Identification of the immune enhancement effect of CpG ODN on periodontitis genetic vaccine by RNA sequencing

Identification of the immune enhancement effect of CpG ODN on periodontitis genetic vaccine by RNA sequencing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of the immune enhancement effect of CpG ODN on periodontitis genetic vaccine by RNA sequencing HuiJie Zhang, FengJiao Zeng, Hang Yu, Bin Chen, XiaoHong Zhou, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1694788/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Periodontitis is one of the main causes of tooth loss in adults. Early diagnosis and intervention can effectively control the progression of periodontitis. The research group constructed a periodontitis genetic vaccine in the early stage and improved the immunogenicity of the body by adding CpG oligonucleotide (CpG ODN). The purpose of this study was to analyse the potential mechanism by which CpG ODN adjuvants enhance the preventive effect of periodontitis genetic vaccines at the molecular level by transcriptome sequencing and to screen out key genes and signaling pathways for follow-up research. Methods: Nine 4- to 6-week-old male Sprague–Dawley (SD) rats were randomly divided into 3 groups, namely, the blank group, pVAX1- HA2-fimA control group, and pVAX1- HA2-fimA + CpG ODN experimental group. At the 1st, 2nd, and 4th weeks, the rats were immunized by intranasal instillation, and three groups of rats were sacrificed at the 7th week. After total RNA was extracted from the spleen, RNA-seq library construction and sequencing were performed. Genetic ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of differentially expressed genes (DEGs). The screened poor DEGs were transferred to the STRING database to establish a protein–protein interaction (PPI) network map. To study the effect of CPG ODN on periodontitis genetic vaccines, we used Cytoscape software to further draw the network map, and quantitative real-time PCR (qRT-PCR) was used to validation of key genes. Results: A total of 161 significantly differentially expressed genes were found between the CPG ODN group and the control group. GO analysis showed that the differentially expressed genes were mainly enriched in immune-related functions such as antibacterial humoral responses, defense responses to other organisms, and defense responses to bacteria. KEGG pathway analysis showed that the differentially expressed genes were mainly involved in Staphylococcus aureus infection, oxidative phosphorylation, spliceosome, and nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) receptor signaling pathways. The PPI network graph constructed with Cytoscape software contains 58 nodes and 155 edges. Based on GO, KEGG, and PPI network map, we screened five key genes, including Oas2, Irf 7, Np4, Defa11 and Camp . These candidate genes may play a key role in the immune mechanism of periodontitis gene vaccines. The verification of key genes by qRT–PCR showed that compared with the control group, the expression of the Oas2 and Irf7 genes in the experimental group was significantly upregulated, and the expression of the Np4, Defa11 and Camp genes was significantly downregulated. Conclusions: The results were consistent with the transcriptome sequencing analysis of the preventive effect of periodontitis gene vaccine based on transcriptome sequencing, and screened five key genes involved in the synergistic effect of CPG ODN adjuvant and periodontitis gene vaccine, including Oas2, Irf7 , Np4, Defa11 and Camp , to understand the immune mechanism of periodontitis gene vaccine at the genetic level. CPG ODN Periodontitis Genetic vaccine RNA-seq Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Materials And Methods 1.1 Animals Nine specific pathogen-free (SPF) SD rats, weighing 100 ± 20 g were purchased from Changsha Tianqin Biotechnology Co., Ltd.with experimental animal license No. SCXK (Xiang) 2019-0014. All rats were fed a standard diet, and the room temperature was 24 ± 2°C,with a relative humidity of 40~ 70%. First, the rats were sequentially coded as 1-9, then 9 numbers were transcribed from the random number table, and each number was always divided by 3, and the remainder 0, 1, 2 represented A, B, C. So 9 rats were divided into 3 groups of 3 rats each, group A: blank group, group B: pVAX1- HA2-fimA control group, and group C: pVAX1- HA2-fimA + CpG ODN (30 µg) experimental group. The rats were numbered A1, A2, A3, B1, B2, B3, C1, C2, and C3 according to the groups. Then rats were anesthetized by inhalation of sevoflurane and immunized by nasal mucosal drip at 1, 2, and 4 weeks. During immunization, the mice were instilled alternately in the bilateral nasal cavity with a micropipette. The immunization dose of each rat was 100 μl each time, and the vaccine concentration was 1000 μg/ml. At the seventh week, all rats were sacrificed by inhalation of sevoflurane overdose, and spleen tissue was collected. The spleen RNA extracts from the three groups of rats were divided into two parts. One part was sent to Beijing Novogene Zhiyuan Technology Co., Ltd. (Beijing, China) for transcriptome sequencing, and the other part was used for subsequent qRT–PCR analysis. All animals were used in accordance with the Animal Welfare Law, and the study was approved by the Ethics Committee of Zunyi Medical University (Approval No. YJSKTLS-2018-2021-034A). 1.2 RNA-seq preparation and sequencing RNA-seq library preparation and Illumina sequencing RNA was extracted from the spleens of three groups of rats by using the Animal Tissue Total RNA Extraction Kit (DP451, TIANGEN, Beijing, China) according to the instruction.The concentration and integrity of the obtained RNA was measured by the NanoPhotometer®spectrophotometer (IMPLEN, CA, USA) and the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Equal amounts of RNA extracted from 9 spleens of rats were used to construct mRNA-Seq libraries.The NEBNext® Ultra™ RNA Library Prep Kit was used to construct mRNA-Seq libraries at Novogene Zhiyuan Technology (Beijing, China) Co., Ltd.. The mRNA with polyA tails in the total RNA was enriched by Oligo dT beads, cDNA synthesized using the fragmented mRNA as a template and amplified by PCR, and the samples were sequenced on machine after passing the test [16]. The Illumina NovaSeq 6000 sequencing platform was used to perform sequencing with paired-end reads with a PE150 sequencing strategy. After sequencing, fastp (version 0.19.7) was used for quality control of the sequencing data. 1.3 Bioinformatics analysis of mRNA-seq data The mRNA-Seq data were read and generated by the Illumina Novaseq 6000 platform, and the reads with adapters, reads with undetermined base information, and low-quality reads (Phred score≤20) in the original data were filtered [17] . The filtered data were normalized by DEseq2v. 1.16.1 before differential expression analysis. The software uses a negative binomial distribution model to detect differential gene expression and its criteria for screeningdifferential genes: Benjamini & Hochberg (BH) p adjust 0 after multiple comparisons. Both GO and KEGG were analysed using clusterProfiler, and the calculated p value was corrected by FDR (BH method).The above screened data were uploaded to a search tool for retrieving interacting genes (STRING,https://string-db.org/ ), and the results with the lowest interaction score > 0.4 were imported into Cytoscape v.3.9.0 to establish the PPI network. Finally, the top 10 DEMs were analysed according to the maximal clique centrality algorithm by using the CytoHubba plugin. Finally, GO, KEGG and PPI network were performed to screen key genes that may play a key role in improving the preventive effect of CpG ODN adjuvant in periodontitis genetic vaccine. 1.4 cDNA synthesis and real-time PCR analysis of gene expression Rat spleen RNA extracts were subjected to cDNA synthesis using EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (AE311, TransGen, China) according to the manufacturer's instruction. qRT-PCR was used to detect mRNA expression of the Oas2 , Irf7, Np4 , Defa11 and Camp genes which are associated with the NOD-like receptor signalling pathway.And the kit used for the assay was the PerfectStart ® Green qPCR SuperMix (AQ601, TransGen, China), while the detailed primer design is listed in Table 1. The reaction procedure: Step 1: 94°C, 30 sec. Step 2: 94°C, 5 sec. Step 3: 52°C, 15 sec. Step 4: 72°C, 10 sec. Step 2-Step 4 (40×). Each sample was replicated 3 times, and the relative mRNA expression was calculated after normalizing the key genes with the β-actin gene. Table 1 Primers used in this study Primer name Forward primer (5′–3′) Reverse primer (5′–3′) β-Actin Oas2 Irf7 Np4 Defa11 Camp TTTCCAGCCTTCCTTCCT CATATAGCAATGGCGGAGGT AAGAGCCTGATCCTGGTGAA GCTCTGCTCTCCCTGCATAC CAAGGATGCACTGAGGATCA CAACCAGCAGTCTTTGGACA CAGGTCTTTGCGGATGTC TTGCTTCCAACCTTCAATCC CCAGGTCCATGAGGAAGTGT AGCCGCCTTAGCTCTTTCTT TTCAGTGGTTGGCAACAGAG TCACTACCCCCTGTTCCTTG 1.5 Statistical analysis Data were statistically analysed by using SPSS 18.0 software (SPSS Inc. Chicago, IL, USA).For normally distributed data, the independent samples unpaired t test was used to examine the significance of differences in mean values between the pVAX1- HA2-fimA and the pVAX1- HA2-fimA +CpG ODN,while the Mann–Whitney U test was used to compare nonparametric data. All results were recorded as SE ± mean, and p<0.05 considered the difference to be statistically significant. 