biol Rev 94:662\u0026ndash;699. https://doi.org/10.1111/brv.12473\u003c/li\u003e\n\u003cli\u003eChen T, Jiao L, Ni L (2022) The phylogeographical pattern of the Amur minnow \u003cem\u003eRhynchocypris lagowskii\u003c/em\u003e (Cypriniformes: Cyprinidae) in the Qinling Mountains. Ecol Evol 12:e8924. https://doi.org/10.1002/ece3.8924\u003c/li\u003e\n\u003cli\u003eCollin FD, Durif G, Raynal L, et al (2021) Extending approximate Bayesian computation with supervised machine learning to infer demographic history from genetic polymorphisms using DIYABC Random Forest. Mol Ecol Resour 21:2598\u0026ndash;2613. https://doi.org/10.1111/1755-0998.13413\u003c/li\u003e\n\u003cli\u003eCorander J, Marttinen P (2006) Bayesian identification of admixture events using multilocus molecular markers. Mol Ecol 15:2833\u0026ndash;43. https://doi.org/10.1111/j.1365-294X.2006.02994.x\u003c/li\u003e\n\u003cli\u003eCorander J, Marttinen P, Sir\u0026eacute;n J, Tang J (2008) Enhanced Bayesian modelling in BAPS software for learning genetic structures of populations. BMC Bioinf 9:539. https://doi.org/10.1186/1471-2105-9-539\u003c/li\u003e\n\u003cli\u003eCornuet JM, Pudlo P, Veyssier J, et al (2014) DIYABC v2.0: a software to make approximate Bayesian computation inferences about population history using single nucleotide polymorphism, DNA sequence and microsatellite data. Bioinformatics 30:1187\u0026ndash;1189. https://doi.org/10.1093/bioinformatics/btt763\u003c/li\u003e\n\u003cli\u003eDevyatkin E. B (1981) Cenozoic of Inner Asia (stratigraphy, geochronology, correlation). Science, Moscow\u003c/li\u003e\n\u003cli\u003eDrummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Ecol Evol 7:214. https://doi.org/10.1186/1471-2148-7-214\u003c/li\u003e\n\u003cli\u003eDyldin Y, Hanel L, Romanov V, Plesnik J (2017) A review of the genus \u003cem\u003eThymallus\u003c/em\u003e (Pisces: Salmoniformes, Salmonidae, Thymallinae) with taxonomic notes. Bulletin Lampetra 8:103\u0026ndash;126\u003c/li\u003e\n\u003cli\u003eEarl DA, vonHoldt BM (2012) STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 4:359\u0026ndash;361\u003c/li\u003e\n\u003cli\u003eEdler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373\u0026ndash;377. https://doi.org/10.1111/2041-210X.13512\u003c/li\u003e\n\u003cli\u003eExcoffier L, Lischer HE (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10:564\u0026ndash;7. https://doi.org/10.1111/j.1755-0998.2010.02847.x\u003c/li\u003e\n\u003cli\u003eFreyhof J and Emma GE (2011) European Red List of freshwater fishes. Publications Office of the European Union, Luxembourg\u003c/li\u003e\n\u003cli\u003eFroufe E, Alekseyev S, Knizhin I, et al (2003a) Comparative phylogeography of salmonid fishes (Salmonidae) reveals late to post-Pleistocene exchange between three now-disjunct river basins in Siberia. Divers Distrib 9:269\u0026ndash;282. https://doi.org/10.1046/j.1472-4642.2003.00024.x\u003c/li\u003e\n\u003cli\u003eFroufe E, Knizhin I, Koskinen MT, et al (2003b) Identification of reproductively isolated lineages of Amur grayling (\u003cem\u003eThymallus grubii \u003c/em\u003eDybowski 1869): concordance between phenotypic and genetic variation. Mol Ecol 12:2345\u0026ndash;55. https://doi.org/10.1046/j.1365-294x.2003.01901.x\u003c/li\u003e\n\u003cli\u003eGinson R, Walter RP, Mandrak NE, et al (2015) Hierarchical analysis of genetic structure in the habitat-specialist Eastern Sand Darter (\u003cem\u003eAmmocrypta pellucida\u003c/em\u003e). Ecol Evol 5:695\u0026ndash;708. https://doi.org/10.1002/ece3.1392\u003c/li\u003e\n\u003cli\u003eG\u0026ouml;nczi AP (1989) A study of physical parameters at the spawning sites of the european grayling (\u003cem\u003eThymallus thymallus \u003c/em\u003eL\u003cem\u003e.