Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis Huiying Qi, Huijuan Cao, Yajie Zhao, Yaqin Cao, Qide Jin, Yeping Wang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2219024/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Jan, 2023 Read the published version in Frontiers in Zoology → Version 1 posted 5 You are reading this latest preprint version Abstract Background Molting is an important physiological process in the growth and development of arthropoda, which is mainly regulated by juvenile hormone and ecdysone. CYP302A1 is a key enzyme which plays a critical role in the synthesis of ecdysone in insects, but it has not been identified in cladocera. Results The CYP302Al gene of D. sinensis was cloned and its function was analyzed in this paper. The CYP302Al gene of D. sinensis was 5926 bp in full-length, with an open reading frame (ORF) of 1596 bp that encoded 531 amino acids, a molecular weight of 60.82 kDa and an isoelectric point of 9.29. The amino acid sequence analysis revealed that there were five characteristic conserved regions of cytochrome P450 family (namely helix-C, helix-K, helix-I, PERF and heme-binding). In dsRNA mediated experiment, the expression level of CYP302A1 gene decreased significantly (knock-down of 56.22%) in the 5% Escherichia coli concentration treatment. In addition, the expression levels of EcR and USP and HR3 genes in the downstream decreased also significantly, whereas that of FTZ -f1 gene increased significantly. In the 5% E. coli concentration treatment, the molting time at first pregnancy of D. sinensis prolonged, and the development of embryos in the incubation capsule appeared abnormal or disintegrated. The whole-mount in situ hybridization showed that the CYP302A1 gene of D. sinensis had six expression sites before RNA interference (RNAi), which located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spine. However, the expression signal of the CYP302A1 gene of D. sinensis disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi. Conclusions In conclusion, the CYP302A1 gene played an important role in the ecdysone synthesis pathway of D. sinensis , and the knock-down of the gene affected the molting and reproduction of D. sinensis . Background During the life history of cladocera (e.g. Daphnia ), their growth and molting are alternately [ 1 ]. The molting action runs through their whole life cycle, and it is a necessary step before they grow and reproduce [ 2 ]. Molting is a result of long-term evolution in arthropod, which are regulated by many factors [ 3 ]. In crustacean ecdysis, ecdysteroid is the most important regulatory factor, which the expression levels vary among species [ 4 ]. Among ecdysones, 20-hydroxyecdysone (20E) is one of the more active hormones in insects [ 5 ]. Moreover, ecdysone can not only regulate the molting physiology in arthropods, but also play important roles in their growth, reproduction and phenotypic plasticity [ 6 , 7 , 8 , 9 , 10 ]. The synthetic pathway of ecdysone has been extensively studied in insects [ 11 , 12 ]. Usually, the synthesis of insect ecdysone is divided into two stages. Firstly, the cholesterol in food was digested and absorbed through the intestine, and then transported to the prothymus (PG) by hemolymph. The cholesterol was transformed to 5β-diketol (3D2, 22, 25dE) under the catalysis of both Neverland and CYP307A1 gene [ 13 , 14 , 15 ]. Secondly, the 5β-diketol was converted to inactive ecdysterone catalyzed by various cytochrome P450s ( CYP306Al , CYP302Al , and CYP315Al ) [ 16 , 17 , 18 , 19 ]. The inactive ecdysone could be also converted to 20-hydroxyecdysone (20E) under the catalysis of the CYP314A1 gene [ 20 ]. Among them, the CYP307A1 ( Spook , Spo ), CYP306A1 ( Phantom , Phm ), CYP302A1 ( Disembodied , DIB ), CYP315A1 ( Shadow , Sad ) and CYP314A1 ( Shade , Shd ) gene are referred to as the Halloween genes. The 20E mediates its biological activities through the ecdysone receptor (EcR) complex, a heterodimer consisting of two nuclear hormone receptors, EcR and the retinoid X receptor homologue Ultraspiracle (USP) [ 21 ]. It can regulate the downstream primary genes ( E75 , Br-C , E74 and E93 ) [ 22 ] and secondary response genes ( HR3 , HR4 , HR 38 and E78 ), and then regulate the expressions of terminal genes through FTZ -f1 gene [ 23 ]. In Drosophila , the transcript levels of Phm and DIB dropped significantly with the loss of FTZ -f1 function in PG cells [ 24 ]. In Daphnia magna , the Neverland , CYP314A1 and CYP307A1 genes had been identified, and their functions had been analyzed [ 25 , 26 , 27 ]. However, the gene expression and functional analysis of CYP302A1 , CYP306A1 and CYP315A1 in cladocera (including Daphnia ) have not been explored. As one of the key genes in insect ecdysone synthesis, CYP302A1 that can catalyze the carbon-22 hydroxylase is a member of the mitochondrial cytochrome P450 family [ 28 , 29 , 30 , 31 ]. Chavez et al. (2000) found that inactive ecdysone and 20-hydroxyecdysone (20E) hadlower titers in the CYP302A1 ( DIB ) mutant embryos of Drosophila , and two 20E-inducible genes ( IMP-E1 and L1 ) failed to express in some tissues, resulting in anaphase abnormality in morphology. After RNAi in Sogatella furcifera and Laodelphax striatellus , the expression levels of both CYP302A1 gene and ecdysone receptor gene ( EcR ) decreased significantly, and the development and death time of nymphs delayed [ 31 ]. In spatio-temporal expression profiling of Bombyx mori , CYP302A1 gene showed a higher expression in the ovary, testis and head of the larvae [ 32 ]. A few investigations have reported on the genes related to the ecdysone synthesis pathway of cladocera [ 33 , 25 , 26 , 27 ], but the molecular mechanisms of ecdysone synthesis pathway and ecdysone signal transduction pathway need still to be further revealed. The study on molecular biology of Daphnia species has become a hot spot, with the successive reports on the genome of Daphnia pulex and D. magna [ 34 , 35 ]. In this study, based on the transcriptome, real-time PCR and RNAi technologies, the CYP302A1 gene cloning, and the changes of downstream response gene expressionsand individual phenotypic characteristics after know-down of the gene were analyzed in D. sinensis . Meanwhile, the function of the CYP302A1 gene was discussed. Moreover, the expression sites of the CYP302A1 gene in D. sinensis was also detected by whole mount in situ hybridization technique. Our results will help to clarify the ecdysone synthesis pathway of Daphnia species, and provide a reference for the future study of ecdysis-related signaling pathways. Results Sequence and phylogenetic analysis of CYP302A1 gene The full-length of the CYP302A1 gene in D. sinensis is 5926 bp with the open reading frame (ORF) of 1596 bp, which encodes 531 amino acids. The molecular formula of its protein is C 2743 H 4344 N 750 O 778 S 17 , with a molecular weight of 60.82 kDa and an isoelectric point of 9.29. Moreover, there is no signal peptide sequence and transmembrane domain in the CYP302A1 gene. Compared with other arthropods, the CYP302A1 gene of D. sinensis had the highest homology with Tigriopus japonicus (45.99%). In the amino acid sequence of the CYP302A1 gene, there were five characteristic conserved domains (namely, helix-C, helix-K, helix-I, PERF and heme binding) (Fig. 1 ). The phylogenetic tree indicated that D. sinensis was the most closely related to the Daphnia species, followed by Tetranychus cinnabarinus (Fig. 2 ). Induced expression of dsRNA (dup: abstract ?) 1% Agarose gel electrophoresis showed that the L4440 vector plasmid and L4440-EGFP were about 150 bp and 900 bp in size, respectively (Fig. 3 -A), and the L4440-DIB recombinant plasmid was about 1000 bp (Fig. 3 -B). mRNA expression of the CYP302A1 gene after RNAi Compared with the control treatment, the mRNA expression levels of the CYP302A1 gene of D. sinensis in the 5% and 10% E. coli treatments decreased by 68.34% and 23.32%, respectively (Fig. 4 and Fig. 5 ). Under the 5% E. coli concentration, the expression levels of EcR , USP and HR3 genes in the downstream decreased significantly, whereas the expression levels of FTZ -f1 gene increased significantly (Fig. 4 ). Under the 10% E. coli concentration, there was no significant difference between E10-DIB treatment and E10-EGFP treatment. Moreover, the expression levels of USP and HR3 genes in the downstream decreased whereas that of the FTZ -f1 gene increased, however, no significant differences were observed (Fig. 5 ). These results indicated that the dsRNA-DIB containing 5% E. coli concentration inhibited significantly the expression level of the CYP302A1 gene in D. sinensis whereas the interference efficiency was low under higher E. coli concentration (10%). Phenotypic changes of D. sinensis after RNAi Compared with the E5-EGFP treatment, both no. eggs at first pregnancy and no. offspring at first reproduction of D. sinensis were bigger than those in the E5-DIB treatment. Moreover, no. eggs at first pregnancy of D. sinensis at the twelfth day of the experiment was significantly biggerthan one in the E5-DIB treatment (Fig. 6 ). However, both the molting times at pregnancy and at first reproduction of D. sinensis in the E5-EGFP treatment were shorter than those in the E5-DIB treatment (Fig. 6 ). Positioning analysis of the CYP302A1 gene in D. sinensis Whole mount in situ hybridization showed that the CYP302A1 gene in D. sinensis had six expression sites, which respectively located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and spines (Fig. 7 A). After RNAi, the expression signal of the CYP302A1 gene disappeared in the first antennal ganglion of D. sinensis , and the expression signal at the ovary was also greatly attenuated (Fig. 7 B). Similarly, the expression sites of the CYP302A1 gene in D. sinensis was not detected in the negative control experiment (Fig. 7 C). Discussion Ecdysone is synthesized under the catalyzation of a series of cytochrome P450 family coding enzymes in arthropods, which can regulate basic physiological processes such as molting and reproduction in arthropods [ 14 , 29 , 33 ]. The cytochrome P450 family is an ancient gene family that exists in almost all organisms [ 38 , 39 ]. Although the amino acid sequences of the cytochrome P450 family member