WDR5 drives the development of cervical squamous cell carcinoma by inducing epithelial- mesenchymal transition and cancer-associated fibroblasts formation

WDR5 drives the development of cervical squamous cell carcinoma by inducing epithelial- mesenchymal transition and cancer-associated fibroblasts formation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article WDR5 drives the development of cervical squamous cell carcinoma by inducing epithelial- mesenchymal transition and cancer-associated fibroblasts formation Fangli Sun, Linmei Mo, Ying Lan, Qiuping Lu, Nengxian Wu, Honglin Song This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1640093/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract WD repeat domain 5 (WDR5) has been indicated to be involved in tumor progression, however, its role in cervical cancer (CC) has not been investigated yet. A total of 350 pairs of CC tissues and para-carcinoma tissues (PCT) were collected. Primary human cervical epithelial cells (hCECs) and cancer-associated fibroblasts (CAFs) were isolated from PCT and cancer tissues. MM102 was used to block the interaction between WDR5 and mixed lineage leukemia protein-1 (MLL1), and it was used in vivo to investigate its therapeutic value. WDR5 was up-regulated in cervical squamous cell carcinoma (CSCC) tissues compared to that in PCT. C-X-C motif chemokine ligand 8 (CXCL8) was indicated to be the target gene of WDR5. Highly expressed CXCL8 promoted epithelial-mesenchymal transition (EMT) to form CAFs, and enhanced the cytokine secretions in CAFs to promote CSCC progression. CXCL8 expression was regulated by the interaction between WDR5 and MLL1, and blocking the interaction between these two proteins using MM102 significantly suppressed tumor growth in mice models. WDR5 plays a key role in CSCC progression by inducing CXCL8 expression and promoting the transformation of CAFs from epithelial cells. Cervical squamous cell carcinoma WD repeat domain 5 C-X-C motif chemokine ligand 8 Epithelial-mesenchymal transition Cancer-associated fibroblasts Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Cervical cancer (CC) is the third most common cancer and the fourth leading cause of cancer death in women [ 1 ]. Cervical squamous cell carcinoma (CSCC) is the most common pathology subtype, accounting for about 80–90% of total CC [ 1 ]. The incidence of CC is much higher in developing countries due to the unavailability of HPV vaccines and unprotected sexuality [ 2 ]. It is estimated that more than 85% of CC and deaths were found in developing countries, including China [ 2 ]. Although early diagnosis can increase the survival rate of CC, the overall treatment efficacy is still poor because of its unclarified pathogenesis [ 3 ]. Cancer-associated fibroblasts (CAFs) are one of the most abundant stromal components in tumor stroma and have prominent roles in the pathogenesis of many, if not all, solid tumors [ 4 ]. Mechanistically, CAFs build up and remodel the tumor microenvironment (TME) by secreting growth factors and cytokines [ 5 ]. Recent studies indicate that CAFs are involved in the progression of CC [ 6 , 7 ], however, limited study has investigated how the formation of CAFs in CC tissues is regulated. WD repeat domain 5 (WDR5) is an important component of histone methyltransferase (HMT), which is responsible for the catalyzation of trimethylation of histone 3 lysine 4 (H3K4me3) [ 8 ]. WDR5 has been proved to play crucial roles in cancer pathogenesis [ 9 ], however, no study has explored its role in CC development. In this study, we proposed a hypothesis that WDR5 may drive the development of CC by promoting CAFs formation. Based on this hypothesis, we analyzed the expression pattern of WDR5 in CC tissues and the para-carcinoma tissues (PCT) using clinical samples. We also investigated the function of WDR5 by in vitro studies and explored the therapeutic value by targeting the WDR5 function using a mouse model. Materials And Methods Ethic s approval The usage of human tissues was approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: H2019018.v03). The experiments were undertaken with the understanding and written consent of each subject, and that the study conforms with The Code of Ethics of the World Medical Association (Declaration of Helsinki), printed in the British Medical Journal (18 July 1964). Humane care was given during the experimental animal breeding and experimental procedures in accordance with the 3R principle of experimental animals. Experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). All animal treatments were approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: KA190114.v02). Human tissue collection From April 8, 2019 to August 1, 2021, CC tissues and the corresponding PCT (defined as tissues ≥ 2 cm away from cancer tissues) from 350 cases of CC patients (250 cases of CSCC, 75 cases of cervical adenocarcinoma, and 25 cases of cervical adenosquamous cell carcinoma) were collected from the Department of Gynecologic Oncology, Guangxi Medical University Cancer Hospital. Basic information on patients was also gathered. All patients were diagnosed for the first time and had not received treatment before. Patients who received treatments before or complicated with other systemic diseases such as diabetes, cardiovascular, or cerebrovascular diseases were excluded from this study. Isolation and culture of cells The primary normal cervical epithelial cells (hCECs) were isolated as the prior report [10]. Briefly, the fresh PCT was minced and digested with type I collagenase at 37 °C for 60 min. The digested mixture was then filtrated through a stainless-steel strainer (0.5-1.0mm). Tell suspension was centrifuged at 1,500 rpm for 5 min, and hCECs were collected and cultured in Dulbecco's Modified Eagle's Medium (DMEM, Thermo Fisher Scientific, USA) supplemented with 10% (v/v) fetal bovine serum (FBS) (Clark, USA). The purity of hCECs was identified by > 90% positive immunofluorescence staining for cytokeratin 7 (Supplementary Figure 1A). Cells with passages > 10 were used in the following cell experiments. We also isolated primary CAFs from cancer tissues of CSCC as previously described [11]. Briefly, fresh cancer tissues were minced and digested with type I collagenase, and the digested mixture was filtrated through a nylon mesh of 38 um pore size. The CAFs were in the filtrate. The filtrate was centrifuged at 1000 g for 5 min, and CAFs were resuspended in DMEM supplemented with 10% FBS, and were then incubated in a fresh culture medium for 4 weeks to allow cell attachment and grow out. The purity of CAFs was identified by > 90% positive immunofluorescence staining for fibroblast activation protein (FAP) (Supplementary Figure 1B). Cells with passages > 10 were used in the following cell experiments. CSCC cell line CaSki was also used in this study. CaSki cells were purchased from the American Type Culture Collection (ATCC) and were cultured in DMEM supplemented with 10% FBS. Cells were all placed in the 37 °C incubators supplemented with 20% oxygen and 5% carbon dioxide. Cell transfections Small interfering RNAs (siRNAs) for WDR5 (si-WDR5) and CXCL8 (si-CXCL8) (VectorBuilder, China) were used to knock down the target transcripts. siRNAs having no target (si-NC) were served as the control. Plasmid overexpressing WDR5 (Vector-WDR5) or CXCL8 (Vector-CXCL8) were also used to express exogenous proteins, and the empty vectors (Vector-NC) were used as the control. The transfection was conducted using Lipofectamine 3000® Transfection Reagent (Invitrogen, USA) according to the manufacturers’ instructions. The sequence of siRNAs was provided in Table 1. Chromatin immunoprecipitation (ChIP) and ChIP-sequencing (ChIP-seq) ChIP assays were performed as described previously [12]. Briefly, cells were cross-linked, lysed, and sheared by sonication to produce DNA fragments with an average length of approximately 500 bp. Then, 1% of the chromatin fragments were used as the input. Chromatin was immunoprecipitated using antibodies against WDR5 (13105, Cell Signaling Technology, USA), H3K4me3 (ab8580, Abcam, USA), and MLL1 (34907, Cell Signaling Technology, USA). Normal rabbit IgG was added as the control. Then DNA fragments immunoprecipitated were purified and were further analyzed by quantitative real-time PCR (RT-qPCR). The sequence of primers used is provided in Table 1. ChIP-seq analyses were performed using the ChIP-IT High Sensitivity Kit (ab185908, Abcam, USA). The model-based analysis of the ChIP-Seq peak-finding algorithm was used to normalize ChIP against the input control. Immunohistochemistry Immunohistochemistry was performed on paraffin-embedded tissue sections. Tissues on the sections were blocked with 5% BSA, and were then incubated overnight at 4 °C with primary antibodies for the detection of the following: WDR5 (ab178410, Abcam, USA), CXCL8 (ab106350, Abcam, USA), and FAP (ab207178, Abcam, USA). After being incubated with the secondary antibodies, slides were visualized using DAB-Substrate (Beyotime, China) and photographed using the Aperio ePathology Scanner (Leica, Germany). Protein expression was quantified by H-score, which was calculated by the formula: H-score = Pi (i), where i is the intensity of staining with a value of 1, 2, or 3 (weak, moderate, or strong, respectively) and Pi is the percentage of stained cells for each intensity in the range of 0-100%. Immunofluorescence Cells were fixed with 4% formaldehyde and incubated overnight at 4°C with primary antibodies anti-vimentin (ab92547, Abcam, USA), anti-cytokeratin 7 (ab68459, Abcam, USA), anti-FAP (66562, Cell Signaling Technology, USA), and anti-tubulin (ab18207, Abcam, USA). Cells were then incubated with the goat anti-rabbit secondary antibody (BA1031, BOSTER, China) at 37°C for another 30 min. The nucleus was strained by 4ʹ,6-diamidino-2-phenylindole (Beyotime, China). Cells were observed by Laser Scanning Confocal Microscope (Leica, Germany) and results were analyzed by Leica Application Suite X (Leica, Germany). Western blotting (WB) Cells lysates containing total proteins were collected and prepared using a loading buffer. An equal amount of protein from each group was loaded into SDS-PAGE (10% gel) and separated by electrophoresis. Proteins in the gel were then transferred to a polyvinyl difluoride membrane. After immersion in quick blocking buffer (Beyotime, China) for 30 min, membranes were incubated overnight at 4 °C with the primary antibodies for the detection of the following: E-cadherin (ab40772, Abcam, USA), N-cadherin (ab76011, Abcam, USA), β-catenin (ab32572, Abcam, USA), snail (ab216347, Abcam, USA), and tubulin (ab215037, Abcam, USA). Membranes were then incubated with the secondary antibodies (ab6721, Abcam, USA) at room temperature for another 30 min. Protein bands in the membrane were visualized using ECL plus kit (Beyotime, China), and the relative expressions of target proteins were quantified using Image J (National Institutes of Health, USA). RT-qPCR Total RNA was extracted by the Trizol method (Thermo Fisher Scientific, USA) and were reversely transcript into cDNA using PrimeScriptTM RT Master Mix (Takara, Japan). RT-qPCR was performed on the Bio-Rad CFX96 (Bio-Rad Laboratories, USA) using SYBR Premix Ex TaqTM (Takara, Japan). The sequence of primers was provided in Table 1. The expression level of each transcript was calculated using the comparative threshold cycle (Ct), based on the using the 2 - △△Ct formula. Invasion Assay Invasion chambers (Corning, USA) were used to perform invasion assay. Briefly, 100 ul of Matrigel (BD, USA) was used to coat the inner side of the chamber, and then cells suspended in a culture medium were loaded. DMEM containing 20% FBS was added to the lower chamber as the chemoattractant. The chambers were incubated at 37°C for 48 hours. The non-invasive cells on the upper side of the chamber were removed gently, and chambers were stained using crystal violet to locate the invaded cells. The number of invaded cells was observed and photographed under an inverted optical microscope (Olympus, Japan). Enzyme-linked immunosorbent assay (ELISA) Levels of growth factors [granulocyte–macrophage colony-stimulating factor (GM-CSF), interleukin-6 (IL-6), CC-chemokine ligand 2 (CCL2), and transforming growth factor-β (TGF-β)] in cancer tissues and cell cultures were analyzed using ELISA kits (mlbio, China) according to the manufacturer’s protocols. The intra- and inter-assay coefficients of variation were all less than 10%. Samples were adjusted for total protein concentrations before detection to ensure that the amounts of total protein in each group were equal. Tumor xenograft mouse model Four-week male nude BALB/c mice (Cyagen, China) were housed in a facility with a 12 h light/dark cycle maintained at 25 ± 0.5°C and 50% to 60% humidity. The xenograft CC model was established as described before [13]. Briefly, CaSki cells were prepared as a single-cell suspension in Matrigel, and 1×10 6 prepared cells were injected subcutaneously into the right axillary fossa. Mice were euthanized 14 days after modeling (pelltobarbitalum natricum, 100mg/kg, intravenous administration), and tumor lesions were enucleated for further analysis. Statistical Analysis Statistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software, USA). The student’s t-test was used to analyze the difference between two groups, and one-way ANOVA was used for the comparison among multiple groups. The Chi-square test was used to analyze the categorical variables. In this study, results were obtained from three independent experiments, and P <0.05 was considered to be statistically significant. Results WDR5 is up-regulated in CSCC tissues compared to that in PCT We first analyzed the expression pattern of WDR5 in CC tissues and the corresponding PCT. Results showed that compared to PCT, WDR5 was up-regulated CSCC tissues (Fig.1 A and B), but had no significant change in cancer tissues of cervical adenocarcinoma and cervical adenosquamous cell carcinoma (Supplementary Figure 2A and B). We next analyzed the correlation between WDR5 expression and the TNM stage of CSCC patients, and found that WDR5 expression was positively correlated with the TNM stage—patients in III-IV stages had markedly higher WDR5 levels compared to patients in I-II stages (Fig. 1A and B). CXCL8 is a target of WDR5 To explore the function of WDR5, we performed ChIP-seq to find its target gene. Results of ChIP-seq showed that a large amount of DNA fragment of CXCL8 was immunoprecipitated by anti-WDR5 antibody (Fig. 2A), indicating that CXCL8 is a target gene of WDR5. Results of WB showed that overexpression WDR5 in hCECs significantly up-regulated the expression of CXCL8, while the knock-down of WDR5 in CAFs markedly inhibited CXCL8 expression (Fig. 2B). Results of ChIP analysis also indicated that WDR5 could be recruited to the promoter region of CXCL8 (Fig. 2C). These results all suggested that CXCL8 expression was regulated by WDR5. Consistent with the expression pattern of WDR5, analysis on human tissues showed that CXCL8 was up-regulated in CSCC tissues compared to that in PCT, and its expression level was positively correlated with the TNM stage of patients (Fig. 2D). CXCL8 promotes epithelial-mesenchymal transition (EMT) and induces the formation of CAFs Using hCECs from PCT, we next investigated the function of CXCL8 in the progression of CSCC. Results showed that overexpression of CXCL8 markedly changed the shape of hCECs, and made it present the shape of stromal cells (Fig. 3A). The markers of EMT such as E-cadherin, N-cadherin, β-catenin, and snail were all changed markedly (Fig. 3B). To identify the characteristic of these transformed cells, we analyzed the expression of FAP, a marker of CAFs [14]. Results showed that CXCL8 overexpression significantly up-regulated the expression of FAP (Fig. 3C), indicating that CXCL8 is an enhancer of CAFs formation. Besides, the secretions of cytokines such as GM-CSF, IL-6, CCL2, and TGFβ, which were proved to promote malignancy progression, were all up-regulated upon CXCL8 overexpression (Fig. 3D), and the invasive ability of CaSki cells was significantly enhanced when they were incubated with the culture medium from cells overexpressing CXCL8 (Fig. 3F). Loss of CXCL8 function makes CAFs transformed into epithelial cells Using CAFs from CSCC tissues, we then performed knockout experiments to verify the role of CXCL8. Results showed that knock-down of CXCL8 made CAFs present the shape of epithelial cells (Fig. 4A), and changed the expressions of EMT markers (Fig. 4B). Besides, the knock-down of CXCL8 suppressed the expression of FAP (Fig. 4C), attenuated the secretions of cytokines (Fig. 4D). Additionally, compared to the culture medium from CAFs treated with si-NC, the culture medium from hCSCs with CXCL8 knockout significantly attenuated the invasive ability of CaSki cells (Fig. 4E). These results all proved that CXCL8 was involved in CSCC progression by enhancing the transformation of CAFs from epithelial cells. CXCL8 is regulated by the interaction between WDR5 and MLL1 In mammals, WDR5 interacts with MLL1 to form the HMT complex and catalyzes the H3K4me3 in gene promoters [8]. We next investigated the regulation pathway of CXCL8 by using MM102, a molecule that can specifically block the interaction between WDR5 and MLL1. Results showed that in hCSCs from CSCC tissues, the expression of CXCL8 is down-regulated after WDR5 knockout, while the knockout of WDR5 had no impact on CXCL8 expression when MM102 was used, and MM102 markedly inhibited CXCL8 expression (Fig. 5A and C). Additionally, in hCECs from PCT, overexpression of WDR5 markedly induced CXCL8 expression, whereas WDR5 overexpression had no impact on CXCL8 expression when MM102 was used (Fig. 5B and D). ChIP analysis revealed that the distributions of WDR5, MLL1, and H3K4me3 in the CXCL8 promoter region were similar, and the recruitments of WDR5 and MLL1 in CXCL8 promoter were significantly higher in hCSCs from CSCC tissues than that in hCECs from PCT, as well as the H3K4me3 level of CXCL8 promoter (Fig. 5E and F). Blocking the interaction between WDR5 and MLL1 suppresses CC development We then performed in vivo study to explore the therapeutic value for CSCC by targeting the interaction between WDR5 and MLL1. Results showed that using MM102 could significantly inhibit tumor growth in mice model (Fig. 6A). Analysis on tumor body showed that MM102 could markedly attenuate the expressions of CXCL8 and FAP (Fig. 6B and C), and the markers of EMT (Fig. 6D), as well as the cytokines involved in tumor growth (Fig. 6E). Overall, all the above results indicate that WDR5 plays a key role in the development of CC. Highly expressed WDR5 promotes the transformation of CAFs from epithelial cells, and enhanced the secretions of cytokines such as GM-CSF, VEGF, PDGF, and TGFβ, thus driving the progression of CC (Fig. 7). Discussion Tumor recurrence, metastasis, and the intractable TME remain the three key unsolved issues that hamper effective cancer treatment in clinical practice [ 15 ]. TME creates a protective niche that is beneficial for tumor cells proliferation and invasion, and protects tumor cells from conventional interventions, leading to therapeutic failure [ 16 ]. It is well known that the TME is a multicellular system with complex tumor-stromal interactions [ 16 ]. Stromal support is essential for multi-step cancer progression including tumor growth, metastatic dissemination, and ectopic colonization [ 17 ]. However, normal fibroblasts have been indicated to function as an inhibitor of cell proliferation and tumorigenesis [ 18 ]. Therefore, reprogrammed fibroblasts, also known as CFAs, are proposed to explain the pro-tumorigenic ability of fibroblasts in tumor stroma. As the most abundant components in the tumor stroma, CAFs play a key role in the regulation of TME [ 15 ]. The role of CAFs has been extensively studied in vitro . Compared to normal fibroblasts, CAFs express different proteins and usually exhibit enhanced proliferative and migratory properties [ 19 ]. The most unique feature of CAFs is their ability to remodel the TME by their high capacity for cytokine secretions, including GM-CSF, TGFβ, IL-6, and CCL2 [ 20 ]. These cytokines can further recruit immunosuppressive cells into the tumor stroma, and lead to immune evasion [ 20 ]. One of the most important sources of CAFs is epithelial or endothelial cells adjacent to cancer cells undergoing EMT to form stromal cells, and further, transform into CAFs [ 21 ]. During the development of CSCC, normal epithelial cells gradually disappeared and are replaced by cancer cells and tumor stromal cells. Do these epithelial cells undergo apoptosis in the process of tumor dilatation? Or do they differentiate into another kind of cells to regulate CSCC progression? Previous studies have indicated that EMT occurs during CSCC oncogenesis and progression [ 22 , 23 ]. So, can these normal epithelial cells be transformed into CAFs via EMT and further be involved in CSCC progression? No answer has been given in previous reports. As a key regulator of HMT, WDR5 is crucial for H3K4me3, chromatin remodeling, and transcriptional activation of target genes [ 8 ]. It was also