\u003c/em\u003e). Regulated Rivers: Research \u0026amp; Management 3:221\u0026ndash;224. https://doi.org/10.1002/rrr.3450030121\u003c/li\u003e\n\u003cli\u003eGoudet J-M (2001) FSTAT, a program to estimate and test gene diversities and fixation indices, version 2.9. 3. http://www2. unil. ch/popgen/softwares/fstat. htm.\u003c/li\u003e\n\u003cli\u003eGum B, Gross R, Kuehn R (2005) Mitochondrial and nuclear DNA phylogeography of European grayling (\u003cem\u003eThymallus thymallus\u003c/em\u003e): evidence for secondary contact zones in central Europe. Mol Ecol 14:1707\u0026ndash;1725. https://doi.org/10.1111/j.1365-294X.2005.02520.x\u003c/li\u003e\n\u003cli\u003eGuo XZ, Zhang GR, Wei KJ, et al (2019) Phylogeography of the threatened tetraploid fish, \u003cem\u003eSchizothorax waltoni\u003c/em\u003e, in the Yarlung Tsangpo River on the southern Qinghai-Tibet Plateau: implications for conservation. Sci Rep 9:2704. https://doi.org/10.1038/s41598-019-39128-y\u003c/li\u003e\n\u003cli\u003eGuo Y, Zhang RM, Cai LG (2012) Fishes of Xinjiang. Xinjiang Science and Technology Press, Urumqi\u003c/li\u003e\n\u003cli\u003eHerget J, Agatova AR, Carling PA, Nepop RK (2020) Altai megafloods\u0026mdash;The temporal context. Earth-Science Reviews 200:102995. https://doi.org/10.1016/j.earscirev.2019.102995\u003c/li\u003e\n\u003cli\u003eHuangfu PP, Fan W, Li Z-H, et al (2023) Linkage between the India\u0026ndash;Asia collision and far-field reactivation of the Altai mountains. Palaeogeography, Palaeoclimatology, Palaeoecology 616:111478. https://doi.org/10.1016/j.palaeo.2023.111478\u003c/li\u003e\n\u003cli\u003eJacobsen MW, Hansen MM, Orlando L, et al (2012) Mitogenome sequencing reveals shallow evolutionary histories and recent divergence time between morphologically and ecologically distinct European whitefish (\u003cem\u003eCoregonus\u003c/em\u003e spp.). Mol Ecol 21:2727\u0026ndash;2742. https://doi.org/10.1111/j.1365-294X.2012.05561.x\u003c/li\u003e\n\u003cli\u003eJakobsson M, Rosenberg NA (2007) CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23:1801\u0026ndash;1806. https://doi.org/10.1093/bioinformatics/btm233\u003c/li\u003e\n\u003cli\u003eJanosik AM, Whitaker JM, Johnston CE (2023) Phylogeography and population structure of the Rock Darter species complex, \u003cem\u003eEtheostoma rupestre\u003c/em\u003e (Teleostomi: Percidae) across the Mobile River Basin. Hydrobiologia 850:761\u0026ndash;773. https://doi.org/10.1007/s10750-022-05122-1\u003c/li\u003e\n\u003cli\u003eJens-Christian S, Wolf L, Signe N, et al (2015) The Influence of Paleoclimate on Present-Day Patterns in Biodiversity and Ecosystems. Annu Rev Ecol Evol S46:551\u0026ndash;572. https://doi.org/10.1146/annurev-ecolsys-112414-054314\u003c/li\u003e\n\u003cli\u003eJiang HL (2012) A Study on Quaternary Glacial Evolution Sequences in the Kanas River, Altai Mountains - Application on Dating of Optically Stimulated Luminescence. Dissertation, Northwest Normal University\u003c/li\u003e\n\u003cli\u003eKavanagh