have high variability, a certain conservative domain are still found. In insects, conserved domains include helix-C, helix-I, helix-K, PERF and heme-binding [ 13 ]. In this study, the CYP302A1 gene of D. sinensis contained also the above five conserved domains, indicating that CYP302A1 gene belonged to the cytochrome P450 family. In recent years, with the developmentof RNAi technology [ 40 ], RNAi has been widely used in the study of biological gene function [ 41 , 42 ]. Using chitin synthase gene A ( SeCHSA ) as the target gene, the growth and development of Spodoptera exigua larvae fed by E. coli containing dsRNA of SeCHSA was disturbed, and then the mortality rates in the 5th instar larvae increased significantly [ 43 ]. After either feeding or injecting dsRNA of the sex-determining gene Transformer-2 to Zeugodacus scutellata , the Transformer-2 gene were all silenced, and increased significantly the number of male among their offspring [ 44 ]. Through RNAi to the appendage terminal Distal-less ( Dll ) gene of D. magna , it was found that the appendage terminal was deficient [ 45 ]. In this study, the expression levels of the CYP302A1 gene decreased significantly (knock-down of 68.34%) in the 5% E. coli treatment, whereas it was only knock-down of 23.32% in the 10% E. coli treatment, indicating that the silencing effect at the lower E. coli concentration was better than at higher concentration. This phenomenon was also observed in other Daphnia species [ 46 , 47 ]. Therefore, the optimal concentration and time of silencing target genes can depend on different experimental animals or genes. After injecting dsRNAs of CYP307A2 and CYP314A1 genes, the development of the ovaries in female adults of Agasicles hygrophila delayed, and the egg production dropped significantly, and the expression level of vitellogenin gene ( Vg ) down-regulated significantly [ 48 ]. Similarly, when injected with dsRNA of the CYP315A1 gene, the adult ovary in Plutella xylostella became smaller and mature eggs decreased, and the cumulative number of eggs also decreased significantly [ 49 ]. In this study, the expression levels of the ecdysone receptor EcR gene and the USP gene in D. sinensis belonging to the downstream response genes of ecdysone decreased significantly after RNAi. Moreover, the knock-down of the CYP302A1 gene resulted in a significant decrease in the expression level of the downstream HR3 gene, but no significant effect on E75 gene was observed. During the experiment, the destruction of these downstream genes could result in some aborted eggs or dead embryos of D. sinensis in the incubation capsule. Hannas et al (2014) also found that the ecdysone could significantly affect the expression level of HR3 gene but less effect on E75 gene [ 50 ]. In this study, the knock-down of the CYP302A1 gene increased significantly the expression level of the FTZ -f1 gene in D. sinensis . Usually, FTZ-f1 is mainly responsible for regulating the expression of upstream CYP302A1 , CYP306A1 and CYP315A1 genes in Drosophila ecdysone signal transduction [ 30 ]. Therefore, our results strongly supported that the CYP302A1 gene is an ecdysone synthesis pathway gene in D. sinensis , affecting the molting and reproduction of Daphnia . Rewitz et al. (2006) found that the ecdysone synthesis pathway gene CYP302A1 of the tobacco hawkmoth was mainly expressed in the prethymocytes during the larval stage whereas it was detected in the fat body, midgut, ganglia, Malpighian tubules and epidermis in animals after the fifth ecdysis [ 51 ]. In this study, the CYP302A1 gene in D. sinensis had mainly six expression sites, which located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spines. However, only expression signal of the CYP302A1 gene in the first ganglion of D. sinensis disappeared after RNAi. Moreover, the expression signals in the ovary weakened greatly. Usually, the first antennae is an important trait for the reproductive transformation of cladocera. Therefore, the CYP302A1 gene can be involved in the reproductive transformation of D. sinensis . It was also consistent with the aborted eggs or dead embryos in the incubation capsule of D. sinensis under the 5% E. coli concentration. Sumiya et al. (2014, 2016) found that both Neverland1 and CYP314A1 are involved in the synthesis of ecdysone in D. magna , and intestinal epithelial cells were responsible for this synthesis [ 25 , 26 ]. Usually, the cecum is located in the left and right sides of the front end of the midgut in cladocera, with a pair of ear-like appendages. In this study, the expression site of the CYP302A1 gene at the cecum of D. sinensis is consistent with other studies [ 25 , 26 ]. It was likely that the cecum in D. sinensis was an important synthesis and secretion site of ecdysone, and some sites of the thoracic limb and tail spine began to express the CYP302A1 gene during the ecdysis. In conclusion, the CYP302A1 gene in D. sinensis was a gene related to synthesis of the ecdysone, which would play an important role in the molting and reproduction of cladoceran. Conclusions Molting is an important physiological process in the life history of cladocera, which is mainly regulated by juvenile hormone and ecdysone. CYP302A1 is the key enzyme which plays a critical role in the synthesis of ecdysone of insects, but it has not been identified in cladocera. In this study, the CYP302A1 genewas also found in D. sinensis . The amino acid sequence analysis revealed that the CYP302A1 gene of D. sinensis had five characteristic conserved regions of cytochrome P450 family, namely, helix-C, helix-K, helix-I, PERF and heme-binding. In dsRNA mediated experiment, the expression level of the CYP302A1 gene decreased significantly in the 5% E. coli treatment. Meanwhile, the expression levels of EcR , USP and HR3 genes in the downstream decreased also significantly whereas that of FTZ-f1 gene increased significantly. Moreover, the development of embryos in the incubation capsule of D. sinensis appeared abnormal or disintegrated. The whole-mount in situ hybridization indicated that the CYP302A1 gene of D. sinensis had six expression sites (namely the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spine) before RNAi. However, the expression signal of the CYP302A1 gene of D. sinensis disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi. Our results suggested that the CYP302A1 gene could play an important role in the ecdysone synthesis pathway of D. sinensis . Materials and Methods D. sinensis culture D. sinensis were obtained from the hatching of resting eggs in the sediments of Lake Chaohu, China. The individual was monoclonally cultured in an intelligent light incubator at 25°C, with a 12 h: 12 h light/dark cycle. The culture medium was changed every day, and D. sinensis were fed with 2×10 5 cells/mL of Tetradesmus obliquus . The culture medium was filtered and aerated tap water over 48 h. RNA extraction and first-strand cDNA synthesis 50 female adults of D. sinensis were collected and stored in 100 µL RNAlater (Biosharp, Hefei, China) in 1.7 mL tubes, and total RNA were extracted by the MiniBEST universal RNA kit (TaKaRa, Dalian, China).The quality and purity of RNA was measured using a NanoDrop spectrophotometer (MD2000D, Biofuture, England) and Agarose electrophoresis. The first-strand cDNA was synthesized using the PrimeScript™RT kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions, and then stored at -80°C. Sequence and phylogenetic analysis of CYP302A1 gene The full-length CYP302A1 gene was obtained by sequencing, splicing and functional annotation of the D. sinensis transcriptome in our previous investigations.The open reading frame of the nucleotide sequence of the CYP302A1 gene was analyzed using the online prediction tool ORF finder ( https://www.ncbi.nlm.nih.gov/orffinder ), and the amino acid sequence was obtained. The amino acid deduction analysis and alignment of the CYP302A1 gene were performed by DNAMAN software, and the phylogenetic tree was constructed by MAGA 11.0 software. Isoelectric point analysis were executed using ExPASy ProtParam ( https://web.expasy.org/protparam ). Signal peptide and transmembrane region in protein were respectively predicted using Signal 4.1 Server ( http://www.cbs.dtu.dk/services/SignalP-4.1 ) and TMHMM ( http://www.cbs.Dtu.dk/services/TMHMM ). Induced expression of dsRNA The primers were designed according to the transcriptome data and EGFP plasmid sequence (Table 1 ).The PCR program was as follows: 95°C for 3 min, 95°C for 15 s, 55–60°C for 15 s, and 72°C for 40 s, followed by 35 cycles, and 72°C for 5 min. PCR products were detected by a 1% agarose gelelectrophoresis. PCR products of DIB/EGFP were subcloned into the pEASY-Blunt3 cloning vector (TransGen, Beijing, China) and sequenced (General Biol, Nanjing, China).After sequencing, the expression vectors L4440 and pEASY-Blunt3-DIB/EGFP plasmid were digested using restriction enzymes BamH I and Xho I (TaKaRa, Dalian, China), and then ligated. The L4440 vector contains two T7 promoters which can be induced by isopropyl β-D-1-thiogalactopyranoside (IPTG) to produce dsRNA of the sequence ligated between these promoters. The L4440 constructs were transformed into E. coli DH5α cells (Sangon Biotech, Shanghai, China), and the vector was confirmed by sequencing (General Biol, Nanjing, China). After sequencing, the L4440-DIB plasmid was transformed into E. coli HT115 cells (a strain deficient in RNase III and an efficient production for dsRNAs). The transformed cells were cultured overnight in LB medium containing ampicillin (100 µg/mL, Sangon Biotech, Shanghai, China) and tetracycline (12.5 µg/mL, Sangon Biotech, Shanghai, China) for the CYP302A1 RNAi experiments. Isopropyl IPTG (1.0 mM, Sangon Biotech, Shanghai, China) was added to induce the T7 RNA polymerase and subsequent production of dsRNA of the target sequence. The expression of dsRNA was detected by 1% agarose gel electrophoresis. The primers used in the experiments were listed in Table 1 . Table 1 Names and sequences of primers used in the experiment Primer name Forward (5'-3') Reverse (5'-3') DIB CGC GGATCC GAAGCGACTAATGCAATCGC CCG CTCGAG TTCGGGACCGTTTGTTGGA EGFP CGC GGATCC ATGGTGAGCAAGGGCGAGG CCG CTCGAG TTACTTGTACAGCTCGTCCATGCCG qDIB ATACTTCGGACGGATAATG CAACGCAATACTCTCAATG qEGFP CGCACCATCTTCTTCAAG GTGGCTGTTGTAGTTGTAC EcR GAGGCGCTGCAGGCTTAC GAGTTTGGCAAACTCCGTCATC USP GTTGGAGTCAAGGATGGTATCGT AGCCGAGTTCCGGTGGAT E75 TCCGGAGAAGTATTCAACAAAAGA TGCGAAGAATGGAGCACTGT HR3 AGTCATCACCTGCGAGGGC GAACTTTGCGACCGCCG FTZ- f1 ATCGTGCAAGGGATTCTTCA ATCAGCGACGCAAGAATAGG GAPDH TCGTCTCCAATGCTTCTT CGGTCCATCAACAGTCTT Note: DIB and EGFP are interference primer, the other primers are qPCR primer, and the underlines of forward and reverse primer are the restriction endonuclease sequence. RNAi feeding protocol Four food treatments were selected for the experiments, namely, E5-EGFP: 5% E. coli HT115 containing L4440-EGFP + 95% T. obliquus ; E5-DIB: 5% E. coli HT115 containing L4440-DIB + 95% T. obliquus ; E10-EGFP: 10% E. coli HT115 containing L4440-EGFP + 90% T. obliquus ; E10-DIB: 10% E. coli HT115 containing L4440-DIB + 90% T. obliquus . There were three replicates at each food treatment. Total food biomass was 20 mg/L wet weigh. 