proven to function as an oncogenic protein and might serve as a novel epigenetic target in cancer treatment [ 9 ]. The role of WDR5 has been investigated in pancreatic cancer [ 24 ], breast cancer [ 25 ], prostate cancer [ 26 ], etc. However, its role in CC has not been explored yet. In this study, we proved that WDR5 expression was up-regulated in CSCC, and its level in cancer tissue is positively correlated with the TNM stage of patients, suggesting that WDR5 is an oncogenic protein that promotes the development of CSCC. A recent study reveals that WDR5 facilitates EMT and metastasis of cholangiocarcinoma by changing chromatin opening and target gene expression [ 27 ], however, no study has investigated the role of WDR5 in EMT in CSCC and its relationship with CFAs formation. Again, our results revealed that highly expressed WDR5 facilitates EMT of normal cervical epithelial cells, and promotes the transformation of CAFs from epithelial cells, so as to drive the progression of CSCC. More importantly, we found a way to block the function of WDR5 by hindering the interaction between WDR5 and MLL1, and proved that loss of WDR5 function suppressed CSCC growth in vivo , and this may provide us a novel approach for CSCC treatment. In conclusion, for the first time, this study investigated the role of WDR5 in CSCC development from the perspective of CAFs, and proved that highly expressed WDR5 induces EMT, promotes the formation of CAFs from epithelial cells, and enhanced the secretions of cytokines, thus driving the progression of CSCC. Declarations Acknowledgements Not applicable. Author contributions Conception: Honglin Song and Fangli Sun; Interpretation or analysis of data: Fangli Sun, Nengxian Wu, Ying Lan, Qiuping Lu, and Linmei Mo; Preparation of the manuscript: Fangli Sun and Linmei Mo; Revision for important intellectual content: Honglin Song and Fangli Sun; Supervision: Honglin Song Funding This work was supported by the Guangxi Key Research and Development Plan (Grant Number: GUIKE AB20159017), the Key Laboratory of High-Incidence Tumor Prevention and Treatment, Guangxi Medical University (Grant Number: GKE2018-10), the Graduate Course Construction Project of Guangxi Medical University (Grant Number: YJSB2019015), and the Degree and Postgraduate Education Reform Project of Guangxi Medical University (Grant Number: JGY2019059). Data availability Raw data and images can be obtained from the authors Code availability Not applicable. Conflict of interest All authors in this study declare that they have no conflict of interests. Ethical approval The usage of human tissues was approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: H2019018.v03). Animal experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). All animal treatments were approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: KA190114.v02). Consent to participate All authors stated consent for participation. Consent for Publication For all authors the final version of the manuscript was available and consent for publication was stated. References L.V. Volkova, A.I. Pashov and N.N. Omelchuk. Cervical Carcinoma: Oncobiology and Biomarkers, Int J Mol Sci 22 (2021):12571. doi: 10.3390/ijms222212571 . G. Bogani, F. Raspagliesi, V. di Donato, C. Brusadelli, R. Guerrisi, C. Pinelli, J. Casarin, F. Ghezzi, A Del Fabro, A. Ditto, T. Simoncini, A. Ciavattini and F. Sopracordevole. Spotlight on the role of human papillomavirus vaccines, Gynecol Oncol 160 (2021):346–350. doi: 10.1016/j.ygyno.2020.08.034 . M.K. Jung, T. Schmidt, S.H. Chon, M. Chevallay, F. Berlth, J. Akiyama, C.A. Gutschow and S.P. Mönig. Current surgical treatment standards for esophageal and esophagogastric junction cancer, Ann N Y Acad Sci 1482 (2020):77–84. doi: 10.1111/nyas.14454 . E. Sahai, I. Astsaturov, E. Cukierman, D.G. DeNardo, M. Egeblad, R.M. Evans, D. Fearon, F.R. Greten, S.R. Hingorani, T. Hunter, et al. A framework for advancing our understanding of cancer-associated fibroblasts, Nat Rev Cancer 20 (2020):174–186. doi: 10.1038/s41568-019-0238-1 . Z. Liao, Z.W. Tan, P. Zhu and N.S. Tan. Cancer-associated fibroblasts in tumor microenvironment - Accomplices in tumor malignancy, Cell Immunol 343 (2019):103729. doi: 10.1016/j.cellimm.2017.12.003 . W.F. Wei, X.J. Chen, L.J. Liang, L. Yu, X.G. Wu, C.F. Zhou, Z.C. Wang, L.S. Fan, Z. Hu, L. Liang and W. Wang. Periostin + cancer-associated fibroblasts promote lymph node metastasis by impairing the lymphatic endothelial barriers in cervical squamous cell carcinoma, Mol Oncol 15 (2021):210–227. doi: 10.1002/1878-0261.12837 . X. Zhang, Y. Wang, X. Wang, B. Zou, J. Mei, X. Peng and Z. Wu. Extracellular vesicles-encapsulated microRNA-10a-5p shed from cancer-associated fibroblast facilitates cervical squamous cell carcinoma cell angiogenesis and tumorigenicity via Hedgehog signaling pathway, Cancer Gene Ther 28 (2021):529–542. doi: 10.1038/s41417-020-00238-9 . E. Froimchuk, Y. Jang and K. Ge. Histone H3 lysine 4 methyltransferase KMT2D, Gene 627 (2017):337–342. doi: 10.1016/j.gene.2017.06.056 . K. Lu, H. Tao, X. Si and Q. Chen. The Histone H3 Lysine 4 Presenter WDR5 as an Oncogenic Protein and Novel Epigenetic Target in Cancer, Front Oncol 8 (2018):502. doi: 10.3389/fonc.2018.00502 . T. Fan, X. Li, Y. Li, Y. Zhi, S. Rong, G. Cheng and X. Zhang. An improved method for primary culture of normal cervical epithelial cells and establishment of cell model in vitro with HPV-16 E6 gene by lentivirus, J Cell Physiol 233 (2018):2773–2780. doi: 10.1002/jcp.25978 . B. Walch-Rückheim, R. Ströder, L. Theobald, J. Pahne-Zeppenfeld, S. Hegde, Y.J. Kim, R.M. Bohle, I. Juhasz-Böss, E.F. Solomayer and S. Smola. Cervical Cancer-Instructed Stromal Fibroblasts Enhance IL23 Expression in Dendritic Cells to Support Expansion of Th17 Cells, Cancer Res 79 (2019):1573–1586. doi: 10.1158/0008-5472.CAN-18-1913 . W. Xue, X. Yao, G. Ting, J. Ling, L. Huimin, Q. Yuan, Z. Chun, Z. Ming and Z. Yuanzhen. BPA modulates the WDR5/TET2 complex to regulate ERβ expression in eutopic endometrium and drives the development of endometriosis, Environ Pollut 268 (2021):115748. doi: 10.1016/j.envpol.2020.115748 . L. Li, Z.X. Wang and Z.H. Wang. Combination of IL-24 and cisplatin inhibits cervical cancer growth in a xenograft nude mice model, Asian Pac J Cancer Prev 12(2011):3293–3298. M. Nurmik, P. Ullmann, F. Rodriguez, S. Haan and E. Letellier. In search of definitions: Cancer-associated fibroblasts and their markers, Int J Cancer 146 (2020):895–905. doi: 10.1002/ijc.32193 . X. Chen and E. Song. Turning foes to friends: targeting cancer-associated fibroblasts, Nat Rev Drug Discov 18 (2019):99–115. doi: 10.1038/s41573-018-0004-1 . D.C. Hinshaw and L.A. Shevde. The Tumor Microenvironment Innately Modulates Cancer Progression, Cancer Res 79 (2019):4557–4566. doi: 10.1158/0008-5472.CAN-18-3962 . A.E. Denton, E.W. Roberts and D.T. Fearon. Stromal Cells in the Tumor Microenvironment, Adv Exp Med Biol 1060 (2018):99–114. doi: 10.1007/978-3-319-78127-3_6 . R. Kaukonen, A. Mai, M. Georgiadou, M. Saari, N. De Franceschi, T. Betz, H. Sihto, S. Ventelä, L. Elo, E. Jokitalo, et al. Normal stroma suppresses cancer cell proliferation via mechanosensitive regulation of JMJD1a-mediated transcription, Nat Commun 7 (2016):12237. doi: 10.1038/ncomms12237 . G. Biffi and D.A. Tuveson. Diversity and Biology of Cancer-Associated Fibroblasts, Physiol Rev 101 (2021):147–176. doi: 10.1152/physrev.00048.2019 . A. Costa, Y. Kieffer, A. Scholer-Dahirel, F. Pelon, B. Bourachot, M. Cardon, P. Sirven, I. Magagna, L. Fuhrmann, C. Bernard, et al. Fibroblast Heterogeneity and Immunosuppressive Environment in Human Breast Cancer, Cancer Cell 33 (2018):463–479.e10. doi: 10.1016/j.ccell.2018.01.011 . I. Druzhkova, M. Shirmanova, N. Ignatova, V. Dudenkova, M. Lukina, E. Zagaynova, D. Safina, S. Kostrov, D. Didych, A. Kuzmich, et al. Expression of EMT-Related Genes in Hybrid E/M Colorectal Cancer Cells Determines Fibroblast Activation and Collagen Remodeling, Int J Mol Sci 21 (2020):8119. doi: 10.3390/ijms21218119 . F.X. He, L.L. Zhang, P.F. Jin, D.D. Liu, A.H. Li. DPY30 regulates cervical squamous cell carcinoma by mediating epithelial-mesenchymal transition (EMT), Onco Targets Ther 12 (2019):7139–7147. doi: 10.2147/OTT.S209315 . Z. Zhang, Y. Zou, M. Liang, Y. Chen, Y. Luo, B. Yang, F. Liu, Y. Qin, D. He, F. Wang, et al. Suppressor of fused (Sufu) promotes epithelial-mesenchymal transition (EMT) in cervical squamous cell carcinoma, Oncotarget 8 (2017):114226–114238. doi: 10.18632/oncotarget.23176 . A. Carugo, G. Genovese, S. Seth, L. Nezi, J.L. Rose, D. Bossi, A. Cicalese, P.K. Shah, A. Viale, P.F. Pettazzoni, et al. In Vivo Functional Platform Targeting Patient-Derived Xenografts Identifies WDR5-Myc Association as a Critical Determinant of Pancreatic Cancer, Cell Rep 16 (2016):133–147. doi: 10.1016/j.celrep.2016.05.063 . R. Yao, Y. Wang, D. Han, Y. Ma, M. Ma, Y. Zhao, J. Tan, J. Lu, G. Xu, X. Li. Lysines 207 and 325 methylation of WDR5 catalyzed by SETD6 promotes breast cancer cell proliferation and migration, Oncol Rep 40 (2018):3069–3077. doi: 10.3892/or.2018.6669 . P. Gu, X. Chen, R. Xie, J. Han, W. Xie, B. Wang, W. Dong, C. Chen, M. Yang, J. Jiang, et al. lncRNA HOXD-AS1 Regulates Proliferation and Chemo-Resistance of Castration-Resistant Prostate Cancer via Recruiting WDR5, Mol Ther 25 (2017):1959–1973. doi: 10.1016/j.ymthe.2017.04.016 . T. Chen, K. Li, Z. Liu, J. Liu, Y. Wang, R. Sun, Z. Li, B. Qiu, X. Zhang, G. Ren, et al. WDR5 facilitates EMT and metastasis of CCA by increasing HIF-1α accumulation in Myc-dependent and independent pathways, Mol Ther 29 (2021):2134–2150. doi: 10.1016/j.ymthe.2021.02.017 . Tables Table 1 Sequence of siRNAs and primers Forward/Sense (5’-3’) Reverse/Antisense (5’-3’) CXCL8 promoter 3’-5’ 207-323 TCCTTTCTCACTAGGTGGC TCATACCTGACGCTGTGCTA 411-532 TGGCTTATGGTTGAAATTCCT GCACATGCCAGTAATCCCA 632-776 TAACTTCTCTGCCTCAAGGAC AGCCAAAATAGAGAGACGCAA 925-1050 GGTCCTAGTCTCGCACCCT CTGCCCACCCCTCTTCTCGG 1074-1223 GGCCTTCCCAGTGACCTCT ACCACACTTCGAGGATCACGTC 1308-1433 GCCATCTGTGCGCCACTATCCTT GAGCACCCTCGAACCGACTCC 1456-1602 AGGCACTACTCCCCTCTACCCT CCGCCTGCTCTTCGCCCTG 1623-1804 TGCTGGCTTTTTGGACACCCACT CCGCCGCCACCTGTTGAGGA siRNAs si-NC GAGGGGCUCACCGACACUCdTdT GGCGAΜGΜGAUAGUAGUCAdTdT si-WDR5 AGGGAGAAUΜGAACACAAdTdT UΜGΜGUUCAAUUCUCCCUdTdT si-CXCL8 CCAGCAAΜGUCACΜGUAUdTdT AUACAGAΜGΜGAUAACΜGGdCdG Gene WDR5 ATGCGACAGAGACCATCATAG CGTGAGGATATGGGATGTGAA GAPDH ACAGTCAGCCGCATCTTCTT GTTAAAAGCAGCCCTGGTGA Abbreviation: CXCL8: C-X-C motif chemokine ligand 8; WDR5: WD repeat domain 5 Additional Declarations No competing interests reported. Supplementary Files SupplementaryFigure1.tif