Single Intraperitoneal Injection of Dexamethasone Alerts Region-specific Neurotransmitter Metabolism in Rat Brain 

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Synthetic glucocorticoids (GCs), such as dexamethasone (DEX), are widely used in therapy; however, their administration at high doses may be associated with effects on the central nervous system, particularly on neurotransmitter systems, yet the molecular mechanisms underlying these phenomena remain poorly understood. In this study, we investigated the effects of a single intraperitoneal administration of DEX (8 mg/kg) on the metabolism of key monoamines and the expression of their metabolic enzymes in various rat brain regions (striatum, hippocampus, and prefrontal cortex) using high-performance liquid chromatography (HPLC) and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). We found that DEX exerts a pronounced, region-specific impact on neurotransmitter systems. In the striatum, DEX increased dopamine (DA) and serotonin (5-HT) levels while simultaneously reducing their catabolism, which was associated with decreased messenger ribonucleic acid (mRNA) expression of monoamine oxidase A (MAOA) and monoamine oxidase B (MAOB) and increased expression of tyrosine 3‑monooxygenase (TH). In the hippocampus, DEX elevated serotonin levels and reduced its turnover despite an increase in MAOA mRNA expression, suggesting the potential involvement of post-transcriptional regulation or minor metabolic enzymes. In the cortex, DEX induced a two-fold reduction in norepinephrine (NE) and its metabolite, as well as a decrease in MAOA and COMT mRNA expression. This study highlights the importance of considering region-specific cerebral effects of GCs for the development of personalized therapeutic and neuroprotective strategies, including the potential use of DEX in conditions such as Parkinson’s disease due to its ability to elevate striatal DA levels.
Full text 142,816 characters · extracted from preprint-html · click to expand
Single Intraperitoneal Injection of Dexamethasone Alerts Region-specific Neurotransmitter Metabolism in Rat Brain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Single Intraperitoneal Injection of Dexamethasone Alerts Region-specific Neurotransmitter Metabolism in Rat Brain Tatiana Valentinovna Tiutiunnik, Daria Alexeevna Obukhova, Valeria Andreevna Vilnikova, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8185277/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 04 Mar, 2026 Read the published version in Neurochemical Research → Version 1 posted 9 You are reading this latest preprint version Abstract Synthetic glucocorticoids (GCs), such as dexamethasone (DEX), are widely used in therapy; however, their administration at high doses may be associated with effects on the central nervous system, particularly on neurotransmitter systems, yet the molecular mechanisms underlying these phenomena remain poorly understood. In this study, we investigated the effects of a single intraperitoneal administration of DEX (8 mg/kg) on the metabolism of key monoamines and the expression of their metabolic enzymes in various rat brain regions (striatum, hippocampus, and prefrontal cortex) using high-performance liquid chromatography (HPLC) and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). We found that DEX exerts a pronounced, region-specific impact on neurotransmitter systems. In the striatum, DEX increased dopamine (DA) and serotonin (5-HT) levels while simultaneously reducing their catabolism, which was associated with decreased messenger ribonucleic acid (mRNA) expression of monoamine oxidase A (MAOA) and monoamine oxidase B (MAOB) and increased expression of tyrosine 3‑monooxygenase (TH). In the hippocampus, DEX elevated serotonin levels and reduced its turnover despite an increase in MAOA mRNA expression, suggesting the potential involvement of post-transcriptional regulation or minor metabolic enzymes. In the cortex, DEX induced a two-fold reduction in norepinephrine (NE) and its metabolite, as well as a decrease in MAOA and COMT mRNA expression. This study highlights the importance of considering region-specific cerebral effects of GCs for the development of personalized therapeutic and neuroprotective strategies, including the potential use of DEX in conditions such as Parkinson’s disease due to its ability to elevate striatal DA levels. Dexamethasone dopamine serotonin hippocampus striatum prefrontal cortex neurotransmitter imbalance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1 Introduction Dexamethasone (DEX) is a potent synthetic glucocorticoid (GC) widely used in clinical practice due to its anti-inflammatory and immunosuppressive properties. This underscores its clinical importance in the rapid management of acute, life-threatening presentations involving blood–brain barrier (BBB) dysfunction and neuroinflammation [ 1 , 2 ]. A key principle of its use is the short-term administration of high doses to achieve a rapid therapeutic effect, followed by a reduction of a dose as quickly as possible to minimize the negative consequences of prolonged glucocorticoid receptor (GR) activation [ 3 ]. In animal models, different aspects of bodily function, especially in the central nervous system (CNS), caт be selectively investigated through the controlled variation of exogenous GC doses. Researchers largely agree that GC exert a pleiotropic effect, restoring homeostasis through the activation of allostasis [ 4 ]. Over time, the allodynamic processes activated by GC can promote adaptation [ 5 ]. For example, it has been shown that DEX improves memory in laboratory rodents via the activation of beta-adrenergic receptors. However, there are reports that DEX induces apoptosis of granule cells in the dentate gyrus and striatopallidal neurons in the dorsomedial caudate-putamen [ 6 ]. This likely involves a "dose-response" relationship, which is characteristic of hormones and neurotransmitters. It is important to note that, according to data presented at Gray J. D. and others [ 7 ], this relationship is not generalized across the brain but manifests with region-specific characteristics. We have previously demonstrated such specificity of DEX: single intraperitoneal injection of DEX at a dose of 8 mg/kg leads to region-specific changes in the profile of neuron-specific proteins (growth-associated protein 43 (GAP-43), tyrosine 3‑monooxygenase (EC 1.14.16.2) (TH)) and calpain activity in the rat brain [ 8 ]. Given the established role of GC in regulating the synthesis and degradation of key neurotransmitters like dopamine (DA), norepinephrine (NE), and serotonin (5-HT), that which likely underlies, at least in part, the GC-mediated effects on learning, memory, emotional regulation, and stress response. Understanding the specific effects of high-dose DEX on the brain is particularly important for assessing the risks associated with long-term DEX therapy and in the context of neuropsychiatric conditions linked to monoamine imbalance. The aim of the present study is to determine how a single high-dose injection of DEX (8 mg/kg) affects the mRNA levels of key enzymes of the catecholaminergic and serotonergic systems (TH – Tyrosine 3‑monooxygenase, TPH1 – Tryptophan Hydroxylase 1 (EC 1.14.16.4) TPH2 – Tryptophan Hydroxylase 2 (EC 1.14.16.4), MAOA – Monoamine Oxidase A (EC 1.4.3.4), MAOB – Monoamine Oxidase B (EC 1.4.3.4), COMT – Catechol-O-Methyltransferase (EC 2.1.1.6)), as well as the dynamics of the main monoamines —: DA, NE, and 5-HT; and their metabolites: 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and 5-hydroxyindoleacetic acid (5-HIAA) —in the rat brain. 2 Materials and methods 2.1 Animals Adult male Wistar rats (180 ± 20) g at the age of 3 months were used in experiments (n = 30). The rats were purchased from the Rappolovo nursery (Leningrad Region, Russia). The animals were housed in cages (4–5 animals/cage) in a room with controlled conditions (temperature of 24 ± 1°C, 45–65% humidity, and a 12h light/12h dark cycle). Chow in pellets and tap water were available ad libitum during the experimental period. All experiments were performed in accordance with institutional guidelines and the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals as well as national laws (Ministry of Health of the Russian Federation N267, June 19, 2003; Guide for the Use of Laboratory Animals, Moscow, 2005) and permission of the Local Ethical Committee for this research Federal State Budgetary Scientific Institution “Institute of Experimental Medicine” of St. Petersburg № 2/23 from 15.06.2023. 2.2 Experimental design Thirty (n = 30) male rats were divided into two groups of 15 each by the block randomization method. The experimental group (DEX) received a single intraperitoneal injection of DEX at a dose of 8 mg/kg. The control group (control) received a single intraperitoneal injection of saline in a volume of 1 ml (Fig. 1 ). After 18 hours, the rats were decapitated as was described previously. All collected tissues were immediately frozen and stored at -80°C until analysis. All experiments were conducted by researchers who were blinded to the group assignments of the animals. Statistical analysis was performed by a researcher who did not participate in data collection and was provided only with group codes without knowledge of their meaning. Power analysis was performed using G*Power software. A beta value corresponding to a statistical power of at least 0,8 was accepted, and the effect size in all analyses was not less than 0,5. Before the withdrawal of animals into the experiments, the rats were anesthetized by intraperitoneal injection of Zoletil 100® (35 mg/kg) and decapitated with a guillotine (Open-Science AE1601, RPC OpenScience Ltd, Russia). The rat brain was quickly excised and dissected from the skull according to methods previously described [ 9 ], and the striatum, hippocampus, and prefrontal cortex were sampled. Brain areas were identified with a brain atlas [ 10 ]. 2.3 High performance liquid chromatography The samples of brain structures were homogenized with 150 µL of a 0.1 M perchloric acid solution, homogenized, and subjected to centrifugation at 13,000g for 20 minutes at 4°C. The resulting supernatant was utilized for the quantitative analysis of monoamines, including NE, DA, 5-HT, DOPAC, HVA, and 5-HIAA. The pellet obtained after centrifugation was reserved for subsequent determination of total protein concentration using a NanoDrop™ spectrophotometer (Thermo Scientific™), measurements at 280 nm with a sample volume 1–2 µL. The mobile phase was prepared by dissolving 70 mM potassium dihydrogen phosphate (KH₂PO₄), 1 mM octane sulfonic acid, and 0.1 mM ethylenediaminetetraacetic acid (EDTA, sodium salt) in deionized water. The solution was adjusted to the desired pH of 3.12. The resulting buffer solution was filtered through a 0.22 µm membrane. Finally, methanol was added to achieve a final concentration of 14% (v/v). To determine the concentration of monoamines in the supernatant, an analytical column BDS HYPERSIL C18 (250 × 4.6) and a DECADE II SCC detector with an analytical cell were used, Shimadzu LC-20 Prominence Chromatographic System. Monoamine concentrations were determined by the external standard method, wherein calibration curves were generated using known concentrations of standard solutions for each analyte. For this purpose, standard solutions of the main detectable monoamines with known concentrations (5 ng/mL, 10 ng/mL, 15 ng/mL) were used. Calibration curves, generated based on chromatograms of the external standard for each monoamine, were employed to determine the concentrations of monoamines in the brain structures of experimental animals. The obtained results were expressed as "ng of monoamines per 1 mg of protein" after normalizing the concentration values to the total protein concentration in the sample, which were determined using a NanoDrop2000 spectrophotometer (Thermo Scientific, USA). 2.4 mRNA isolation Total mRNA was isolated from frozen tissues (50–100 mg) using the ExtractRNA kit (#BC032, Evrogen, Russia) following the manufacturer’s protocols for Phenol–chloroform extraction. Briefly, after two chloroform extraction steps, RNA was precipitated with isopropanol and the pellet was washed twice with 70% ethanol. After air-drying, RNase Free water (#W4502, Sigma) was added to each sample in a volume of 20 µl. The concentrations of RNA samples were determined using a NanoDrop2000 spectrophotometer (Thermo Scientific, USA), and the purity was verified by confirming that each sample had an A260/A280 optical density ratio > 1.9. After that, the samples were stored at -80°C until further analysis. 2.5 Reverse transcription A total of 2 µg mRNA was used for complementary DNA (cDNA) synthesis. The reverse transcription reaction was performed using a commercial Reverta reagent kit (#SK022S, Evrogen, Russia) according to the manufacturer’s instructions. The resulting cDNA was stored at -20°C for further use. 2.6 Real-time PCR Quantitative real-time polymerase chain reaction (RT-PCR) was conducted employing the BioRad CFX96 Real-TimeSystem (Bio-Rad Laboratories, USA) and a commercial qPCRmix-HS SYBR 5x reagent kit (#PK147L, Evrogen, Russia). Primer development was executed using the PrimerBlast software (NCBI, USA). The optimal reaction parameters were determined for each primer to ensure successful amplification. A list of primer sequences is provided in Table 1 . The PCR protocol commenced with an initial denaturation at 95°C for 5 minutes, subsequently comprising 45 cycles each consisting of a 20-second denaturation (94°C), a 40-second annealing (60°C), and a 50-second extension (72°C). A melting curve analysis was conducted, gradually increasing the temperature from 65°C to 95°C in 0.5°C steps, to evaluate the specificity of the amplification process. For normalization purposes, the expression of Peptidyl prolyl isomerase A (EC 5.2.1.8) (PPIA) and Phosphoglycerate kinase 1 (EC 2.7.2.3) (PGK1) genes were chosen as reference genes. To quantify relative gene expression, we employed the method described by Vandesompele et al [ 11 ], with results displayed as alternate units in the graphs. Quantile normalization was used to normalize the batch effect in the PCR data [ 12 ]. Normalization was performed using Python (version 3.12.12). Standard libraries, including NumPy, pandas, Matplotlib, and SciPy, were employed for data processing. Table 1 Primers used for real-time PCR analysis Name Primer sequences (5’ → 3’) Annealing temperature, °C Product size, bp PPIA F GGATTTGGCTATAAGGGTTC R GTTGTCCACAGTCGGAGA + 60 358 PGK1 F ATGCAAAGACTGGCCAAGCTAC R AGCCACAGCCTCAGCATATTTC + 60 104 COMT F CTGGAGGCCATCGACACCTA R AGTAAGCTCCCAGCTCCAGCA + 67 130 MAOA F GCCAGGAACGGAAATTTGTA R TCTCAGGTGGAAGCTCTGGT + 64 231 MAOB F TGGGCCAAGAGATTCCCAGTGATG R AGAGTGTGGCAATCTGCTTTGTAG + 60 129 TH F TCACCACCTGGTCACCAAGTT R GTTCACCGTGCTTGTACT + 60 125 TPH1 F GCACAGCCAGGCATGAGGATG R GGCTACACTGCTGACACCACAC + 60 195 TPH2 F ССОСТСАССТССТССТАСАСС R GCTCTTCTGGCACCGCTGAATC + 60 81 2.7 Statistical analysis Statistical analysis was conducted using GraphPad Prism 8.0 software (GraphPad Software, USA). Pairwise comparisons were performed using the Mann–Whitney U test (U-statistics reported). All tests were two-tailed, and a p-value of < 0.05 was considered statistically significant. 