15 animals (birth time < 12 h) in each replicate were employed as the mother. During the experiment, all newborns produced by the mother were immediately removed. All mothers in each replicate were collected at the twelfth day after feeding, placed in a 1.7 mL tube containing 100 µL RNAlater and stored in a refrigerator at 4℃ for 12 h, and then transferred to an ultra-low temperature refrigerator at -80℃. After RNAi, the expression levels of related genes were determined by qPCR, and the relative expression levels of target genes was calculated by 2 −△△ Ct. The life history parameters of the four growth stages (at birth, at first pregnancy, at first reproduction and at the twelfth days) were observed and recorded during the experiment. Whole mount in situ hybridization In order to prepare probes for in situ hybridization according to the ORF of the CYP302A1 gene, the sequences of specific primers were designed as follows: ISH-DIB-Forward: CGCGGATCCGAGCTTTATACTGTATCATCTTGCC, ISH-DIB-Reverse: CCGCTCGAGGACTCTTTTACTGCAGCCTTTAGAT, with a length of 150 bp. Target fragment was synthesized according to the primer sequence. After sequencing, the positive clone bacteria were amplified and cultured, and then the Blunt3-ISH-DIB vector plasmid was extracted. The concentration and purity of the plasmid were determined by a NanoDrop spectrophotometer (MD2000D, Biofuture). The linearized plasmid was obtained through restricted digestion of BamH I or Xho I, and the digested DNA fragments were purified and used as templates for sense and antisense probes, respectively. RNA probes were synthesized through DIG RNA Labeling Kit (SP6/SP7) (Roche, USA), and then digested the probe cDNA template using DNase (RNase-free). In addition, a 1/9 volume of 5 M LiCl and 2 volumes of absolute ethanol were added, and were incubated overnight at -20°C. RNA pellets was washed twice with 75% ethanol, and then dried to remove residual ethanol. Finally, RNA pellets was re-suspended in 30 µL diethylpyrocarbonate water, which1 µL RNA inhibitor (20 U) were added. Aliquots of RNA solutions (1 µL) were added and electrophoresed, and the concentrations were measured. Remaining RNA probes were stored at -20°C. According to theRNAi feeding protocol, 50 female adults of D. sinensis were collected. All samples were fixed in 4% paraformaldehyde (PFA) overnight, and then were replaced by anhydrous methanol and remained at -20°C. Whole-mount in situ hybridization was carried out according to previously published methods [ 36 , 37 ] with some modifications. The specimens stored at -20°C were rehydrated gradually with methanol-PBST and digested with proteinase K (10 µg/mL, Solarbio, Beijing, China). The individuals were digested at 37°C for 12 min. Afterpre-hybridization at 68°C for 2.5 h, 100 µL RNA probe which was diluted 1: 100 was added and incubated at 70°C overnight. The specimens were blocked for approximately 2 h at room temperature with slow shaking in MAB block solution, and then added anti-DIG antibody (diluted 1: 5000; Roche, USA) and incubated at 4°C for 13 h. Finally, antibody solution was discarded and the specimens were washed in MABT. At room temperature, the NBT liquid dye (Roche, USA) was used to shade the color for 15 min-2 h, and then the individuals were fixed in 4% PFA for 20 min. Hybridization was observed with a fluorescence microscope (Olympus, CX21). Acknowledge The L4440 vector and HT115 of E. coli were presented by Professor Liu Fengsong who came from Hebei University. Declarations Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Funding This work was supported by the Funds of the National Natural Science Fund of China [31870451, 31370470, 32001155]. Author contributions Qi HY: Conceptualization, Methodology, Investigation, Writing-Original Draft, Writingand Editing. Cao HJ, Zhao YJ, Cao YQ, Jin QD, Wang YP: Validation, Data Curation. Zhang K: conception, revision of the manuscript. Deng DG: Review and Editing, Supervision, Project, Conceptualization, and Funding acquisition. All authors read andapproved the final manuscript. References Jiang XZ, Du NS. Fauna sinica: Crustacean-freshwater Cladocera. Beijing: Science Press; 1979. Li XG, Zhou G, Gu XH. Review of aquatic crustaceans molting and its influencing factors. Chin J Zool. 2014;49(2):294–302. Loeb MJ. Hormonal control of growth and reproduction in the arthropods: introduction to the symposium. American Zoologist. 1993;33:303–307. Mykles DL. Ecdysteroid metabolism in crustaceans. J Steroid Biochem Mol Biol. 2011;127(3–5):196–203. Li Z, Ge X, Ling L, Zeng BS, Xu J, Aslam AFM, You L, Palli SR, Huang YP, Tan AJ. CYP18A1 regulates tissue-specific steroid hormone inactivation in Bombyx mori . Insect Biochem Mol Biol. 2014;54:33–41. Kumar S, Chen D, Jang C, Nall A, Zheng XZ, Sehgal A. An ecdysone-responsive nuclear receptor regulates circadian rhythms in Drosophila . Nat Commun. 2014;5:5697. Wen R, Zhao Q, Wang B, Ma Y, Ma L. Molecular characterization and functional analysis of USP-1 by RNA interference in the Asian gypsy moth Lymantria dispar . J Forestry Res. 2019;31(5):449–57. Muramatsu M, Tsuji T, Tanaka S, Shiotsuki T, Jouraku A, Miura K, Mifom VI, Minakuchi C. Sex-specific expression profiles of ecdysteroid biosynthesis and ecdysone response genes in extreme sexual dimorphism of the mealybug, Planococcus kraunhiae (Kuwana). PLoS ONE. 2020;15(4):e0231451. Suzuki T, Iwami M. Sequential changes in the regulatory mechanism of carbohydrate digestion in larvae of the silkworm, Bombyx mori . J Comp Physiol B. 2021;191:439–53. Swall ME, Benrabaa S, Tran NM, Tran TD, Ventura T, Mykles DL. Characterization of Shed genes encoding ecdysone 20-monooxygenase (CYP314A1) in the Y-organ of the blackback land crab, Gecarcinus lateralis . Gen Comp Endocrinol. 2021;301:113658. Niwa YS, Niwa R. Transcriptional regulation of insect steroid hormone biosynthesis and its role in controlling timing of molting and metamorphosis. Dev Growth Differ. 2016;58(1):94–105. Lin MT, Lu JH, Wang Y, Yuan DJ. Insect ecdysone-mediated molting and metamorphosis development. Chem life. 2022;42(1):63–70. Chavez VM, Marques G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. The Drosophila disembodied gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development. 2000;127(19):4115–26. Warren JT, Petryk A, Marqués G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of Drosophila melanogaster . Proceedings of the National Academy of Sciences. 2002;99(17):11043–11048. Petryk A, Warren JT, Marques G, Jarcho MP, Gilbert LI, Kahler J, Parvy JP, Li Y, Dauphin-Villemant C, O'Connor M B. Shade is the Drosophila P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proceedings of the National Academy of Sciences. 2003;100(24):13773–13778. Niwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. CYP306A1 , a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of Bombyx and Drosophila . J Biol Chem. 2004;279(34):35942–9. Warren JT, Petryk A, Marqués G, Parvy JP, Shinoda T, Itoyama K, Kobayashi J, Jarcho M, Li Y, O'Connor MB, Dauphin-Villemant C. Phantom encodes the 25-hydroxylase of Drosophila melanogaster and Bombyx mori : a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol. 2004;34(9):991–1010. Yoshiyama T, Namiki T, Mita K, Kataoka H, Niwa R. Neverland is an evolutionally conserved rieske-domain protein that is essential for ecdysone synthesis and insect growth. Development. 2006;133(13):2565–74. Niwa R, Namiki T, Ito K, Shimada-Niwa Y, Kiuchi M, Kawaoka S, Kayukawa T, Banno Y, Fujimoto Y, Shigenobu S, Kobayashi S. Non-molting glossy/shroud encodes a short-chain dehydrogenase/reductase that functions in the 'black box' of the ecdysteroid biosynthesis pathway. Development. 2010;137(12):1991–9. Yoshiyama-Yanagawa T, Enya S, Shimada-Niwa Y, Yaguchi S, Haramoto Y, Matsuya T, Shiomi K, Sasakura Y, Takahashi S, Asashima M, Kataoka H. The conserved rieske oxygenase daf-36/neverland is a novel cholesterol-metabolizing enzyme. J Biol Chem. 2011;286(29):25756–62. Yao TP, Segraves WA, Oro AE, McKeown M, Evans RM. Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell. 1992;71(1):63–72. Regulation of transcription. factors MHR4 and betaFTZ-F1 by 20-hydroxyecdysone during a larval molt in the tobacco hornworm, Manduca sexta . Dev Biol. 2001;232(1):265–74. Zhu J, Li C, Sun G, Raikhel AS. The competence factor βFTZ-F1 potentiates ecdysone receptor activity via recruiting a p160/SRC coactivator. Mol Cell Biol. 2006;26(24):9402–12. Parvy JP, Blais C, Bernard F, Warren JT, Petryk A, Gilbert LI, O'Connor MB, Dauphin-Villemant C. A role for betaFTZ-F1 in regulating ecdysteroid titers during post-embryonic development in Drosophila melanogaster. Dev Biol. 2005;282(1):84–94. Sumiya E, Ogino Y, Miyakawa H, Hiruta C, Toyota K, Miyagawa S, Iguchi T. Roles of ecdysteroids for progression of reproductive cycle in the fresh water crustacean Daphnia magna . Front Zool. 2014;11(1):60. Sumiya E, Ogino Y, Toyota K, Miyakawa H, Miyagawa S, Iguchi T. Neverland regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea Daphnia magna , and may thus act as a target for chemical disruption of molting. J Appl Toxicol. 2016;36(11–12):1476–85. Adhitama N, Kato Y, Matsuura T, Watanabe H. Roles of and cross-talk between ecdysteroid and sesquiterpenoid pathways in embryogenesis of branchiopod crustacean Daphnia magna . PLoS ONE. 2020;15(10):e0239893. Iga M, Smagghe G. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in Spodoptera littoralis . Peptides. 2010;31(3):456–67. Gilbert LI. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster . Mol Cell Endocrinol. 2004;215(1–2):1–10. Niwa R, Sakudoh T, Namiki T, Saida K, Fujimoto Y, Kataoka H. The ecdysteroidogenic P450 Cyp302a1 / disembodied from the silkworm, Bombyx mori , is transcriptionally regulated by prothoracicotropic hormone.Insect Molecular Biology. 2005;14(5):563–571. Wan PJ, Jia S, Li N, Fan JM, Li GQ. RNA interference depletion of the Halloween gene disembodied implies its potential application for management of planthopper Sogatella furcifera and Laodelphax striatellus . PLoS ONE. 2014;9(1):e86675. Cheng DJ, Li ZQ, Meng M, Peng J, Qian WL, Kang LX, Xia QY. Characterization of cytochrome P450 genes involving in ecdysteroido genesis in Silkworm ( Bombyx mori ). Scientia Agricultura Sinica. 2014;47(3):594–604. Rewitz KF, Gilbert LI. Daphnia Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. BMC Evolutionary Biology.2008;8:60. Cristescu MEA, Colbourne JK, Radivojac J, Lynch M. A microsatellite-based genetic linkage map of the waterflea, Daphnia pulex : on the prospect of crustacean genomics. Genomics. 2006;88(4):415–30. Routtu J, Jansen B, Colson I, De Meester L, Ebert D. The first-generation Daphnia magna linkage map. BMC Genomics. 2010;11(1):1–7. Liu A, Zhang M, Kong L, Wu D, Weng X, Wang D, Zhao Y. Cloning and expression profiling of a cuticular protein gene in Daphnia carinata . Dev Genes Evol. 2014;224(3):129–35. Kong L, Li HX, Wu DL, Xu GR, Wang DL, Zhao YL. Molecular characterization of the gene checkpoint homolog in Daphnia carinata during different reproductive phases. Genet Mol Res. 2016;15(2):1–13. Nelson DR. Metazoan cytochrome P450 evolution. Comparative Biochemistry and Physiology-Part C: Pharmacology, Toxicology and Endocrinology. 1998;121(1):15–22. Baldwin WS, Marko PB, Nelson DR. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex . BMC Genomics. 2009;10:169. Matzke MA, Birchler JA. RNAi-mediated pathways in the nucleus. Nat Rev Genet. 2005;6(1):24–35. Hiruta C, Toyota K, Miyakawa H, Ogino Y, Miyagawa S, Tatarazako N, Shaw RJ, Iguchi T. Development of a microinjection system for RNA interference in the water flea Daphnia pulex . BMC Biotechnol. 2013;13(1):1–7. Shi M, Liu XN, Ma J. RNA interference of antifreeze protein gene in Tenebrio molitor mediated by bacterially expressed dsRNA. Biotechnol Bull. 2014;30(8):113–9. Tian H, Peng H, Yao Q, Chen H, Xie Q, Tang B, Zhang W. Developmental control of a Lepidopteran pest Spodoptera exigua by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS ONE. 2009;4(7):e6225. Al Baki M, Vatanparast M, Kim Y. Male-biased adult production of the striped fruit fly, Zeugodacus scutellata , by feeding dsRNA specific to Transformer-2 . Insects. 2020;11(4):e211. Kato Y, Shiga Y, Kobayashi K, Tokishita SI, Yamagata H, Iguchi T, Watanabe H. Development of an RNA interference method in the cladoceran crustacean Daphnia magna . Dev Genes Evol. 2011;220:337–45. Schumpert CA, Dudycha JL, Patel RC. Development of an efficient RNA interference method by feeding for the microcrustacean Daphnia . BMC Biotechnol. 2015;15(1):1–3. Eytcheson SA, LeBlanc GA. Hemoglobin levels modulate nitrite toxicity to Daphnia magna . Sci Rep. 2018;8(1):1–8. Liu YR, Zhang H, Jin JS, Zhou ZS, Guo JY. Identification and expression analysis of the Halloween gene family in Agasicles hygrophila . Scientia Agricultura Sinica. 2020;53(10):2009–19. Wang L. Identification and functional analysis of Halloween genes in Plutella xylostella . Fujian Agriculture and Forestry University; 2018. Hannas BR, Leblanc GA. Expression and ecdysteroid responsiveness of the nuclear receptors HR3 and E75 in the crustacean Daphnia magna . Mol Cell Endocrinol. 2010;315(1–2):208–18. Rewitz KF, Rybczynski R, Warren JT, Gilbert LI. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta . Insect Biochem Mol Biol. 2006;36(3):188–99. Unsectioned Figure Details A Fig. 1 Homology comparison of amino acid sequences of the CYP302A1 gene in D. sinensis with other arthropods Note: Underlines are the conserved domain of helix-C, helix-I, helix-K, PERF and heme binding. A Fig. 2 Phylogenetictrees of the CYP302A1 gene in D. sinensis A Fig. 3 Induced expression of L4440-DIB and L4440-EGFP fragments Note: A: Induced expression levels of HT115 strain carrying L4440-EGFP recombinant plasmid and L4440 vector plasmid; B: Induced expression level of HT115 strain carrying l4440-DIB recombinant plasmid; M: DNA molecular weight standard; 1: HT115 strain carrying L4440 vector plasmid was not induced; 2: induced product of HT115 strain carrying L4440 vector plasmid; 3: HT115 strain carrying l4440-EGFP recombinant plasmid was not induced; 4: induced product of HT115 strain carrying l4440-EGFP recombinant plasmid; 5: HT115 strain carrying l4440-DIB recombinant plasmid was not induced; 6: Induced product of HT115 strain carrying l4440-DIB recombinant plasmid. A Fig. 5 TheqPCR results of molting gene CYP302A1 and its downstream response gene in D. sinensis fed by 10% E. coli concentration Note: E10 (EGFP): 10% E. coli concentration containing L4440-EGFP; E10 (DIB): 10% E. coli concentration containing L4440-DIB. A A Fig. 4 qPCR results of ecdysis gene CYP302A1 and its downstream response gene in D. sinensis fed by 5% E. coli concentration Note: E5-EGFP: 5% E. coli concentration containing L4440-EGFP; E5-DIB: 5% E. coli concentration containing L4440-DIB. * stands for P <0.05; ** stands for P <0.01. A Fig. 5q PCR results of ecdysisgene CYP302A1 and its downstream response gene in D. sinensis fed by 10% E. coli concentration Note: E10-EGFP: 10% E. coli concentration containing L4440-EGFP; E10-DIB: 10% E. coli concentration containing L4440-DIB. A Fig. 6 No. offspring at first reproduction, and no. eggs and molting time at two growth stages of D. sinensis after RNAi A Fig. 7 Expression sites of the CYP302A1 gene in D. sinensis Note: Blue is the positive signal; A: in situ hybridization map of D. sinensis without RNAi (antisense probe); B: in situ hybridization map of D. sinensis after RNAi (antisense probe); C: negative control (sense probe); D1: first antennal nerve; D2: ovary; D3: gastric coeca; D4: olfactory hair; D5: thoracic limb; D6: spine. Unsectioned Paragraphs Cite Share Download PDF Status: Published Journal Publication published 12 Jan, 2023 Read the published version in Frontiers in Zoology → Version 1 posted Editorial decision: Major revision 11 Dec, 2022 Reviewers agreed at journal 26 Nov, 2022 Reviewers invited by journal 08 Nov, 2022 Editor assigned by journal 31 Oct, 2022 First submitted to journal 30 Oct, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2219024","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":150390567,"identity":"155c1167-1865-417b-832f-dc18d7c5a0c0","order_by":0,"name":"Huiying Qi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYBACAwbGBoYEIINN/vHBBwkVNaRoYUhLNnhw5hgxWuAgx0zyYQszYS3mEsltEg931Mr2MRxLq0hsYGPgb+9OwKvFckZim0TimePGbYzNx24k7pBhkDhzdgN+h90AaWk7ltjGzJZ2I/EMG4OBRC6xWth4zAqAGonWUpPYxsNjxkCcljMPmy0S2w4Yt0mwJUsknDnGQ9gvx9Mf3vzZVic7fwbzwY8/Kmrk+Nt78WsBAhYJBobDwAiFAB5CykGA+QMDQx1cyygYBaNgFIwCDAAA0cBOie2REnMAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-2147-2018","institution":"Huaibei Normal University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Huiying","middleName":"","lastName":"Qi","suffix":""},{"id":150390568,"identity":"15e39d47-3490-419d-abae-859708e21e62","order_by":1,"name":"Huijuan Cao","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Huijuan","middleName":"","lastName":"Cao","suffix":""},{"id":150390569,"identity":"e2281d79-f41f-46af-9f64-315ae751b036","order_by":2,"name":"Yajie Zhao","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yajie","middleName":"","lastName":"Zhao","suffix":""},{"id":150390570,"identity":"d33edc45-a547-4d92-bf68-d5e1ac80209b","order_by":3,"name":"Yaqin Cao","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yaqin","middleName":"","lastName":"Cao","suffix":""},{"id":150390571,"identity":"57e3d92a-d3b7-43fe-822a-c9474cf31132","order_by":4,"name":"Qide Jin","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Qide","middleName":"","lastName":"Jin","suffix":""},{"id":150390572,"identity":"21bef9d9-5ffb-4282-b648-7721dd258f21","order_by":5,"name":"Yeping Wang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yeping","middleName":"","lastName":"Wang","suffix":""},{"id":150390573,"identity":"046577a9-09f8-466c-960b-316676023d35","order_by":6,"name":"Kun Zhang","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kun","middleName":"","lastName":"Zhang","suffix":""},{"id":150390574,"identity":"c9da34de-1c0c-413f-b45c-e268d6a44a82","order_by":7,"name":"Daogui Deng","email":"","orcid":"","institution":"Huaibei Normal University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Daogui","middleName":"","lastName":"Deng","suffix":""}],"badges":[],"createdAt":"2022-10-30 15:57:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2219024/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2219024/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12983-023-00483-2","type":"published","date":"2023-01-12T18:18:19+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":44716967,"identity":"5ee62f62-3141-4bf5-897e-c5b0a401b75a","added_by":"auto","created_at":"2023-10-16 18:31:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":345453,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2219024/v1/505c2ac8-cd21-4ffd-82ce-14d225513554.pdf"}],"financialInterests":"","formattedTitle":"Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis","fulltext":[{"header":"Background","content":"\u003cp\u003eDuring the life history of cladocera (e.g. \u003cem\u003eDaphnia\u003c/em\u003e), their growth and molting are alternately [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The molting action runs through their whole life cycle, and it is a necessary step before they grow and reproduce [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Molting is a result of long-term evolution in arthropod, which are regulated by many factors [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In crustacean ecdysis, ecdysteroid is the most important regulatory factor, which the expression levels