SupplementaryFigure2.tif Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1640093","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":104956014,"identity":"6cc0406d-f9ab-4a3f-af99-8dea2378bb16","order_by":0,"name":"Fangli Sun","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fangli","middleName":"","lastName":"Sun","suffix":""},{"id":104956015,"identity":"27f38142-42e9-4386-9fcd-74ac7793117b","order_by":1,"name":"Linmei Mo","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Linmei","middleName":"","lastName":"Mo","suffix":""},{"id":104956017,"identity":"60fa4574-1860-45ca-aed9-f7a9394d7782","order_by":2,"name":"Ying Lan","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Lan","suffix":""},{"id":104956019,"identity":"0f3e88a6-3282-45ef-b888-7fc4179fac88","order_by":3,"name":"Qiuping Lu","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qiuping","middleName":"","lastName":"Lu","suffix":""},{"id":104956023,"identity":"31590bde-2582-41a6-90dd-7f58e2c52093","order_by":4,"name":"Nengxian Wu","email":"","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Nengxian","middleName":"","lastName":"Wu","suffix":""},{"id":104956025,"identity":"8337566b-7c2e-4dc1-85ea-fea218e955df","order_by":5,"name":"Honglin Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYBAC/uaDzZ95G2yATOYGBoYDRGiROHD4mDRvQxoDAxsjkVoMGI6lMfM2HCZJyxkzoJbzcgb3GxsffDjDIM8vRkAfUIvx578Nt40NjjE2G864wWA4c3YCfi2GB84YAP1yO3HDMcY2aZ4PDAkGtwloMThw/gNQyzlStJwA23IAquUGEVokzvaYAbUkG0seSwT65YwEYb/wt/MYf+b9YyfHd/jwwQcfjtnI80sT0IJhK2nKR8EoGAWjYBRgBwAUQ0s3ekanfgAAAABJRU5ErkJggg==","orcid":"","institution":"Guangxi Medical University Cancer Hospital","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Honglin","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2022-05-10 02:59:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1640093/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1640093/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":21451231,"identity":"da6b87cd-1ed9-43f0-a76e-280dc29da9a7","added_by":"auto","created_at":"2022-05-13 19:44:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1434220,"visible":true,"origin":"","legend":"\u003cp\u003eWDR5 is up-regulated in CSCC tissues compared to that in PCT. Results of \u003cstrong\u003e(A)\u003c/strong\u003e immunohistochemistry and \u003cstrong\u003e(B)\u003c/strong\u003e RT-qPCR revealed that compared to PCT, WDR5 was up-regulated significantly in CSCC tissues, and its level is positively correlated with the TNM stage of CSCC. Data were shown as mean ± SEM. ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/c3544dc6224826f5ada42bcb.png"},{"id":21451093,"identity":"5e4feb26-7d05-4b77-878d-0081b5b188d8","added_by":"auto","created_at":"2022-05-13 19:39:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1148168,"visible":true,"origin":"","legend":"\u003cp\u003eCXCL8 is a target of WDR5. \u003cstrong\u003e(A)\u003c/strong\u003e Results of ChIP-seq showed that a large number of DNA fragments of CXCL8 were immunoprecipitated by antibody anti-WDR5. \u003cstrong\u003e(B)\u003c/strong\u003e Results of WB revealed that CXCL8 expression is regulated by WDR5.\u003cstrong\u003e (C)\u003c/strong\u003e ChIP results showed that WDR5 can be recruited to the promoter region of CXCL8. \u003cstrong\u003e(D)\u003c/strong\u003e Immunohistochemistry shows that CXCL8 expression is positively correlated with the TNM stage of CSCC. Data were shown as mean ± SEM. ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/12ed6392012d56fc2d8f2925.png"},{"id":21451088,"identity":"b0c5151b-aa95-4156-810a-0e7b1d6a1ce1","added_by":"auto","created_at":"2022-05-13 19:39:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1697154,"visible":true,"origin":"","legend":"\u003cp\u003eCXCL8 induces the formation of CAFs. \u003cstrong\u003e(A)\u003c/strong\u003e Overexpression of CXCL8 promoted EMT of hCECs, and made the hCECs present the shape of stromal cells. \u003cstrong\u003e(B)\u003c/strong\u003e Markers of EMT in hCECs all changed significantly after CXCL8 overexpression.\u003cstrong\u003e (C) \u003c/strong\u003eFAP (green) expression was significantly up-regulated in hCECs after CXCL8 overexpression.\u003cstrong\u003e (D)\u003c/strong\u003e Secretions of cytokines including GM-CSF, IL-6, CCL2, and TGFβ were all enhanced in hCECs after CXCL8 overexpression. \u003cstrong\u003e(E)\u003c/strong\u003e The invasive ability of CaSki cells was enhanced markedly after being incubated with the culture medium from hCECs overexpressing CXCL8. Data were shown as mean ± SEM. ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/ea35d8197d92c96cf9aabf9e.png"},{"id":21451091,"identity":"8b1c8736-b439-4a89-a240-ab064712ee63","added_by":"auto","created_at":"2022-05-13 19:39:19","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1988455,"visible":true,"origin":"","legend":"\u003cp\u003eLoss of CXCL8 function makes CAFs transformed into epithelial cells. \u003cstrong\u003e(A)\u003c/strong\u003e Knock-down of CXCL8 reversed EMT of CAFs, and made the CAFs present the shape of epithelial cells. \u003cstrong\u003e(B)\u003c/strong\u003e Markers of EMT in CAFs all changed significantly after the CXCL8 knock-down. \u003cstrong\u003e(C)\u003c/strong\u003e FAP (green) expression was significantly down-regulated in CAFs after CXCL8 knock-down. \u003cstrong\u003e(D)\u003c/strong\u003e Secretions of cytokines including GM-CSF, IL-6, CCL2, and TGFβ were all attenuated after CXCL8 knock-down.\u003cstrong\u003e (E)\u003c/strong\u003e The invasive ability of CaSki cells was attenuated markedly after being incubated with the culture medium from CAFs with CXCL8 knock-down. Data were shown as mean ± SEM. ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/3516d2d5592dbe78cd5add2a.png"},{"id":21451094,"identity":"f625dd82-f347-4e16-ba1f-d8498dfd03c1","added_by":"auto","created_at":"2022-05-13 19:39:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":341369,"visible":true,"origin":"","legend":"\u003cp\u003eCXCL8 is regulated by the interaction between WDR5 and MLL1. \u003cstrong\u003e(A and C)\u003c/strong\u003e Expression of CXCL8 in CAFs was down-regulated after WDR5 knock-down, while the knock-down of WDR5 had no impact on CXCL8 expression when MM102 was used, and MM102 markedly inhibited CXCL8 expression in CAFs. \u003cstrong\u003e(B and D)\u003c/strong\u003e Expression of CXCL8 in hCECs was up-regulated after WDR5 overexpression, while the overexpression of WDR5 had no impact on CXCL8 expression when MM102 was used\u003cstrong\u003e (E and F)\u003c/strong\u003e ChIP analysis revealed that the distributions of WDR5, MLL1, and H3K4me3 in CXCL8 promoter were overlapping, and the recruitments of WDR5 and MLL1 in CXCL8 promoter were significantly higher in CAFs than that in hCECs, as well as the H3K4me3 level in this region. Data were shown as mean ± SEM. ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/86cc780e60c3bda07e33f9a8.png"},{"id":21451090,"identity":"c581a396-6d18-4c1e-b30c-3fea13b3116a","added_by":"auto","created_at":"2022-05-13 19:39:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2818176,"visible":true,"origin":"","legend":"\u003cp\u003eBlocking the interaction between WDR5 and MLL1 suppresses CC development. \u003cstrong\u003e(A) \u003c/strong\u003eUsing MM102 significantly suppressed tumor growth. \u003cstrong\u003e(B and C)\u003c/strong\u003e Using MM102 (10 ug/g) markedly down-regulated the expressions of CXCL8 and FAP in tumor lesions. \u003cstrong\u003e(D)\u003c/strong\u003e Using MM102 (10 ug/g) markedly changed the expression levels of EMT markers. \u003cstrong\u003e(E)\u003c/strong\u003e Using MM102 (10 ug/g) significantly down-regulated cytokines secretions in tumor lesions. Data were shown as mean ± SEM. ** \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/fb54715325d5437821faf523.png"},{"id":21451092,"identity":"578bc468-f6ab-4159-8bd0-fb1abe7c118a","added_by":"auto","created_at":"2022-05-13 19:39:20","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":43310,"visible":true,"origin":"","legend":"\u003cp\u003eOverview of the mechanism of WDR5 promoting CSCC development. WDR5 promotes the EMT process and enhances the transformation of CAFs from normal epithelial cells. CAFs secret cytokines such as GM-CSF, IL-6, CCL2, and TGFβ, and further drives CSCC progression.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/c8379081534f77eb062cff19.png"},{"id":21451233,"identity":"227f9ffd-4a84-47de-8037-0421078bb85e","added_by":"auto","created_at":"2022-05-13 19:44:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4176030,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/f7ff4d39-c627-41ea-888f-b85cd424c874.pdf"},{"id":21451096,"identity":"e89afb1b-6ad1-4aed-9db1-aced381491dd","added_by":"auto","created_at":"2022-05-13 19:39:21","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":44213768,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/25091772b5da17fff633399d.tif"},{"id":21451095,"identity":"71dacc7f-cc36-4f5e-82a2-e5940a209076","added_by":"auto","created_at":"2022-05-13 19:39:20","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":6289524,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-1640093/v1/4102afc00dfa9ab272113314.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"WDR5 drives the development of cervical squamous cell carcinoma by inducing epithelial- mesenchymal transition and cancer-associated fibroblasts formation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCervical cancer (CC) is the third most common cancer and the fourth leading cause of cancer death in women [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Cervical squamous cell carcinoma (CSCC) is the most common pathology subtype, accounting for about 80\u0026ndash;90% of total CC [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The incidence of CC is much higher in developing countries due to the unavailability of HPV vaccines and unprotected sexuality [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is estimated that more than 85% of CC and deaths were found in developing countries, including China [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Although early diagnosis can increase the survival rate of CC, the overall treatment efficacy is still poor because of its unclarified pathogenesis [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCancer-associated fibroblasts (CAFs) are one of the most abundant stromal components in tumor stroma and have prominent roles in the pathogenesis of many, if not all, solid tumors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Mechanistically, CAFs build up and remodel the tumor microenvironment (TME) by secreting growth factors and cytokines [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Recent studies indicate that CAFs are involved in the progression of CC [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], however, limited study has investigated how the formation of CAFs in CC tissues is regulated.