3 Results 3.1 Effect of DEX on the concentrations of DA, NE, 5-HT and their primary metabolites (DOPAC, HVA, 5-HIAA) in the brain The levels of major biogenic monoamines and their metabolites in striatum, hippocampus and prefrontal cortex are shown in Table 2 . Table 2 The levels of major biogenic monoamines and their metabolites in CNS. NE, ng/mg DA, ng/mg DOPAC, ng/mg HVA, ng/mg 5-HT, ng/mg 5-HIAA, ng/mg Striatum control 33,21 (12,1; 43,6) 28,24 (7,4; 50,6) 3,68 (1,2; 4,9) 0,8 (0,6; 4,7) 2,42 (1,9; 3,0) 0,34 (0,2; 0,6) DEX 31,11 (24,7; 41,5) 107,4 (60,3; 174,8) 8,93 (6,4; 15,6) 0,8 (0,6; 1,2) 1,11 (0,8; 1,4) 0,31 (0,2; 0,4) Hippocampus control 7,9 (2,6; 9,7) 0,14 (0,1; 1,2) 0,17 (0,1; 0,2) 2,92 (1,9; 3,5) 0,35 (0,3; 0,4) 0,29 (0,2; 0,4) DEX 5,4 (2,3; 12,4) 0,11 (0,1; 1,2) 0,07 (0,1; 0,2) 1,75 (1,3; 2,0) 0,50 (0,4; 0,6) 0,20 (0,1; 0,2) Prefrontal cortex control 129,20 (98,6; 390,3) 15,98 (7,4; 25,9) 93,14 (63,4; 245,4) 99,71 (73,9; 339,1) 2,45 (1,3; 4,5) 1,19 (0,9; 3,5) DEX 60,48 (41,6; 69,9) 4,31 (3,9; 5,8) 59,90 (42,1; 75,6) 45,35 (33,0; 64,4) 1,33 (1,1; 1,9) 0,55 (0,3; 0,9) Table 2 . The effect of DEX on the level of monoamines in the striatum, hippocampus and prefrontal cortex in rats. Values are protein concentrations in ng/mg of total protein presented as median values with interquartile ranges (25th; 75th percentiles), n = 5 for each group. Mann–Whitney U test. Statistically significant values (p < 0,05) are highlighted in bold. It was shown that dexamethasone significantly increases levels of DA (U = 0; p = 0,0286) and DOPAC (U = 0; p = 0,0286) in striatum compared to the control group. Administration of DEX significantly reduced 5-HT levels relative to controls (U = 0; p = 0,0286), with no observable effect on its major metabolite 5-HIAA (U = 7; p = 0,885). In the hippocampus, the DEX group demonstrated a significant 1.45-fold increase in 5-HT levels (U = 0; p = 0,03) and a 1,5-fold decrease in 5-HIAA levels (U = 0; p = 0,03). In the prefrontal cortex, DEX significantly decreased NE by 2.15-fold (U = 0; p = 0,008), HVA by 1.5-fold (U = 2; p = 0,03) and 5-HIAA by 2.14-fold (U = 0; p = 0,03). 3.2 Effect of DEX on DA metabolism in rat brain To evaluate dopaminergic metabolic activity, we quantified the ratios of DA metabolites (DOPAC and HVA) to DA concentrations in rat brain cells. These metabolic indices (DOPAC/DA and HVA/DA ratios) were analyzed across experimental groups, with comparative results presented in Fig. 2 . DEX administration significantly alter dopamine metabolic indices, including HVA/DA (0,014 (0,01; 0,06) vs 0,007 (0,007; 0,009); U = 1; p = 0,01; Fig. 2 a), DOPAC/DA (0,55 (0,27; 0,98) vs 0,09 (0,08; 0,11); U = 0; p = 0,008; Fig. 2 b) and (HVA + DOPAC)/DA (0,56 (0,33; 0,99) vs 0,09 (0,08; 0,12); U = 0; p = 0,008; Fig. 2 c) ratios in striatatum, compared to control group. DEX administration did not significantly alter DA metabolic indices, including HVA/DA (0,16 (0,14; 0,52) vs 0,17 (0,08; 0,21); U = 11; p = 0,84; Fig. 3 a), DOPAC/DA (1,8 (0,12; 0,6) vs 1,2 (0,08; 0,28); U = 10; p = 0,69; Fig. 3 b), or (HVA + DOPAC)/DA (0,33 (0,25; 1,14) vs 0,31 (0,22; 0,43); U = 9; p = 0,55; Fig. 3 c) ratios in hippocampal, compared to control group. DEX administration did not significantly alter DA metabolic indices, including HVA/DA (0,42 (0,32; 0,71) vs 0,53 (0,38; 0,62); U = 10; p = 0,69; Fig. 4 a) or (HVA + DOPAC)/DA (0,79 (0,65; 1,18) vs 1,2 (0,94; 1,3); U = 7; p = 0,3; Fig. 4 c) ratios in prefrontal cortex, compared to control group. However, dex administration leads to decrease of DOPAC/DA (0,37 (0,31; 0,49) vs 0,63 (0,49; 0,76); U = 2; p = 0,03; Fig. 4 b), compared to control group. 3.3 Effect of DEX on 5-HT metabolism in rat brain To evaluate serotonergic metabolic activity, we quantified the ratio of 5-HIAA to 5-HT concentrations in rat brain cells. This 5-HIAA/5-HT ratio, an established index of 5-HT turnover, was compared across experimental groups (Fig. 5 ). DEX administration significantly decreased the 5-HIAA/5-HT ratio in the hippocampus (1,2 (1,1; 1,8) vs 0,62 (0,36; 0,81); U = 0; p = 0,007; Fig. 5 b), indicating reduced 5-HT metabolism in this region. In contrast, striatal (0,42 (0,3; 0,78) vs 0,94 (0,77; 1,16); U = 4; p = 0,09; Fig. 5 a) and cortical (2,6 (1,8; 3,8) vs 1,1 (0,83; 2,56); U = 5; p = 0,15; Fig. 5 c) 5-HIAA/5-HT ratios remained unaffected by DEX treatment. 3.4 Effect of DEX on mRNA expression of TPH1, TPH2 and TH in CNS The TPH 1 mRNA expression declines in the striatum from control group to DEX group (0,8 (-0,1; 1,5) vs -0,4 (-0,6; -0,2), U = 6, p = 0,0003, Fig. 6 a). mRNA expression of TPH2 stays at the same level in the striatum from control group to DEX group (-0,4 (-0,8; 0,5) vs -0,3 (-0,5; 0,2), U = 41, p = 0,5288, Fig. 6 b). There is an increase in TH mRNA expression in the striatum from control group to DEX group (-0,6 (-1,0; -0,4) vs 0,6 (0,1; 0,9), U = 5, p = 0,0002, Fig. 6 c). There is no difference in TPH1 mRNA expression in the hippocampus from control group to DEX group (-0,5 (-0,5; -0,3) vs -0,4 (-0,5; -0,3), U = 47, p = 0,8534, Fig. 7 a). mRNA expression of TPH2 does not differ in the hippocampus from control group to DEX group (-0,2 (-0,7; 0,4) vs -0,2 (-0,6; 0,7), U = 43, p = 0,6305, Fig. 7 b). The level of mRNA expression TH does not change in the hippocampus from control group to DEX group (0,0 (-1,0; 0,9) vs -0,0 (-0,5; 0,5), U = 46, p = 0,7959, Fig. 7 c). The mRNA level of the TPH1 remains unchanged in the prefrontal cortex from control group to DEX group (-0,4 (-0,8; 0,6) vs 0,1 (-0,8; 0,8), U = 47, p = 0,8534, Fig. 8 a). mRNA expression of TPH2 does not differ in the prefrontal cortex from control group to DEX group (-0,3 (-1,0; 0,7) vs 0,2 (-0,7; 0,6), U = 37, p = 0,3527, Fig. 8 b). Also mRNA expression of TH stays at the same level in the prefrontal cortex from control group to DEX group (-0,3 (-0,7; 1,0) vs -0,1 (-0,8; 0,5), U = 47, p = 0,8534, Fig. 8 c). 3.5 Effect of DEX on mRNA expression of MAOA, MAOB, COMT in CNS The mRNA expression level of MAOA rises in the striatum from control group to DEX group (0,8 (0,3; 1,0) vs -0,6 (-0,8; -0,3), U = 2, p = 0,0001, Fig. 9 a). There is decrease in MAO B mRNA expression in the striatum from control group to DEX group (-0,02 (-0,3; 0,2) vs -0,5 (-0,9; -0,4), U = 10, p = 0,0015, Fig. 9 b). The mRNA expression level of COMT remains unchanged in the striatum from control group to DEX group (-0,4 (-0,9; -0,1) vs -0,4 (-0,6; 0,4), U = 42, p = 0,5787, Fig. 9 a). The level of mRNA expression MAOA increases in the hippocampus from control group to DEX group (-0,5 (-0,8; -0,3) vs 0,4 (0,3; 0,5), U = 10, p = 0,0015, Fig. 10 a). There is no differ in MAO B mRNA expression in the hippocampus from control group to DEX group (-0,3 (-0,6; 0,0) vs -0,4 (-0,4; -0,3), U = 43, p = 0,6305, Fig. 10 b). There are no significant changes in COMT mRNA expression in the hippocampus from control group to DEX group (-0,5 (-1,0; 1,1) vs -0,1 (-0,6; 0,6), U = 37, p = 0,3527, Fig. 10 c). The MAO A mRNA expression declines in the prefrontal cortex from control group to DEX group (0,9 (-0,1; 1,3) vs -0,3 (-0,5; -0,1), U = 16, p = 0,0089, Fig. 11 a). Conversely, there is no difference in mRNA expression of MAO B in the prefrontal cortex from control group to DEX group (-0,3 (-0,7; -0,1) vs -0,4 (-0,6; -0,1), U = 47, p = 0,8534, Fig. 11 b). There is decline in COMT mRNA expression in the prefrontal cortex from control group to DEX group (0,6 (-0,0; 1,2) vs -1,0 (-1,2; -0,7), U = 2, p = 0,0001, Fig. 11 c). 4 Discussion In this study, we investigated the effect of a single intraperitoneal injection of DEX at a dose of 8 mg/kg on the content and metabolism of key monoamines and on the expression of mRNA of the major enzymes of monoamine metabolism. This research is important because GCs, particularly DEX, are widely used in the treatment of various diseases; however, the use of high doses of synthetic GCs, even in pulse therapy, leads to numerous side effects, the molecular mechanisms of which remain insufficiently studied [ 13 ]. GC hormones and their synthetic analogs freely penetrate the BBB and, consequently, are capable of altering the development and functioning of the brain [ 14 ]. Therefore, the effects of GCs on the CNS must be studied and taken into account when prescribing GC therapy. It is widely accepted that GCs exert their effects through genomic mechanisms mediated by GR and MR, which directly bind to DNA, as well as through non-genomic mechanisms [ 15 ]. For the CNS, among the mechanisms of GC action, their ability to interact with neurotransmitters and neurotrophic factors, thereby modulating the body's adaptive responses, should be highlighted [ 16 , 17 , 18 , 19 , 20 ]. One well-documented aspect of GC action on the brain, particularly on the hippocampus, is an inverted U-shaped dose-response relationship [ 21 ]. We note that the shape of this relationship is specific to different brain regions, meaning that the effect of GCs on CNS cells in different brain regions will vary even at the same administered dose [ 8 ], and, certainly, the use of different doses will lead to different effects. For example, DEX at a dose of 0,7 mg/kg did not cause significant changes in the content and metabolic rate of dopamine and serotonin in the striatum and cortex but led to a decrease in serotonin in the hippocampus [ 18 ]. In this study, we tested how a single injection of DEX at a dose of 8 mg/kg affects neurotransmitter metabolism (Table 2 ). We have previously shown that a single injection of DEX at this dose stimulates GAP-43 mRNA and protein production in the rat hippocampus, leads to an increase in GAP-43 protein levels and calpain-2 activation in the striatum and prefrontal cortex of rats; however, calpain-2 protein production is increased in the striatum and decreased in the prefrontal cortex. Our data support the hypothesis that DEX can be used to enhance the production of GAP-43 and other proteins crucial for brain function, such as TH and calpains [ 8 ]. Since this dose affects TH expression, we hypothesized that in this case DEX would influence neurotransmitter metabolism. We discovered that in the striatum, DEX causes an increase in DA content, an increase in DOPAC and 5-HT (Table 2 ), while a decrease in the rate of intra- and extracellular DA catabolism is observed (Fig. 2 , 9 ). The likely reason for the changes we found lies in the effect of DEX on the expression of genes encoding monoamine metabolism enzymes (Fig. 6 , 9 ). For example, the decreased rate of DA catabolism can be explained by our finding of reduced mRNA expression of MAOA and MAOB enzymes (Fig. 9 ), and notably, a glucocorticoid response element (GRE) binding site is known to exist in the MAOA promoter (Supplement 1). The increase in DA is likely associated with increased TH expression (Fig. 6 ) [ 8 ], in whose promoter a functional GR binding site has also been identified (Supplement 1). The decrease in 5-HT in the striatum correlates with a decrease in TPH1 mRNA (Fig. 6 ), which, although considered peripheral, also contributes to brain DEX 5-HT synthesis [ 22 ]. In the hippocampus, in response to DEX administration, no changes in DA levels or its metabolites were recorded (Table 2 ), the DA conversion rate also remained unchanged (Fig. 3 ), but an increase in 5-HT content and a decrease in its metabolite 5-HIAA were recorded (Table 2 ), along with a decreased 5-HT conversion rate (Fig. 5 b) and an increase in MAOA mRNA (Fig. 10 ) without changes in TPH1, TPH2, or TH mRNA (Fig. 7 ). Our observations recorded an increase in MAOA mRNA (Fig. 10 ), which would typically be expected to lead to accelerated 5-HT breakdown. However, the decreased 5-HIAA content indicates that the actual metabolism of 5-HT does not increase but rather decreases, which might be associated with regional specificity of enzymatic activity or post-transcriptional mechanisms. For instance, the decrease in 5-HT catabolism rate we observed in the hippocampus could be additionally mediated by the effect of DEX on other, minor, metabolic enzymes. In particular, phenol sulfotransferase (EC 2.8.2.1) (gene SULT1A3) plays a significant role in the sulfation and inactivation of DA and 5-HT in the CNS. Bian and colleagues indicate that the SULT1A3 gene is a direct GC regulatory gene, due to the presence of a GRE in its promoter (Supplement 1) [ 23 ]. Region-specific activity of SULT1A3 could also play a role: possibly, DEX does not induce SULT1A3 in the hippocampus or even temporarily suppresses its activity, which would contribute to 5-HT accumulation. In the prefrontal cortex, we observed a two-fold decrease in NE and HVA (Table 2 ), an increased DA conversion rate (Fig. 4 ), and a decrease in MAOA and COMT mRNA (Fig. 11 ), which might be linked to the action of DEX as a regulator of the expression of these enzymes' genes at the genomic level (Supplement 1). However, DEX administration did not affect the expression of TPH1, TPH2, or TH mRNA. The data we obtained are summarized in Fig. 12 . Such pronounced and multidirectional regional effects are not unexpected, given the complex and context-dependent role of GR and MR receptors [ 24 , 25 ]. For instance, Mifsud and colleagues demonstrated that in the rodent hippocampus, the two types of stress receptors (GR and MR) bind to different DNA sites [ 26 ]. This explains their differential influence on gene activity across various brain regions. This kind of multidirectional modulation of the monoaminergic system is also consistent with observations by Bray and colleagues, who showed that local infusion of corticosterone into the ventral hippocampus differentially affected DA release in the nucleus accumbens of intact animals (enhanced it) versus animals after psychostimulant withdrawal (suppressed it). These differences were associated with changes in the state of the hippocampo-striatal regulatory loop and the context-dependent action of GR and MR. Study showed that infusion