2. Results 2.1 Characterization of transcriptome sequences To explore the mechanism by which the CPG ODN adjuvant improves the immunogenicity of the periodontitis gene vaccine, a total of 9 samples from groups A, B, and C were sequenced, and a transcriptome library was constructed. The three groups A, B, and C generated averages of 4.92M, 4.65M, 4.62M raw reads, respectively. After filtering out low-quality reads and adapter sequences from the raw data, the average number of clean reads was 4.67M, 4.41M, 4.36M. In groups A, B, and C, the average clean reading ratios were 90.24%, 89.36%, and 90.43%, respectively. The average clean reading Q30% values were 94.72%, 94.64%, and 95.00%, respectively, and the average GC values was 50.45%, 50.06% and 48.32%, respectively (Table 2). In FPKM-based gene expression analysis, uniquely mapped clean reads were used. Compared with the gene expression of the pVAX1- HA2-fimA +CpG ODN group and pVAX1- HA2-fimA group, there were 51 upregulated genes and 110 downregulated genes (Fig. 1). These 51 upregulated and 110 downregulated differentially expressed genes (|log2FC| > 0 and p adjusted < 0.05) are supplemented in Tables S1 and S2 files. Table 2 Summary of the reads and mapping results Sample A1 A2 A3 B1 B2 B3 C1 C2 C3 Total raw reads (M) 4.54 5.43 4.80 4.59 4.81 4.54 4.86 4.41 4.59 Total clean reads (M) 4.34 5.14 4.53 4.40 4.63 4.21 4.64 4.13 4.32 Total clean bases(Gb) 6.51 7.70 6.79 6.60 6.94 6.32 6.96 6.19 6.48 Clean reads Q20 (%) 98.19 98.25 98.13 98.15 98.10 98.20 98.26 98.24 98.50 Clean reads Q30 (%) 94.68 94.86 94.62 94.67 94.54 94.70 94.83 94.79 95.38 Clean reads ratio (%) 91.59 89.80 89.33 91.38 87.83 88.86 91.94 92.82 86.54 Total mapping (%) 95.28 95.41 95.63 95.14 94.52 95.07 94.53 95.18 95.86 Multiple mapping(%) 6.67 6.67 6.86 6.61 7.40 7.71 6.65 8.35 8.40 Unique mapping (%) 88.61 88.74 88.76 88.53 87.11 87.36 87.88 86.83 87.46 GC (%) 50.44 50.36 50.55 50.49 50.83 48.86 48.09 48.33 48.54 2.2 GO enrichment analysis of DEMs for differentially expressed genes To further explore the mechanism by which the CPG ODN adjuvant improves the immunogenicity of the periodontitis genetic vaccine, GO functional annotation and enrichment analysis of DEGs were performed. The analysis included three parts, biological process, cellular component, and molecular function. and the 30 most significant terms were selected to draw a histogram (Fig 2). The results showed that most of the genes in the above three categories of gene function were involved in immune processes, such as antimicrobial humoral response, defense response to other organisms, defense response to bacterium, and defense response to Gram-negative bacterium. In short, GO enrichment analysis indicated that CPG ODN adjuvant may play an important role in the periodontitis genetic vaccine alleviating experimental periodontitis. 2.3 KEGG pathway enrichment analysis of DEMs To elucidate the effect of CPG ODNs on periodontitis genetic vaccines, KEGG enrichment analysis was performed on the top 20 most enriched pathways of DEGs (Fig. 3). All enriched KEGG pathways from DEGs are listed in Table S3 in Supplementary file . The results show that the NOD-like receptor signaling pathway, Staphylococcus aureus infection, ribosome and other signaling pathways have changed significantly, and the NOD-like receptor signaling pathway is closely related to the immune process, thus we speculate that the NOD-like receptor signaling pathway may be involved in the immune process. CPG ODN plays a crucial role in providing immunogenicity to periodontitis genetic vaccines. The KEGG enrichment map of the NOD-like receptor signaling pathway is shown in Fig 4,where Np4, Defa5, Camp, and Defa11 genes were significantly downregulated, and Irf7, Oas2, and Oas1a genes were significantly upregulated. 2.3 PPI network construction and analysis The DEMs based on the above screening criteria were mapped into the STRING database, the exported files were uploaded to Cytoscape software, and a PPI network graph of these genes was constructed, which has 58 nodes and 155 edges (Fig. 5). In the PPI network, highly connected proteins are called hub genes, and hub genes usually play important roles in biological processes. The CytoHubba plugin in Cytoscape software was used to screen the top 10 hub genes. The top 10 nodes with the highest degree were Mx2, Irf7, Usp18, Mx1, Oasl, Herc6, Oas1a, Xaf1, Epsti1, and Oas2. In this PPI network , Irf7, Oasl, Oas1a and Oas2 are closely related to immune response. 2.4 Expression of key genes in the spleen after nasal drop immunization of rats Based on the transcriptome sequence and combined with GO, KEGG, and PPI network map analysis, we speculated that the enhanced immunogenicity of the periodontitis gene vaccine by CPG ODN may be related to Oas2, Irf7 , Np4, Defa11 and Camp . The qRT–PCR results showed that, compared with the control group, under the action of CpG ODN, Oas2 and Irf7 were significantly upregulated, and Np4, Defa11 and Camp were significantly downregulated (Fig 6).So this experimental result was consistent with the transcriptome sequencing results and this result was statistically significant. 3. Discussion Periodontitis is a chronic inflammatory disease caused by dysbiosis of oral microflora, where the degree of periodontal tissue destruction is determined by host susceptibility, and long-term chronic inflammatory stimulation leads to resorption of alveolar bone and eventually to loosening and loss of teeth [18]. At present, the treatment of periodontitis mainly focuses on eliminating the cause, reducing risk factors and periodontal maintenance treatment. Some new treatment methods, such as host conditioning therapy, antibacterial photodynamic therapy, laser therapy, and probiotics, have been proposed as adjuvant therapies [19] . In recent years, DNA vaccines and mRNA vaccines for coronavirus disease 2019 have achieved exciting results in clinical applications, while their low cost and ease of preparation have allowed researchers to see the potential for the development of genetic vaccines [20]. In order to find a more convenient and efficient treatment method, our group extracted the total DNA of P.gingivalis W83 in the early stage, obtained the core functional regions HA2 and fimA of P.gingivalis, and spliced HA2 , fimA , and IRES sequence genes to acquire HA2-fimA fragment.The periodontitis genetic vaccine was constructed using pIRES2-EGFP as a template and pVAX1 plasmid as a vector.The recombinant plasmid was transferred into receptor DH5α cells, the successfully transfected recombinants were selected for sequencing, amplification and bacteriophage preservation. Our later experiments showed that pVAX1 -HA2-fimA was successfully expressed in 293T cells in vitro by Western Blot.We immunized SD rats by double nasal drip and observed that the level of specific antibodies was increased in the immunized rats compared to the blank group, but the specific antibodies were not maintained for a long time. Subsequently, our group tried to improve the immunogenicity of the vaccine by adding CPG ODN adjuvant in order to improve the immunogenicity of the vaccine. To our knowledge, this is the first time that the pVAX1- HA2-fimA gene vaccine was used in combination with the adjuvant CPG ODN. Although the periodontitis vaccine with the addition of the adjuvant achieved better preventive effects, the mechanism of how CPG ODN works with the periodontitis gene vaccine is still unknown. RNA-Seq, a technique for quantifying gene expression levels and gene expression patterns, is widely used to uncover genomic changes across transcriptome samples [21] In order to investigate the mechanism of action of periodontitis gene vaccine at the molecular level, our group used the use of RNA-Seq technology to collect the expression of genes between different groups. In this study, we comprehensively analyzed the RNA-Seq sequencing data to screen the DEMs between the pVAX1- HA2-fimA and pVAX1- HA2-fimA +CpG ODN groups. To more fully analyze the functions and mechanisms of these DEMs, we performed GO and KEGG enrichment analysis by using the clusterProfiler package. And GO analysis showed that DEMs are mainly involved in antimicrobial humoral responses, defense responses against bacteria, and defense responses of Gram-negative bacteria, and these biological processes may help to reduce the damage to periodontal tissues in experimental periodontitis. KEGG pathway analysis showed that upregulation of certain pathway expression may help to regulate inflammation, such as the NOD-like receptor pathway. Previous studies have shown that the NOD-like receptor pathway is a mediator of innate immunity key factor, and NLR are able to regulate inflammation by triggering the assembly of inflammatory vesicles through the regulation of NF-κB and MAPK pathways [22]. Therefore, modulation of the NOD-like receptor pathway may be a therapeutic strategy for periodontitis. After analysis, this study screened five key genes: Oas2, Irf7, Np4, Defa11, Camp, which have been shown to be associated with the prognosis of periodontitis. A study by Rodriguez-Hernandez et al. showed that P. gingivalis strongly inhibited the body's type I interferon (IFN) response, members of the antiviral restriction factor family were substantially downregulated, and P. gingivalis increased host susceptibility by impairing antiviral status [23]. 2'-5'oligoadenylate synthase (OAS) is an antiviral enzyme induced by interferon or virus, which is involved in the activation of Ribonuclease L (RNaseL) during viral infection, blocking viral replication and inhibiting viral protein synthesis [24]. Consistent with human 2'-5' OAS genotyping, OAS1, OAS2, OAS3 and OAS-like genes (OASL) were also identified in the rat genome [25]. OAS2 inhibits viral replication by enhancing the type I IFN-activated immune response, and enhanced RNaseL activity contributes to innate immunity and cellular metabolism when OAS2 binds to NOD2 [26].Irf7 is a key member of the IFN regulatory factor (IRF) family, and Irf7 positively regulates the expression of IFN-α and IFN-β [27]. IFN-α plays an osteogenic role by activating osteoblast differentiation and inhibiting osteoclast fusion, whereas IFN-β inhibits osteoblast-mediated bone remodelling as well as osteoclast differentiation and attenuates bone resorption [28]. However, it has been shown that type I IFNI type I increases gingival RANKL expression by inducing prolonged initiation of CD4 Th1 cells in dendritic cells, leading to alveolar bone loss [29].Np4, Defa11 and cathelicidins are antimicrobial peptides (AMPs) produced by rats. AMPs are small proteins that are naturally produced by organisms as the first line of defence against microbial attack, and are also known as host defence peptides (HDPs) [30]. Mammals are divided into two main groups, defensins and cathelicidins, based on the structural composition of AMPs [31]. AMPs are important in periodontal and oral tissue homeostasis. In addition to their antibacterial activity against periodontal pathogens, AMPs also play a regulatory role in immune responses [32]. LL-37 is an antimicrobial peptide in humans, a study by Svensson et al. showed that high concentrations of LL-37depressed host osteoblast viability and affected disease progression [33]. Similar to these results, Jönsson et al. showed that high concentrations of LL-37 reduced the number of periodontal ligament cells by inhibiting DNA synthesis and apoptosis [34]. However, whether Oas2 , Irf7 , Np4 , Defa11 , and Camp are related to the immune mechanism of periodontitis genetic vaccines can be investigated in future experiments. 