vary among species [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Among ecdysones, 20-hydroxyecdysone (20E) is one of the more active hormones in insects [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Moreover, ecdysone can not only regulate the molting physiology in arthropods, but also play important roles in their growth, reproduction and phenotypic plasticity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe synthetic pathway of ecdysone has been extensively studied in insects [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Usually, the synthesis of insect ecdysone is divided into two stages. Firstly, the cholesterol in food was digested and absorbed through the intestine, and then transported to the prothymus (PG) by hemolymph. The cholesterol was transformed to 5β-diketol (3D2, 22, 25dE) under the catalysis of both \u003cem\u003eNeverland\u003c/em\u003e and \u003cem\u003eCYP307A1\u003c/em\u003e gene [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Secondly, the 5β-diketol was converted to inactive ecdysterone catalyzed by various cytochrome P450s (\u003cem\u003eCYP306Al\u003c/em\u003e, \u003cem\u003eCYP302Al\u003c/em\u003e, and \u003cem\u003eCYP315Al\u003c/em\u003e) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The inactive ecdysone could be also converted to 20-hydroxyecdysone (20E) under the catalysis of the \u003cem\u003eCYP314A1\u003c/em\u003e gene [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Among them, the\u003cem\u003eCYP307A1\u003c/em\u003e (\u003cem\u003eSpook\u003c/em\u003e, \u003cem\u003eSpo\u003c/em\u003e), \u003cem\u003eCYP306A1\u003c/em\u003e (\u003cem\u003ePhantom\u003c/em\u003e, \u003cem\u003ePhm\u003c/em\u003e), \u003cem\u003eCYP302A1\u003c/em\u003e (\u003cem\u003eDisembodied\u003c/em\u003e, \u003cem\u003eDIB\u003c/em\u003e), \u003cem\u003eCYP315A1\u003c/em\u003e (\u003cem\u003eShadow\u003c/em\u003e, \u003cem\u003eSad\u003c/em\u003e) and \u003cem\u003eCYP314A1\u003c/em\u003e (\u003cem\u003eShade\u003c/em\u003e, \u003cem\u003eShd\u003c/em\u003e) gene are referred to as the Halloween genes. The 20E mediates its biological activities through the ecdysone receptor (EcR) complex, a heterodimer consisting of two nuclear hormone receptors, EcR and the retinoid X receptor homologue Ultraspiracle (USP) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. It can regulate the downstream primary genes (\u003cem\u003eE75\u003c/em\u003e, \u003cem\u003eBr-C\u003c/em\u003e, \u003cem\u003eE74\u003c/em\u003e and \u003cem\u003eE93\u003c/em\u003e) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and secondary response genes (\u003cem\u003eHR3\u003c/em\u003e, \u003cem\u003eHR4\u003c/em\u003e, \u003cem\u003eHR\u003c/em\u003e38 and \u003cem\u003eE78\u003c/em\u003e), and then regulate the expressions of terminal genes through \u003cem\u003eFTZ\u003c/em\u003e-f1 gene [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In \u003cem\u003eDrosophila\u003c/em\u003e, the transcript levels of \u003cem\u003ePhm\u003c/em\u003e and \u003cem\u003eDIB\u003c/em\u003e dropped significantly with the loss of \u003cem\u003eFTZ\u003c/em\u003e-f1 function in PG cells [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In \u003cem\u003eDaphnia magna\u003c/em\u003e, the \u003cem\u003eNeverland\u003c/em\u003e, \u003cem\u003eCYP314A1\u003c/em\u003e and \u003cem\u003eCYP307A1\u003c/em\u003e genes had been identified, and their functions had been analyzed [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the gene expression and functional analysis of \u003cem\u003eCYP302A1\u003c/em\u003e, \u003cem\u003eCYP306A1\u003c/em\u003e and \u003cem\u003eCYP315A1\u003c/em\u003e in cladocera (including \u003cem\u003eDaphnia\u003c/em\u003e) have not been explored.\u003c/p\u003e \u003cp\u003eAs one of the key genes in insect ecdysone synthesis, \u003cem\u003eCYP302A1\u003c/em\u003e that can catalyze the carbon-22 hydroxylase is a member of the mitochondrial cytochrome P450 family [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Chavez et al. (2000) found that inactive ecdysone and 20-hydroxyecdysone (20E) hadlower titers in the \u003cem\u003eCYP302A1\u003c/em\u003e (\u003cem\u003eDIB\u003c/em\u003e) mutant embryos of \u003cem\u003eDrosophila\u003c/em\u003e, and two 20E-inducible genes (\u003cem\u003eIMP-E1\u003c/em\u003e and \u003cem\u003eL1\u003c/em\u003e) failed to express in some tissues, resulting in anaphase abnormality in morphology. After RNAi in \u003cem\u003eSogatella furcifera\u003c/em\u003e and \u003cem\u003eLaodelphax striatellus\u003c/em\u003e, the expression levels of both \u003cem\u003eCYP302A1\u003c/em\u003e gene and ecdysone receptor gene (\u003cem\u003eEcR\u003c/em\u003e) decreased significantly, and the development and death time of nymphs delayed [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In spatio-temporal expression profiling of \u003cem\u003eBombyx mori\u003c/em\u003e, \u003cem\u003eCYP302A1\u003c/em\u003e gene showed a higher expression in the ovary, testis and head of the larvae [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. A few investigations have reported on the genes related to the ecdysone synthesis pathway of cladocera [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], but the molecular mechanisms of ecdysone synthesis pathway and ecdysone signal transduction pathway need still to be further revealed.\u003c/p\u003e \u003cp\u003eThe study on molecular biology of \u003cem\u003eDaphnia\u003c/em\u003e species has become a hot spot, with the successive reports on the genome of \u003cem\u003eDaphnia pulex\u003c/em\u003e and \u003cem\u003eD. magna\u003c/em\u003e [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In this study, based on the transcriptome, real-time PCR and RNAi technologies, the \u003cem\u003eCYP302A1\u003c/em\u003e gene cloning, and the changes of downstream response gene expressionsand individual phenotypic characteristics after know-down of the gene were analyzed in \u003cem\u003eD. sinensis\u003c/em\u003e. Meanwhile, the function of the \u003cem\u003eCYP302A1\u003c/em\u003e gene was discussed. Moreover, the expression sites of the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e was also detected by whole mount in situ hybridization technique. Our results will help to clarify the ecdysone synthesis pathway of \u003cem\u003eDaphnia\u003c/em\u003e species, and provide a reference for the future study of ecdysis-related signaling pathways.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eSequence and phylogenetic analysis of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe full-length of the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e is 5926 bp with the open reading frame (ORF) of 1596 bp, which encodes 531 amino acids. The molecular formula of its protein is C\u003csub\u003e2743\u003c/sub\u003eH\u003csub\u003e4344\u003c/sub\u003eN\u003csub\u003e750\u003c/sub\u003eO\u003csub\u003e778\u003c/sub\u003eS\u003csub\u003e17\u003c/sub\u003e, with a molecular weight of 60.82 kDa and an isoelectric point of 9.29. Moreover, there is no signal peptide sequence and transmembrane domain in the \u003cem\u003eCYP302A1\u003c/em\u003e gene. Compared with other arthropods, the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e had the highest homology with \u003cem\u003eTigriopus japonicus\u003c/em\u003e (45.99%). In the amino acid sequence of the \u003cem\u003eCYP302A1\u003c/em\u003e gene, there were five characteristic conserved domains (namely, helix-C, helix-K, helix-I, PERF and heme binding) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The phylogenetic tree indicated that \u003cem\u003eD. sinensis\u003c/em\u003e was the most closely related to the \u003cem\u003eDaphnia\u003c/em\u003e species, followed by \u003cem\u003eTetranychus cinnabarinus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e"},{"header":"Induced expression of dsRNA (dup: abstract ?)","content":"\u003cp\u003e1% Agarose gel electrophoresis showed that the L4440 vector plasmid and L4440-EGFP were about 150 bp and 900 bp in size, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-A), and the L4440-DIB recombinant plasmid was about 1000 bp (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e-B).\u003c/p\u003e \u003cp\u003e \u003cb\u003emRNA expression of the\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e \u003cb\u003egene after RNAi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCompared with the control treatment, the mRNA expression levels of the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e in the 5% and 10% \u003cem\u003eE. coli\u003c/em\u003e treatments decreased by 68.34% and 23.32%, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Under the 5% \u003cem\u003eE. coli\u003c/em\u003e concentration, the expression levels of \u003cem\u003eEcR\u003c/em\u003e, \u003cem\u003eUSP\u003c/em\u003e and \u003cem\u003eHR3\u003c/em\u003e genes in the downstream decreased significantly, whereas the expression levels of \u003cem\u003eFTZ\u003c/em\u003e-f1 gene increased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Under the 10% \u003cem\u003eE. coli\u003c/em\u003e concentration, there was no significant difference between E10-DIB treatment and E10-EGFP treatment. Moreover, the expression levels of \u003cem\u003eUSP\u003c/em\u003e and \u003cem\u003eHR3\u003c/em\u003e genes in the downstream decreased whereas that of the \u003cem\u003eFTZ\u003c/em\u003e-f1 gene increased, however, no significant differences were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003e). These results indicated that the dsRNA-DIB containing 5% \u003cem\u003eE. coli\u003c/em\u003e concentration inhibited significantly the expression level of the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e whereas the interference efficiency was low under higher \u003cem\u003eE. coli\u003c/em\u003e concentration (10%).