of corticosterone into the ventral hippocampus or stress-induced activation increased 5-HT release and promoted potential excitability of glutamatergic neurons (GLUT) while suppressing inhibitory GABAergic (GABA) neurons via actions on GR and MR (Fig. 12 ) [ 27 ]. Collectively, these findings and our data confirm that GR activation by DEX in different brain structures can exert opposing influences on dopaminergic transmission, depending on regional receptor specificity and the state of neuronal networks. Region-specific modulation of monoamines across various CNS structures is further supported by the existence of functional connections between the hippocampus, cortex, and striatum via glutamatergic (GLUT) pathways [ 28 ]. As we discussed previously, the activation of GLUT neurons in the hippocampus under the influence of GCs may contribute to the redistribution and altered levels of catecholamines in other brain areas through the propagation of GLUT activity (Fig. 12 ) [ 28 ]. Our data align well with the concept of a U-shaped dose-response curve for G) effects in the hippocampus. Under moderate MR activation, neurotransmitter systems remain balanced: levels of DA, 5-HT, and NE are maintained at baseline, which helps the brain adapt to stress and preserve cognitive functions. At high GC doses, GR activation DA, leading to impairments. We observed an accumulation of DA and 5-HT alongside a decrease in their metabolites, despite increased MAOA expression, indicating disrupted catabolism of these neurotransmitters (Fig. 12 ). This effect manifests region-specifically: the hippocampus and striatum respond differently, likely due to varying activity of enzymes, including minor ones like SULT1A3. Furthermore, hippocampal GLUT neurons under high GC doses may enhance signaling to the cortex and striatum, altering local monoamine levels. Thus, comprehensive investigation of the cerebral effects of DEX is imperative for modern translational medicine. Deciphering the signaling pathways mediating both therapeutic and adverse effects, particularly those concerning neurotransmitter balance, will enable a shift from empirical application to personalized therapy and the development of adjuvant neuroprotective strategies. For instance, DEX could potentially be incorporated into treatment regimens for Parkinson's disease due to its ability to increase striatal DA. Leveraging the knowledge gained, it may be possible to create a new generation of selective GR modulators devoid of the limitations inherent in current pharmacotherapy. 5 Conclusions The study revealed that a single high-dose DEX administration (8 mg/kg) exerts complex and region-specific effects on the monoaminergic systems of the rat brain. The observed multidirectional changes in the levels of DA, 5-HT, and their metabolites in the striatum, hippocampus, and prefrontal cortex are associated with modulation of the mRNA expression of key enzymes involved in their synthesis and catabolism (TH, MAO, COMT, TPH). The data obtained are consistent with the concept of a U-shaped dose-response relationship between GCs effects and highlight the key role of GR activation in altering neurotransmitter balance. These results are important for understanding the molecular mechanisms of GC-induced side effects and offer prospects for developing safer treatment strategies. Based on our data, we recommend further in-depth studies of dexamethasone as a potential antiparkinsonian drug. Abbreviations CNS – Central Nervous System DEX – Dexamethasone GC – Glucocorticoids GR – Glucocorticoid Receptor GRE – Glucocorticoid Response Element MR – Mineralocorticoid Receptor BBB – Blood–Brain Barrier DNA – Deoxyribonucleic Acid mRNA – Messenger Ribonucleic Acid qRT-PCR – Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction PPIA – Peptidyl-Prolyl Isomerase A PGK1 – Phosphoglycerate Kinase 1 HPLC – High-Performance Liquid Chromatography DA – Dopamine NE – Norepinephrine 5-HT – Serotonin, 5-hydroxytryptamine DOPAC – 3,4-Dihydroxyphenylacetic Acid HVA – Homovanillic Acid 5-HIAA – 5-Hydroxyindoleacetic Acid TH – Tyrosine 3‑monooxygenase TPH1 – Tryptophan Hydroxylase 1 TPH2 – Tryptophan Hydroxylase 2 MAOA – Monoamine Oxidase A MAOB – Monoamine Oxidase B COMT – Catechol-O-Methyltransferase HPK – Hippocampus VHPK – Ventral Hippocampus STR – Striatum PFC – Prefrontal Cortex GLUT – Glutamatergic Neurons GABA – Gamma-Aminobutyric Acid (GABAergic) neurons RN – Reverse signaling Neurons EDTA – Ethylenediaminetetraacetic Acid Declarations Funding This work is supported by project ID: FGWG-2025-0016 of the Federal State Budgetary Scientific Institution ‘Institute of Experimental Medicine’, St. Petersburg, Russia. Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author contributions Tiutiunnik TV: Methodology, Validation, Investigation, Writing—original draft, Data curation. Obukhova DA: Methodology, Writing – review & editing. Vilnikova VA: Methodology, Writing – review & editing. Muruzheva ZM: Conceptualization, Validation. Karpenko MN: Writing – review & editing, Supervision, Funding acquisition, Conceptualization, Validation. All authors read and approved the final manuscript. Data availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval All experiments were performed in accordance with institutional guidelines and the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals as well as national laws (Ministry of Health of the Russian Federation N267, June 19, 2003; Guide for the Use of Laboratory Animals, Moscow, 2005) and permission of the Local Ethical Committee for this research Federal State Budgetary Scientific Institution “Institute of Experimental Medicine” of St. Petersburg № 2/23 from 15.06.2023. References McMahon D, Oakden W, Hynynen K (2020) Investigating the effects of dexamethasone on blood-brain barrier permeability and inflammatory response following focused ultrasound and microbubble exposure. Theranostics 10(4):1604–1618. https://doi.org/10.7150/thno.40908 Garcia-Gomara M, Juan-Palencia A, Alfaro M, Cuadrado-Tejedor M, Garcia-Osta A (2024) Neuroprotective Effects of Dexamethasone in a Neuromelanin-Driven Parkinson's Disease Model. J neuroimmune pharmacology: official J Soc NeuroImmune Pharmacol 20(1):2. https://doi.org/10.1007/s11481-024-10164-4 Cruz-Topete D, Cidlowski JA (2015) One hormone, two actions: anti- and pro-inflammatory effects of glucocorticoids. Neuroimmunomodulation 22(1–2):20–32. https://doi.org/10.1159/000362724 McEwen BS (2003) Interacting mediators of allostasis and allostatic load: Towards an understanding of resilience in aging. Metabolism 52(10 Suppl 2):10–16. https://doi.org/10.1016/s0026-0495(03)00295-6 Roozendaal B, Griffith QK, Buranday J, De Quervain DJ, McGaugh JL (2003) The hippocampus mediates glucocorticoid-induced impairment of spatial memory retrieval: Dependence on the basolateral amygdala. Proc Natl Acad Sci USA 100(3):1328–1333. https://doi.org/10.1073/pnas.0337480100 Haynes LE, Griffiths MR, Hyde RE, Barber DJ, Mitchell IJ (2001) Dexamethasone induces limited apoptosis in the developing rat striatum and the cultured human foetal neocortex. Brain Res 918(1–2):60–70. https://doi.org/10.1016/S0306-4522(01)00070-7 Gray JD, Kogan JF, Marrocco J, McEwen BS (2017) Genomic and epigenomic mechanisms of glucocorticoids in the brain. Nat Reviews Endocrinol 13(11):661–673. https://doi.org/10.1038/nrendo.2017.97 Tiutiunnik TV, Kudrinskaya VM, Obukhova DA, Vilnikova VA, Burdinskaya VO, Muruzheva Z, Karpenko MN (2025) Intraperitoneal Single Injection of Dexamethasone Leads to Region-Specific Changes in the Profile of Neuron-Specific Proteins in the Rat Brain. Eur J Neurosci 61(10):e70146. https://doi.org/10.1111/ejn.70146 Paul CA, Beltz B, Berger-Sweeney J (2008) The Nissl stain: A stain for cell bodies in brain sections. CSH Protocols 2008(5). https://doi.org/10.1101/pdb.prot4805 . pdb.prot4805 Paxinos G, Watson C (2013) The rat brain in stereotaxic coordinates: Hard cover edition. Academic Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7). https://doi.org/10.1186/gb-2002-3-7-research0034 . research0034.1 Mar JC, Kimura Y, Schroder K, Irvine KM, Hayashizaki Y, Suzuki H, Hume D, Quackenbush J (2009) Data-driven normalization strategies for high-throughput quantitative RT-PCR. BMC Bioinformatics 10:110. https://doi.org/10.1186/1471-2105-10-110 Eachus H, Ryu S (2024) Glucocorticoid effects on the brain: from adaptive developmental plasticity to allostatic overload. J Exp Biol 227(Suppl1):jeb246128. https://doi.org/10.1242/jeb.246128 Walker DJ, Spencer KA (2018) Glucocorticoid programming of neuroimmune function. Gen Comp Endocrinol 256:80–88. https://doi.org/10.1016/j.ygcen.2017.07.016 Timmermans S, Souffriau J, Libert C (2019) A General Introduction to Glucocorticoid Biology. Front Immunol 10:1545. https://doi.org/10.3389/fimmu.2019.01545 Wróbel A, Nowak G, Ossowska G, Danilczuk Z, Zebrowska-Łupina I, Wielosz M (2004) Effect of chronic treatment with dexamethasone on brain dopamine receptors in mice. Pol J Pharmacol 56(4):399–405 Iasevoli F, Aloj L, Latte G, Avvisati L, Marmo F, Tomasetti C, Buonaguro EF, Simeoli C, Pivonello R, Colao A, de Bartolomeis A (2013) The glucocorticoid analog dexamethasone alters the expression and the distribution of dopamine receptors and enkephalin within cortico-subcortical regions. Curr Mol Pharmacol 6(3):149–155. https://doi.org/10.2174/18744672060314041521594 Inoue T, Koyama T (1996) Effects of acute and chronic administration of high-dose corticosterone and dexamethasone on regional brain dopamine and serotonin metabolism in rats. Prog Neuro-psychopharmacol Biol Psychiatry 20(1):147–156. https://doi.org/10.1016/0278-5846(95)00299-5 Korewo-Labelle D, Karnia MJ, Myślińska D, Kaczor JJ (2023) Supplementation with Vitamin D3 Protects against Mitochondrial Dysfunction and Loss of BDNF-Mediated Akt Activity in the Hippocampus during Long-Term Dexamethasone Treatment in Rats. Int J Mol Sci 24(18):13941. https://doi.org/10.3390/ijms241813941 Lanshakov DA, Sukhareva EV, Bulygina VV, Bannova AV, Shaburova EV, Kalinina TS (2021) Single neonatal dexamethasone administration has long-lasting outcome on depressive-like behaviour, Bdnf, Nt-3, p75ngfr and sorting receptors (SorCS1-3) stress reactive expression. Sci Rep 11(1):8092. https://doi.org/10.1038/s41598-021-87652-7 Joëls M (2006) Corticosteroid effects in the brain: U-shape it. Trends Pharmacol Sci 27(5):244–250. https://doi.org/10.1016/j.tips.2006.03.007 Abumaria N, Ribic A, Anacker C, Fuchs E, Flügge G (2008) Stress upregulates TPH1 but not TPH2 mRNA in the rat dorsal raphe nucleus: identification of two TPH2 mRNA splice variants. Cell Mol Neurobiol 28(3):331–342. https://doi.org/10.1007/s10571-007-9259-5 Bian HS, Ngo SY, Tan W, Wong CH, Boelsterli UA, Tan TM (2007) Induction of human sulfotransferase 1A3 (SULT1A3) by glucocorticoids. Life Sci 81(25–26):1659–1667. https://doi.org/10.1016/j.lfs.2007.09.029 Koning ACAM, Buurstede JC, van Weert LTCM, Meijer OC (2019) Glucocorticoid and Mineralocorticoid Receptors in the Brain: A Transcriptional Perspective. J Endocr Soc 3(10):1917–1930. https://doi.org/10.1210/js.2019-00158 Daskalakis NP, Meijer OC, de Kloet ER (2022) Mineralocorticoid receptor and glucocorticoid receptor work alone and together in cell-type-specific manner: Implications for resilience prediction and targeted therapy. Neurobiol stress 18:100455. https://doi.org/10.1016/j.ynstr.2022.100455 Mifsud KR, Kennedy CLM, Salatino S, Sharma E, Price EM, Haque SN, Gialeli A, Goss HM, Panchenko PE, Broxholme J, Engledow S, Lockstone H, Cordero Llana O, Reul JMHM (2021) Distinct regulation of hippocampal neuroplasticity and ciliary genes by corticosteroid receptors. Nat Commun 12(1):4737. https://doi.org/10.1038/s41467-021-24967-z Bray B, Clement KA, Bachmeier D, Weber MA, Forster GL (2020) Corticosterone in the ventral hippocampus differentially alters accumbal dopamine output in drug-naïve and amphetamine-withdrawn rats. Neuropharmacology 165:107924. https://doi.org/10.1016/j.neuropharm.2019.107924 Ménard C, Hodes GE, Russo SJ (2016) Pathogenesis of depression: Insights from human and rodent studies. Neuroscience 321:138–162. https://doi.org/10.1016/j.neuroscience.2015.05.053 Sjöberg RL, Ducci F, Barr CS, Newman TK, Dell'osso L, Virkkunen M, Goldman D (2008) A non-additive interaction of a functional MAO-A VNTR and testosterone predicts antisocial behavior. Neuropsychopharmacology: official publication Am Coll Neuropsychopharmacol 33(2):425–430. https://doi.org/10.1038/sj.npp.1301417 Hagerty T, Morgan WW, Elango N, Strong R (2001) Identification of a glucocorticoid-responsive element in the promoter region of the mouse tyrosine hydroxylase gene. J Neurochem 76(3):825–834. https://doi.org/10.1046/j.1471-4159.2001.00072.x Clark JA, Flick RB, Pai LY, Szalayova I, Key S, Conley RK, Deutch AY, Hutson PH, Mezey E (2008) Glucocorticoid modulation of tryptophan hydroxylase-2 protein in raphe nuclei and 5-hydroxytryptophan concentrations in frontal cortex of C57/Bl6 mice. Mol Psychiatry 13(5):498–506. https://doi.org/10.1038/sj.mp.4002041 Bian HS, Ngo SY, Tan W, Wong CH, Boelsterli UA, Tan TM (2007) Induction of human sulfotransferase 1A3 (SULT1A3) by glucocorticoids. Life Sci 81(25–26):1659–1667. https://doi.org/10.1016/j.lfs.2007.09.029 Additional Declarations No competing interests reported. Supplementary Files 6Supplements.docx Cite Share Download PDF Status: Published Journal Publication published 04 Mar, 2026 Read the published version in Neurochemical Research → Version 1 posted Editorial decision: Revision requested 26 Dec, 2025 Reviews received at journal 26 Dec, 2025 Reviews received at journal 23 Dec, 2025 Reviewers agreed at journal 21 Dec, 2025 Reviewers agreed at journal 11 Dec, 2025 Reviewers invited by journal 09 Dec, 2025 Editor assigned by journal 02 Dec, 2025 Submission checks completed at journal 28 Nov, 2025 First submitted to journal 23 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8185277","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":558787225,"identity":"c0a2a92b-1978-4689-a3dd-6f47783e2c7a","order_by":0,"name":"Tatiana Valentinovna Tiutiunnik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYNACHgYGNmbmA0CWhAwRipkhWvjY2RJAWniI1AIEcvw8BlALCQB7Bv6DnwtkbPLYmHk+v7pRY8HDwH746AYCtjBLz+BJK2Zj5t1mnXMM6DCetLQbhBwmzcNzOLENqMU4hw2oRYLHjJAW5t8QLTzPjHP+EaeFDWoLD/Pj3DZitBxmNrPm4UkDamEzY87tk+BhI+QX9vbGx7d5e2wS5/cffvw551udHD/74WN4tYCjhbEHzGSTAJN4lcPBD4juD8SpHgWjYBSMgpEGALgWNjS6ESpqAAAAAElFTkSuQmCC","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":true,"prefix":"","firstName":"Tatiana","middleName":"Valentinovna","lastName":"Tiutiunnik","suffix":""},{"id":558787226,"identity":"e238d380-501b-4a92-add0-cdf6e437e3d5","order_by":1,"name":"Daria