4. Conclusion In general, our team optimized the periodontitis genetic vaccine through CPG ODN adjuvant and analysed its potential mechanism of action through sequencing data, but the candidate key genes and pathways have not been studied in depth, and this is what our team needs to do in the future work. Abbreviations AMPs Antimicrobial peptides BH Benjamini & Hochberg CpG ODNs CpG oligonucleotide DEGs Differentially expressed genes GO Gene Ontology HA2 H emagglutinin-2 HDPs Host defense peptides IFN Type I interferon IRF Interferon regulatory factor KEGG Kyoto Encyclopedia of Genes and Genomes NLR Nod-like receptor Nucleotide-binding oligomerization domain NOD OASL Oligoadenylate synthase-like P. gingivalis Porphyromonas gingivalis PPI Protein–protein interaction quantitative real-time PCR qRT-PCR RNase L Ribonuclease L SD Sprague–Dawley SPF Specific pathogen free Declarations Acknowledgements Not applicable. Author Contributions Bai Guo Hui and Wang Ming Wei conceived the research program. Yu Hang and Chen Bin analysed the research data. Zhang Hui Jie wrote the manuscript. Zeng Feng Jiao and Zhou xiao hong Revised draft. All authors read and approved the final manuscript. Funding This study was supported by "National Natural Science Foundation of China: Study on the immune enhancing effect and mechanism of signaling molecular adjuvant on DNA vaccine for periodontitis (Contract No. 82160181, 340,000)", "Science and Technology Program of Guizhou Province: Antigenic epitope prediction of periodontitis gene vaccine and its Study on the Type of Induced Immune Response (Contract No.: Qiankehe Foundation-ZK[2021] General 439, 100,000)", "Science and Technology Program Project of Guizhou Province:Research on Key Genes Mining and Regulatory Mechanism of Differential Induced Humoral Immune Response of Periodontal Disease Gene Vaccine, (Contract No.: Qianke Platform Talent [2020]- 034)", "Zunyi Science and Technology Support Program Project: A preliminary investigation on the mechanism of the type of immune response induced by periodontitis gene vaccine pVAX1- HA2-fimA -IL-15 in SD rats, (Zuncheng Kehe HZ Zi (2020) No. 297)", and "Zhuhai Medical Research Fund Project: Development of Anti-Porphyrinomonas gingivalis DNA Vaccine and Observation of its Effect, (Contract No. ZH3310200018PJL)". The funding agency provided us with financial support and helped us to complete all the work. Availability of data and materials Datasets generated and/or analyzed in the current study are available in the Gene Expression Data library, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE206597.The following secure token has been created to allow review of record GSE206597 while it remains in private status: Obktksoepxgbfsj. Declarations Ethics approval and consent to participate Animals participating in the study were handled in accordance with the "National Laboratory Animal Management Regulations" (GB14923-2010). The animal experimental protocol was approved and reviewed by the Ethics Committee of Zunyi Medical University.And the study was reported in accordance with ARRIVE guidelines Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Footnotes Publisher's Note Bai Guo Hui and Wang Ming Wei are Co-corresponding author Contributor Information Zhang Hui Jie，Email: [email protected] Zeng Feng Jiao，Email: [email protected] Yu Hang，Email: [email protected] Chen Bin，Email: [email protected] Zhou xiao hong，Email: [email protected] Wang Ming Wei,Email: [email protected] Bai Guo Hui, Email: [email protected] References Hirtz C, O'Flynn R, Voisin PM, et al. The potential impact of salivary peptides in periodontitis [J]. Critical reviews in clinical laboratory sciences, 2021, 58(7): 479-492 Hajishengallis G. Immunomicrobial pathogenesis of periodontitis: keystones, pathobionts, and host response [J]. Trends in immunology, 2014, 35(1): 3-11. Yang B, Pang X, Li Z, et al. Immunomodulation in the treatment of periodontitis: Progress and perspectives[J]. Frontiers in immunology, 2021, 12: 781378. Kornman K S. Mapping the pathogenesis of periodontitis: a new look [J]. Journal of Periodontology, 2008, 79: 1560-1568. Cecoro G, Annunziata M, Iuorio MT, et al. Periodontitis, low-grade inflammation and systemic health: A scoping review [J]. Medicina, 2020, 56(6): 272. Yang L, Ge Q, Ye Z, et al. Sulfonylureas for Treatment of Periodontitis-Diabetes Comorbidity-Related Complications: Killing Two Birds With One Stone [J]. Frontiers in Pharmacology, 2021: 12:728458. Kitamura M, Ikebe K, Kamide K, et al. Association of periodontal disease with atherosclerosis in 70-year-old Japanese older adults [J]. Odontology, 2021, 109(2): 506-513. Ryder MI, Xenoudi P. Alzheimer disease and the periodontal patient: new insights, connections, and therapies [J]. Periodontology 2000, 2021, 87(1): 32-42. Chen MX, Zhong YJ, Dong QQ, et al. Global, regional, and national burden of severe periodontitis, 1990–2019: An analysis of the Global Burden of Disease Study 2019 [J]. Journal of clinical periodontology, 2021, 48(9): 1165-1188. Wei Y, Wang Z, Lei L, et al. Global burden of periodontal disease and its relation with socioeconomic development during 1990—2019 [J]. Journal of Zhejiang University (Medical Science), 2021, 50(5): 545-552. Vaernewyck Victor, Arzi Boaz, Sanders Niek N et al. Mucosal Vaccination Against Periodontal Disease: Current Status and Opportunities [J]. Front Immunol, 2021, 12: 768397. Nigar Shireen, Shimosato Takeshi, Cooperation of Oligodeoxynucleotides and Synthetic Molecules as Enhanced Immune Modulators [J].Front Nutr, 2019, 6: 140 Hou Yingying,Wang Ying,Tang Yao et al. Codelivery of antigen and dual adjuvants by aluminum hydroxide nanoparticles for enhanced immune responses [J].J Control Release, 2020, 326: 120-130. Li Qin,Ren Jie,Liu Wei et al. CpG Oligodeoxynucleotide Developed to Activate Primate Immune Responses Promotes Antitumoral Effects in Combination with a Neoantigen-Based mRNA Cancer Vaccine [J].Drug Des Devel Ther, 2021, 15: 3953-3963. Bai Guohui,Yu Hang,Guan Xiaoyan et al. CpG immunostimulatory oligodeoxynucleotide 1826 as a novel nasal ODN adjuvant enhanced the protective efficacy of the periodontitis gene vaccine in a periodontitis model in SD rats [J].BMC Oral Health, 2021, 21 (1): 403. Zhao Liangzhen, Zhang Hangxiao, Kohnen Markus V et al. Analysis of Transcriptome and Epitranscriptome in Plants Using PacBio Iso-Seq and Nanopore-Based Direct RNA Sequencing [J]. Front Genet, 2019, 10: 253. Bayega Anthony, Fahiminiya Somayyeh, Oikonomopoulos Spyros et al. Current and Future Methods for mRNA Analysis: A Drive Toward Single Molecule Sequencing [J].Methods Mol Biol, 2018, 1783: 209-241. Yang Bo, Pang Xuefei, Li Zhipeng et al. Immunomodulation in the Treatment of Periodontitis: Progress and Perspectives [J].Front Immunol, 2021, 12: 781378. Kwon TaeHyun, Lamster Ira B, Levin Liran, Current Concepts in the Management of Periodontitis [J].Int Dent J, 2021, 71(6):462-476. Li Maochen, Wang Han, Tian Lili et al. COVID-19 vaccine development: milestones, lessons and prospects [J].Signal Transduct Target Ther, 2022, 7 (1): 146. Ura Hiroki, Togi Sumihito, Niida Yo, A comparison of mRNA sequencing (RNA-Seq) library preparation methods for transcriptome analysis [J].BMC Genomics, 2022, 23 (1): 303. Barbé François, Douglas Todd, Saleh Maya, Advances in Nod-like receptors (NLR) biology [J].Cytokine Growth Factor Rev, 2014, 25(6): 681-697. Rodriguez-Hernandez CJ, Sokoloski KJ, Stocke KS, et al. Microbiome-mediated incapacitation of interferon lambda production in the oral mucosa [J]. Proceedings of the National Academy of Sciences, 118(51): e2105170118. Lee WB, Choi WY, Lee DH, et al. OAS1 and OAS3 negatively regulate the expression of chemokines and interferon-responsive genes in human macrophages [J]. BMB reports, 2019, 52(2):133-138 Kristiansen H, Gad HH, Eskildsen-Larsen S, et al. The oligoadenylate synthetase family: an ancient protein family with multiple antiviral activities [J]. Journal of Interferon & Cytokine Research, 2011, 31(1): 41-47. Perelygin AA, Zharkikh AA, Scherbik SV, et al. The mammalian 2′-5′ oligoadenylate synthetase gene family: evidence for concerted evolution of paralogous Oas1 genes in Rodentia and Artiodactyla [J]. Journal of molecular evolution, 2006, 63(4): 562-576. Zhang W, Cao X, Cao G, et al. OASs in Defense of Mycobacterial Infection: Angels or Demons? [J]. Current Issues in Molecular Biology, 2021, 40(1): 221-230. Wang Yan, Yang Fuling, Yin Huadong et al. Chicken interferon regulatory factor 7 (IRF7) can control ALV-J virus infection by triggering type I interferon production through affecting genes related with innate immune signaling pathway [J].Dev Comp Immunol, 2021, 119: 104026. Deng Zihan, Hu Wenhui, Ai Hongbo et al. The Dramatic Role of IFN Family in Aberrant Inflammatory Osteolysis [J].Curr Gene Ther, 2021, 21: 112-129. Mizraji Gabriel, Nassar Maria, Segev Hadas et al. Porphyromonas gingivalis Promotes Unrestrained Type I Interferon Production by Dysregulating TAM Signaling via MYD88 Degradation. [J].Cell Rep, 2017, 18: 419-431. Moretta A, Scieuzo C, Petrone AM, et al. Antimicrobial peptides: A new hope in biomedical and pharmaceutical fields[J]. Frontiers in Cellular and Infection Microbiology, 2021, 11: 668632 Solanki SS, Singh P, Kashyap P, et al. Promising role of defensins peptides as therapeutics to combat against viral infection [J]. Microbial Pathogenesis, 2021, 155: 104930. Jourdain ML, Velard F, Pierrard L, et al. Cationic antimicrobial peptides and periodontal physiopathology: A systematic review [J]. Journal of periodontal research, 2019, 54(6): 589-600. Svensson D, Westman J, Wickström C, et al. Human endogenous peptide p33 inhibits detrimental effects of LL‐37 on osteoblast viability [J]. Journal of Periodontal Research, 2015, 50(1): 80-88. Jönsson D, Nilsson B O. The antimicrobial peptide LL-37 is anti-inflammatory and proapoptotic in human periodontal ligament cells [J]. Journal of periodontal research, 2012, 47(3): 330-335. Additional Declarations No competing interests reported. Supplementary Files S1.xlsx S2.xlsx S3.