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhenotypic changes of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e \u003cb\u003eafter RNAi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCompared with the E5-EGFP treatment, both no. eggs at first pregnancy and no. offspring at first reproduction of \u003cem\u003eD. sinensis\u003c/em\u003e were bigger than those in the E5-DIB treatment. Moreover, no. eggs at first pregnancy of \u003cem\u003eD. sinensis\u003c/em\u003e at the twelfth day of the experiment was significantly biggerthan one in the E5-DIB treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e). However, both the molting times at pregnancy and at first reproduction of \u003cem\u003eD. sinensis\u003c/em\u003e in the E5-EGFP treatment were shorter than those in the E5-DIB treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePositioning analysis of the\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e \u003cb\u003egene in\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e\u003c/p\u003e \u003cp\u003eWhole mount in situ hybridization showed that the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e had six expression sites, which respectively located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and spines (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). After RNAi, the expression signal of the \u003cem\u003eCYP302A1\u003c/em\u003e gene disappeared in the first antennal ganglion of \u003cem\u003eD. sinensis\u003c/em\u003e, and the expression signal at the ovary was also greatly attenuated (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Similarly, the expression sites of the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e was not detected in the negative control experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e7\u003c/span\u003eC).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eEcdysone is synthesized under the catalyzation of a series of cytochrome P450 family coding enzymes in arthropods, which can regulate basic physiological processes such as molting and reproduction in arthropods [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The cytochrome P450 family is an ancient gene family that exists in almost all organisms [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Although the amino acid sequences of the cytochrome P450 family member have high variability, a certain conservative domain are still found. In insects, conserved domains include helix-C, helix-I, helix-K, PERF and heme-binding [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In this study, the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e contained also the above five conserved domains, indicating that \u003cem\u003eCYP302A1\u003c/em\u003e gene belonged to the cytochrome P450 family.\u003c/p\u003e \u003cp\u003eIn recent years, with the developmentof RNAi technology [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], RNAi has been widely used in the study of biological gene function [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Using chitin synthase gene A (\u003cem\u003eSeCHSA\u003c/em\u003e) as the target gene, the growth and development of \u003cem\u003eSpodoptera exigua\u003c/em\u003e larvae fed by \u003cem\u003eE. coli\u003c/em\u003e containing dsRNA of \u003cem\u003eSeCHSA\u003c/em\u003e was disturbed, and then the mortality rates in the 5th instar larvae increased significantly [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. After either feeding or injecting dsRNA of the sex-determining gene \u003cem\u003eTransformer-2\u003c/em\u003e to \u003cem\u003eZeugodacus scutellata\u003c/em\u003e, the \u003cem\u003eTransformer-2\u003c/em\u003e gene were all silenced, and increased significantly the number of male among their offspring [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Through RNAi to the appendage terminal \u003cem\u003eDistal-less\u003c/em\u003e (\u003cem\u003eDll\u003c/em\u003e) gene of \u003cem\u003eD. magna\u003c/em\u003e, it was found that the appendage terminal was deficient [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. In this study, the expression levels of the \u003cem\u003eCYP302A1\u003c/em\u003e gene decreased significantly (knock-down of 68.34%) in the 5% \u003cem\u003eE. coli\u003c/em\u003e treatment, whereas it was only knock-down of 23.32% in the 10% \u003cem\u003eE. coli\u003c/em\u003e treatment, indicating that the silencing effect at the lower \u003cem\u003eE. coli\u003c/em\u003e concentration was better than at higher concentration. This phenomenon was also observed in other \u003cem\u003eDaphnia\u003c/em\u003e species [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Therefore, the optimal concentration and time of silencing target genes can depend on different experimental animals or genes. After injecting dsRNAs of \u003cem\u003eCYP307A2\u003c/em\u003eand \u003cem\u003eCYP314A1\u003c/em\u003e genes, the development of the ovaries in female adults of \u003cem\u003eAgasicles hygrophila\u003c/em\u003e delayed, and the egg production dropped significantly, and the expression level of vitellogenin gene (\u003cem\u003eVg\u003c/em\u003e) down-regulated significantly [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Similarly, when injected with dsRNA of the \u003cem\u003eCYP315A1\u003c/em\u003e gene, the adult ovary in \u003cem\u003ePlutella xylostella\u003c/em\u003e became smaller and mature eggs decreased, and the cumulative number of eggs also decreased significantly [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In this study, the expression levels of the ecdysone receptor \u003cem\u003eEcR\u003c/em\u003e gene and the \u003cem\u003eUSP\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e belonging to the downstream response genes of ecdysone decreased significantly after RNAi. Moreover, the knock-down of the \u003cem\u003eCYP302A1\u003c/em\u003e gene resulted in a significant decrease in the expression level of the downstream \u003cem\u003eHR3\u003c/em\u003e gene, but no significant effect on \u003cem\u003eE75\u003c/em\u003e gene was observed. During the experiment, the destruction of these downstream genes could result in some aborted eggs or dead embryos of \u003cem\u003eD. sinensis\u003c/em\u003e in the incubation capsule. Hannas et al (2014) also found that the ecdysone could significantly affect the expression level of \u003cem\u003eHR3\u003c/em\u003e gene but less effect on \u003cem\u003eE75\u003c/em\u003e gene [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. In this study, the knock-down of the \u003cem\u003eCYP302A1\u003c/em\u003e gene increased significantly the expression level of the \u003cem\u003eFTZ\u003c/em\u003e-f1 gene in \u003cem\u003eD. sinensis\u003c/em\u003e. Usually, \u003cem\u003eFTZ-f1\u003c/em\u003e is mainly responsible for regulating the expression of upstream \u003cem\u003eCYP302A1\u003c/em\u003e, \u003cem\u003eCYP306A1\u003c/em\u003e and \u003cem\u003eCYP315A1\u003c/em\u003e genes in \u003cem\u003eDrosophila\u003c/em\u003e ecdysone signal transduction [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Therefore, our results strongly supported that the \u003cem\u003eCYP302A1\u003c/em\u003e gene is an ecdysone synthesis pathway gene in \u003cem\u003eD. sinensis\u003c/em\u003e, affecting the molting and reproduction of \u003cem\u003eDaphnia\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eRewitz et al. (2006) found that the ecdysone synthesis pathway gene \u003cem\u003eCYP302A1\u003c/em\u003e of the tobacco hawkmoth was mainly expressed in the prethymocytes during the larval stage whereas it was detected in the fat body, midgut, ganglia, Malpighian tubules and epidermis in animals after the fifth ecdysis [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In this study, the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e had mainly six expression sites, which located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spines. However, only expression signal of the \u003cem\u003eCYP302A1\u003c/em\u003e gene in the first ganglion of \u003cem\u003eD. sinensis\u003c/em\u003e disappeared after RNAi. Moreover, the expression signals in the ovary weakened greatly. Usually, the first antennae is an important trait for the reproductive transformation of cladocera. Therefore, the \u003cem\u003eCYP302A1\u003c/em\u003e gene can be involved in the reproductive transformation of \u003cem\u003eD. sinensis\u003c/em\u003e. It was also consistent with the aborted eggs or dead embryos in the incubation capsule of \u003cem\u003eD. sinensis\u003c/em\u003e under the 5% \u003cem\u003eE. coli\u003c/em\u003e concentration. Sumiya et al. (2014, 2016) found that both \u003cem\u003eNeverland1\u003c/em\u003e and \u003cem\u003eCYP314A1\u003c/em\u003e are involved in the synthesis of ecdysone in \u003cem\u003eD. magna\u003c/em\u003e, and intestinal epithelial cells were responsible for this synthesis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Usually, the cecum is located in the left and right sides of the front end of the midgut in cladocera, with a pair of ear-like appendages. In this study, the expression site of the \u003cem\u003eCYP302A1\u003c/em\u003e gene at the cecum of \u003cem\u003eD. sinensis\u003c/em\u003e is consistent with other studies [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It was likely that the cecum in \u003cem\u003eD. sinensis\u003c/em\u003e was an important synthesis and secretion site of ecdysone, and some sites of the thoracic limb and tail spine began to express the \u003cem\u003eCYP302A1\u003c/em\u003e gene during the ecdysis. In conclusion, the \u003cem\u003eCYP302A1\u003c/em\u003e gene in \u003cem\u003eD. sinensis\u003c/em\u003e was a gene related to synthesis of the ecdysone, which would play an important role in the molting and reproduction of cladoceran.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eMolting is an important physiological process in the life history of cladocera, which is mainly regulated by juvenile hormone and ecdysone.