Alexeevna Obukhova","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Daria","middleName":"Alexeevna","lastName":"Obukhova","suffix":""},{"id":558787227,"identity":"3f64c42a-15f6-433a-9f13-3b37355c0feb","order_by":2,"name":"Valeria Andreevna Vilnikova","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Valeria","middleName":"Andreevna","lastName":"Vilnikova","suffix":""},{"id":558787228,"identity":"06752944-7a44-4bbd-b47d-3eba5d506d54","order_by":3,"name":"Zamira Magomedovna Muruzheva","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zamira","middleName":"Magomedovna","lastName":"Muruzheva","suffix":""},{"id":558787233,"identity":"dd70976b-d486-4bc5-9483-d51039ea381b","order_by":4,"name":"Marina Nikolaevna Karpenko","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Marina","middleName":"Nikolaevna","lastName":"Karpenko","suffix":""}],"badges":[],"createdAt":"2025-11-23 12:08:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8185277/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8185277/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11064-026-04718-6","type":"published","date":"2026-03-04T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":98044910,"identity":"a1ae2f07-4c90-46a1-8c27-d5ca113b81a0","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2987860,"visible":true,"origin":"","legend":"","description":"","filename":"SingleIntraperitonealInjectionofDexamethasone.docx","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/29916e199f8bad6ff25d13d9.docx"},{"id":98428212,"identity":"d2d4310e-4bec-49eb-be27-f0ced6ce8c38","added_by":"auto","created_at":"2025-12-17 16:41:47","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7153,"visible":true,"origin":"","legend":"","description":"","filename":"ece6816b351b47a09e4e2bc903a57f6a.json","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/3f4e113de2293ae2881b9dde.json"},{"id":98427366,"identity":"8bda4854-1cbe-47d7-adfc-cfb157542101","added_by":"auto","created_at":"2025-12-17 16:40:15","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":127738,"visible":true,"origin":"","legend":"","description":"","filename":"ece6816b351b47a09e4e2bc903a57f6a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/11cd53397d559c47dea2531c.xml"},{"id":98427419,"identity":"a126e8bc-8f94-485f-8e35-e4199e0795ce","added_by":"auto","created_at":"2025-12-17 16:40:19","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18779,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/8ac4765460c2d41db45a1f78.png"},{"id":98427748,"identity":"f77a66b5-9879-4959-9835-47b9afeaac73","added_by":"auto","created_at":"2025-12-17 16:41:05","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21422,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/fde17ec4cc82a3e4bf7ebc9b.png"},{"id":98427982,"identity":"fdaa4591-014f-4679-93a9-91bb0858d2fd","added_by":"auto","created_at":"2025-12-17 16:41:27","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21207,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/dc7df4a6e989f07c55447c38.png"},{"id":98427462,"identity":"54b1662e-987d-4b48-be62-aea5ea517325","added_by":"auto","created_at":"2025-12-17 16:40:29","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27316,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/557681cb8768aad4bcb69160.png"},{"id":98427469,"identity":"8558c0d9-832a-46f9-af5c-7d1e8f82a126","added_by":"auto","created_at":"2025-12-17 16:40:30","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16019,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/2266eb419d4a599144b81f75.png"},{"id":98044920,"identity":"810fce79-4b04-41ed-a1f0-0b266b30bc8b","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15972,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/4a735b14d079da509b0efb9d.png"},{"id":98427870,"identity":"8b0be674-072e-48f6-9012-b587cd3466ed","added_by":"auto","created_at":"2025-12-17 16:41:18","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16369,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/a619cd4f13853eab2680326b.png"},{"id":98044928,"identity":"24bece82-b9be-4844-ad73-138616e7c0bf","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13509,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/6bfbbbb0460225de2ad7ba54.png"},{"id":98427711,"identity":"5afbcb15-d539-4904-87dd-b35149ca5491","added_by":"auto","created_at":"2025-12-17 16:41:00","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21102,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/ba30385739aee126db6d3add.png"},{"id":98044924,"identity":"7cd16967-8183-46c3-837f-17870621c09b","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26247,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/01eb1473c44010fc59cfcfcb.png"},{"id":98044927,"identity":"ab27f02c-e788-4fad-aa91-65c9e444678e","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26287,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/dfcb2e45ce855f75148557a8.png"},{"id":98044926,"identity":"c8f1f517-3084-4741-92a8-d4c0cc7c110e","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21350,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/590550ca4a244e3f776e43ff.png"},{"id":98427503,"identity":"c0367bfe-2933-409b-a7d7-65ab520aac07","added_by":"auto","created_at":"2025-12-17 16:40:34","extension":"xml","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":128917,"visible":true,"origin":"","legend":"","description":"","filename":"ece6816b351b47a09e4e2bc903a57f6a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/32f3ce0f7786277a31a04ef8.xml"},{"id":98044929,"identity":"213bd828-5cec-44ae-a2df-52d04f0b1a7b","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"html","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":140320,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/7f2065ec26ce2e1b81ffb99e.html"},{"id":98044901,"identity":"781afeb5-8c42-44d7-a8b6-e45447a818ab","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":229748,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design (*n=10+10 – 10 samples in control group and 10 samples in DEX group for PCR analysis, *n=5+5 – 5 samples in control group and 5 samples in DEX group for HPLC analysis).TH – Tyrosine 3‑monooxygenase, TPH1 – Tryptophan Hydroxylase 1 TPH2 – Tryptophan Hydroxylase 2, MAOA – Monoamine Oxidase A, MAOB – Monoamine Oxidase B, COMT – Catechol-O-Methyltransferase, HPLC – High-Performance Liquid Chromatography, Real-Time PCR – Real-Time Quantitative Reverse Transcription Polymerase.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/bfefd8c150e4a7d3aa769fe3.png"},{"id":98044904,"identity":"93a7ccd2-53b5-4001-8b1b-351490114012","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":89113,"visible":true,"origin":"","legend":"\u003cp\u003eRatios of monoamine concentrations in rat striatum; a - HVA to DA concentration levels; a - DOPAC to DA concentration levels; c - (HVA+DOPAC) to DA concentration levels. The data is presented as experimental points (n=5 in each group) and median. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/3c01b896865085e397ffe4cd.png"},{"id":98044908,"identity":"421449b7-d8db-42e5-8c9f-96639a435db5","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":308484,"visible":true,"origin":"","legend":"\u003cp\u003eRatios of monoamine concentrations in rat hippocampus\u003cstrong\u003e; \u003c/strong\u003ea - HVA to DA concentration levels; b - DOPAC to DA concentration levels; c - (HVA+DOPAC) to DA concentration levels. The data is presented as experimental points (n=5 in each group) and median. Mann–Whitney U test\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/d558d261b5d16ecd15437e62.png"},{"id":98044905,"identity":"647575f6-936d-4c00-867b-685210e3ef9b","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":92776,"visible":true,"origin":"","legend":"\u003cp\u003eRatios of monoamine concentrations in prefrontal cortex: HVA to DA concentration levels; b - DOPAC to DA concentration levels; c - (HVA+DOPAC) to DA concentration levels. The data is presented as experimental points (n=5 in each group) and median. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/02c6a867f6e19c057616cabc.png"},{"id":98427407,"identity":"6ab95df3-b486-49be-8cff-cd22886639c1","added_by":"auto","created_at":"2025-12-17 16:40:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":78891,"visible":true,"origin":"","legend":"\u003cp\u003eRatio of 5-HIAA concentration to 5-HT concentration in rat brain; a - striatum; b - hippocampus; c - prefrontal cortex. The data is presented as experimental points (n=5 in each group) and median. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/7396bcc17ccff8c97745614d.png"},{"id":98455930,"identity":"6b49a2dc-2996-4fa6-a5eb-bd9c7724307f","added_by":"auto","created_at":"2025-12-17 18:34:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":49237,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the striatum is presented as experimental points (n=10 in each group) and median, a - TPH1, b - TPH2, c - TH. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/b915d77a952f3e6f3818b6c3.png"},{"id":98330196,"identity":"811036dd-560f-4e3d-a177-1776361e9a4f","added_by":"auto","created_at":"2025-12-16 15:15:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":263108,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the hippocampus is presented as experimental points (n=10 in each group) and median, a - TPH1, b - TPH2, c - TH. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/dc21be870e2fb1de728b92b9.png"},{"id":98044912,"identity":"a44a55c9-ecd8-45f4-8e7b-c34476d5d598","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":267827,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the prefrontal cortex is presented as experimental points (n=10 in each group) and median, a - TPH1, b - TPH2, c - TH. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"floatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/2f5323853ec65f47521ea8d9.png"},{"id":98044917,"identity":"2b071f2a-55f3-43f4-af6c-924f21dc65c0","added_by":"auto","created_at":"2025-12-12 08:03:45","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":90840,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the striatum is presented as experimental points (n=10 in each group) and median, a - MAOA, b - MAOB, c - COMT. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/aa0014ffa5b5bf6492632f3a.png"},{"id":98044915,"identity":"ba5b5a8a-7f4c-49ca-980e-f89328388e41","added_by":"auto","created_at":"2025-12-12 08:03:44","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":99553,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the hippocampus is presented as experimental points (n=10 in each group) and median, a - MAOA, b - MAOB, c - COMT. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/4e64b2eed6fdae28a24ae316.png"},{"id":98330336,"identity":"77ffd815-0012-47eb-8068-d6bd071422f6","added_by":"auto","created_at":"2025-12-16 15:17:40","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":90758,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression in the prefrontal cortex is presented as experimental points (n=10 in each group) and median, a - MAOA, b - MAOB, c - COMT. * - p\u0026lt;0.05, compared with the control group. Mann–Whitney U test. Q.n.e. - Quantile-normalized expression\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/1d916337b318e42e0f666405.png"},{"id":98330194,"identity":"ee327c0f-373b-482e-9a13-633e6772bd4e","added_by":"auto","created_at":"2025-12-16 15:15:36","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":190478,"visible":true,"origin":"","legend":"\u003cp\u003ePutative mechanism of single intraperitoneal DEX injection on neurotransmitter systems (description in the text).\u003c/p\u003e\n\u003cp\u003eBrain regions: HPK – Hippocampus; VHPK – Ventral Hippocampus; STR – Striatum; PFC – Prefrontal Cortex. Neurotransmitters/metabolites: DA – Dopamine; NE – Norepinephrine; 5-HT – Serotonin; DOPAC – 3,4-Dihydroxyphenylacetic Acid (dopamine metabolite); HVA – Homovanillic Acid (dopamine metabolite); 5-HIAA – 5-Hydroxyindoleacetic Acid (serotonin metabolite).\u003c/p\u003e\n\u003cp\u003eEnzymes: TH –Tyrosine 3‑monooxygenase; TPH – Tryptophan Hydroxylase; MAOA/B – Monoamine Oxidases A/B; COMT – Catechol-O-Methyltransferase. Neurons: GLUT – Glutamatergic; GABA – GABAergic. Hormones/receptors: DEX – Dexamethasone; GR – Glucocorticoid Receptor; MR – Mineralocorticoid Receptor. Other: RN – Reverse signaling neurons.\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/e80ab5614e71cbe322dd642b.png"},{"id":104250617,"identity":"79ffdc7b-3e7e-42ff-91e9-bbcdde71fac2","added_by":"auto","created_at":"2026-03-09 16:02:10","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2550013,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/5cc952b6-d178-4817-a43e-225bf66c271c.pdf"},{"id":98427157,"identity":"8ac5b9b4-080c-42e3-b28c-5dc1ec6b91e3","added_by":"auto","created_at":"2025-12-17 16:39:48","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15336,"visible":true,"origin":"","legend":"","description":"","filename":"6Supplements.docx","url":"https://assets-eu.researchsquare.com/files/rs-8185277/v1/f0630b77256c11b5a706f292.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Single Intraperitoneal Injection of Dexamethasone Alerts Region-specific Neurotransmitter Metabolism in Rat Brain ","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eDexamethasone (DEX) is a potent synthetic glucocorticoid (GC) widely used in clinical practice due to its anti-inflammatory and immunosuppressive properties. This underscores its clinical importance in the rapid management of acute, life-threatening presentations involving blood\u0026ndash;brain barrier (BBB) dysfunction and neuroinflammation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA key principle of its use is the short-term administration of high doses to achieve a rapid therapeutic effect, followed by a reduction of a dose as quickly as possible to minimize the negative consequences of prolonged glucocorticoid receptor (GR) activation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In animal models, different aspects of bodily function, especially in the central nervous system (CNS), caт be selectively investigated through the controlled variation of exogenous GC doses.