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1694788","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":115898058,"identity":"cff254fc-f267-415d-aa15-349f1ae7f612","order_by":0,"name":"HuiJie Zhang","email":"","orcid":"","institution":"Key Laboratory of Oral Diseases Research, School of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"HuiJie","middleName":"","lastName":"Zhang","suffix":""},{"id":115898059,"identity":"19b23b72-7ef8-4ed1-b797-bdf06eeaa431","order_by":1,"name":"FengJiao Zeng","email":"","orcid":"","institution":"Hospital of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"FengJiao","middleName":"","lastName":"Zeng","suffix":""},{"id":115898060,"identity":"69bc6354-8535-45ce-9e23-1c2290d93960","order_by":2,"name":"Hang Yu","email":"","orcid":"","institution":"Key Laboratory of Oral Diseases Research, School of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Yu","suffix":""},{"id":115898061,"identity":"0345cba8-fe1a-4553-a4ce-5963fa3539e3","order_by":3,"name":"Bin Chen","email":"","orcid":"","institution":"Key Laboratory of Oral Diseases Research, School of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Chen","suffix":""},{"id":115898062,"identity":"bd524be4-e652-448a-97a5-32adb018adc5","order_by":4,"name":"XiaoHong Zhou","email":"","orcid":"","institution":"Key Laboratory of Oral Diseases Research, School of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"XiaoHong","middleName":"","lastName":"Zhou","suffix":""},{"id":115898063,"identity":"2a30c6ae-1b53-415b-9ada-49e804204fe1","order_by":5,"name":"MingWei Wang","email":"","orcid":"","institution":"The Fifth Affiliated Hospital of Zunyi Medical University, Zhuhai 519100","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"MingWei","middleName":"","lastName":"Wang","suffix":""},{"id":115898064,"identity":"1565e39f-4343-435d-a8dc-0cd79d0358f8","order_by":6,"name":"GuoHui Bai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYHACNgYGgwMMbOwNQLaBBSlaeA6AtEgQq4UBqFwiAcQhQot8RPKxxzwFd+T5JJ9f3fCjQIKBv707Aa8Wwxtp6cY8Bs8M26Rzym72AB0mcebsBvxaZuSYSfMYHGYEakm7wQPUYiCRS5wW+zbJM2k3/xCjRV4CoiWxTYL92G2ibDHgeZYmOcfgWXIbTw7bbRkDCR6CfpFvTz4m8ebPHdv57cef3Xzzx0aOv72XgC0H4EweAzCJVznYlgY4k/0BQdWjYBSMglEwMgEAebtEjvmqDDkAAAAASUVORK5CYII=","orcid":"","institution":"Hospital of Stomatology, Zunyi Medical University, Zunyi 563000","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"GuoHui","middleName":"","lastName":"Bai","suffix":""}],"badges":[],"createdAt":"2022-05-26 04:29:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1694788/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1694788/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":23241463,"identity":"54abd89e-8f23-4a96-8a1e-1a9521df3132","added_by":"auto","created_at":"2022-06-29 16:49:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":22087,"visible":true,"origin":"","legend":"\u003cp\u003eA volcano plot of genes identified between pVAX1-\u003cem\u003eHA2-fimA \u003c/em\u003e+ CpG ODN and pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/4c516d43ed96e103ad95844a.png"},{"id":23240700,"identity":"0d7a0a2b-0964-4b9e-b1e7-355186dcf2eb","added_by":"auto","created_at":"2022-06-29 16:44:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":77618,"visible":true,"origin":"","legend":"\u003cp\u003eGO enrichment analysis of spleen DEGs between pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e + CpG ODN and pVAX1- \u003cem\u003eHA2-fimA\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\tBP: biological process, CC: cellular component MF: Molecular Function\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/332f5066d44e0b354c71a16e.png"},{"id":23241982,"identity":"9b5a30ea-a25b-4cb6-ad88-527cafec1db2","added_by":"auto","created_at":"2022-06-29 16:54:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":45997,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG enrichment analysis of spleen DEGs between pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e + CpG ODN and pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/2b2b2a246a894c709174128c.png"},{"id":23240694,"identity":"a715d698-78ef-4d5c-b75e-b8c8a8d2c05a","added_by":"auto","created_at":"2022-06-29 16:44:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157329,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG enrichment map of the NOD-like receptor signaling pathway\u003c/p\u003e\u003cp\u003eCompared with the pVAX1\u003cem\u003e-HA2-fimA \u003c/em\u003egroup, red in the pathway indicates that the gene expression in the pVAX1-\u003cem\u003eHA2-fimA \u003c/em\u003e+ CpG ODN group is upregulated, and blue indicates that the gene expression is downregulated.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/b3f88aa8ba1aedc1bed27405.png"},{"id":23240703,"identity":"5312dbc0-e207-4611-811a-c775faa86895","added_by":"auto","created_at":"2022-06-29 16:44:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":231157,"visible":true,"origin":"","legend":"\u003cp\u003ePPI network of DEMs\u003c/p\u003e\u003cp\u003eThe size of the circle is related to the contribution of nodes in the whole network. The larger the circle said degree is higher, the smaller circle degree value is lower.The red circle represents the up-regulated mrna and the blue circle represents the down-regulated mrna\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/4e9e1a5ef89fd2ba150d6606.png"},{"id":23240706,"identity":"ebf57cb7-e533-436d-a6b3-bca6986a705d","added_by":"auto","created_at":"2022-06-29 16:44:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":12225,"visible":true,"origin":"","legend":"\u003cp\u003eThe expression of \u003cem\u003eOas2, Irf7\u003c/em\u003e, \u003cem\u003eNp4, Defa11 \u003c/em\u003eand \u003cem\u003eCamp \u003c/em\u003ein the spleens of rats\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/3a4e17c263facdc2c8d0dfbd.png"},{"id":26441514,"identity":"b91bd9f9-1162-42cb-9e4c-40808588e9d8","added_by":"auto","created_at":"2022-09-14 08:29:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":949000,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/d4fbfa66-5ca3-4741-ad50-52464dd5d233.pdf"},{"id":23240716,"identity":"b58808a5-5150-4af2-805f-8740107a2dd0","added_by":"auto","created_at":"2022-06-29 16:44:12","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19996,"visible":true,"origin":"","legend":"","description":"","filename":"S1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/3cf0998b4dff581074ed84df.xlsx"},{"id":23240693,"identity":"a422e2a5-1267-452a-945b-3e2f2e7b8c8b","added_by":"auto","created_at":"2022-06-29 16:44:11","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":31170,"visible":true,"origin":"","legend":"","description":"","filename":"S2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/e3fd7549d7d2ba9ad4639cb9.xlsx"},{"id":23240698,"identity":"138df618-8f7b-4b74-92ac-0a4d96ed8573","added_by":"auto","created_at":"2022-06-29 16:44:11","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":21300,"visible":true,"origin":"","legend":"","description":"","filename":"S3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-1694788/v1/d2dcd0a3740cc94557ebc827.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of the immune enhancement effect of CpG ODN on periodontitis genetic vaccine by RNA sequencing","fulltext":[{"header":"1. Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003e1.1 Animals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNine specific pathogen-free (SPF) SD rats, weighing 100 \u0026plusmn; 20 g were purchased from Changsha Tianqin Biotechnology Co., Ltd.with experimental animal license No. SCXK (Xiang) 2019-0014. All \u0026nbsp;rats were fed a standard diet, and the room temperature was 24 \u0026plusmn; 2\u0026deg;C,with a relative humidity of 40~ \u0026nbsp;70%. First, the rats were sequentially coded as 1-9, then 9 numbers were transcribed from the random \u0026nbsp;number table, and each number was always divided by 3, and the remainder 0, 1, 2 represented A, B, C. \u0026nbsp;So 9 rats were divided into 3 groups of 3 rats each, group A: blank group, group B: pVAX1-\u003cem\u003eHA2-fimA \u0026nbsp;\u003c/em\u003econtrol group,\u0026nbsp;and group C: pVAX1-\u003cem\u003eHA2-fimA\u0026nbsp;\u003c/em\u003e+ CpG ODN (30 \u0026micro;g) experimental group. The rats were numbered A1, A2, A3, B1, B2, B3, C1, C2, and C3 according to the groups. Then rats were anesthetized by inhalation of sevoflurane and immunized by nasal mucosal drip at 1, 2, and 4 weeks. During immunization, the mice were instilled alternately in the bilateral nasal cavity with a micropipette. The immunization dose of each rat was 100 \u0026mu;l each time, and the vaccine concentration was 1000 \u0026mu;g/ml. At the seventh week, all rats were sacrificed by inhalation of sevoflurane overdose, and spleen tissue was collected. The spleen RNA extracts from the three groups of rats were divided into two parts. One part was sent to Beijing Novogene Zhiyuan Technology Co., Ltd. (Beijing, China) for transcriptome sequencing, and the other part was used for subsequent qRT\u0026ndash;PCR analysis. All animals were used in accordance with the Animal Welfare Law, and the study was approved by the Ethics Committee of Zunyi Medical University (Approval No. YJSKTLS-2018-2021-034A).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.2 RNA-seq preparation and sequencing RNA-seq library preparation and Illumina sequencing\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; RNA was extracted from the spleens of three groups of rats by using the Animal Tissue Total RNA Extraction Kit (DP451, TIANGEN, Beijing, China) according to the instruction.The concentration and integrity of the obtained RNA was measured by the NanoPhotometer\u0026reg;spectrophotometer (IMPLEN, CA, USA) and the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Equal amounts of RNA extracted from 9 spleens of rats were used to construct mRNA-Seq libraries.The NEBNext\u0026reg; Ultra\u0026trade; RNA Library Prep Kit was used to construct mRNA-Seq libraries at Novogene Zhiyuan Technology (Beijing, China) Co., Ltd.. The mRNA with polyA tails in the total RNA was enriched by Oligo dT beads, cDNA synthesized using the fragmented mRNA as a template and amplified by PCR, and the samples were sequenced on machine after passing the test [16]. The Illumina NovaSeq 6000 sequencing platform was used to perform sequencing with paired-end reads with a PE150 sequencing strategy. After sequencing, fastp (version 0.19.7) was used for quality control of the sequencing data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.3 Bioinformatics analysis of mRNA-seq data\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;The mRNA-Seq data were read and generated by the Illumina Novaseq 6000 platform, and the reads \u0026nbsp;with adapters, reads with undetermined base information, and low-quality reads (Phred score\u0026le;20) in the original data were filtered [17] . The filtered data were normalized by DEseq2v. 1.16.1 before differential expression analysis. The software uses a negative binomial distribution model to detect differential gene expression and its criteria for screeningdifferential genes: Benjamini \u0026amp; Hochberg (BH) p adjust \u0026lt; 0.05 \u0026amp; |log2FC| \u0026gt; 0 after multiple comparisons. Both GO and KEGG were analysed using clusterProfiler, and the calculated p value was corrected by FDR (BH method).The above screened data were uploaded to a search tool for retrieving interacting genes (STRING,https://string-db.org/\u0026nbsp;\u003c/a\u003e), and the results with the lowest interaction score \u0026gt; 0.4 were imported into Cytoscape v.3.9.0 to establish the PPI network. Finally, the top 10 DEMs were analysed according to the maximal clique centrality algorithm by using the CytoHubba plugin. Finally, GO, KEGG and PPI network were performed to screen key genes that may play a key role in improving the preventive effect of CpG ODN adjuvant in periodontitis genetic vaccine.