\u003c/p\u003e \u003cp\u003eWD repeat domain 5 (WDR5) is an important component of histone methyltransferase (HMT), which is responsible for the catalyzation of trimethylation of histone 3 lysine 4 (H3K4me3) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. WDR5 has been proved to play crucial roles in cancer pathogenesis [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], however, no study has explored its role in CC development. In this study, we proposed a hypothesis that WDR5 may drive the development of CC by promoting CAFs formation. Based on this hypothesis, we analyzed the expression pattern of WDR5 in CC tissues and the para-carcinoma tissues (PCT) using clinical samples. We also investigated the function of WDR5 by \u003cem\u003ein vitro\u003c/em\u003e studies and explored the therapeutic value by targeting the WDR5 function using a mouse model.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eEthic\u003c/strong\u003e\u003cstrong\u003es approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe usage of human tissues was approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: H2019018.v03). The experiments were undertaken with the understanding and written consent of each subject, and that the study conforms with The Code of Ethics of the World Medical Association (Declaration of Helsinki), printed in the British Medical Journal (18 July 1964).\u003c/p\u003e\n\u003cp\u003eHumane care was given during the experimental animal breeding and experimental procedures in accordance with the 3R principle of experimental animals. Experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). All animal treatments were approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: KA190114.v02).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHuman tissue collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFrom April 8, 2019 to August 1, 2021, CC tissues and the corresponding PCT (defined as tissues \u0026ge; 2 cm away from cancer tissues) from 350 cases of CC patients (250 cases of CSCC, 75 cases of cervical adenocarcinoma, and 25 cases of cervical adenosquamous cell carcinoma) were collected from the Department of Gynecologic Oncology, Guangxi Medical University Cancer Hospital. Basic information on patients was also gathered. All patients were diagnosed for the first time and had not received treatment before. Patients who received treatments before or complicated with other systemic diseases such as diabetes, cardiovascular, or cerebrovascular diseases were excluded from this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and culture of cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe primary normal cervical epithelial cells (hCECs) were isolated as the\u0026nbsp;prior report [10]. Briefly, the fresh PCT was minced and digested with type I collagenase at 37 \u0026deg;C for 60 min. The digested mixture was then filtrated through a stainless-steel strainer (0.5-1.0mm). Tell suspension was centrifuged at 1,500 rpm for 5 min, and hCECs were collected and cultured in Dulbecco\u0026apos;s Modified Eagle\u0026apos;s Medium (DMEM, Thermo Fisher Scientific, USA) supplemented with 10% (v/v) fetal bovine serum (FBS) (Clark, USA). The purity of hCECs was identified by \u0026gt; 90% positive immunofluorescence staining for cytokeratin 7 (Supplementary Figure 1A). Cells with passages \u0026gt; 10 were used in the following cell experiments.\u003c/p\u003e\n\u003cp\u003eWe also isolated primary CAFs from cancer tissues of CSCC as previously described [11]. Briefly, fresh cancer tissues were minced and digested with type I collagenase, and the digested mixture was filtrated through a nylon mesh of 38 um pore size. The CAFs were in the filtrate. The filtrate was centrifuged at 1000 g for 5 min, and CAFs were resuspended in DMEM supplemented with 10% FBS, and were then incubated in\u0026nbsp;a fresh culture medium for 4 weeks to allow cell attachment and grow out. The purity of CAFs was identified by \u0026gt; 90% positive immunofluorescence staining for fibroblast activation protein (FAP) (Supplementary Figure 1B). Cells with passages \u0026gt; 10 were used in the following cell experiments.\u0026nbsp;CSCC cell line CaSki was also used in this study. CaSki cells were purchased from\u0026nbsp;the American Type Culture Collection (ATCC) and were cultured in DMEM supplemented with 10% FBS. Cells were all placed in the 37 \u0026deg;C incubators supplemented with 20% oxygen and 5% carbon dioxide.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell transfections\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSmall interfering RNAs (siRNAs) for WDR5 (si-WDR5) and CXCL8 (si-CXCL8) (VectorBuilder, China) were used to knock down the target transcripts. siRNAs having no target (si-NC) were served as the control. Plasmid overexpressing WDR5 (Vector-WDR5) or CXCL8 (Vector-CXCL8) were also used to express exogenous proteins, and the empty vectors (Vector-NC) were used as the control. The transfection was conducted using Lipofectamine 3000\u0026reg; Transfection Reagent (Invitrogen, USA) according to the manufacturers\u0026rsquo; instructions. The sequence of siRNAs was provided in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChromatin immunoprecipitation (ChIP) and ChIP-sequencing (ChIP-seq)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChIP assays were performed as described previously [12]. Briefly, cells were cross-linked, lysed, and sheared by sonication to produce DNA fragments with an average length of approximately 500 bp. Then, 1% of the chromatin fragments were used as the input. Chromatin was immunoprecipitated using antibodies against WDR5 (13105, Cell Signaling Technology, USA), H3K4me3 (ab8580, Abcam, USA), and MLL1 (34907, Cell Signaling Technology, USA). Normal rabbit IgG was added as the control. Then DNA fragments immunoprecipitated were purified and were further analyzed by quantitative real-time PCR (RT-qPCR). The sequence of primers used is provided in Table 1. ChIP-seq analyses were performed using the ChIP-IT High Sensitivity Kit (ab185908, Abcam, USA). The model-based analysis of the\u0026nbsp;ChIP-Seq peak-finding algorithm was used to normalize ChIP against the input control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eImmunohistochemistry was performed on paraffin-embedded tissue sections. Tissues on the sections were blocked with 5% BSA, and were then incubated overnight at 4 \u0026deg;C with primary antibodies for the detection of the following: WDR5 (ab178410, Abcam, USA), CXCL8 (ab106350, Abcam, USA), and FAP (ab207178, Abcam, USA). After being incubated with the secondary antibodies, slides were visualized using DAB-Substrate (Beyotime, China) and photographed using the Aperio ePathology Scanner (Leica, Germany). Protein expression was quantified by H-score, which was calculated by the formula: H-score = Pi (i), where i is the intensity of staining with a value of 1, 2, or 3 (weak, moderate, or strong, respectively) and Pi is the percentage of stained cells for each intensity in the range of 0-100%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were fixed with 4% formaldehyde and incubated overnight at 4\u0026deg;C with primary antibodies anti-vimentin (ab92547, Abcam, USA), anti-cytokeratin 7 (ab68459, Abcam, USA), anti-FAP (66562, Cell Signaling Technology, USA), and anti-tubulin (ab18207, Abcam, USA). Cells were then incubated with the goat anti-rabbit secondary antibody (BA1031, BOSTER, China) at 37\u0026deg;C for another 30 min. The nucleus was strained by 4ʹ,6-diamidino-2-phenylindole (Beyotime, China). Cells were observed by Laser Scanning Confocal Microscope (Leica, Germany) and results were analyzed by Leica Application Suite X (Leica, Germany).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting (WB)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells lysates containing total proteins were collected and prepared using a\u0026nbsp;loading buffer. An equal amount of protein from each group was loaded into SDS-PAGE (10% gel) and separated by electrophoresis. Proteins in the gel were then transferred to a polyvinyl difluoride membrane. After immersion in quick blocking buffer (Beyotime, China) for 30 min, membranes were incubated overnight at 4 \u0026deg;C with the primary antibodies for the detection of the following: E-cadherin (ab40772, Abcam, USA), N-cadherin (ab76011, Abcam, USA), \u0026beta;-catenin (ab32572, Abcam, USA), snail (ab216347, Abcam, USA), and tubulin (ab215037, Abcam, USA). Membranes were then incubated with the secondary antibodies (ab6721, Abcam, USA) at room temperature for another 30 min. Protein bands in the membrane were visualized using ECL plus kit (Beyotime, China), and the relative expressions of target proteins were quantified using Image J (National Institutes of Health, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted by the\u0026nbsp;Trizol method (Thermo Fisher Scientific, USA) and were reversely transcript into cDNA using PrimeScriptTM RT Master Mix (Takara, Japan). RT-qPCR was performed on the Bio-Rad CFX96 (Bio-Rad Laboratories, USA) using SYBR Premix Ex TaqTM (Takara, Japan). The sequence of primers was provided in Table 1. The expression level of each transcript was calculated using the comparative threshold cycle (Ct), based on the using the 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△Ct\u003c/sup\u003e formula.