\u003c/p\u003e\u003cp\u003eResearchers largely agree that GC exert a pleiotropic effect, restoring homeostasis through the activation of allostasis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Over time, the allodynamic processes activated by GC can promote adaptation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. For example, it has been shown that DEX improves memory in laboratory rodents via the activation of beta-adrenergic receptors. However, there are reports that DEX induces apoptosis of granule cells in the dentate gyrus and striatopallidal neurons in the dorsomedial caudate-putamen [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This likely involves a \"dose-response\" relationship, which is characteristic of hormones and neurotransmitters. It is important to note that, according to data presented at Gray J. D. and others [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], this relationship is not generalized across the brain but manifests with region-specific characteristics. We have previously demonstrated such specificity of DEX: single intraperitoneal injection of DEX at a dose of 8 mg/kg leads to region-specific changes in the profile of neuron-specific proteins (growth-associated protein 43 (GAP-43), tyrosine 3‑monooxygenase (EC 1.14.16.2) (TH)) and calpain activity in the rat brain [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eGiven the established role of GC in regulating the synthesis and degradation of key neurotransmitters like dopamine (DA), norepinephrine (NE), and serotonin (5-HT), that which likely underlies, at least in part, the GC-mediated effects on learning, memory, emotional regulation, and stress response.\u003c/p\u003e\u003cp\u003eUnderstanding the specific effects of high-dose DEX on the brain is particularly important for assessing the risks associated with long-term DEX therapy and in the context of neuropsychiatric conditions linked to monoamine imbalance.\u003c/p\u003e\u003cp\u003eThe aim of the present study is to determine how a single high-dose injection of DEX (8 mg/kg) affects the mRNA levels of key enzymes of the catecholaminergic and serotonergic systems (TH \u0026ndash; Tyrosine 3‑monooxygenase, TPH1 \u0026ndash; Tryptophan Hydroxylase 1 (EC 1.14.16.4) TPH2 \u0026ndash; Tryptophan Hydroxylase 2 (EC 1.14.16.4), MAOA \u0026ndash; Monoamine Oxidase A (EC 1.4.3.4), MAOB \u0026ndash; Monoamine Oxidase B (EC 1.4.3.4), COMT \u0026ndash; Catechol-O-Methyltransferase (EC 2.1.1.6)), as well as the dynamics of the main monoamines \u0026mdash;: DA, NE, and 5-HT; and their metabolites: 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and 5-hydroxyindoleacetic acid (5-HIAA) \u0026mdash;in the rat brain.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Animals\u003c/h2\u003e\u003cp\u003eAdult male Wistar rats (180\u0026thinsp;\u0026plusmn;\u0026thinsp;20) g at the age of 3 months were used in experiments (n\u0026thinsp;=\u0026thinsp;30). The rats were purchased from the Rappolovo nursery (Leningrad Region, Russia). The animals were housed in cages (4\u0026ndash;5 animals/cage) in a room with controlled conditions (temperature of 24\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, 45\u0026ndash;65% humidity, and a 12h light/12h dark cycle). Chow in pellets and tap water were available \u003cem\u003ead libitum\u003c/em\u003e during the experimental period.\u003c/p\u003e\u003cp\u003e All experiments were performed in accordance with institutional guidelines and the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals as well as national laws (Ministry of Health of the Russian Federation N267, June 19, 2003; Guide for the Use of Laboratory Animals, Moscow, 2005) and permission of the Local Ethical Committee for this research Federal State Budgetary Scientific Institution \u0026ldquo;Institute of Experimental Medicine\u0026rdquo; of St. Petersburg № 2/23 from 15.06.2023.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Experimental design\u003c/h2\u003e\u003cp\u003eThirty (n\u0026thinsp;=\u0026thinsp;30) male rats were divided into two groups of 15 each by the block randomization method. The experimental group (DEX) received a single intraperitoneal injection of DEX at a dose of 8 mg/kg. The control group (control) received a single intraperitoneal injection of saline in a volume of 1 ml (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). After 18 hours, the rats were decapitated as was described previously. All collected tissues were immediately frozen and stored at -80\u0026deg;C until analysis.\u003c/p\u003e\u003cp\u003eAll experiments were conducted by researchers who were blinded to the group assignments of the animals. Statistical analysis was performed by a researcher who did not participate in data collection and was provided only with group codes without knowledge of their meaning.\u003c/p\u003e\u003cp\u003ePower analysis was performed using G*Power software. A beta value corresponding to a statistical power of at least 0,8 was accepted, and the effect size in all analyses was not less than 0,5.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eBefore the withdrawal of animals into the experiments, the rats were anesthetized by intraperitoneal injection of Zoletil 100\u0026reg; (35 mg/kg) and decapitated with a guillotine (Open-Science AE1601, RPC OpenScience Ltd, Russia). The rat brain was quickly excised and dissected from the skull according to methods previously described [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and the striatum, hippocampus, and prefrontal cortex were sampled. Brain areas were identified with a brain atlas [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3 High performance liquid chromatography\u003c/h2\u003e\u003cp\u003eThe samples of brain structures were homogenized with 150 \u0026micro;L of a 0.1 M perchloric acid solution, homogenized, and subjected to centrifugation at 13,000g for 20 minutes at 4\u0026deg;C. The resulting supernatant was utilized for the quantitative analysis of monoamines, including NE, DA, 5-HT, DOPAC, HVA, and 5-HIAA. The pellet obtained after centrifugation was reserved for subsequent determination of total protein concentration using a NanoDrop\u0026trade; spectrophotometer (Thermo Scientific\u0026trade;), measurements at 280 nm with a sample volume 1\u0026ndash;2 \u0026micro;L.\u003c/p\u003e\u003cp\u003eThe mobile phase was prepared by dissolving 70 mM potassium dihydrogen phosphate (KH₂PO₄), 1 mM octane sulfonic acid, and 0.1 mM ethylenediaminetetraacetic acid (EDTA, sodium salt) in deionized water. The solution was adjusted to the desired pH of 3.12. The resulting buffer solution was filtered through a 0.22 \u0026micro;m membrane. Finally, methanol was added to achieve a final concentration of 14% (v/v).\u003c/p\u003e\u003cp\u003eTo determine the concentration of monoamines in the supernatant, an analytical column BDS HYPERSIL C18 (250 \u0026times; 4.6) and a DECADE II SCC detector with an analytical cell were used, Shimadzu LC-20 Prominence Chromatographic System.\u003c/p\u003e\u003cp\u003eMonoamine concentrations were determined by the external standard method, wherein calibration curves were generated using known concentrations of standard solutions for each analyte. For this purpose, standard solutions of the main detectable monoamines with known concentrations (5 ng/mL, 10 ng/mL, 15 ng/mL) were used. Calibration curves, generated based on chromatograms of the external standard for each monoamine, were employed to determine the concentrations of monoamines in the brain structures of experimental animals.\u003c/p\u003e\u003cp\u003eThe obtained results were expressed as \"ng of monoamines per 1 mg of protein\" after normalizing the concentration values to the total protein concentration in the sample, which were determined using a NanoDrop2000 spectrophotometer (Thermo Scientific, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4 mRNA isolation\u003c/h2\u003e\u003cp\u003eTotal mRNA was isolated from frozen tissues (50\u0026ndash;100 mg) using the ExtractRNA kit (#BC032, Evrogen, Russia) following the manufacturer\u0026rsquo;s protocols for Phenol\u0026ndash;chloroform extraction. Briefly, after two chloroform extraction steps, RNA was precipitated with isopropanol and the pellet was washed twice with 70% ethanol. After air-drying, RNase Free water (#W4502, Sigma) was added to each sample in a volume of 20 \u0026micro;l. The concentrations of RNA samples were determined using a NanoDrop2000 spectrophotometer (Thermo Scientific, USA), and the purity was verified by confirming that each sample had an A260/A280 optical density ratio\u0026thinsp;\u0026gt;\u0026thinsp;1.9. After that, the samples were stored at -80\u0026deg;C until further analysis.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5 Reverse transcription\u003c/h2\u003e\u003cp\u003eA total of 2 \u0026micro;g mRNA was used for complementary DNA (cDNA) synthesis. The reverse transcription reaction was performed using a commercial Reverta reagent kit (#SK022S, Evrogen, Russia) according to the manufacturer\u0026rsquo;s instructions. The resulting cDNA was stored at -20\u0026deg;C for further use.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6 Real-time PCR\u003c/h2\u003e\u003cp\u003eQuantitative real-time polymerase chain reaction (RT-PCR) was conducted employing the BioRad CFX96 Real-TimeSystem (Bio-Rad Laboratories, USA) and a commercial qPCRmix-HS SYBR 5x reagent kit (#PK147L, Evrogen, Russia). Primer development was executed using the PrimerBlast software (NCBI, USA). The optimal reaction parameters were determined for each primer to ensure successful amplification. A list of primer sequences is provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The PCR protocol commenced with an initial denaturation at 95\u0026deg;C for 5 minutes, subsequently comprising 45 cycles each consisting of a 20-second denaturation (94\u0026deg;C), a 40-second annealing (60\u0026deg;C), and a 50-second extension (72\u0026deg;C). A melting curve analysis was conducted, gradually increasing the temperature from 65\u0026deg;C to 95\u0026deg;C in 0.5\u0026deg;C steps, to evaluate the specificity of the amplification process. For normalization purposes, the expression of Peptidyl prolyl isomerase A (EC 5.2.1.8) (PPIA) and Phosphoglycerate kinase 1 (EC 2.7.2.3) (PGK1) genes were chosen as reference genes. To quantify relative gene expression, we employed the method described by Vandesompele et al [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], with results displayed as alternate units in the graphs. Quantile normalization was used to normalize the batch effect in the PCR data [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Normalization was performed using Python (version 3.12.12). Standard libraries, including NumPy, pandas, Matplotlib, and SciPy, were employed for data processing.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers used for real-time PCR analysis\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003cp\u003e(5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAnnealing temperature, \u0026deg;C\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eProduct size, bp\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePPIA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF GGATTTGGCTATAAGGGTTC\u003c/p\u003e\u003cp\u003eR GTTGTCCACAGTCGGAGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e358\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePGK1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF ATGCAAAGACTGGCCAAGCTAC\u003c/p\u003e\u003cp\u003eR AGCCACAGCCTCAGCATATTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e104\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCOMT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF CTGGAGGCCATCGACACCTA\u003c/p\u003e\u003cp\u003eR AGTAAGCTCCCAGCTCCAGCA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;67\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e130\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMAOA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF GCCAGGAACGGAAATTTGTA\u003c/p\u003e\u003cp\u003eR TCTCAGGTGGAAGCTCTGGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;64\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e231\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMAOB\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF TGGGCCAAGAGATTCCCAGTGATG\u003c/p\u003e\u003cp\u003eR AGAGTGTGGCAATCTGCTTTGTAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e129\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF TCACCACCTGGTCACCAAGTT\u003c/p\u003e\u003cp\u003eR GTTCACCGTGCTTGTACT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e125\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTPH1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF GCACAGCCAGGCATGAGGATG\u003c/p\u003e\u003cp\u003eR GGCTACACTGCTGACACCACAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e195\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTPH2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eF ССОСТСАССТССТССТАСАСС\u003c/p\u003e\u003cp\u003eR GCTCTTCTGGCACCGCTGAATC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e+\u0026thinsp;60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e81\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was conducted using GraphPad Prism 8.0 software (GraphPad Software, USA). Pairwise comparisons were performed using the Mann\u0026ndash;Whitney U test (U-statistics reported). All tests were two-tailed, and a p-value of \u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3 Results","content":"\u003cp\u003e3.1 Effect of DEX on the concentrations of DA, NE, 5-HT and their primary metabolites (DOPAC, HVA, 5-HIAA) in the brain\u003c/p\u003e\u003cp\u003eThe levels of major biogenic monoamines and their metabolites in striatum, hippocampus and prefrontal cortex are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe levels of major biogenic monoamines and their metabolites in CNS.