KD, Haugen TO, Gregersen F, et al (2010) Contemporary temperature-driven divergence in a Nordic freshwater fish under conditions commonly thought to hinder adaptation. BMC Evol Biol 10:350. https://doi.org/10.1186/1471-2148-10-350\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Bogdanov BE, Vasil\u0026rsquo;eva EA (2006a) Biological and morphological characteristic of the Arctic grayling \u003cem\u003eThymallus arcticus\u003c/em\u003e (Thymallidae) from Alpine Lakes of the basin of the upper reaches of the Angara River. J Ichthyol 46:709\u0026ndash;721. https://doi.org/10.1134/S0032945206090037\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Kirillov AF, Weiss SJ (2006b) On the diversity and taxonomic status of graylings (\u003cem\u003eThymallus Thymallidae\u003c/em\u003e) from the Lena River. J Ichthyol 46:234\u0026ndash;246. https://doi.org/10.1134/S0032945206030039\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Weiss SJ (2009) A new species of grayling \u003cem\u003eThymallus svetovidovi\u003c/em\u003e sp. nova (Thymallidae) from the Yenisei basin and its position in the genus Thymallus. J Ichthyol 49:1\u0026ndash;9. https://doi.org/10.1134/S0032945209010019\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Weiss SJ, Bogdanov BE, et al (2006c) Finding a new form of the grayling \u003cem\u003eThymallus arcticus\u003c/em\u003e (thymallidae) in the basin of lake baikal. J Ichthyol 46:34\u0026ndash;43. https://doi.org/10.1134/S003294520601005X\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Weiss SJ, Bogdanov BE, et al (2008) Graylings (Thymallidae) of water bodies in western Mongolia: Morphological and genetic diversity. J Ichthyol 48:714\u0026ndash;735. https://doi.org/10.1134/S0032945208090038\u003c/li\u003e\n\u003cli\u003eKnizhin IB, Weiss SJ, Su\u0026scaron;nik S (2006d) Graylings of Baikal Lake basin (Thymallus, Thymallidae): Diversity of forms and their taxonomic status. J Ichthyol 46:418\u0026ndash;435. https://doi.org/10.1134/S0032945206060026\u003c/li\u003e\n\u003cli\u003eKoskinen MT, Knizhin I, Primmer CR, et al (2002a) Mitochondrial and nuclear DNA phylogeography of \u003cem\u003eThymallus\u003c/em\u003e spp. (grayling) provides evidence of ice-age mediated environmental perturbations in the world\u0026rsquo;s oldest body of fresh water, Lake Baikal. Mol Ecol 11:2599\u0026ndash;2611. https://doi.org/10.1046/j.1365-294X.2002.01642.x\u003c/li\u003e\n\u003cli\u003eKoskinen M, Nilsson J, Veselov AJ, et al (2002b) Microsatellite data resolve phylogeographic patterns in European grayling, \u003cem\u003eThymallus thymallus\u003c/em\u003e, Salmonidae. Heredity 88:391\u0026ndash;401. https://doi.org/10.1038/sj.hdy.6800072\u003c/li\u003e\n\u003cli\u003eKoskinen MT, Piironen J, Primmer CR (2001) Interpopulation genetic divergence in European grayling (\u003cem\u003eThymallus thymallus\u003c/em\u003e, Salmonidae) at a microgeographic scale: implications for conservation. Conserv Genet 2:133\u0026ndash;143. https://doi.org/10.1023/A:1011814528664\u003c/li\u003e\n\u003cli\u003eKoskinen MT, Sundell P, Piironen J, Primmer CR (2002c) Genetic assessment of spatiotemporal evolutionary relationships and stocking effects in grayling (\u003cem\u003eThymallus thymallus\u003c/em\u003e, Salmonidae). Ecol Lett 5:193\u0026ndash;205. https://doi.org/10.1046/j.1461-0248.2002.00302.x\u003c/li\u003e\n\u003cli\u003eLarkin