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInvasion Assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eInvasion chambers (Corning, USA) were used to perform invasion assay. Briefly, 100 ul of Matrigel (BD, USA) was used to coat the inner side of the\u0026nbsp;chamber, and then cells suspended in a\u0026nbsp;culture medium were loaded. DMEM containing 20% FBS was added to the lower chamber as the chemoattractant. The chambers were incubated at 37\u0026deg;C for 48 hours. The non-invasive cells on the upper side of the chamber were removed gently, and chambers were stained using crystal violet to locate the invaded cells. The number of invaded cells was observed and photographed under an inverted optical microscope (Olympus, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLevels of growth factors [granulocyte\u0026ndash;macrophage colony-stimulating factor (GM-CSF), interleukin-6 (IL-6), CC-chemokine ligand 2 (CCL2), and transforming growth factor-\u0026beta; (TGF-\u0026beta;)] in cancer tissues and cell cultures were analyzed using ELISA kits (mlbio, China) according to the manufacturer\u0026rsquo;s protocols. The intra- and inter-assay coefficients of variation were all less than 10%. Samples were adjusted for total protein concentrations before detection to ensure that the amounts of total protein in each group were equal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTumor xenograft mouse model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFour-week male nude BALB/c mice (Cyagen, China) were housed in a facility with a 12 h light/dark cycle maintained at 25 \u0026plusmn; 0.5\u0026deg;C and 50% to 60% humidity. The xenograft CC model was established as described before [13]. Briefly, CaSki cells were prepared as a single-cell suspension in Matrigel, and 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e prepared cells were injected subcutaneously into the right axillary fossa. Mice were euthanized 14 days after modeling (pelltobarbitalum natricum, 100mg/kg, intravenous administration), and tumor lesions were enucleated for further analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software, USA). The student\u0026rsquo;s t-test was used to analyze the difference between two groups, and one-way ANOVA was used for the comparison among multiple groups. The\u0026nbsp;Chi-square test was used to analyze the categorical variables. In this study, results were obtained from three independent experiments, and \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 was considered to be statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eWDR5 is up-regulated in CSCC tissues compared to that in PCT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe first analyzed the expression pattern of WDR5 in CC tissues and the corresponding PCT. Results showed that compared to PCT, WDR5 was up-regulated CSCC tissues (Fig.1 A and B), but had no significant change in cancer tissues of cervical adenocarcinoma and cervical adenosquamous cell carcinoma (Supplementary Figure 2A and B). We next analyzed the correlation between WDR5 expression and the TNM stage of CSCC patients, and found that WDR5 expression was positively correlated with the TNM stage\u0026mdash;patients in III-IV stages had markedly higher WDR5 levels compared to patients in I-II stages (Fig. 1A and B).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCL8 is a target of WDR5\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the function of WDR5, we performed ChIP-seq to find its target gene. Results of ChIP-seq showed that a large amount of DNA fragment of CXCL8 was immunoprecipitated by anti-WDR5 antibody (Fig. 2A), indicating that CXCL8 is a target gene of WDR5. Results of WB showed that overexpression WDR5 in hCECs significantly up-regulated the expression of CXCL8, while the knock-down of WDR5 in CAFs markedly inhibited CXCL8 expression (Fig. 2B). Results of ChIP analysis also indicated that WDR5 could be recruited to the promoter region of CXCL8 (Fig. 2C). These results all suggested that CXCL8 expression was regulated by WDR5. Consistent with the expression pattern of WDR5, analysis on human tissues showed that CXCL8 was up-regulated in CSCC tissues compared to that in PCT, and its expression level was positively correlated with the TNM stage of patients (Fig. 2D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCL8 promotes epithelial-mesenchymal transition (EMT) and induces the formation of CAFs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing hCECs from PCT, we next investigated the function of CXCL8 in the progression of CSCC. Results showed that overexpression of CXCL8 markedly changed the shape of hCECs, and made it present the shape of stromal cells (Fig. 3A). The markers of EMT such as E-cadherin, N-cadherin, \u0026beta;-catenin, and snail were all changed markedly (Fig. 3B). To identify the characteristic of these transformed cells, we analyzed the expression of FAP, a marker of CAFs [14]. Results showed that CXCL8 overexpression significantly up-regulated the expression of FAP (Fig. 3C), indicating that CXCL8 is an enhancer of CAFs formation. Besides, the secretions of cytokines such as GM-CSF, IL-6, CCL2, and TGF\u0026beta;, which were proved to promote malignancy progression, were all up-regulated upon CXCL8 overexpression (Fig. 3D), and the invasive ability of CaSki cells was significantly enhanced when they were incubated with the culture medium from cells overexpressing CXCL8 (Fig. 3F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLoss of CXCL8 function makes CAFs transformed into epithelial cells\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing CAFs from CSCC tissues, we then performed knockout experiments to verify the role of CXCL8. Results showed that knock-down of CXCL8 made CAFs present the shape of epithelial cells (Fig. 4A), and changed the expressions of EMT markers (Fig. 4B). Besides, the knock-down of CXCL8 suppressed the expression of FAP (Fig. 4C), attenuated the secretions of cytokines (Fig. 4D). Additionally, compared to the culture medium from CAFs treated with si-NC, the culture medium from hCSCs with CXCL8 knockout significantly attenuated the invasive ability of CaSki cells (Fig. 4E). These results all proved that CXCL8 was involved in CSCC progression by enhancing the transformation of CAFs from epithelial cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCXCL8 is regulated by the interaction between WDR5 and MLL1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn mammals, WDR5 interacts with MLL1 to form the\u0026nbsp;HMT complex and catalyzes the H3K4me3 in gene promoters [8]. We next investigated the regulation pathway of CXCL8 by using MM102, a molecule that can specifically block the interaction between WDR5 and MLL1. Results showed that in hCSCs from CSCC tissues, the expression of CXCL8 is down-regulated after WDR5 knockout, while the knockout of WDR5 had no impact on CXCL8 expression when MM102 was used, and MM102 markedly inhibited CXCL8 expression (Fig. 5A and C). Additionally, in hCECs from PCT, overexpression of WDR5 markedly induced CXCL8 expression, whereas WDR5 overexpression had no impact on CXCL8 expression when MM102 was used (Fig. 5B and D). ChIP analysis revealed that the distributions of WDR5, MLL1, and H3K4me3 in the\u0026nbsp;CXCL8 promoter region were similar, and the recruitments of WDR5 and MLL1 in CXCL8 promoter were significantly higher in hCSCs from CSCC tissues than that in hCECs from PCT, as well as the H3K4me3 level of CXCL8 promoter (Fig. 5E and F).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlocking the interaction between WDR5 and MLL1 suppresses CC development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe then performed \u003cem\u003ein vivo\u003c/em\u003e study to explore the therapeutic value for CSCC by targeting the interaction between WDR5 and MLL1. Results showed that using MM102 could significantly inhibit tumor growth in mice model (Fig. 6A). Analysis on tumor body showed that MM102 could markedly attenuate the expressions of CXCL8 and FAP (Fig. 6B and C), and the markers of EMT (Fig. 6D), as well as the cytokines involved in tumor growth (Fig. 6E).\u003c/p\u003e\n\u003cp\u003eOverall, all the above results indicate that WDR5 plays a key role in the development of CC. Highly expressed WDR5 promotes the transformation of CAFs from epithelial cells, and enhanced the secretions of cytokines such as GM-CSF, VEGF, PDGF, and TGF\u0026beta;, thus driving the progression of CC (Fig. 7).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTumor recurrence, metastasis, and the intractable TME remain the three key unsolved issues that hamper effective cancer treatment in clinical practice [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. TME creates a protective niche that is beneficial for tumor cells proliferation and invasion, and protects tumor cells from conventional interventions, leading to therapeutic failure [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. It is well known that the TME is a multicellular system with complex tumor-stromal interactions [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Stromal support is essential for multi-step cancer progression including tumor growth, metastatic dissemination, and ectopic colonization [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, normal fibroblasts have been indicated to function as an inhibitor of cell proliferation and tumorigenesis [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, reprogrammed fibroblasts, also known as CFAs, are proposed to explain the pro-tumorigenic ability of fibroblasts in tumor stroma.\u003c/p\u003e \u003cp\u003eAs the most abundant components in the tumor stroma, CAFs play a key role in the regulation of TME [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The role of CAFs has been extensively studied \u003cem\u003ein vitro\u003c/em\u003e. Compared to normal fibroblasts, CAFs express different proteins and usually exhibit enhanced proliferative and migratory properties [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The most unique feature of CAFs is their ability to remodel the TME by their high capacity for cytokine secretions, including GM-CSF, TGFβ, IL-6, and CCL2 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. These cytokines can further recruit immunosuppressive cells into the tumor stroma, and lead to immune evasion [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. One of the most important sources of CAFs is epithelial or endothelial cells adjacent to cancer cells undergoing EMT to form stromal cells, and further, transform into CAFs [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. During the development of CSCC, normal epithelial cells gradually disappeared and are replaced by cancer cells and tumor stromal cells. Do these epithelial cells undergo apoptosis in the process of tumor dilatation? Or do they differentiate into another kind of cells to regulate CSCC progression? Previous studies have indicated that EMT occurs during CSCC oncogenesis and progression [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. So, can these normal epithelial cells be transformed into CAFs via EMT and further be involved in CSCC progression? No answer has been given in previous reports.