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e1.4 cDNA synthesis and real-time PCR analysis of gene expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;Rat spleen RNA extracts were subjected to cDNA synthesis using EasyScript\u0026reg; One-Step gDNA Removal and cDNA Synthesis SuperMix (AE311, TransGen, China) according to the manufacturer\u0026apos;s instruction. qRT-PCR was used to detect mRNA expression of the\u003cem\u003e\u0026nbsp;Oas2\u003c/em\u003e, \u003cem\u003eIrf7, Np4\u003c/em\u003e, \u003cem\u003eDefa11\u003c/em\u003e and \u003cem\u003eCamp\u003c/em\u003e genes which are associated with the NOD-like receptor signalling pathway.And the kit used for the assay was the PerfectStart\u003csup\u003e\u0026reg;\u003c/sup\u003e Green qPCR SuperMix (AQ601, TransGen, China), while the detailed primer design is listed in Table 1. The reaction procedure: Step 1: 94\u0026deg;C, 30 sec. Step 2: 94\u0026deg;C, 5 sec. Step 3: 52\u0026deg;C, 15 sec. Step 4: 72\u0026deg;C, 10 sec. Step 2-Step 4 (40\u0026times;). Each sample was replicated 3 times, and the relative mRNA expression was calculated after normalizing the key genes with the \u0026beta;-actin gene.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003ePrimers used in this study\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"19.162640901771336%\"\u003e\u003cstrong\u003ePrimer name\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.774557165861516%\"\u003e\u003cstrong\u003eForward primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.06280193236715%\"\u003e\u003cstrong\u003eReverse primer (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/strong\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"19.162640901771336%\"\u003e\u003cem\u003e\u0026beta;-Actin\u003c/em\u003e\u003cbr\u003e\u003cem\u003eOas2\u003c/em\u003e\u003cbr\u003e\u003cem\u003eIrf7\u003c/em\u003e\u003cbr\u003e\u003cem\u003eNp4\u003c/em\u003e\u003cbr\u003e\u003cem\u003eDefa11\u003c/em\u003e\u003cbr\u003e\u003cem\u003eCamp\u003c/em\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" width=\"39.774557165861516%\"\u003eTTTCCAGCCTTCCTTCCT\u003cbr\u003eCATATAGCAATGGCGGAGGT\u003cbr\u003eAAGAGCCTGATCCTGGTGAA\u003cbr\u003eGCTCTGCTCTCCCTGCATAC\u003cbr\u003eCAAGGATGCACTGAGGATCA\u003cbr\u003eCAACCAGCAGTCTTTGGACA\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.06280193236715%\"\u003eCAGGTCTTTGCGGATGTC\u003cbr\u003eTTGCTTCCAACCTTCAATCC\u003cbr\u003eCCAGGTCCATGAGGAAGTGT\u003cbr\u003eAGCCGCCTTAGCTCTTTCTT\u003cbr\u003eTTCAGTGGTTGGCAACAGAG\u003cbr\u003eTCACTACCCCCTGTTCCTTG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003e1.5 Statistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were statistically analysed by using SPSS 18.0 software (SPSS Inc. Chicago, IL, USA).For normally distributed data, the independent samples unpaired \u003cem\u003et\u003c/em\u003e test was used to examine the significance of differences in mean values between the pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e and the pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e+CpG ODN,while the Mann\u0026ndash;Whitney U test was used to compare nonparametric data. All results were recorded as SE \u0026plusmn; mean, and \u003cem\u003ep\u0026lt;0.05\u0026nbsp;\u003c/em\u003econsidered the difference to be statistically significant.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cp\u003e\u003cstrong\u003e2.1 Characterization of transcriptome sequences\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the mechanism by which the CPG ODN adjuvant improves the immunogenicity of the periodontitis gene vaccine, a total of 9 samples from groups A, B, and C were sequenced, and a transcriptome library was constructed. The three groups A, B, and C generated averages of 4.92M, 4.65M, 4.62M raw reads, respectively. After filtering out low-quality reads and adapter sequences from the raw data, the average number of clean reads was 4.67M, 4.41M, 4.36M. In groups A, B, and C, the average clean reading ratios were 90.24%, 89.36%, and 90.43%, respectively. The average clean reading Q30% values were 94.72%, 94.64%, and 95.00%, respectively, and the average GC values was 50.45%, 50.06% and 48.32%, respectively (Table 2). In FPKM-based gene expression analysis, uniquely mapped clean reads were used. Compared with the gene expression of the pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e+CpG ODN group and pVAX1-\u003cem\u003eHA2-fimA\u0026nbsp;\u003c/em\u003egroup, there were 51 upregulated genes and 110 downregulated genes (Fig. 1). These 51 upregulated and 110 downregulated differentially expressed genes (|log2FC| \u0026gt; 0 and p adjusted \u0026lt; 0.05) are supplemented in Tables S1\u0026nbsp;and S2\u0026nbsp;files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e2\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eSummary of the reads and mapping results\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eSample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"7.79896013864818%\"\u003e\n \u003cp\u003eA1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.665511265164644%\"\u003e\n \u003cp\u003eA2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.31889081455806%\"\u003e\n \u003cp\u003eA3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.01213171577123%\"\u003e\n \u003cp\u003eB1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.145580589254767%\"\u003e\n \u003cp\u003eB2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003eB3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003eC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003eC2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003eC3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eTotal raw reads (M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e4.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e5.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e4.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e4.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e4.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e4.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e4.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e4.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e4.59\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eTotal clean reads (M)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e4.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e5.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e4.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e4.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e4.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e4.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e4.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e4.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e4.32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eTotal clean bases(Gb)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e6.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e7.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e6.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e6.60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e6.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e6.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e6.96\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e6.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e6.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eClean reads Q20 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"7.79896013864818%\"\u003e\n \u003cp\u003e98.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.665511265164644%\"\u003e\n \u003cp\u003e98.25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.31889081455806%\"\u003e\n \u003cp\u003e98.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.01213171577123%\"\u003e\n \u003cp\u003e98.15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.145580589254767%\"\u003e\n \u003cp\u003e98.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e98.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e98.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e98.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e98.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eClean reads Q30 (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"7.79896013864818%\"\u003e\n \u003cp\u003e94.68\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.665511265164644%\"\u003e\n \u003cp\u003e94.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.31889081455806%\"\u003e\n \u003cp\u003e94.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.01213171577123%\"\u003e\n \u003cp\u003e94.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.145580589254767%\"\u003e\n \u003cp\u003e94.54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e94.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e94.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e94.79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e95.38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eClean reads ratio (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"7.79896013864818%\"\u003e\n \u003cp\u003e91.59\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.665511265164644%\"\u003e\n \u003cp\u003e89.80\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.31889081455806%\"\u003e\n \u003cp\u003e89.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.01213171577123%\"\u003e\n \u003cp\u003e91.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.145580589254767%\"\u003e\n \u003cp\u003e87.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e88.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e91.94\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e92.82\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e86.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eTotal mapping (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e95.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e95.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e95.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e95.14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e94.52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e95.07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e94.