MA, Blackshields G, Brown NP, et al (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947\u0026ndash;8. https://doi.org/10.1093/bioinformatics/btm404\u003c/li\u003e\n\u003cli\u003eLarson EL, White TA, Ross CL, Harrison RG (2013) Gene flow and the maintenance of species boundaries. Mol Ecol 23:1668\u0026ndash;1678. https://doi.org/10.1111/mec.12601\u003c/li\u003e\n\u003cli\u003eLeigh JW, Bryant D (2015) popart: full-feature software for haplotype network construction. Methods Ecol Evol 6:1110\u0026ndash;1116. https://doi.org/10.1111/2041-210X.12410\u003c/li\u003e\n\u003cli\u003eLetunic I, Bork P (2021) Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res 49:W293-w296. https://doi.org/10.1093/nar/gkab301\u003c/li\u003e\n\u003cli\u003eLiang Y, He D, Jia Y, et al (2017) Phylogeographic studies of schizothoracine fishes on the central Qinghai-Tibet Plateau reveal the highest known glacial microrefugia. Sci Rep 7:10983. https://doi.org/10.1038/s41598-017-11198-w\u003c/li\u003e\n\u003cli\u003eLiu H, Li Y, Liu X, et al (2014) Phylogeographic structure of \u003cem\u003eBrachymystax lenok tsinlingensis \u003c/em\u003e(Salmonidae) populations in the Qinling Mountains, Shaanxi, based on mtDNA control region. Mitochondrial DNA Part A 26:532\u0026ndash;537. https://doi.org/10.3109/19401736.2013.865168\u003c/li\u003e\n\u003cli\u003eLiu YG, Li YY, Meng W, Liu LX (2016) The complete mitochondrial DNA sequence of Xinjiang arctic grayling \u003cem\u003eThymallus arcticus grubei\u003c/em\u003e. Mitochondrial DNA Part B 1:724\u0026ndash;725. https://doi.org/10.1080/23802359.2016.1229589\u003c/li\u003e\n\u003cli\u003eMa B, Lui T, Zhang Y, Chen J (2012) Phylogeography and Population Genetic Structure of Amur Grayling \u003cem\u003eThymallus grubii\u003c/em\u003e in the Amur Basin. Asian-Australasian journal of animal sciences 25:935\u0026ndash;44. https://doi.org/10.5713/ajas.2011.11500\u003c/li\u003e\n\u003cli\u003eMoritz C (1994) Defining \u0026lsquo;Evolutionarily Significant Units\u0026rsquo; for conservation. Trends Ecol Evol 9:373\u0026ndash;375. https://doi.org/10.1016/0169-5347(94)90057-4\u003c/li\u003e\n\u003cli\u003eNorthcote TG (1995) Comparative biology and management of Arctic and European grayling (Salmonidae, Thymallus). Rev Fish Biol Fish 5:141\u0026ndash;194. https://doi.org/10.1007/BF00179755\u003c/li\u003e\n\u003cli\u003eNyk\u0026auml;nen M, Huusko A, M\u0026auml;ki-Pet\u0026auml;ys A (2001) Seasonal changes in the habitat use and movements of adult European grayling in a large subarctic river. J Fish Biol 58:506\u0026ndash;519. https://doi.org/10.1111/j.1095-8649.2001.tb02269.x\u003c/li\u003e\n\u003cli\u003eNylander J (2004) MrModeltest V2. Program Distributed by the Author. Bioinformatics 24:581\u0026ndash;583\u003c/li\u003e\n\u003cli\u003ePan S, Zhang W, Zhou GH, Zhang W (2007) Effect of lilted Uplift and Strike Sip Shear Structure of AltaiMountains on Ergisi and Wiungu River Basin Envron ment. Geological Science and Technology Information 26:19\u0026ndash;24. https://doi.org/1000-7849(2007)02-0019-06\u003c/li\u003e\n\u003cli\u003ePeakall R, Smouse PE (2012) GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research\u0026mdash;an update. Bioinformatics 28:2537\u0026ndash;2539. https://doi.org/10.1093/bioinformatics/bts460\u003c/li\u003e\n\u003cli\u003ePorras-Hurtado