\u003c/p\u003e \u003cp\u003eAs a key regulator of HMT, WDR5 is crucial for H3K4me3, chromatin remodeling, and transcriptional activation of target genes [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It was also proven to function as an oncogenic protein and might serve as a novel epigenetic target in cancer treatment [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The role of WDR5 has been investigated in pancreatic cancer [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], breast cancer [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], prostate cancer [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], etc. However, its role in CC has not been explored yet. In this study, we proved that WDR5 expression was up-regulated in CSCC, and its level in cancer tissue is positively correlated with the TNM stage of patients, suggesting that WDR5 is an oncogenic protein that promotes the development of CSCC. A recent study reveals that WDR5 facilitates EMT and metastasis of cholangiocarcinoma by changing chromatin opening and target gene expression [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], however, no study has investigated the role of WDR5 in EMT in CSCC and its relationship with CFAs formation. Again, our results revealed that highly expressed WDR5 facilitates EMT of normal cervical epithelial cells, and promotes the transformation of CAFs from epithelial cells, so as to drive the progression of CSCC. More importantly, we found a way to block the function of WDR5 by hindering the interaction between WDR5 and MLL1, and proved that loss of WDR5 function suppressed CSCC growth \u003cem\u003ein vivo\u003c/em\u003e, and this may provide us a novel approach for CSCC treatment.\u003c/p\u003e \u003cp\u003eIn conclusion, for the first time, this study investigated the role of WDR5 in CSCC development from the perspective of CAFs, and proved that highly expressed WDR5 induces EMT, promotes the formation of CAFs from epithelial cells, and enhanced the secretions of cytokines, thus driving the progression of CSCC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConception:\u0026nbsp;Honglin Song and Fangli Sun;\u0026nbsp;Interpretation or analysis of data:\u0026nbsp;Fangli Sun, Nengxian Wu, Ying Lan, Qiuping Lu, and Linmei Mo;\u0026nbsp;Preparation of the manuscript:\u0026nbsp;Fangli Sun and Linmei Mo;\u0026nbsp;Revision for important intellectual content:\u0026nbsp;Honglin Song and Fangli Sun; Supervision:\u0026nbsp;Honglin Song\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Guangxi Key Research and Development Plan (Grant Number:\u0026nbsp;GUIKE AB20159017), the\u0026nbsp;Key Laboratory of High-Incidence Tumor Prevention and Treatment, Guangxi Medical University (Grant Number:\u0026nbsp;GKE2018-10), the Graduate Course Construction Project of Guangxi Medical University (Grant Number: YJSB2019015), and the Degree and Postgraduate Education Reform Project of Guangxi Medical University (Grant Number: JGY2019059).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaw data and images can be obtained from the authors\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors in this study declare that they have no conflict of interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe usage of human tissues was approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: H2019018.v03). Animal experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). All animal treatments were approved by the Ethics Committee of the Guangxi Medical University Cancer Hospital (No.: KA190114.v02).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors stated consent for participation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor all authors the final version of the manuscript was available and consent for publication was stated.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eL.V. Volkova, A.I. Pashov and N.N. Omelchuk. Cervical Carcinoma: Oncobiology and Biomarkers, Int J Mol Sci \u003cb\u003e22\u003c/b\u003e (2021):12571. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms222212571\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212571\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Bogani, F. Raspagliesi, V. di Donato, C. Brusadelli, R. Guerrisi, C. Pinelli, J. Casarin, F. Ghezzi, A Del Fabro, A. Ditto, T. Simoncini, A. Ciavattini and F. Sopracordevole. Spotlight on the role of human papillomavirus vaccines, Gynecol Oncol \u003cb\u003e160\u003c/b\u003e (2021):346\u0026ndash;350. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ygyno.2020.08.034\u003c/span\u003e\u003cspan address=\"10.1016/j.ygyno.2020.08.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM.K. Jung, T. Schmidt, S.H. Chon, M. Chevallay, F. Berlth, J. Akiyama, C.A. Gutschow and S.P. M\u0026ouml;nig. Current surgical treatment standards for esophageal and esophagogastric junction cancer, Ann N Y Acad Sci \u003cb\u003e1482\u003c/b\u003e (2020):77\u0026ndash;84. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nyas.14454\u003c/span\u003e\u003cspan address=\"10.1111/nyas.14454\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eE. Sahai, I. Astsaturov, E. Cukierman, D.G. DeNardo, M. Egeblad, R.M. Evans, D. Fearon, F.R. Greten, S.R. Hingorani, T. Hunter, et al. A framework for advancing our understanding of cancer-associated fibroblasts, Nat Rev Cancer \u003cb\u003e20\u003c/b\u003e (2020):174\u0026ndash;186. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41568-019-0238-1\u003c/span\u003e\u003cspan address=\"10.1038/s41568-019-0238-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ. Liao, Z.W. Tan, P. Zhu and N.S. Tan. Cancer-associated fibroblasts in tumor microenvironment - Accomplices in tumor malignancy, Cell Immunol \u003cb\u003e343\u003c/b\u003e (2019):103729. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cellimm.2017.12.003\u003c/span\u003e\u003cspan address=\"10.1016/j.cellimm.2017.12.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eW.F. Wei, X.J. Chen, L.J. Liang, L. Yu, X.G. Wu, C.F. Zhou, Z.C. Wang, L.S. Fan, Z. Hu, L. Liang and W. Wang. Periostin + cancer-associated fibroblasts promote lymph node metastasis by impairing the lymphatic endothelial barriers in cervical squamous cell carcinoma, Mol Oncol \u003cb\u003e15\u003c/b\u003e (2021):210\u0026ndash;227. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/1878-0261.12837\u003c/span\u003e\u003cspan address=\"10.1002/1878-0261.12837\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eX. Zhang, Y. Wang, X. Wang, B. Zou, J. Mei, X. Peng and Z. Wu. Extracellular vesicles-encapsulated microRNA-10a-5p shed from cancer-associated fibroblast facilitates cervical squamous cell carcinoma cell angiogenesis and tumorigenicity via Hedgehog signaling pathway, Cancer Gene Ther \u003cb\u003e28\u003c/b\u003e (2021):529\u0026ndash;542. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41417-020-00238-9\u003c/span\u003e\u003cspan address=\"10.1038/s41417-020-00238-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eE. Froimchuk, Y. Jang and K. Ge. Histone H3 lysine 4 methyltransferase KMT2D, Gene \u003cb\u003e627\u003c/b\u003e (2017):337\u0026ndash;342. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.gene.2017.06.056\u003c/span\u003e\u003cspan address=\"10.1016/j.gene.2017.06.056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Lu, H. Tao, X. Si and Q. Chen. The Histone H3 Lysine 4 Presenter WDR5 as an Oncogenic Protein and Novel Epigenetic Target in Cancer, Front Oncol \u003cb\u003e8\u003c/b\u003e (2018):502. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fonc.2018.00502\u003c/span\u003e\u003cspan address=\"10.3389/fonc.2018.00502\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. Fan, X. Li, Y. Li, Y. Zhi, S. Rong, G. Cheng and X. Zhang. An improved method for primary culture of normal cervical epithelial cells and establishment of cell model in vitro with HPV-16 E6 gene by lentivirus, J Cell Physiol \u003cb\u003e233\u003c/b\u003e (2018):2773\u0026ndash;2780. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/jcp.25978\u003c/span\u003e\u003cspan address=\"10.1002/jcp.25978\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB. Walch-R\u0026uuml;ckheim, R. Str\u0026ouml;der, L. Theobald, J. Pahne-Zeppenfeld, S. Hegde, Y.J. Kim, R.M. Bohle, I. Juhasz-B\u0026ouml;ss, E.F. Solomayer and S. Smola. Cervical Cancer-Instructed Stromal Fibroblasts Enhance IL23 Expression in Dendritic Cells to Support Expansion of Th17 Cells, Cancer Res \u003cb\u003e79\u003c/b\u003e (2019):1573\u0026ndash;1586. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-18-1913\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-18-1913\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eW. Xue, X. Yao, G. Ting, J. Ling, L. Huimin, Q. Yuan, Z. Chun, Z. Ming and Z. Yuanzhen. BPA modulates the WDR5/TET2 complex to regulate ERβ expression in eutopic endometrium and drives the development of endometriosis, Environ Pollut \u003cb\u003e268\u003c/b\u003e (2021):115748. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envpol.2020.115748\u003c/span\u003e\u003cspan address=\"10.1016/j.envpol.2020.115748\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Li, Z.X. Wang and Z.H. Wang. Combination of IL-24 and cisplatin inhibits cervical cancer growth in a xenograft nude mice model, Asian Pac J Cancer Prev 12(2011):3293\u0026ndash;3298.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Nurmik, P. Ullmann, F. Rodriguez, S. Haan and E. Letellier. In search of definitions: Cancer-associated fibroblasts and their markers, Int J Cancer \u003cb\u003e146\u003c/b\u003e (2020):895\u0026ndash;905. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ijc.32193\u003c/span\u003e\u003cspan address=\"10.1002/ijc.32193\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eX. Chen and E. Song. Turning foes to friends: targeting cancer-associated fibroblasts, Nat Rev Drug Discov \u003cb\u003e18\u003c/b\u003e (2019):99\u0026ndash;115. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41573-018-0004-1\u003c/span\u003e\u003cspan address=\"10.1038/s41573-018-0004-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD.C. Hinshaw and L.A. Shevde. The Tumor Microenvironment Innately Modulates Cancer Progression, Cancer Res \u003cb\u003e79\u003c/b\u003e (2019):4557\u0026ndash;4566. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-18-3962\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-18-3962\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA.E. Denton, E.W. Roberts and D.T. Fearon. Stromal Cells in the Tumor Microenvironment, Adv Exp Med Biol \u003cb\u003e1060\u003c/b\u003e (2018):99\u0026ndash;114. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-3-319-78127-3_6\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-78127-3_6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Kaukonen, A. Mai, M. Georgiadou, M. Saari, N. De Franceschi, T. Betz, H. Sihto, S. Ventel\u0026auml;, L. Elo, E. Jokitalo, et al. Normal stroma suppresses cancer cell proliferation via mechanosensitive regulation of JMJD1a-mediated transcription, Nat Commun \u003cb\u003e7\u003c/b\u003e (2016):12237. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms12237\u003c/span\u003e\u003cspan address=\"10.1038/ncomms12237\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Biffi and D.A. Tuveson. Diversity and Biology of Cancer-Associated Fibroblasts, Physiol Rev \u003cb\u003e101\u003c/b\u003e (2021):147\u0026ndash;176. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/physrev.00048.2019\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00048.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Costa, Y. Kieffer, A. Scholer-Dahirel, F. Pelon, B. Bourachot, M. Cardon, P. Sirven, I. Magagna, L. Fuhrmann, C. Bernard, et al. Fibroblast Heterogeneity and Immunosuppressive Environment in Human Breast Cancer, Cancer Cell \u003cb\u003e33\u003c/b\u003e (2018):463\u0026ndash;479.e10. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ccell.2018.01.011\u003c/span\u003e\u003cspan address=\"10.1016/j.ccell.2018.01.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eI. Druzhkova, M. Shirmanova, N. Ignatova, V. Dudenkova, M. Lukina, E. Zagaynova, D. Safina, S. Kostrov, D. Didych, A. Kuzmich, et al. Expression of EMT-Related Genes in Hybrid E/M Colorectal Cancer Cells Determines Fibroblast Activation and Collagen Remodeling, Int J Mol Sci \u003cb\u003e21\u003c/b\u003e (2020):8119. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21218119\u003c/span\u003e\u003cspan address=\"10.3390/ijms21218119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF.X. He, L.L. Zhang, P.F. Jin, D.D. Liu, A.H. Li. DPY30 regulates cervical squamous cell carcinoma by mediating epithelial-mesenchymal transition (EMT), Onco Targets Ther \u003cb\u003e12\u003c/b\u003e (2019):7139\u0026ndash;7147. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2147/OTT.S209315\u003c/span\u003e\u003cspan address=\"10.2147/OTT.S209315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ. Zhang, Y. Zou, M. Liang, Y. Chen, Y. Luo, B. Yang, F. Liu, Y. Qin, D. He, F. Wang, et al. Suppressor of fused (Sufu) promotes epithelial-mesenchymal transition (EMT) in cervical squamous cell carcinoma, Oncotarget \u003cb\u003e8\u003c/b\u003e (2017):114226\u0026ndash;114238. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/oncotarget.23176\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.23176\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eA. Carugo, G. Genovese, S. Seth, L. Nezi, J.L. Rose, D. Bossi, A. Cicalese, P.K. Shah, A. Viale, P.F. Pettazzoni, et al. In Vivo Functional Platform Targeting Patient-Derived Xenografts Identifies WDR5-Myc Association as a Critical Determinant of Pancreatic Cancer, Cell Rep \u003cb\u003e16\u003c/b\u003e (2016):133\u0026ndash;147. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2016.05.063\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.05.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Yao, Y. Wang, D. Han, Y. Ma, M. Ma, Y. Zhao, J. Tan, J. Lu, G. Xu, X. Li. Lysines 207 and 325 methylation of WDR5 catalyzed by SETD6 promotes breast cancer cell proliferation and migration, Oncol Rep \u003cb\u003e40\u003c/b\u003e (2018):3069\u0026ndash;3077. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/or.2018.6669\u003c/span\u003e\u003cspan address=\"10.3892/or.2018.6669\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Gu, X. Chen, R. Xie, J. Han, W. Xie, B. Wang, W. Dong, C. Chen, M. Yang, J. Jiang, et al. lncRNA HOXD-AS1 Regulates Proliferation and Chemo-Resistance of Castration-Resistant Prostate Cancer via Recruiting WDR5, Mol Ther \u003cb\u003e25\u003c/b\u003e (2017):1959\u0026ndash;1973. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2017.04.016\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2017.04.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. Chen, K. Li, Z. Liu, J. Liu, Y. Wang, R. Sun, Z. Li, B. Qiu, X. Zhang, G. Ren, et al. WDR5 facilitates EMT and metastasis of CCA by increasing HIF-1α accumulation in Myc-dependent and independent pathways, Mol Ther \u003cb\u003e29\u003c/b\u003e (2021):2134\u0026ndash;2150. doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymthe.2021.02.017\u003c/span\u003e\u003cspan address=\"10.1016/j.ymthe.2021.02.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;Sequence of siRNAs and primers\u003c/strong\u003e\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"37.32503888024883%\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward/Sense (5\u0026rsquo;-3\u0026rsquo;)\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.0357698289269%\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse/Antisense (5\u0026rsquo;-3\u0026rsquo;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"8\" valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003eCXCL8 promoter\u003c/p\u003e\n \u003cp\u003e3\u0026rsquo;-5\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003e207-323\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"37.32503888024883%\"\u003e\n \u003cp\u003eTCCTTTCTCACTAGGTGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.0357698289269%\"\u003e\n \u003cp\u003eTCATACCTGACGCTGTGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e411-532\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eTGGCTTATGGTTGAAATTCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eGCACATGCCAGTAATCCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e632-776\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eTAACTTCTCTGCCTCAAGGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eAGCCAAAATAGAGAGACGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e925-1050\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eGGTCCTAGTCTCGCACCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eCTGCCCACCCCTCTTCTCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e1074-1223\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eGGCCTTCCCAGTGACCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eACCACACTTCGAGGATCACGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e1308-1433\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eGCCATCTGTGCGCCACTATCCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eGAGCACCCTCGAACCGACTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e1456-1602\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eAGGCACTACTCCCCTCTACCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eCCGCCTGCTCTTCGCCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003e1623-1804\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eTGCTGGCTTTTTGGACACCCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eCCGCCGCCACCTGTTGAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"3\" valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003esiRNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003esi-NC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"37.32503888024883%\"\u003e\n \u003cp\u003eGAGGGGCUCACCGACACUCdTdT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.0357698289269%\"\u003e\n \u003cp\u003eGGCGA\u0026Mu;G\u0026Mu;GAUAGUAGUCAdTdT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003esi-WDR5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eAGGGAGAAU\u0026Mu;GAACACAAdTdT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eU\u0026Mu;G\u0026Mu;GUUCAAUUCUCCCUdTdT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003esi-CXCL8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eCCAGCAA\u0026Mu;GUCAC\u0026Mu;GUAUdTdT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eAUACAGA\u0026Mu;G\u0026Mu;GAUAAC\u0026Mu;GGdCdG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.81959564541213%\"\u003e\n \u003cp\u003eWDR5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"37.32503888024883%\"\u003e\n \u003cp\u003eATGCGACAGAGACCATCATAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.0357698289269%\"\u003e\n \u003cp\u003eCGTGAGGATATGGGATGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.403880070546737%\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"42.32804232804233%\"\u003e\n \u003cp\u003eACAGTCAGCCGCATCTTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"44.26807760141094%\"\u003e\n \u003cp\u003eGTTAAAAGCAGCCCTGGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eAbbreviation: CXCL8: C-X-C motif chemokine ligand 8; WDR5: WD repeat domain 5\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Cervical squamous cell carcinoma, WD repeat domain 5, C-X-C motif chemokine ligand 8, Epithelial-mesenchymal transition, Cancer-associated fibroblasts","lastPublishedDoi":"10.21203/rs.3.rs-1640093/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1640093/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWD repeat domain 5 (WDR5) has been indicated to be involved in tumor progression, however, its role in cervical cancer (CC) has not been investigated yet. A total of 350 pairs of CC tissues and para-carcinoma tissues (PCT) were collected. Primary human cervical epithelial cells (hCECs) and cancer-associated fibroblasts (CAFs) were isolated from PCT and cancer tissues. MM102 was used to block the interaction between WDR5 and mixed lineage leukemia protein-1 (MLL1), and it was used \u003cem\u003ein vivo\u003c/em\u003e to investigate its therapeutic value. WDR5 was up-regulated in cervical squamous cell carcinoma (CSCC) tissues compared to that in PCT. C-X-C motif chemokine ligand 8 (CXCL8) was indicated to be the target gene of WDR5. Highly expressed CXCL8 promoted epithelial-mesenchymal transition (EMT) to form CAFs, and enhanced the cytokine secretions in CAFs to promote CSCC progression. CXCL8 expression was regulated by the interaction between WDR5 and MLL1, and blocking the interaction between these two proteins using MM102 significantly suppressed tumor growth in mice models. WDR5 plays a key role in CSCC progression by inducing CXCL8 expression and promoting the transformation of CAFs from epithelial cells.\u003c/p\u003e","manuscriptTitle":"WDR5 drives the development of cervical squamous cell carcinoma by inducing epithelial- mesenchymal transition and cancer-associated fibroblasts formation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-05-13 19:39:17","doi":"10.21203/rs.3.rs-1640093/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a83c9c45-b1ac-4cca-9f8b-768367185537","owner":[],"postedDate":"May 13th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-05-13T19:39:19+00:00","versionOfRecord":[],"versionCreatedAt":"2022-05-13 19:39:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1640093","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1640093","identity":"rs-1640093","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}