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e95.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e95.86\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eMultiple mapping(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e6.67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e6.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e6.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e7.40\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e7.71\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e6.65\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e8.35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e8.40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eUnique mapping (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"7.79896013864818%\"\u003e\n \u003cp\u003e88.61\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.665511265164644%\"\u003e\n \u003cp\u003e88.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.31889081455806%\"\u003e\n \u003cp\u003e88.76\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.01213171577123%\"\u003e\n \u003cp\u003e88.53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.145580589254767%\"\u003e\n \u003cp\u003e87.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e87.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e87.88\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"8.492201039861351%\"\u003e\n \u003cp\u003e86.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"9.185441941074524%\"\u003e\n \u003cp\u003e87.46\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" width=\"22.703639514731368%\"\u003e\n \u003cp\u003eGC (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"7.79896013864818%\"\u003e\n \u003cp\u003e50.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.665511265164644%\"\u003e\n \u003cp\u003e50.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.31889081455806%\"\u003e\n \u003cp\u003e50.55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.01213171577123%\"\u003e\n \u003cp\u003e50.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.145580589254767%\"\u003e\n \u003cp\u003e50.83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e48.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e48.09\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"8.492201039861351%\"\u003e\n \u003cp\u003e48.33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" width=\"9.185441941074524%\"\u003e\n \u003cp\u003e48.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 GO enrichment analysis of DEMs\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003efor differentially expressed genes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;To further explore the mechanism by which the CPG ODN adjuvant improves the immunogenicity of the periodontitis genetic vaccine, GO functional annotation and enrichment analysis of DEGs were performed. The analysis included three parts, biological process, cellular component, and molecular function. and the 30 most significant terms were selected to draw a histogram (Fig 2). The results showed that most of the genes in the above three categories of gene function were involved in immune processes, such as antimicrobial humoral response, defense response to other organisms, defense response to bacterium, and defense response to Gram-negative bacterium. In short, GO enrichment analysis indicated that CPG ODN adjuvant may play an important role in the periodontitis genetic vaccine alleviating experimental periodontitis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 KEGG pathway enrichment analysis of DEMs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;To elucidate the effect of CPG ODNs on periodontitis genetic vaccines, KEGG enrichment analysis was performed on the top 20 most enriched pathways of DEGs (Fig. 3). All enriched KEGG pathways from DEGs are listed in Table S3 in Supplementary file\u0026nbsp;\u003c/a\u003e. The results show that the NOD-like receptor signaling pathway, Staphylococcus aureus infection, ribosome and other signaling pathways have changed significantly, and the NOD-like receptor signaling pathway is closely related to the immune process, thus we speculate that the NOD-like receptor signaling pathway may be involved in the immune process. CPG ODN plays a crucial role in providing immunogenicity to periodontitis genetic vaccines. The KEGG enrichment map of the NOD-like receptor signaling pathway is shown in Fig 4,where \u003cem\u003eNp4, Defa5, Camp, and Defa11\u0026nbsp;\u003c/em\u003egenes were significantly downregulated, and \u003cem\u003eIrf7, Oas2, and Oas1a\u0026nbsp;\u003c/em\u003egenes were significantly upregulated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 PPI network construction and analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;The DEMs based on the above screening criteria were mapped into the STRING database, the exported files were uploaded to Cytoscape software, and a PPI network graph of these genes was constructed, which has 58 nodes and 155 edges (Fig. 5). In the PPI network, highly connected proteins are called hub genes, and hub genes usually play important roles in biological processes. The CytoHubba plugin in Cytoscape software was used to screen the top 10 hub genes. The top 10 nodes with the highest degree were Mx2, Irf7, Usp18, Mx1, Oasl, Herc6, Oas1a, Xaf1, Epsti1, and Oas2. In this PPI network , Irf7, Oasl, Oas1a and Oas2 are closely related to immune response.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Expression of key genes in the spleen after nasal drop immunization of rats\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;Based on the transcriptome sequence and combined with GO, KEGG, and PPI network map analysis, we speculated that the enhanced immunogenicity of the periodontitis gene vaccine by CPG ODN may be related to \u003cem\u003eOas2, Irf7\u003c/em\u003e, \u003cem\u003eNp4, Defa11\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCamp\u003c/em\u003e. The qRT\u0026ndash;PCR results showed that, compared with the control group, under the action of CpG ODN, \u003cem\u003eOas2 and Irf7\u0026nbsp;\u003c/em\u003ewere\u003cem\u003e\u0026nbsp;\u003c/em\u003esignificantly upregulated, and \u003cem\u003eNp4, Defa11\u0026nbsp;\u003c/em\u003eand \u003cem\u003eCamp\u0026nbsp;\u003c/em\u003ewere significantly downregulated (Fig 6).So this experimental result was consistent with the transcriptome sequencing results and this result was statistically significant.\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003ePeriodontitis is a chronic inflammatory disease caused by dysbiosis of oral microflora, where the degree of periodontal tissue destruction is determined by host susceptibility, and long-term chronic inflammatory stimulation leads to resorption of alveolar bone and eventually to loosening and loss of teeth [18]. At present, the treatment of periodontitis mainly focuses on eliminating the cause, reducing risk factors and periodontal maintenance treatment. Some new treatment methods, such as host conditioning therapy, antibacterial photodynamic therapy, laser therapy, and probiotics, have been proposed as adjuvant therapies [19] . In recent years, DNA vaccines and mRNA vaccines for coronavirus disease 2019 have achieved exciting results in clinical applications, while their low cost and ease of preparation have allowed researchers to see the potential for the development of genetic vaccines [20].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp;In order to find a more convenient and efficient treatment method, our group extracted the total DNA of \u003cem\u003eP.gingivalis\u003c/em\u003e W83 in the early stage, obtained the core functional regions \u003cem\u003eHA2\u003c/em\u003e and \u003cem\u003efimA\u003c/em\u003e of P.gingivalis, and spliced \u003cem\u003eHA2\u003c/em\u003e, \u003cem\u003efimA\u003c/em\u003e, and \u003cem\u003eIRES\u003c/em\u003e sequence genes to acquire \u003cem\u003eHA2-fimA\u003c/em\u003e fragment.The periodontitis genetic vaccine was constructed using pIRES2-EGFP as a template and pVAX1 plasmid as a vector.The recombinant plasmid was transferred into receptor DH5\u0026alpha; cells, the successfully transfected recombinants were selected for sequencing, amplification and bacteriophage preservation. Our later experiments showed that pVAX1\u003cem\u003e-HA2-fimA\u003c/em\u003e was successfully expressed in 293T cells in vitro by Western Blot.We immunized SD rats by double nasal drip and observed that the level of specific antibodies was increased in the immunized rats compared to the blank group, but the specific antibodies were not maintained for a long time. Subsequently, our group tried to improve the immunogenicity of the vaccine by adding CPG ODN adjuvant in order to improve the immunogenicity of the vaccine. To our knowledge, this is the first time that the pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e gene vaccine was used in combination with the adjuvant CPG ODN. Although the periodontitis vaccine with the addition of the adjuvant achieved better preventive effects, the mechanism of how CPG ODN works with the periodontitis gene vaccine is still unknown.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;RNA-Seq, a technique for quantifying gene expression levels and gene expression patterns, is widely used to uncover genomic changes across transcriptome samples [21] In order to investigate the mechanism of action of periodontitis gene vaccine at the molecular level, our group used the use of RNA-Seq technology to collect the expression of genes between different groups. In this study, we comprehensively analyzed the RNA-Seq sequencing data to screen the DEMs between the pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e and pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e+CpG ODN groups. To more fully analyze the functions and mechanisms of these DEMs, we performed GO and KEGG enrichment analysis by using the clusterProfiler package. And GO analysis showed that DEMs are mainly involved in antimicrobial humoral responses, defense responses against bacteria, and defense responses of Gram-negative bacteria, and these biological processes may help to reduce the damage to periodontal tissues in experimental periodontitis. KEGG pathway analysis showed that upregulation of certain pathway expression may help to regulate inflammation, such as the NOD-like receptor pathway. Previous studies have shown that the NOD-like receptor pathway is a mediator of innate immunity key factor, and NLR are able to regulate inflammation by triggering the assembly of inflammatory vesicles through the regulation of NF-\u0026kappa;B and MAPK pathways [22]. Therefore, modulation of the NOD-like receptor pathway may be a therapeutic strategy for periodontitis.