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNE,\u003c/p\u003e\u003cp\u003eng/mg\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eDA,\u003c/p\u003e\u003cp\u003eng/mg\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eDOPAC, ng/mg\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eHVA,\u003c/p\u003e\u003cp\u003eng/mg\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003e5-HT, ng/mg\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003e5-HIAA, ng/mg\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e\u003cp\u003eStriatum\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003econtrol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e33,21 (12,1; 43,6)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e28,24 (7,4; 50,6)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e3,68 (1,2; 4,9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0,8 (0,6; 4,7)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2,42 (1,9; 3,0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0,34 (0,2; 0,6)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDEX\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e31,11 (24,7; 41,5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e107,4 (60,3; 174,8)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e\u003cb\u003e8,93 (6,4; 15,6)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0,8 (0,6; 1,2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e1,11 (0,8; 1,4)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0,31 (0,2; 0,4)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e\u003cp\u003eHippocampus\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003econtrol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e7,9 (2,6; 9,7)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0,14 (0,1; 1,2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0,17 (0,1; 0,2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2,92 (1,9; 3,5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0,35 (0,3; 0,4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0,29 (0,2; 0,4)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDEX\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e5,4 (2,3; 12,4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0,11 (0,1; 1,2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0,07 (0,1; 0,2)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1,75 (1,3; 2,0)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e0,50 (0,4; 0,6)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003e0,20 (0,1; 0,2)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colspan=\"6\" nameend=\"c7\" namest=\"c2\"\u003e\u003cp\u003ePrefrontal cortex\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003econtrol\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e129,20 (98,6; 390,3)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e15,98 (7,4; 25,9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e93,14 (63,4; 245,4)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e99,71 (73,9; 339,1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e2,45 (1,3; 4,5)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1,19 (0,9; 3,5)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDEX\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003e60,48 (41,6; 69,9)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e4,31 (3,9; 5,8)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e59,90 (42,1; 75,6)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e45,35 (33,0; 64,4)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e1,33 (1,1; 1,9)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e\u003cb\u003e0,55 (0,3; 0,9)\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The effect of DEX on the level of monoamines in the striatum, hippocampus and prefrontal cortex in rats. Values are protein concentrations in ng/mg of total protein presented as median values with interquartile ranges (25th; 75th percentiles), n\u0026thinsp;=\u0026thinsp;5 for each group. Mann\u0026ndash;Whitney U test. Statistically significant values (p\u0026thinsp;\u0026lt;\u0026thinsp;0,05) are highlighted in bold.\u003c/p\u003e\u003cp\u003eIt was shown that dexamethasone significantly increases levels of DA (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,0286) and DOPAC (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,0286) in striatum compared to the control group.\u003c/p\u003e\u003cp\u003eAdministration of DEX significantly reduced 5-HT levels relative to controls (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,0286), with no observable effect on its major metabolite 5-HIAA (U\u0026thinsp;=\u0026thinsp;7; p\u0026thinsp;=\u0026thinsp;0,885).\u003c/p\u003e\u003cp\u003eIn the hippocampus, the DEX group demonstrated a significant 1.45-fold increase in 5-HT levels (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,03) and a 1,5-fold decrease in 5-HIAA levels (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,03).\u003c/p\u003e\u003cp\u003eIn the prefrontal cortex, DEX significantly decreased NE by 2.15-fold (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,008), HVA by 1.5-fold (U\u0026thinsp;=\u0026thinsp;2; p\u0026thinsp;=\u0026thinsp;0,03) and 5-HIAA by 2.14-fold (U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,03).\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Effect of DEX on DA metabolism in rat brain\u003c/h2\u003e\u003cp\u003eTo evaluate dopaminergic metabolic activity, we quantified the ratios of DA metabolites (DOPAC and HVA) to DA concentrations in rat brain cells. These metabolic indices (DOPAC/DA and HVA/DA ratios) were analyzed across experimental groups, with comparative results presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eDEX administration significantly alter dopamine metabolic indices, including HVA/DA (0,014 (0,01; 0,06) vs 0,007 (0,007; 0,009); U\u0026thinsp;=\u0026thinsp;1; p\u0026thinsp;=\u0026thinsp;0,01; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), DOPAC/DA (0,55 (0,27; 0,98) vs 0,09 (0,08; 0,11); U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,008; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb) and (HVA\u0026thinsp;+\u0026thinsp;DOPAC)/DA (0,56 (0,33; 0,99) vs 0,09 (0,08; 0,12); U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,008; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec) ratios in striatatum, compared to control group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDEX administration did not significantly alter DA metabolic indices, including HVA/DA (0,16 (0,14; 0,52) vs 0,17 (0,08; 0,21); U\u0026thinsp;=\u0026thinsp;11; p\u0026thinsp;=\u0026thinsp;0,84; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), DOPAC/DA (1,8 (0,12; 0,6) vs 1,2 (0,08; 0,28); U\u0026thinsp;=\u0026thinsp;10; p\u0026thinsp;=\u0026thinsp;0,69; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), or (HVA\u0026thinsp;+\u0026thinsp;DOPAC)/DA (0,33 (0,25; 1,14) vs 0,31 (0,22; 0,43); U\u0026thinsp;=\u0026thinsp;9; p\u0026thinsp;=\u0026thinsp;0,55; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) ratios in hippocampal, compared to control group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDEX administration did not significantly alter DA metabolic indices, including HVA/DA (0,42 (0,32; 0,71) vs 0,53 (0,38; 0,62); U\u0026thinsp;=\u0026thinsp;10; p\u0026thinsp;=\u0026thinsp;0,69; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) or (HVA\u0026thinsp;+\u0026thinsp;DOPAC)/DA (0,79 (0,65; 1,18) vs 1,2 (0,94; 1,3); U\u0026thinsp;=\u0026thinsp;7; p\u0026thinsp;=\u0026thinsp;0,3; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec) ratios in prefrontal cortex, compared to control group.\u003c/p\u003e\u003cp\u003eHowever, dex administration leads to decrease of DOPAC/DA (0,37 (0,31; 0,49) vs 0,63 (0,49; 0,76); U\u0026thinsp;=\u0026thinsp;2; p\u0026thinsp;=\u0026thinsp;0,03; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), compared to control group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Effect of DEX on 5-HT metabolism in rat brain\u003c/h2\u003e\u003cp\u003eTo evaluate serotonergic metabolic activity, we quantified the ratio of 5-HIAA to 5-HT concentrations in rat brain cells. This 5-HIAA/5-HT ratio, an established index of 5-HT turnover, was compared across experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDEX administration significantly decreased the 5-HIAA/5-HT ratio in the hippocampus (1,2 (1,1; 1,8) vs 0,62 (0,36; 0,81); U\u0026thinsp;=\u0026thinsp;0; p\u0026thinsp;=\u0026thinsp;0,007; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb), indicating reduced 5-HT metabolism in this region. In contrast, striatal (0,42 (0,3; 0,78) vs 0,94 (0,77; 1,16); U\u0026thinsp;=\u0026thinsp;4; p\u0026thinsp;=\u0026thinsp;0,09; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea) and cortical (2,6 (1,8; 3,8) vs 1,1 (0,83; 2,56); U\u0026thinsp;=\u0026thinsp;5; p\u0026thinsp;=\u0026thinsp;0,15; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec) 5-HIAA/5-HT ratios remained unaffected by DEX treatment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Effect of DEX on mRNA expression of TPH1, TPH2 and TH in CNS\u003c/h2\u003e\u003cp\u003eThe TPH 1 mRNA expression declines in the striatum from control group to DEX group (0,8 (-0,1; 1,5) vs -0,4 (-0,6; -0,2), U\u0026thinsp;=\u0026thinsp;6, p\u0026thinsp;=\u0026thinsp;0,0003, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003emRNA expression of TPH2 stays at the same level in the striatum from control group to DEX group (-0,4 (-0,8; 0,5) vs -0,3 (-0,5; 0,2), U\u0026thinsp;=\u0026thinsp;41, p\u0026thinsp;=\u0026thinsp;0,5288, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eThere is an increase in TH mRNA expression in the striatum from control group to DEX group (-0,6 (-1,0; -0,4) vs 0,6 (0,1; 0,9), U\u0026thinsp;=\u0026thinsp;5, p\u0026thinsp;=\u0026thinsp;0,0002, Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThere is no difference in TPH1 mRNA expression in the hippocampus from control group to DEX group (-0,5 (-0,5; -0,3) vs -0,4 (-0,5; -0,3), U\u0026thinsp;=\u0026thinsp;47, p\u0026thinsp;=\u0026thinsp;0,8534, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003emRNA expression of TPH2 does not differ in the hippocampus from control group to DEX group (-0,2 (-0,7; 0,4) vs -0,2 (-0,6; 0,7), U\u0026thinsp;=\u0026thinsp;43, p\u0026thinsp;=\u0026thinsp;0,6305, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eThe level of mRNA expression TH does not change in the hippocampus from control group to DEX group (0,0 (-1,0; 0,9) vs -0,0 (-0,5; 0,5), U\u0026thinsp;=\u0026thinsp;46, p\u0026thinsp;=\u0026thinsp;0,7959, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe mRNA level of the TPH1 remains unchanged in the prefrontal cortex from control group to DEX group (-0,4 (-0,8; 0,6) vs 0,1 (-0,8; 0,8), U\u0026thinsp;=\u0026thinsp;47, p\u0026thinsp;=\u0026thinsp;0,8534, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003emRNA expression of TPH2 does not differ in the prefrontal cortex from control group to DEX group (-0,3 (-1,0; 0,7) vs 0,2 (-0,7; 0,6), U\u0026thinsp;=\u0026thinsp;37, p\u0026thinsp;=\u0026thinsp;0,3527, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eAlso mRNA expression of TH stays at the same level in the prefrontal cortex from control group to DEX group (-0,3 (-0,7; 1,0) vs -0,1 (-0,8; 0,5), U\u0026thinsp;=\u0026thinsp;47, p\u0026thinsp;=\u0026thinsp;0,8534, Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Effect of DEX on mRNA expression of MAOA, MAOB, COMT in CNS\u003c/h2\u003e\u003cp\u003eThe mRNA expression level of MAOA rises in the striatum from control group to DEX group (0,8 (0,3; 1,0) vs -0,6 (-0,8; -0,3), U\u0026thinsp;=\u0026thinsp;2, p\u0026thinsp;=\u0026thinsp;0,0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003eThere is decrease in MAO B mRNA expression in the striatum from control group to DEX group (-0,02 (-0,3; 0,2) vs -0,5 (-0,9; -0,4), U\u0026thinsp;=\u0026thinsp;10, p\u0026thinsp;=\u0026thinsp;0,0015, Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eThe mRNA expression level of COMT remains unchanged in the striatum from control group to DEX group (-0,4 (-0,9; -0,1) vs -0,4 (-0,6; 0,4), U\u0026thinsp;=\u0026thinsp;42, p\u0026thinsp;=\u0026thinsp;0,5787, Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe level of mRNA expression MAOA increases in the hippocampus from control group to DEX group (-0,5 (-0,8; -0,3) vs 0,4 (0,3; 0,5), U\u0026thinsp;=\u0026thinsp;10, p\u0026thinsp;=\u0026thinsp;0,0015, Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003eThere is no differ in MAO B mRNA expression in the hippocampus from control group to DEX group (-0,3 (-0,6; 0,0) vs -0,4 (-0,4; -0,3), U\u0026thinsp;=\u0026thinsp;43, p\u0026thinsp;=\u0026thinsp;0,6305, Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eThere are no significant changes in COMT mRNA expression in the hippocampus from control group to DEX group (-0,5 (-1,0; 1,1) vs -0,1 (-0,6; 0,6), U\u0026thinsp;=\u0026thinsp;37, p\u0026thinsp;=\u0026thinsp;0,3527, Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe MAO A mRNA expression declines in the prefrontal cortex from control group to DEX group (0,9 (-0,1; 1,3) vs -0,3 (-0,5; -0,1), U\u0026thinsp;=\u0026thinsp;16, p\u0026thinsp;=\u0026thinsp;0,0089, Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003ea).\u003c/p\u003e\u003cp\u003eConversely, there is no difference in mRNA expression of MAO B in the prefrontal cortex from control group to DEX group (-0,3 (-0,7; -0,1) vs -0,4 (-0,6; -0,1), U\u0026thinsp;=\u0026thinsp;47, p\u0026thinsp;=\u0026thinsp;0,8534, Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003eb).\u003c/p\u003e\u003cp\u003eThere is decline in COMT mRNA expression in the prefrontal cortex from control group to DEX group (0,6 (-0,0; 1,2) vs -1,0 (-1,2; -0,7), U\u0026thinsp;=\u0026thinsp;2, p\u0026thinsp;=\u0026thinsp;0,0001, Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003ec).