L, Ruiz Y, Santos C, et al (2013) An overview of STRUCTURE: applications, parameter settings, and supporting software. Front Genet 4:98. https://doi.org/10.3389/fgene.2013.00098\u003c/li\u003e\n\u003cli\u003ePoursaeid S, Falahatkar B (2012) Threatened fishes of the world: Stenodus leucichthys leucichthys G\u0026uuml;ldenst\u0026auml;dt, 1772 (Salmonidae). AQUA: International Journal of Ichthyology 18: 31-34. \u003c/li\u003e\n\u003cli\u003eRambaut A, Drummond AJ, Xie D, et al (2018) Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst Biol 67:901\u0026ndash;904. https://doi.org/10.1093/sysbio/syy032\u003c/li\u003e\n\u003cli\u003eRedenbach Z, Taylor EB (1999) Zoogeographical implications of variation in mitochondrial DNA of Arctic grayling (\u003cem\u003eThymallus arcticus\u003c/em\u003e). Mol Ecol 8:23\u0026ndash;35. https://doi.org/10.1046/j.1365-294x.1999.00516.x\u003c/li\u003e\n\u003cli\u003eRen ML, Guo Y, Zhang RM (2002) Fisheries Resources and Fishery of the Irtysh River in China. Xinjiang Science and Technology Press, Urumqi\u003c/li\u003e\n\u003cli\u003eRonquist F, Teslenko M, van der Mark P, et al (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539\u0026ndash;42. https://doi.org/10.1093/sysbio/sys029\u003c/li\u003e\n\u003cli\u003eRosenberg NA (2004) distruct: a program for the graphical display of population structure. Molecular Ecology Notes 4:137\u0026ndash;138. https://doi.org/10.1046/j.1471-8286.2003.00566.x\u003c/li\u003e\n\u003cli\u003eRozas J, Ferrer-Mata A, S\u0026aacute;nchez-DelBarrio JC, et al (2017) DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol Biol Evol 34:3299\u0026ndash;3302. https://doi.org/10.1093/molbev/msx248\u003c/li\u003e\n\u003cli\u003eSecci-Petretto G, Englmaier GK, Weiss SJ, et al (2023) Evaluating a species phylogeny using ddRAD SNPs: Cyto-nuclear discordance and introgression in the salmonid genus Thymallus (Salmonidae). Mol Phylogenet 178:107654. https://doi.org/10.1016/j.ympev.2022.107654\u003c/li\u003e\n\u003cli\u003eSkog A, V\u0026oslash;llestad LA, Stenseth NC, et al (2014) Circumpolar phylogeography of the northern pike (\u003cem\u003eEsox lucius\u003c/em\u003e) and its relationship to the Amur pike (\u003cem\u003eE. reichertii\u003c/em\u003e). Front Zool 11:67. https://doi.org/10.1186/s12983-014-0067-8\u003c/li\u003e\n\u003cli\u003eSlynko YV, Mendsaykhan B, Kas\u0026rsquo;anov AN (2010) On Intraspecies Forms of the Mongolian grayling (\u003cem\u003eThymallus brevirostris\u003c/em\u003e Kessl.) from Hoton Nur Lake (Western Mongolia). J Ichthyol 50:28\u0026ndash;37. https://doi.org/10.1134/S0032945210010042\u003c/li\u003e\n\u003cli\u003eStamford MD, Taylor EB (2004) Phylogeographical lineages of Arctic grayling (\u003cem\u003eThymallus arcticus\u003c/em\u003e) in North America: divergence, origins and affinities with Eurasian Thymallus. Mol Ecol 13:1533\u0026ndash;1549. https://doi.org/10.1111/j.1365-294X.2004.02174.x\u003c/li\u003e\n\u003cli\u003eSuchard MA, Rambaut A (2009) Many-core algorithms for statistical phylogenetics. Bioinformatics 25:1370\u0026ndash;6. https://doi.org/10.1093/bioinformatics/btp244\u003c/li\u003e\n\u003cli\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022\u0026ndash;3027. https://doi.org/10.1093/molbev/msab120\u003c/li\u003e\n\u003cli\u003eWallace DC (2007) Why do we still have a maternally inherited