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;After analysis, this study screened five key genes: Oas2, Irf7, Np4, Defa11, Camp, which have been shown to be associated with the prognosis of periodontitis. A study by Rodriguez-Hernandez et al. showed that P. gingivalis strongly inhibited the body\u0026apos;s type I interferon (IFN) response, members of the antiviral restriction factor family were substantially downregulated, and \u003cem\u003eP. gingivalis\u003c/em\u003e increased host susceptibility by impairing antiviral status [23]. 2\u0026apos;-5\u0026apos;oligoadenylate synthase (OAS) is an antiviral enzyme induced by interferon or virus, which is involved in the activation of Ribonuclease L (RNaseL) during viral infection, blocking viral replication and inhibiting viral protein synthesis [24]. Consistent with human 2\u0026apos;-5\u0026apos; OAS genotyping, \u003cem\u003eOAS1, OAS2, OAS3\u003c/em\u003e and OAS-like genes (OASL) were also identified in the rat genome [25]. OAS2 inhibits viral replication by enhancing the type I IFN-activated immune response, and enhanced RNaseL activity contributes to innate immunity and cellular metabolism when OAS2 binds to NOD2 [26].Irf7 is a key member of the IFN regulatory factor (IRF) family, and Irf7 positively regulates the expression of IFN-\u0026alpha; and IFN-\u0026beta; [27]. IFN-\u0026alpha; plays an osteogenic role by activating osteoblast differentiation and inhibiting osteoclast fusion, whereas IFN-\u0026beta; inhibits osteoblast-mediated bone remodelling as well as osteoclast differentiation and attenuates bone resorption [28]. However, it has been shown that type I IFNI type I increases gingival RANKL expression by inducing prolonged initiation of CD4 Th1 cells in dendritic cells, leading to alveolar bone loss [29].Np4, Defa11 and cathelicidins are antimicrobial peptides (AMPs) produced by rats. AMPs are small proteins that are naturally produced by organisms as the first line of defence against microbial attack, and are also known as host defence peptides (HDPs) [30]. Mammals are divided into two main groups, defensins and cathelicidins, based on the structural composition of AMPs [31]. AMPs are important in periodontal and oral tissue homeostasis. In addition to their antibacterial activity against periodontal pathogens, AMPs also play a regulatory role in immune responses [32]. LL-37 is an antimicrobial peptide in humans, a study by Svensson et al. showed that high concentrations of LL-37depressed host osteoblast viability and affected disease progression [33]. Similar to these results, J\u0026ouml;nsson et al. showed that high concentrations of LL-37 reduced the number of periodontal ligament cells by inhibiting DNA synthesis and apoptosis [34]. However, whether \u003cem\u003eOas2\u003c/em\u003e, \u003cem\u003eIrf7\u003c/em\u003e, \u003cem\u003eNp4\u003c/em\u003e, \u003cem\u003eDefa11\u003c/em\u003e, and \u003cem\u003eCamp\u003c/em\u003e are related to the immune mechanism of periodontitis genetic vaccines can be investigated in future experiments.\u003c/p\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;In general, our team optimized the periodontitis genetic vaccine through CPG ODN adjuvant and analysed its potential mechanism of action through sequencing data, but the candidate key genes and pathways have not been studied in depth, and this is what our team needs to do in the future work.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAMPs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Antimicrobial peptides\u003c/p\u003e\n\u003cp\u003eBH \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Benjamini \u0026amp; Hochberg\u003c/p\u003e\n\u003cp\u003eCpG ODNs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;CpG oligonucleotide\u003c/p\u003e\n\u003cp\u003eDEGs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Differentially expressed genes\u003c/p\u003e\n\u003cp\u003eGO \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Gene Ontology\u003c/p\u003e\n\u003cp\u003eHA2 \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;H emagglutinin-2\u003c/p\u003e\n\u003cp\u003eHDPs \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Host defense peptides\u003c/p\u003e\n\u003cp\u003eIFN \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Type I interferon\u003c/p\u003e\n\u003cp\u003eIRF \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Interferon regulatory factor\u003c/p\u003e\n\u003cp\u003eKEGG \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Kyoto Encyclopedia of Genes and Genomes\u003c/p\u003e\n\u003cp\u003eNLR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Nod-like receptor\u003c/p\u003e\n\u003cp\u003eNucleotide-binding oligomerization domain \u0026nbsp; \u0026nbsp; \u0026nbsp;NOD\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOASL \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003e Oligoadenylate synthase-like\u003c/a\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eP. gingivalis \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003ePorphyromonas gingivalis\u003c/p\u003e\n\u003cp\u003ePPI \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Protein\u0026ndash;protein interaction\u003c/p\u003e\n\u003cp\u003equantitative real-time PCR \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;qRT-PCR\u003c/p\u003e\n\u003cp\u003eRNase L \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;Ribonuclease L\u003c/p\u003e\n\u003cp\u003eSD \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Sprague\u0026ndash;Dawley\u003c/p\u003e\n\u003cp\u003eSPF\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u0026nbsp;Specific pathogen free\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBai Guo Hui and Wang Ming Wei\u0026nbsp;conceived the research program.\u003c/p\u003e\n\u003cp\u003eYu Hang and Chen Bin\u0026nbsp;analysed the research data.\u003c/p\u003e\n\u003cp\u003eZhang Hui Jie\u0026nbsp;wrote the manuscript.\u003c/p\u003e\n\u003cp\u003eZeng Feng Jiao and Zhou xiao hong\u0026nbsp;Revised draft.\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by \u0026quot;National Natural Science Foundation of China: Study on the immune enhancing effect and mechanism of signaling molecular adjuvant on DNA vaccine for periodontitis (Contract No. 82160181, 340,000)\u0026quot;, \u0026quot;Science and Technology Program of Guizhou Province: Antigenic epitope prediction of periodontitis gene vaccine and its Study on the Type of Induced Immune Response (Contract No.: Qiankehe Foundation-ZK[2021] General 439, 100,000)\u0026quot;, \u0026quot;Science and Technology Program Project of Guizhou Province:Research on Key Genes Mining and Regulatory Mechanism of Differential Induced Humoral Immune Response of Periodontal Disease Gene Vaccine, (Contract No.: Qianke Platform Talent [2020]- 034)\u0026quot;, \u0026quot;Zunyi Science and Technology Support Program Project: A preliminary investigation on the mechanism of the type of immune response induced by periodontitis gene vaccine pVAX1-\u003cem\u003eHA2-fimA\u003c/em\u003e-IL-15 in SD rats, (Zuncheng Kehe HZ Zi (2020) No. 297)\u0026quot;, and \u0026quot;Zhuhai Medical Research Fund Project:\u003c/p\u003e\n\u003cp\u003eDevelopment of Anti-Porphyrinomonas gingivalis DNA Vaccine and Observation of its Effect, (Contract No. ZH3310200018PJL)\u0026quot;. The funding agency provided us with financial support and helped us to complete all the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDatasets generated and/or analyzed in the current study are available in the Gene Expression Data library, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE206597.The following secure token has been created to allow review of record GSE206597 while it remains in private status:\u003c/p\u003e\n\u003cp\u003eObktksoepxgbfsj.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eAnimals participating in the study were handled in accordance with the \u0026quot;National Laboratory Animal Management Regulations\u0026quot; (GB14923-2010). The animal experimental protocol was approved and reviewed by the Ethics Committee of\u0026nbsp;Zunyi Medical University.And the study was reported in accordance with ARRIVE guidelines\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFootnotes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePublisher\u0026apos;s Note\u003c/p\u003e\n\u003cp\u003eBai Guo Hui and Wang Ming Wei are\u0026nbsp;Co-corresponding author\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributor Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhang Hui Jie，Email:[email protected]\u003c/p\u003e\n\u003cp\u003eZeng Feng Jiao，Email:[email protected]\u003c/p\u003e\n\u003cp\u003eYu Hang，Email:[email protected]\u003c/p\u003e\n\u003cp\u003eChen Bin，Email:[email protected]\u003c/p\u003e\n\u003cp\u003eZhou xiao hong，Email:[email protected]\u003c/p\u003e\n\u003cp\u003eWang Ming Wei,Email:[email protected]\u003c/p\u003e\n\u003cp\u003eBai Guo Hui,\u0026nbsp;Email:\u0026nbsp;[email protected]\u0026nbsp;\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHirtz C, O\u0026apos;Flynn R, Voisin PM, et al. The potential impact of salivary peptides in periodontitis [J]. Critical reviews in clinical laboratory sciences, 2021, 58(7): 479-492\u003c/li\u003e\n\u003cli\u003eHajishengallis G. Immunomicrobial pathogenesis of periodontitis: keystones, pathobionts, and host response [J]. Trends in immunology, 2014, 35(1): 3-11.\u003c/li\u003e\n\u003cli\u003eYang B, Pang X, Li Z, et al. Immunomodulation in the treatment of periodontitis: Progress and perspectives[J]. Frontiers in immunology, 2021, 12: 781378.\u003c/li\u003e\n\u003cli\u003eKornman K S. Mapping the pathogenesis of periodontitis: a new look [J]. Journal of Periodontology, 2008, 79: 1560-1568.\u003c/li\u003e\n\u003cli\u003eCecoro G, Annunziata M, Iuorio MT, et al. Periodontitis, low-grade inflammation and systemic health: A scoping review [J]. Medicina, 2020, 56(6): 272.\u003c/li\u003e\n\u003cli\u003eYang L, Ge Q, Ye Z, et al. Sulfonylureas for Treatment of Periodontitis-Diabetes Comorbidity-Related Complications: Killing Two Birds With One Stone [J]. Frontiers in Pharmacology, 2021: 12:728458.\u003c/li\u003e\n\u003cli\u003eKitamura M, Ikebe K, Kamide K, et al. Association of periodontal disease with atherosclerosis in 70-year-old Japanese older adults [J]. Odontology, 2021, 109(2): 506-513.