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eIn this study, we investigated the effect of a single intraperitoneal injection of DEX at a dose of 8 mg/kg on the content and metabolism of key monoamines and on the expression of mRNA of the major enzymes of monoamine metabolism. This research is important because GCs, particularly DEX, are widely used in the treatment of various diseases; however, the use of high doses of synthetic GCs, even in pulse therapy, leads to numerous side effects, the molecular mechanisms of which remain insufficiently studied [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. GC hormones and their synthetic analogs freely penetrate the BBB and, consequently, are capable of altering the development and functioning of the brain [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, the effects of GCs on the CNS must be studied and taken into account when prescribing GC therapy. It is widely accepted that GCs exert their effects through genomic mechanisms mediated by GR and MR, which directly bind to DNA, as well as through non-genomic mechanisms [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. For the CNS, among the mechanisms of GC action, their ability to interact with neurotransmitters and neurotrophic factors, thereby modulating the body's adaptive responses, should be highlighted [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. One well-documented aspect of GC action on the brain, particularly on the hippocampus, is an inverted U-shaped dose-response relationship [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. We note that the shape of this relationship is specific to different brain regions, meaning that the effect of GCs on CNS cells in different brain regions will vary even at the same administered dose [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and, certainly, the use of different doses will lead to different effects. For example, DEX at a dose of 0,7 mg/kg did not cause significant changes in the content and metabolic rate of dopamine and serotonin in the striatum and cortex but led to a decrease in serotonin in the hippocampus [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In this study, we tested how a single injection of DEX at a dose of 8 mg/kg affects neurotransmitter metabolism (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We have previously shown that a single injection of DEX at this dose stimulates GAP-43 mRNA and protein production in the rat hippocampus, leads to an increase in GAP-43 protein levels and calpain-2 activation in the striatum and prefrontal cortex of rats; however, calpain-2 protein production is increased in the striatum and decreased in the prefrontal cortex. Our data support the hypothesis that DEX can be used to enhance the production of GAP-43 and other proteins crucial for brain function, such as TH and calpains [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSince this dose affects TH expression, we hypothesized that in this case DEX would influence neurotransmitter metabolism. We discovered that in the striatum, DEX causes an increase in DA content, an increase in DOPAC and 5-HT (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), while a decrease in the rate of intra- and extracellular DA catabolism is observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). The likely reason for the changes we found lies in the effect of DEX on the expression of genes encoding monoamine metabolism enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). For example, the decreased rate of DA catabolism can be explained by our finding of reduced mRNA expression of MAOA and MAOB enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), and notably, a glucocorticoid response element (GRE) binding site is known to exist in the MAOA promoter (Supplement 1). The increase in DA is likely associated with increased TH expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], in whose promoter a functional GR binding site has also been identified (Supplement 1). The decrease in 5-HT in the striatum correlates with a decrease in TPH1 mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), which, although considered peripheral, also contributes to brain DEX 5-HT synthesis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn the hippocampus, in response to DEX administration, no changes in DA levels or its metabolites were recorded (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), the DA conversion rate also remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), but an increase in 5-HT content and a decrease in its metabolite 5-HIAA were recorded (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), along with a decreased 5-HT conversion rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) and an increase in MAOA mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e) without changes in TPH1, TPH2, or TH mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Our observations recorded an increase in MAOA mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e), which would typically be expected to lead to accelerated 5-HT breakdown. However, the decreased 5-HIAA content indicates that the actual metabolism of 5-HT does not increase but rather decreases, which might be associated with regional specificity of enzymatic activity or post-transcriptional mechanisms. For instance, the decrease in 5-HT catabolism rate we observed in the hippocampus could be additionally mediated by the effect of DEX on other, minor, metabolic enzymes. In particular, phenol sulfotransferase (EC 2.8.2.1) (gene SULT1A3) plays a significant role in the sulfation and inactivation of DA and 5-HT in the CNS. Bian and colleagues indicate that the SULT1A3 gene is a direct GC regulatory gene, due to the presence of a GRE in its promoter (Supplement 1) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRegion-specific activity of SULT1A3 could also play a role: possibly, DEX does not induce SULT1A3 in the hippocampus or even temporarily suppresses its activity, which would contribute to 5-HT accumulation.\u003c/p\u003e\u003cp\u003eIn the prefrontal cortex, we observed a two-fold decrease in NE and HVA (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), an increased DA conversion rate (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e), and a decrease in MAOA and COMT mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e), which might be linked to the action of DEX as a regulator of the expression of these enzymes' genes at the genomic level (Supplement 1). However, DEX administration did not affect the expression of TPH1, TPH2, or TH mRNA.\u003c/p\u003e\u003cp\u003eThe data we obtained are summarized in Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eSuch pronounced and multidirectional regional effects are not unexpected, given the complex and context-dependent role of GR and MR receptors [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. For instance, Mifsud and colleagues demonstrated that in the rodent hippocampus, the two types of stress receptors (GR and MR) bind to different DNA sites [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. This explains their differential influence on gene activity across various brain regions. This kind of multidirectional modulation of the monoaminergic system is also consistent with observations by Bray and colleagues, who showed that local infusion of corticosterone into the ventral hippocampus differentially affected DA release in the nucleus accumbens of intact animals (enhanced it) versus animals after psychostimulant withdrawal (suppressed it). These differences were associated with changes in the state of the hippocampo-striatal regulatory loop and the context-dependent action of GR and MR. Study showed that infusion of corticosterone into the ventral hippocampus or stress-induced activation increased 5-HT release and promoted potential excitability of glutamatergic neurons (GLUT) while suppressing inhibitory GABAergic (GABA) neurons via actions on GR and MR (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Collectively, these findings and our data confirm that GR activation by DEX in different brain structures can exert opposing influences on dopaminergic transmission, depending on regional receptor specificity and the state of neuronal networks.\u003c/p\u003e\u003cp\u003eRegion-specific modulation of monoamines across various CNS structures is further supported by the existence of functional connections between the hippocampus, cortex, and striatum via glutamatergic (GLUT) pathways [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. As we discussed previously, the activation of GLUT neurons in the hippocampus under the influence of GCs may contribute to the redistribution and altered levels of catecholamines in other brain areas through the propagation of GLUT activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eOur data align well with the concept of a U-shaped dose-response curve for G) effects in the hippocampus. Under moderate MR activation, neurotransmitter systems remain balanced: levels of DA, 5-HT, and NE are maintained at baseline, which helps the brain adapt to stress and preserve cognitive functions.\u003c/p\u003e\u003cp\u003eAt high GC doses, GR activation DA, leading to impairments. We observed an accumulation of DA and 5-HT alongside a decrease in their metabolites, despite increased MAOA expression, indicating disrupted catabolism of these neurotransmitters (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e). This effect manifests region-specifically: the hippocampus and striatum respond differently, likely due to varying activity of enzymes, including minor ones like SULT1A3. Furthermore, hippocampal GLUT neurons under high GC doses may enhance signaling to the cortex and striatum, altering local monoamine levels.\u003c/p\u003e\u003cp\u003eThus, comprehensive investigation of the cerebral effects of DEX is imperative for modern translational medicine. Deciphering the signaling pathways mediating both therapeutic and adverse effects, particularly those concerning neurotransmitter balance, will enable a shift from empirical application to personalized therapy and the development of adjuvant neuroprotective strategies. For instance, DEX could potentially be incorporated into treatment regimens for Parkinson's disease due to its ability to increase striatal DA. Leveraging the knowledge gained, it may be possible to create a new generation of selective GR modulators devoid of the limitations inherent in current pharmacotherapy.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eThe study revealed that a single high-dose DEX administration (8 mg/kg) exerts complex and region-specific effects on the monoaminergic systems of the rat brain. The observed multidirectional changes in the levels of DA, 5-HT, and their metabolites in the striatum, hippocampus, and prefrontal cortex are associated with modulation of the mRNA expression of key enzymes involved in their synthesis and catabolism (TH, MAO, COMT, TPH). The data obtained are consistent with the concept of a U-shaped dose-response relationship between GCs effects and highlight the key role of GR activation in altering neurotransmitter balance. These results are important for understanding the molecular mechanisms of GC-induced side effects and offer prospects for developing safer treatment strategies. Based on our data, we recommend further in-depth studies of dexamethasone as a potential antiparkinsonian drug.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCNS – Central Nervous System\u003c/p\u003e\n\u003cp\u003eDEX – Dexamethasone\u003cbr\u003e\u0026nbsp;GC – Glucocorticoids\u003cbr\u003e\u0026nbsp;GR – Glucocorticoid Receptor\u003c/p\u003e\n\u003cp\u003eGRE – Glucocorticoid Response Element\u003c/p\u003e\n\u003cp\u003eMR – Mineralocorticoid Receptor\u003cbr\u003e\u0026nbsp;BBB – Blood–Brain Barrier\u003cbr\u003e\u0026nbsp;DNA – Deoxyribonucleic Acid\u003cbr\u003e\u0026nbsp;mRNA – Messenger Ribonucleic Acid\u003cbr\u003e\u0026nbsp;qRT-PCR – Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction\u003cbr\u003e\u0026nbsp;PPIA – Peptidyl-Prolyl Isomerase A\u003c/p\u003e\n\u003cp\u003ePGK1 – Phosphoglycerate Kinase 1\u003cbr\u003e\u0026nbsp;HPLC – High-Performance Liquid Chromatography\u003c/p\u003e\n\u003cp\u003eDA – Dopamine\u003cbr\u003e\u0026nbsp;NE – Norepinephrine\u003cbr\u003e\u0026nbsp;5-HT – Serotonin, 5-hydroxytryptamine\u003cbr\u003e\u0026nbsp;DOPAC – 3,4-Dihydroxyphenylacetic Acid\u003cbr\u003e\u0026nbsp;HVA – Homovanillic Acid\u003cbr\u003e\u0026nbsp;5-HIAA – 5-Hydroxyindoleacetic Acid\u003c/p\u003e\n\u003cp\u003eTH – Tyrosine 3‑monooxygenase\u003cbr\u003e\u0026nbsp;TPH1 – Tryptophan Hydroxylase 1\u003cbr\u003e\u0026nbsp;TPH2 – Tryptophan Hydroxylase 2\u003cbr\u003e\u0026nbsp;MAOA – Monoamine Oxidase A\u003cbr\u003e\u0026nbsp;MAOB – Monoamine Oxidase B\u003cbr\u003e\u0026nbsp;COMT – Catechol-O-Methyltransferase\u003c/p\u003e\n\u003cp\u003eHPK – Hippocampus\u003cbr\u003e\u0026nbsp;VHPK – Ventral Hippocampus\u003cbr\u003e\u0026nbsp;STR – Striatum\u003cbr\u003e\u0026nbsp;PFC – Prefrontal Cortex\u003c/p\u003e\n\u003cp\u003eGLUT – Glutamatergic Neurons\u003c/p\u003e\n\u003cp\u003eGABA – Gamma-Aminobutyric Acid (GABAergic) neurons\u003c/p\u003e\n\u003cp\u003eRN – Reverse signaling Neurons\u003c/p\u003e\n\u003cp\u003eEDTA – Ethylenediaminetetraacetic Acid\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work is supported by project ID: \u003cstrong\u003eFGWG-2025-0016\u003c/strong\u003e of the Federal State Budgetary Scientific Institution \u0026lsquo;Institute of Experimental Medicine\u0026rsquo;, St. Petersburg, Russia.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTiutiunnik TV: Methodology, Validation, Investigation, Writing\u0026mdash;original draft, Data curation.\u003c/p\u003e\n\u003cp\u003eObukhova DA: Methodology, Writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eVilnikova VA: Methodology, Writing \u0026ndash; review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003eMuruzheva ZM: Conceptualization, Validation.\u003c/p\u003e\n\u003cp\u003eKarpenko MN: Writing \u0026ndash; review \u0026amp; editing, Supervision, Funding acquisition, Conceptualization, Validation.\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were performed in accordance with institutional guidelines and the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals as well as national laws (Ministry of Health of the Russian Federation N267, June 19, 2003; Guide for the Use of Laboratory Animals, Moscow, 2005) and permission of the Local Ethical Committee for this research Federal State Budgetary Scientific Institution \u0026ldquo;Institute of Experimental Medicine\u0026rdquo; of St. Petersburg № 2/23 from 15.06.2023.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMcMahon D, Oakden W, Hynynen K (2020) Investigating the effects of dexamethasone on blood-brain barrier permeability and inflammatory response following focused ultrasound and microbubble exposure. Theranostics 10(4):1604\u0026ndash;1618. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/thno.40908\u003c/span\u003e\u003cspan address=\"10.7150/thno.40908\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGarcia-Gomara M, Juan-Palencia A, Alfaro M, Cuadrado-Tejedor M, Garcia-Osta A (2024) Neuroprotective Effects of Dexamethasone in a Neuromelanin-Driven Parkinson's Disease Model. J neuroimmune pharmacology: official J Soc NeuroImmune Pharmacol 20(1):2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11481-024-10164-4\u003c/span\u003e\u003cspan address=\"10.1007/s11481-024-10164-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCruz-Topete D, Cidlowski JA (2015) One hormone, two actions: anti- and pro-inflammatory effects of glucocorticoids. Neuroimmunomodulation 22(1\u0026ndash;2):20\u0026ndash;32. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1159/000362724\u003c/span\u003e\u003cspan address=\"10.1159/000362724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMcEwen BS (2003) Interacting mediators of allostasis and allostatic load: Towards an understanding of resilience in aging. Metabolism 52(10 Suppl 2):10\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0026-0495(03)00295-6\u003c/span\u003e\u003cspan address=\"10.1016/s0026-0495(03)00295-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRoozendaal B, Griffith QK, Buranday J, De Quervain DJ, McGaugh JL (2003) The hippocampus mediates glucocorticoid-induced impairment of spatial memory retrieval: Dependence on the basolateral amygdala. Proc Natl Acad Sci USA 100(3):1328\u0026ndash;1333. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0337480100\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0337480100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaynes LE, Griffiths MR, Hyde RE, Barber DJ, Mitchell IJ (2001) Dexamethasone induces limited apoptosis in the developing rat striatum and the cultured human foetal neocortex. Brain Res 918(1\u0026ndash;2):60\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0306-4522(01)00070-7\u003c/span\u003e\u003cspan address=\"10.1016/S0306-4522(01)00070-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGray JD, Kogan JF, Marrocco J, McEwen BS (2017) Genomic and epigenomic mechanisms of glucocorticoids in the brain. Nat Reviews Endocrinol 13(11):661\u0026ndash;673. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrendo.2017.97\u003c/span\u003e\u003cspan address=\"10.1038/nrendo.2017.97\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTiutiunnik TV, Kudrinskaya VM, Obukhova DA, Vilnikova VA, Burdinskaya VO, Muruzheva Z, Karpenko MN (2025) Intraperitoneal Single Injection of Dexamethasone Leads to Region-Specific Changes in the Profile of Neuron-Specific Proteins in the Rat Brain. Eur J Neurosci 61(10):e70146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ejn.70146\u003c/span\u003e\u003cspan address=\"10.1111/ejn.70146\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaul CA, Beltz B, Berger-Sweeney J (2008) The Nissl stain: A stain for cell bodies in brain sections. CSH Protocols 2008(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1101/pdb.prot4805\u003c/span\u003e\u003cspan address=\"10.1101/pdb.prot4805\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. pdb.prot4805\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaxinos G, Watson C (2013) The rat brain in stereotaxic coordinates: Hard cover edition. Academic\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/gb-2002-3-7-research0034\u003c/span\u003e\u003cspan address=\"10.1186/gb-2002-3-7-research0034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. research0034.1\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMar JC, Kimura Y, Schroder K, Irvine KM, Hayashizaki Y, Suzuki H, Hume D, Quackenbush J (2009) Data-driven normalization strategies for high-throughput quantitative RT-PCR. BMC Bioinformatics 10:110. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2105-10-110\u003c/span\u003e\u003cspan address=\"10.1186/1471-2105-10-110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEachus H, Ryu S (2024) Glucocorticoid effects on the brain: from adaptive developmental plasticity to allostatic overload. J Exp Biol 227(Suppl1):jeb246128. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jeb.246128\u003c/span\u003e\u003cspan address=\"10.1242/jeb.246128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWalker DJ, Spencer KA (2018) Glucocorticoid programming of neuroimmune function. Gen Comp Endocrinol 256:80\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ygcen.2017.07.016\u003c/span\u003e\u003cspan address=\"10.1016/j.ygcen.2017.07.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTimmermans S, Souffriau J, Libert C (2019) A General Introduction to Glucocorticoid Biology. Front Immunol 10:1545. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2019.01545\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2019.01545\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWr\u0026oacute;bel A, Nowak G, Ossowska G, Danilczuk Z, Zebrowska-Łupina I, Wielosz M (2004) Effect of chronic treatment with dexamethasone on brain dopamine receptors in mice. Pol J Pharmacol 56(4):399\u0026ndash;405\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIasevoli F, Aloj L, Latte G, Avvisati L, Marmo F, Tomasetti C, Buonaguro EF, Simeoli C, Pivonello R, Colao A, de Bartolomeis A (2013) The glucocorticoid analog dexamethasone alters the expression and the distribution of dopamine receptors and enkephalin within cortico-subcortical regions. Curr Mol Pharmacol 6(3):149\u0026ndash;155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2174/18744672060314041521594\u003c/span\u003e\u003cspan address=\"10.2174/18744672060314041521594\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInoue T, Koyama T (1996) Effects of acute and chronic administration of high-dose corticosterone and dexamethasone on regional brain dopamine and serotonin metabolism in rats. Prog Neuro-psychopharmacol Biol Psychiatry 20(1):147\u0026ndash;156. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0278-5846(95)00299-5\u003c/span\u003e\u003cspan address=\"10.1016/0278-5846(95)00299-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKorewo-Labelle D, Karnia MJ, Myślińska D, Kaczor JJ (2023) Supplementation with Vitamin D3 Protects against Mitochondrial Dysfunction and Loss of BDNF-Mediated Akt Activity in the Hippocampus during Long-Term Dexamethasone Treatment in Rats. Int J Mol Sci 24(18):13941. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms241813941\u003c/span\u003e\u003cspan address=\"10.3390/ijms241813941\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLanshakov DA, Sukhareva EV, Bulygina VV, Bannova AV, Shaburova EV, Kalinina TS (2021) Single neonatal dexamethasone administration has long-lasting outcome on depressive-like behaviour, Bdnf, Nt-3, p75ngfr and sorting receptors (SorCS1-3) stress reactive expression. Sci Rep 11(1):8092. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-021-87652-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-021-87652-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJo\u0026euml;ls M (2006) Corticosteroid effects in the brain: U-shape it. Trends Pharmacol Sci 27(5):244\u0026ndash;250. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tips.2006.03.007\u003c/span\u003e\u003cspan address=\"10.1016/j.tips.2006.03.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbumaria N, Ribic A, Anacker C, Fuchs E, Fl\u0026uuml;gge G (2008) Stress upregulates TPH1 but not TPH2 mRNA in the rat dorsal raphe nucleus: identification of two TPH2 mRNA splice variants. Cell Mol Neurobiol 28(3):331\u0026ndash;342. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10571-007-9259-5\u003c/span\u003e\u003cspan address=\"10.1007/s10571-007-9259-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBian HS, Ngo SY, Tan W, Wong CH, Boelsterli UA, Tan TM (2007) Induction of human sulfotransferase 1A3 (SULT1A3) by glucocorticoids. Life Sci 81(25\u0026ndash;26):1659\u0026ndash;1667. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2007.09.029\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2007.09.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKoning ACAM, Buurstede JC, van Weert LTCM, Meijer OC (2019) Glucocorticoid and Mineralocorticoid Receptors in the Brain: A Transcriptional Perspective. J Endocr Soc 3(10):1917\u0026ndash;1930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/js.2019-00158\u003c/span\u003e\u003cspan address=\"10.1210/js.2019-00158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDaskalakis NP, Meijer OC, de Kloet ER (2022) Mineralocorticoid receptor and glucocorticoid receptor work alone and together in cell-type-specific manner: Implications for resilience prediction and targeted therapy. Neurobiol stress 18:100455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ynstr.2022.100455\u003c/span\u003e\u003cspan address=\"10.1016/j.ynstr.2022.100455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMifsud KR, Kennedy CLM, Salatino S, Sharma E, Price EM, Haque SN, Gialeli A, Goss HM, Panchenko PE, Broxholme J, Engledow S, Lockstone H, Cordero Llana O, Reul JMHM (2021) Distinct regulation of hippocampal neuroplasticity and ciliary genes by corticosteroid receptors. Nat Commun 12(1):4737. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-24967-z\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-24967-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBray B, Clement KA, Bachmeier D, Weber MA, Forster GL (2020) Corticosterone in the ventral hippocampus differentially alters accumbal dopamine output in drug-na\u0026iuml;ve and amphetamine-withdrawn rats. Neuropharmacology 165:107924. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2019.107924\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2019.107924\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eM\u0026eacute;nard C, Hodes GE, Russo SJ (2016) Pathogenesis of depression: Insights from human and rodent studies. Neuroscience 321:138\u0026ndash;162. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuroscience.2015.05.053\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroscience.2015.05.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSj\u0026ouml;berg RL, Ducci F, Barr CS, Newman TK, Dell'osso L, Virkkunen M, Goldman D (2008) A non-additive interaction of a functional MAO-A VNTR and testosterone predicts antisocial behavior. Neuropsychopharmacology: official publication Am Coll Neuropsychopharmacol 33(2):425\u0026ndash;430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.npp.1301417\u003c/span\u003e\u003cspan address=\"10.1038/sj.npp.1301417\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHagerty T, Morgan WW, Elango N, Strong R (2001) Identification of a glucocorticoid-responsive element in the promoter region of the mouse tyrosine hydroxylase gene. J Neurochem 76(3):825\u0026ndash;834. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1471-4159.2001.00072.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1471-4159.2001.00072.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClark JA, Flick RB, Pai LY, Szalayova I, Key S, Conley RK, Deutch AY, Hutson PH, Mezey E (2008) Glucocorticoid modulation of tryptophan hydroxylase-2 protein in raphe nuclei and 5-hydroxytryptophan concentrations in frontal cortex of C57/Bl6 mice. Mol Psychiatry 13(5):498\u0026ndash;506. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/sj.mp.4002041\u003c/span\u003e\u003cspan address=\"10.1038/sj.mp.4002041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBian HS, Ngo SY, Tan W, Wong CH, Boelsterli UA, Tan TM (2007) Induction of human sulfotransferase 1A3 (SULT1A3) by glucocorticoids. Life Sci 81(25\u0026ndash;26):1659\u0026ndash;1667. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2007.09.029\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2007.09.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Dexamethasone, dopamine, serotonin, hippocampus, striatum, prefrontal cortex, neurotransmitter imbalance","lastPublishedDoi":"10.21203/rs.3.rs-8185277/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8185277/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSynthetic glucocorticoids (GCs), such as dexamethasone (DEX), are widely used in therapy; however, their administration at high doses may be associated with effects on the central nervous system, particularly on neurotransmitter systems, yet the molecular mechanisms underlying these phenomena remain poorly understood. In this study, we investigated the effects of a single intraperitoneal administration of DEX (8 mg/kg) on the metabolism of key monoamines and the expression of their metabolic enzymes in various rat brain regions (striatum, hippocampus, and prefrontal cortex) using high-performance liquid chromatography (HPLC) and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR). We found that DEX exerts a pronounced, region-specific impact on neurotransmitter systems. In the striatum, DEX increased dopamine (DA) and serotonin (5-HT) levels while simultaneously reducing their catabolism, which was associated with decreased messenger ribonucleic acid (mRNA) expression of monoamine oxidase A (MAOA) and monoamine oxidase B (MAOB) and increased expression of tyrosine 3‑monooxygenase (TH). In the hippocampus, DEX elevated serotonin levels and reduced its turnover despite an increase in MAOA mRNA expression, suggesting the potential involvement of post-transcriptional regulation or minor metabolic enzymes. In the cortex, DEX induced a two-fold reduction in norepinephrine (NE) and its metabolite, as well as a decrease in MAOA and COMT mRNA expression. This study highlights the importance of considering region-specific cerebral effects of GCs for the development of personalized therapeutic and neuroprotective strategies, including the potential use of DEX in conditions such as Parkinson\u0026rsquo;s disease due to its ability to elevate striatal DA levels.\u003c/p\u003e","manuscriptTitle":"Single Intraperitoneal Injection of Dexamethasone Alerts Region-specific Neurotransmitter Metabolism in Rat Brain ","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-12 08:03:36","doi":"10.21203/rs.3.rs-8185277/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-26T07:55:44+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-26T07:52:20+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-23T13:46:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"197669738570286132701795881826161933602","date":"2025-12-21T06:08:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"95600330933094959318908608195795291288","date":"2025-12-11T11:08:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-09T05:09:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-02T18:53:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-28T05:05:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Neurochemical Research","date":"2025-11-23T11:57:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"neurochemical-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nere","sideBox":"Learn more about [Neurochemical Research](https://www.springer.com/journal/11064)","snPcode":"11064","submissionUrl":"https://submission.nature.com/new-submission/11064/3","title":"Neurochemical Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3af4dda4-3d64-418d-bea8-75d3db55a076","owner":[],"postedDate":"December 12th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-09T16:00:50+00:00","versionOfRecord":{"articleIdentity":"rs-8185277","link":"https://doi.org/10.1007/s11064-026-04718-6","journal":{"identity":"neurochemical-research","isVorOnly":false,"title":"Neurochemical Research"},"publishedOn":"2026-03-04 15:57:03","publishedOnDateReadable":"March 4th, 2026"},"versionCreatedAt":"2025-12-12 08:03:36","video":"","vorDoi":"10.1007/s11064-026-04718-6","vorDoiUrl":"https://doi.org/10.1007/s11064-026-04718-6","workflowStages":[]},"version":"v1","identity":"rs-8185277","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8185277","identity":"rs-8185277","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00