mitochondrial DNA? Insights from evolutionary medicine. Annu Rev Biochem 76:781\u0026ndash;821. https://doi.org/10.1146/annurev.biochem.76.081205.150955\u003c/li\u003e\n\u003cli\u003eWang EZ, liao XL, Yang Z, et al (2019) Comparative analysis of mitochondrial genomes in \u003cem\u003eHucho taimen\u003c/em\u003e distributed in Amur and Irtysh River systems. Journal of Hydroecology 40:75\u0026ndash;82. https://doi.org/10.15928/j.1674-3075.2019.04.010\u003c/li\u003e\n\u003cli\u003eWaples RS (1991) Pacific Salmon, \u003cem\u003eOncorhynchus\u003c/em\u003e spp., and the Definition of \u0026quot;Species\u0026quot; Under the Endangered Species Act. Marine Fisheries Review 53:11\u0026ndash;22.\u003c/li\u003e\n\u003cli\u003eWeiss S, Grimm J, Gon\u0026ccedil;alves DV, et al (2020a) Comparative genetic analysis of grayling (\u003cem\u003eThymallus\u003c/em\u003e spp. Salmonidae) across the paleohydrologically dynamic river drainages of the Altai-Sayan mountain region. Hydrobiologia 847:2823\u0026ndash;2844. https://doi.org/10.1007/s10750-020-04273-3\u003c/li\u003e\n\u003cli\u003eWeiss S, Knizhin I, Kirillov A, Froufe E (2006) Phenotypic and genetic differentiation of two major phylogeographical lineages of arctic grayling \u003cem\u003eThymallus arcticus\u003c/em\u003e in the Lena River, and surrounding Arctic drainages. Biological Journal of the Linnean Society 88:511\u0026ndash;525. https://doi.org/10.1111/j.1095-8312.2006.00621.x\u003c/li\u003e\n\u003cli\u003eWeiss S, Secci-Petretto G, Antonov A, Froufe E (2020b) Multiple species of grayling (\u003cem\u003eThymallus\u003c/em\u003e sp.) found in sympatry in a remote tributary of the Amur River. Zool Scr 49:117\u0026ndash;128. https://doi.org/10.1111/zsc.12393\u003c/li\u003e\n\u003cli\u003eWeiss SJ, Gon\u0026ccedil;alves DV, Secci-Petretto G, et al (2021) Global systematic diversity, range distributions, conservation and taxonomic assessments of graylings (Teleostei: Salmonidae; \u003cem\u003eThymallus\u003c/em\u003e spp.).Org Divers Evol 21:25\u0026ndash;42. https://doi.org/10.1007/s13127-020-00468-7\u003c/li\u003e\n\u003cli\u003eWen G, Fu J (2021) Isolation and reconnection: Demographic history and multiple contact zones of the green odorous frog (\u003cem\u003eOdorrana margaretae\u003c/em\u003e) around the Sichuan Basin. Mol Ecol 30:4103\u0026ndash;4117. https://doi.org/10.1111/mec.16021\u003c/li\u003e\n\u003cli\u003eWiens JJ, Donoghue MJ (2004) Historical biogeography, ecology and species richness. Trends Ecol Evol 19:639\u0026ndash;644. https://doi.org/10.1016/j.tree.2004.09.011\u003c/li\u003e\n\u003cli\u003eZang W, Fu Y, Liu B, et al (2015) Geomorphological process of late Quaternary glaciers in Kanas river valley of the Altay Mountains. Acta Geographica Sinica 70:739\u0026ndash;750. https://doi.org/10.11821/dlxb201505006\u003c/li\u003e\n\u003cli\u003eZhang F, Zhu L, Zhang L, et al (2017) Phylogeography of freshwater fishes of the Qilian Mountains area (\u003cem\u003eTriplophysa leptosoma\u003c/em\u003e, Cobitidae: Cypriniformes). Environ Biol Fish100:1383\u0026ndash;1396. https://doi.org/10.1007/s10641-017-0650-x\u003c/li\u003e\n\u003cli\u003eZhang YJ, St\u0026ouml;ck M, Zhang P, et al (2008) Phylogeography of a widespread terrestrial vertebrate in a barely-studied Palearctic region: green toads (\u003cem\u003eBufo viridis\u003c/em\u003e subgroup) indicate