\u003cem\u003eCYP302A1\u003c/em\u003e is the key enzyme which plays a critical role in the synthesis of ecdysone of insects, but it has not been identified in cladocera. In this study, the \u003cem\u003eCYP302A1\u003c/em\u003e genewas also found in \u003cem\u003eD. sinensis\u003c/em\u003e. The amino acid sequence analysis revealed that the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e had five characteristic conserved regions of cytochrome P450 family, namely, helix-C, helix-K, helix-I, PERF and heme-binding. In dsRNA mediated experiment, the expression level of the \u003cem\u003eCYP302A1\u003c/em\u003e gene decreased significantly in the 5% \u003cem\u003eE. coli\u003c/em\u003e treatment. Meanwhile, the expression levels of \u003cem\u003eEcR\u003c/em\u003e, \u003cem\u003eUSP\u003c/em\u003e and \u003cem\u003eHR3\u003c/em\u003e genes in the downstream decreased also significantly whereas that of \u003cem\u003eFTZ-f1\u003c/em\u003e gene increased significantly. Moreover, the development of embryos in the incubation capsule of \u003cem\u003eD. sinensis\u003c/em\u003e appeared abnormal or disintegrated. The whole-mount in situ hybridization indicated that the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e had six expression sites (namely the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spine) before RNAi. However, the expression signal of the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi. Our results suggested that the \u003cem\u003eCYP302A1\u003c/em\u003e gene could play an important role in the ecdysone synthesis pathway of \u003cem\u003eD. sinensis\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003col\u003e \u003cspan\u003e \u003cli\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e \u003cb\u003eculture\u003c/b\u003e\u003c/p\u003e \u003c/li\u003e \u003c/span\u003e \u003c/ol\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eD. sinensis\u003c/em\u003e were obtained from the hatching of resting eggs in the sediments of Lake Chaohu, China. The individual was monoclonally cultured in an intelligent light incubator at 25\u0026deg;C, with a 12 h: 12 h light/dark cycle. The culture medium was changed every day, and \u003cem\u003eD. sinensis\u003c/em\u003e were fed with 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL of \u003cem\u003eTetradesmus obliquus\u003c/em\u003e. The culture medium was filtered and aerated tap water over 48 h.\u003c/p\u003e"},{"header":"RNA extraction and first-strand cDNA synthesis","content":"\u003cp\u003e50 female adults of \u003cem\u003eD. sinensis\u003c/em\u003e were collected and stored in 100 \u0026micro;L RNAlater (Biosharp, Hefei, China) in 1.7 mL tubes, and total RNA were extracted by the MiniBEST universal RNA kit (TaKaRa, Dalian, China).The quality and purity of RNA was measured using a NanoDrop spectrophotometer (MD2000D, Biofuture, England) and Agarose electrophoresis. The first-strand cDNA was synthesized using the PrimeScript\u0026trade;RT kit (TaKaRa, Dalian, China) according to the manufacturer\u0026rsquo;s instructions, and then stored at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSequence and phylogenetic analysis of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe full-length \u003cem\u003eCYP302A1\u003c/em\u003e gene was obtained by sequencing, splicing and functional annotation of the \u003cem\u003eD. sinensis\u003c/em\u003e transcriptome in our previous investigations.The open reading frame of the nucleotide sequence of the \u003cem\u003eCYP302A1\u003c/em\u003e gene was analyzed using the online prediction tool ORF finder (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/orffinder\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/orffinder\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the amino acid sequence was obtained. The amino acid deduction analysis and alignment of the \u003cem\u003eCYP302A1\u003c/em\u003e gene were performed by DNAMAN software, and the phylogenetic tree was constructed by MAGA 11.0 software. Isoelectric point analysis were executed using ExPASy ProtParam (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://web.expasy.org/protparam\u003c/span\u003e\u003cspan address=\"https://web.expasy.org/protparam\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Signal peptide and transmembrane region in protein were respectively predicted using Signal 4.1 Server (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.dtu.dk/services/SignalP-4.1\u003c/span\u003e\u003cspan address=\"http://www.cbs.dtu.dk/services/SignalP-4.1\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and TMHMM (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbs.Dtu.dk/services/TMHMM\u003c/span\u003e\u003cspan address=\"http://www.cbs.Dtu.dk/services/TMHMM\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e"},{"header":"Induced expression of dsRNA","content":"\u003cp\u003eThe primers were designed according to the transcriptome data and \u003cem\u003eEGFP\u003c/em\u003e plasmid sequence (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).The PCR program was as follows: 95\u0026deg;C for 3 min, 95\u0026deg;C for 15 s, 55\u0026ndash;60\u0026deg;C for 15 s, and 72\u0026deg;C for 40 s, followed by 35 cycles, and 72\u0026deg;C for 5 min. PCR products were detected by a 1% agarose gelelectrophoresis. PCR products of \u003cem\u003eDIB/EGFP\u003c/em\u003e were subcloned into the pEASY-Blunt3 cloning vector (TransGen, Beijing, China) and sequenced (General Biol, Nanjing, China).After sequencing, the expression vectors L4440 and pEASY-Blunt3-DIB/EGFP plasmid were digested using restriction enzymes \u003cem\u003eBamH\u003c/em\u003e I and \u003cem\u003eXho\u003c/em\u003e I (TaKaRa, Dalian, China), and then ligated. The L4440 vector contains two T7 promoters which can be induced by isopropyl β-D-1-thiogalactopyranoside (IPTG) to produce dsRNA of the sequence ligated between these promoters. The L4440 constructs were transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5α cells (Sangon Biotech, Shanghai, China), and the vector was confirmed by sequencing (General Biol, Nanjing, China). After sequencing, the L4440-DIB plasmid was transformed into \u003cem\u003eE. coli\u003c/em\u003e HT115 cells (a strain deficient in RNase III and an efficient production for dsRNAs). The transformed cells were cultured overnight in LB medium containing ampicillin (100 \u0026micro;g/mL, Sangon Biotech, Shanghai, China) and tetracycline (12.5 \u0026micro;g/mL, Sangon Biotech, Shanghai, China) for the \u003cem\u003eCYP302A1\u003c/em\u003e RNAi experiments. Isopropyl IPTG (1.0 mM, Sangon Biotech, Shanghai, China) was added to induce the T7 RNA polymerase and subsequent production of dsRNA of the target sequence. The expression of dsRNA was detected by 1% agarose gel electrophoresis. The primers used in the experiments were listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNames and sequences of primers used in the experiment\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eDIB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eGAAGCGACTAATGCAATCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCTCGAG\u003c/span\u003eTTCGGGACCGTTTGTTGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEGFP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGC\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGGATCC\u003c/span\u003eATGGTGAGCAAGGGCGAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCG\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCTCGAG\u003c/span\u003eTTACTTGTACAGCTCGTCCATGCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqDIB\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATACTTCGGACGGATAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACGCAATACTCTCAATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqEGFP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCACCATCTTCTTCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGCTGTTGTAGTTGTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEcR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGGCGCTGCAGGCTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTTTGGCAAACTCCGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTGGAGTCAAGGATGGTATCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCCGAGTTCCGGTGGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE75\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCGGAGAAGTATTCAACAAAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCGAAGAATGGAGCACTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eHR3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTCATCACCTGCGAGGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACTTTGCGACCGCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eFTZ-\u003c/em\u003ef1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGTGCAAGGGATTCTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCAGCGACGCAAGAATAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGTCTCCAATGCTTCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGTCCATCAACAGTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eNote: \u003cem\u003eDIB\u003c/em\u003e and \u003cem\u003eEGFP\u003c/em\u003e are interference primer, the other primers are qPCR primer, and the underlines of forward and reverse primer are the restriction endonuclease sequence.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"RNAi feeding protocol","content":"\u003cp\u003eFour food treatments were selected for the experiments, namely, E5-EGFP: 5% \u003cem\u003eE. coli\u003c/em\u003e HT115 containing L4440-EGFP\u0026thinsp;+\u0026thinsp;95% \u003cem\u003eT. obliquus\u003c/em\u003e; E5-DIB: 5% \u003cem\u003eE. coli\u003c/em\u003e HT115 containing L4440-DIB\u0026thinsp;+\u0026thinsp;95% \u003cem\u003eT. obliquus\u003c/em\u003e; E10-EGFP: 10% \u003cem\u003eE. coli\u003c/em\u003e HT115 containing L4440-EGFP\u0026thinsp;+\u0026thinsp;90% \u003cem\u003eT. obliquus\u003c/em\u003e; E10-DIB: 10% \u003cem\u003eE. coli\u003c/em\u003e HT115 containing L4440-DIB\u0026thinsp;+\u0026thinsp;90% \u003cem\u003eT. obliquus\u003c/em\u003e. There were three replicates at each food treatment. Total food biomass was 20 mg/L wet weigh. 15 animals (birth time\u0026thinsp;\u0026lt;\u0026thinsp;12 h) in each replicate were employed as the mother. During the experiment, all newborns produced by the mother were immediately removed. All mothers in each replicate were collected at the twelfth day after feeding, placed in a 1.7 mL tube containing 100 \u0026micro;L RNAlater and stored in a refrigerator at 4℃ for 12 h, and then transferred to an ultra-low temperature refrigerator at -80℃. After RNAi, the expression levels of related genes were determined by qPCR, and the relative expression levels of target genes was calculated by 2\u003csup\u003e\u0026minus;△△\u003c/sup\u003eCt. The life history parameters of the four growth stages (at birth, at first pregnancy, at first reproduction and at the twelfth days) were observed and recorded during the experiment.