\u003c/li\u003e\n\u003cli\u003eRyder MI, Xenoudi P. Alzheimer disease and the periodontal patient: new insights, connections, and therapies [J]. Periodontology 2000, 2021, 87(1): 32-42.\u003c/li\u003e\n\u003cli\u003eChen MX, Zhong YJ, Dong QQ, et al. Global, regional, and national burden of severe periodontitis, 1990\u0026ndash;2019: An analysis of the Global Burden of Disease Study 2019 [J]. Journal of clinical periodontology, 2021, 48(9): 1165-1188.\u003c/li\u003e\n\u003cli\u003eWei Y, Wang Z, Lei L, et al. Global burden of periodontal disease and its relation with socioeconomic development during 1990\u0026mdash;2019 [J]. Journal of Zhejiang University (Medical Science), 2021, 50(5): 545-552.\u003c/li\u003e\n\u003cli\u003eVaernewyck Victor, Arzi Boaz, Sanders Niek N et al. Mucosal Vaccination Against Periodontal Disease: Current Status and Opportunities [J]. Front Immunol, 2021, 12: 768397.\u003c/li\u003e\n\u003cli\u003eNigar Shireen, Shimosato Takeshi, Cooperation of Oligodeoxynucleotides and Synthetic Molecules as Enhanced Immune Modulators [J].Front Nutr, 2019, 6: 140\u003c/li\u003e\n\u003cli\u003eHou Yingying,Wang Ying,Tang Yao et al. Codelivery of antigen and dual adjuvants by aluminum hydroxide nanoparticles for enhanced immune responses [J].J Control Release, 2020, 326: 120-130.\u003c/li\u003e\n\u003cli\u003eLi Qin,Ren Jie,Liu Wei et al. CpG Oligodeoxynucleotide Developed to Activate Primate Immune Responses Promotes Antitumoral Effects in Combination with a Neoantigen-Based mRNA Cancer Vaccine [J].Drug Des Devel Ther, 2021, 15: 3953-3963.\u003c/li\u003e\n\u003cli\u003eBai Guohui,Yu Hang,Guan Xiaoyan et al. CpG immunostimulatory oligodeoxynucleotide 1826 as a novel nasal ODN adjuvant enhanced the protective efficacy of the periodontitis gene vaccine in a periodontitis model in SD rats [J].BMC Oral Health, 2021, 21 (1): 403.\u003c/li\u003e\n\u003cli\u003eZhao Liangzhen, Zhang Hangxiao, Kohnen Markus V et al. Analysis of Transcriptome and Epitranscriptome in Plants Using PacBio Iso-Seq and Nanopore-Based Direct RNA Sequencing [J]. Front Genet, 2019, 10: 253.\u003c/li\u003e\n\u003cli\u003eBayega Anthony, Fahiminiya Somayyeh, Oikonomopoulos Spyros et al. Current and Future Methods for mRNA Analysis: A Drive Toward Single Molecule Sequencing [J].Methods Mol Biol, 2018, 1783: 209-241.\u003c/li\u003e\n\u003cli\u003eYang Bo, Pang Xuefei, Li Zhipeng et al. Immunomodulation in the Treatment of Periodontitis: Progress and Perspectives [J].Front Immunol, 2021, 12: 781378.\u003c/li\u003e\n\u003cli\u003eKwon TaeHyun, Lamster Ira B, Levin Liran, Current Concepts in the Management of Periodontitis [J].Int Dent J, 2021, 71(6):462-476.\u003c/li\u003e\n\u003cli\u003eLi Maochen, Wang Han, Tian Lili et al. COVID-19 vaccine development: milestones, lessons and prospects [J].Signal Transduct Target Ther, 2022, 7 (1): 146.\u003c/li\u003e\n\u003cli\u003eUra Hiroki, Togi Sumihito, Niida Yo, A comparison of mRNA sequencing (RNA-Seq) library preparation methods for transcriptome analysis [J].BMC Genomics, 2022, 23 (1): 303.\u003c/li\u003e\n\u003cli\u003eBarb\u0026eacute; Fran\u0026ccedil;ois, Douglas Todd, Saleh Maya, Advances in Nod-like receptors (NLR) biology [J].Cytokine Growth Factor Rev, 2014, 25(6): 681-697.\u003c/li\u003e\n\u003cli\u003eRodriguez-Hernandez CJ, Sokoloski KJ, Stocke KS, et al. Microbiome-mediated incapacitation of interferon lambda production in the oral mucosa [J]. Proceedings of the National Academy of Sciences, 118(51): e2105170118.\u003c/li\u003e\n\u003cli\u003eLee WB, Choi WY, Lee DH, et al. OAS1 and OAS3 negatively regulate the expression of chemokines and interferon-responsive genes in human macrophages [J]. BMB reports, 2019, 52(2):133-138\u003c/li\u003e\n\u003cli\u003eKristiansen H, Gad HH, Eskildsen-Larsen S, et al. The oligoadenylate synthetase family: an ancient protein family with multiple antiviral activities [J]. Journal of Interferon \u0026amp; Cytokine Research, 2011, 31(1): 41-47.\u003c/li\u003e\n\u003cli\u003ePerelygin AA, Zharkikh AA, Scherbik SV, et al. The mammalian 2\u0026prime;-5\u0026prime; oligoadenylate synthetase gene family: evidence for concerted evolution of paralogous Oas1 genes in Rodentia and Artiodactyla [J]. Journal of molecular evolution, 2006, 63(4): 562-576.\u003c/li\u003e\n\u003cli\u003eZhang W, Cao X, Cao G, et al. OASs in Defense of Mycobacterial Infection: Angels or Demons? [J]. Current Issues in Molecular Biology, 2021, 40(1): 221-230.\u003c/li\u003e\n\u003cli\u003eWang Yan, Yang Fuling, Yin Huadong et al. Chicken interferon regulatory factor 7 (IRF7) can control ALV-J virus infection by triggering type I interferon production through affecting genes related with innate immune signaling pathway [J].Dev Comp Immunol, 2021, 119: 104026.\u003c/li\u003e\n\u003cli\u003eDeng Zihan, Hu Wenhui, Ai Hongbo et al. The Dramatic Role of IFN Family in Aberrant Inflammatory Osteolysis [J].Curr Gene Ther, 2021, 21: 112-129.\u003c/li\u003e\n\u003cli\u003eMizraji Gabriel, Nassar Maria, Segev Hadas et al. Porphyromonas gingivalis Promotes Unrestrained Type I Interferon Production by Dysregulating TAM Signaling via MYD88 Degradation. [J].Cell Rep, 2017, 18: 419-431.\u003c/li\u003e\n\u003cli\u003eMoretta A, Scieuzo C, Petrone AM, et al. Antimicrobial peptides: A new hope in biomedical and pharmaceutical fields[J]. Frontiers in Cellular and Infection Microbiology, 2021, 11: 668632\u003c/li\u003e\n\u003cli\u003eSolanki SS, Singh P, Kashyap P, et al. Promising role of defensins peptides as therapeutics to combat against viral infection [J]. Microbial Pathogenesis, 2021, 155: 104930.\u003c/li\u003e\n\u003cli\u003eJourdain ML, Velard F, Pierrard L, et al. Cationic antimicrobial peptides and periodontal physiopathology: A systematic review [J]. Journal of periodontal research, 2019, 54(6): 589-600.\u003c/li\u003e\n\u003cli\u003eSvensson D, Westman J, Wickstr\u0026ouml;m C, et al. Human endogenous peptide p33 inhibits detrimental effects of LL‐37 on osteoblast viability [J]. Journal of Periodontal Research, 2015, 50(1): 80-88.\u003c/li\u003e\n\u003cli\u003eJ\u0026ouml;nsson D, Nilsson B O. The antimicrobial peptide LL-37 is anti-inflammatory and proapoptotic in human periodontal ligament cells [J]. Journal of periodontal research, 2012, 47(3): 330-335.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CPG ODN, Periodontitis, Genetic vaccine, RNA-seq","lastPublishedDoi":"10.21203/rs.3.rs-1694788/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1694788/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Periodontitis is one of the main causes of tooth loss in adults. Early diagnosis and intervention can effectively control the progression of periodontitis. The research group constructed a periodontitis genetic vaccine in the early stage and improved the immunogenicity of the body by adding CpG oligonucleotide (CpG ODN). The purpose of this study was to analyse the potential mechanism by which CpG ODN adjuvants enhance the preventive effect of periodontitis genetic vaccines at the molecular level by transcriptome sequencing and to screen out key genes and signaling pathways for follow-up research.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e Nine 4- to 6-week-old male Sprague–Dawley (SD) rats were randomly divided into 3 groups, namely, the blank group, pVAX1-\u003cem\u003eHA2-fimA \u003c/em\u003econtrol group, and pVAX1-\u003cem\u003eHA2-fimA \u003c/em\u003e+ CpG ODN experimental group. At the 1st, 2nd, and 4th weeks, the rats were immunized by intranasal instillation, and three groups of rats were sacrificed at the 7th week. After total RNA was extracted from the spleen, RNA-seq library construction and sequencing were performed. Genetic ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of differentially expressed genes (DEGs). The screened poor DEGs were transferred to the STRING database to establish a protein–protein interaction (PPI) network map. To study the effect of CPG ODN on periodontitis genetic vaccines, we used Cytoscape software to further draw the network map, and quantitative real-time PCR (qRT-PCR) was used to validation of key genes.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eA total of 161 significantly differentially expressed genes were found between the CPG ODN group and the control group. GO analysis showed that the differentially expressed genes were mainly enriched in immune-related functions such as antibacterial humoral responses, defense responses to other organisms, and defense responses to bacteria. KEGG pathway analysis showed that the differentially expressed genes were mainly involved in Staphylococcus aureus infection, oxidative phosphorylation, spliceosome, and nucleotide-binding oligomerization domain (NOD)-like receptor (NLR) receptor signaling pathways. The PPI network graph constructed with Cytoscape software contains 58 nodes and 155 edges. Based on GO, KEGG, and PPI network map, we screened five key genes, including \u003cem\u003eOas2, Irf 7, Np4, Defa11 \u003c/em\u003eand \u003cem\u003eCamp\u003c/em\u003e. These candidate genes may play a key role in the immune mechanism of periodontitis gene vaccines. The verification of key genes by qRT–PCR showed that compared with the control group, the expression of the \u003cem\u003eOas2 and Irf7 \u003c/em\u003egenes in the experimental group was significantly upregulated, and the expression of the \u003cem\u003eNp4, Defa11 \u003c/em\u003eand \u003cem\u003eCamp \u003c/em\u003egenes was significantly downregulated.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThe results were consistent with the transcriptome sequencing analysis of the preventive effect of periodontitis gene vaccine based on transcriptome sequencing, and screened five key genes involved in the synergistic effect of CPG ODN adjuvant and periodontitis gene vaccine, including \u003cem\u003eOas2, Irf7\u003c/em\u003e, \u003cem\u003eNp4, Defa11 \u003c/em\u003eand \u003cem\u003eCamp\u003c/em\u003e, to understand the immune mechanism of periodontitis gene vaccine at the genetic level.\u003c/p\u003e","manuscriptTitle":"Identification of the immune enhancement effect of CpG ODN on periodontitis genetic vaccine by RNA sequencing","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-06-29 16:44:09","doi":"10.21203/rs.3.rs-1694788/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"aa2e31d0-f8e3-46fb-bfad-39be44b3f22c","owner":[],"postedDate":"June 29th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-09-14T08:29:35+00:00","versionOfRecord":[],"versionCreatedAt":"2022-06-29 16:44:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1694788","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1694788","identity":"rs-1694788","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}