glacial refugia in Eastern Central Asia. Genetica 134:353\u0026ndash;365. https://doi.org/10.1007/s10709-008-9243-0\u003c/li\u003e\n\u003cli\u003eZhao J, Xiufeng Y, Harbor J, et al (2013) Quaternary glacial chronology of the Kanas River valley, Altai Mountains, China. Quat Int 311:44\u0026ndash;53. https://doi.org/10.1016/j.quaint.2013.07.047\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Altai Mountains, biogeography, Conserv Genet, OB-Irtysh River, Pleistocene, Thymallus","lastPublishedDoi":"10.21203/rs.3.rs-4063125/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4063125/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eQuaternary geological and climatic events in central Asia have influenced the evolutionary history of populations of endemic species, and patterns in their distribution. We investigate species of grayling (\u003cem\u003eThymallus\u003c/em\u003e) from the upper OB-Irtysh River, Xinjiang, China, using mitochondrial DNA sequences and 10 microsatellite markers. Phylogenetic analyses attribute this species to \u003cem\u003eThymallus brevicephalus\u003c/em\u003e, and validate its divergence from a sister taxon, the Mongolian grayling (\u003cem\u003eThymallus brevirostris\u003c/em\u003e) through geomorphological changes caused by uplift of the Altai Mountains. Microsatellite analysis using STRUCTURE and pairwise FST analysis reveals significant genetic differentiation between eastern and western \u003cem\u003eT. brevicephalus\u003c/em\u003e populations, which we estimate to have diverged approximately 0.81\u0026nbsp;million years ago (MY). High haplotype and low nucleotide diversities, and patterns of population history, indicate the western population of \u003cem\u003eT. brevicephalus\u003c/em\u003e has slowly expanded following the Last Glacial Maximum approximately 0.4\u0026ndash;0.1 MY. Hardy\u0026ndash;Weinberg disequilibrium and within-population inbreeding coefficients identify a founder effect in this species. The origin of \u003cem\u003eT. brevicephalus\u003c/em\u003e corresponds to the uplift of the Altai Mountains. Simultaneously, internal differentiation and population expansion occurred during repeated Quaternary climatic glacial\u0026ndash;interglacial cycles. If management of \u003cem\u003eT. brevicephalus\u003c/em\u003e, an endemic fish species in the upper Irtysh River in the Altai Mountains, was an option, we recommend establishing two management units separated by the Crane River. Release activities should be carried out independently for the eastern and western populations, and international cooperation in conservation efforts should be strengthened.\u003c/p\u003e","manuscriptTitle":"The freshwater fish genus Thymallus (Thymallidae) in the upper OB-Irtysh River: its evolutionary history and implications for conservation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-15 16:49:44","doi":"10.21203/rs.3.rs-4063125/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"eb8f5620-b6c5-4bbd-bccb-5556ebbf3d7e","owner":[],"postedDate":"March 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-08T20:14:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-15 16:49:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4063125","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4063125","identity":"rs-4063125","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.