\u003c/p\u003e"},{"header":"Whole mount in situ hybridization","content":"\u003cp\u003eIn order to prepare probes for in situ hybridization according to the ORF of the \u003cem\u003eCYP302A1\u003c/em\u003e gene, the sequences of specific primers were designed as follows: ISH-DIB-Forward: CGCGGATCCGAGCTTTATACTGTATCATCTTGCC, ISH-DIB-Reverse: CCGCTCGAGGACTCTTTTACTGCAGCCTTTAGAT, with a length of 150 bp. Target fragment was synthesized according to the primer sequence. After sequencing, the positive clone bacteria were amplified and cultured, and then the Blunt3-ISH-DIB vector plasmid was extracted. The concentration and purity of the plasmid were determined by a NanoDrop spectrophotometer (MD2000D, Biofuture). The linearized plasmid was obtained through restricted digestion of \u003cem\u003eBamH\u003c/em\u003e I or \u003cem\u003eXho\u003c/em\u003e I, and the digested DNA fragments were purified and used as templates for sense and antisense probes, respectively. RNA probes were synthesized through DIG RNA Labeling Kit (SP6/SP7) (Roche, USA), and then digested the probe cDNA template using DNase (RNase-free). In addition, a 1/9 volume of 5 M LiCl and 2 volumes of absolute ethanol were added, and were incubated overnight at -20\u0026deg;C. RNA pellets was washed twice with 75% ethanol, and then dried to remove residual ethanol. Finally, RNA pellets was re-suspended in 30 \u0026micro;L diethylpyrocarbonate water, which1 \u0026micro;L RNA inhibitor (20 U) were added. Aliquots of RNA solutions (1 \u0026micro;L) were added and electrophoresed, and the concentrations were measured. Remaining RNA probes were stored at -20\u0026deg;C.\u003c/p\u003e \u003cp\u003eAccording to theRNAi feeding protocol, 50 female adults of \u003cem\u003eD. sinensis\u003c/em\u003e were collected. All samples were fixed in 4% paraformaldehyde (PFA) overnight, and then were replaced by anhydrous methanol and remained at -20\u0026deg;C. Whole-mount in situ hybridization was carried out according to previously published methods [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] with some modifications. The specimens stored at -20\u0026deg;C were rehydrated gradually with methanol-PBST and digested with proteinase K (10 \u0026micro;g/mL, Solarbio, Beijing, China). The individuals were digested at 37\u0026deg;C for 12 min. Afterpre-hybridization at 68\u0026deg;C for 2.5 h, 100 \u0026micro;L RNA probe which was diluted 1: 100 was added and incubated at 70\u0026deg;C overnight. The specimens were blocked for approximately 2 h at room temperature with slow shaking in MAB block solution, and then added anti-DIG antibody (diluted 1: 5000; Roche, USA) and incubated at 4\u0026deg;C for 13 h. Finally, antibody solution was discarded and the specimens were washed in MABT. At room temperature, the NBT liquid dye (Roche, USA) was used to shade the color for 15 min-2 h, and then the individuals were fixed in 4% PFA for 20 min. Hybridization was observed with a fluorescence microscope (Olympus, CX21).\u003c/p\u003e"},{"header":"Acknowledge","content":"\u003cp\u003eThe L4440 vector and HT115 of \u003cem\u003eE. coli\u003c/em\u003e were presented by Professor Liu Fengsong who came from Hebei University.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eDeclarations\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Funds of the National Natural Science Fund of China [31870451, 31370470, 32001155].\u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eQi HY: Conceptualization, Methodology, Investigation, Writing-Original Draft, Writingand Editing. Cao HJ, Zhao YJ, Cao YQ, Jin QD, Wang YP: Validation, Data Curation. Zhang K: conception, revision of the manuscript. Deng DG: Review and Editing, Supervision, Project, Conceptualization, and Funding acquisition. All authors read andapproved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eJiang XZ, Du NS. Fauna sinica: Crustacean-freshwater Cladocera. Beijing: Science Press; 1979.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi XG, Zhou G, Gu XH. Review of aquatic crustaceans molting and its influencing factors. Chin J Zool. 2014;49(2):294\u0026ndash;302.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoeb MJ. Hormonal control of growth and reproduction in the arthropods: introduction to the symposium. American Zoologist. 1993;33:303\u0026ndash;307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMykles DL. Ecdysteroid metabolism in crustaceans. J Steroid Biochem Mol Biol. 2011;127(3\u0026ndash;5):196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Ge X, Ling L, Zeng BS, Xu J, Aslam AFM, You L, Palli SR, Huang YP, Tan AJ. \u003cem\u003eCYP18A1\u003c/em\u003e regulates tissue-specific steroid hormone inactivation in \u003cem\u003eBombyx mori\u003c/em\u003e. Insect Biochem Mol Biol. 2014;54:33\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Chen D, Jang C, Nall A, Zheng XZ, Sehgal A. An ecdysone-responsive nuclear receptor regulates circadian rhythms in \u003cem\u003eDrosophila\u003c/em\u003e. Nat Commun. 2014;5:5697.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen R, Zhao Q, Wang B, Ma Y, Ma L. Molecular characterization and functional analysis of \u003cem\u003eUSP-1\u003c/em\u003e by RNA interference in the Asian gypsy moth \u003cem\u003eLymantria dispar\u003c/em\u003e. J Forestry Res. 2019;31(5):449\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuramatsu M, Tsuji T, Tanaka S, Shiotsuki T, Jouraku A, Miura K, Mifom VI, Minakuchi C. Sex-specific expression profiles of ecdysteroid biosynthesis and ecdysone response genes in extreme sexual dimorphism of the mealybug, \u003cem\u003ePlanococcus kraunhiae\u003c/em\u003e (Kuwana). PLoS ONE. 2020;15(4):e0231451.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki T, Iwami M. Sequential changes in the regulatory mechanism of carbohydrate digestion in larvae of the silkworm, \u003cem\u003eBombyx mori\u003c/em\u003e. J Comp Physiol B. 2021;191:439\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSwall ME, Benrabaa S, Tran NM, Tran TD, Ventura T, Mykles DL. Characterization of \u003cem\u003eShed\u003c/em\u003e genes encoding ecdysone 20-monooxygenase (CYP314A1) in the Y-organ of the blackback land crab, \u003cem\u003eGecarcinus lateralis\u003c/em\u003e. Gen Comp Endocrinol. 2021;301:113658.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiwa YS, Niwa R. Transcriptional regulation of insect steroid hormone biosynthesis and its role in controlling timing of molting and metamorphosis. Dev Growth Differ. 2016;58(1):94\u0026ndash;105.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin MT, Lu JH, Wang Y, Yuan DJ. Insect ecdysone-mediated molting and metamorphosis development. Chem life. 2022;42(1):63\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChavez VM, Marques G, Delbecque JP, Kobayashi K, Hollingsworth M, Burr J, Natzle JE, O'Connor MB. The \u003cem\u003eDrosophila disembodied\u003c/em\u003e gene controls late embryonic morphogenesis and codes for a cytochrome P450 enzyme that regulates embryonic ecdysone levels. Development. 2000;127(19):4115\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarren JT, Petryk A, Marqu\u0026eacute;s G, Jarcho M, Parvy JP, Dauphin-Villemant C, O'Connor MB, Gilbert LI. Molecular and biochemical characterization of two P450 enzymes in the ecdysteroidogenic pathway of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Proceedings of the National Academy of Sciences. 2002;99(17):11043\u0026ndash;11048.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetryk A, Warren JT, Marques G, Jarcho MP, Gilbert LI, Kahler J, Parvy JP, Li Y, Dauphin-Villemant C, O'Connor M B. \u003cem\u003eShade\u003c/em\u003e is the \u003cem\u003eDrosophila\u003c/em\u003e P450 enzyme that mediates the hydroxylation of ecdysone to the steroid insect molting hormone 20-hydroxyecdysone. Proceedings of the National Academy of Sciences. 2003;100(24):13773\u0026ndash;13778.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiwa R, Matsuda T, Yoshiyama T, Namiki T, Mita K, Fujimoto Y, Kataoka H. \u003cem\u003eCYP306A1\u003c/em\u003e, a cytochrome P450 enzyme, is essential for ecdysteroid biosynthesis in the prothoracic glands of \u003cem\u003eBombyx\u003c/em\u003e and \u003cem\u003eDrosophila\u003c/em\u003e. J Biol Chem. 2004;279(34):35942\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWarren JT, Petryk A, Marqu\u0026eacute;s G, Parvy JP, Shinoda T, Itoyama K, Kobayashi J, Jarcho M, Li Y, O'Connor MB, Dauphin-Villemant C. Phantom encodes the 25-hydroxylase of \u003cem\u003eDrosophila melanogaster\u003c/em\u003e and \u003cem\u003eBombyx mori\u003c/em\u003e: a P450 enzyme critical in ecdysone biosynthesis. Insect Biochem Mol Biol. 2004;34(9):991\u0026ndash;1010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshiyama T, Namiki T, Mita K, Kataoka H, Niwa R. \u003cem\u003eNeverland\u003c/em\u003e is an evolutionally conserved rieske-domain protein that is essential for ecdysone synthesis and insect growth. Development. 2006;133(13):2565\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiwa R, Namiki T, Ito K, Shimada-Niwa Y, Kiuchi M, Kawaoka S, Kayukawa T, Banno Y, Fujimoto Y, Shigenobu S, Kobayashi S. Non-molting \u003cem\u003eglossy/shroud\u003c/em\u003e encodes a short-chain dehydrogenase/reductase that functions in the 'black box' of the ecdysteroid biosynthesis pathway. Development. 2010;137(12):1991\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoshiyama-Yanagawa T, Enya S, Shimada-Niwa Y, Yaguchi S, Haramoto Y, Matsuya T, Shiomi K, Sasakura Y, Takahashi S, Asashima M, Kataoka H. The conserved rieske oxygenase daf-36/neverland is a novel cholesterol-metabolizing enzyme. J Biol Chem. 2011;286(29):25756\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao TP, Segraves WA, Oro AE, McKeown M, Evans RM. \u003cem\u003eDrosophila\u003c/em\u003e ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell. 1992;71(1):63\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRegulation of transcription. factors MHR4 and betaFTZ-F1 by 20-hydroxyecdysone during a larval molt in the tobacco hornworm, \u003cem\u003eManduca sexta\u003c/em\u003e. Dev Biol. 2001;232(1):265\u0026ndash;74.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu J, Li C, Sun G, Raikhel AS. The competence factor βFTZ-F1 potentiates ecdysone receptor activity via recruiting a p160/SRC coactivator. Mol Cell Biol. 2006;26(24):9402\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParvy JP, Blais C, Bernard F, Warren JT, Petryk A, Gilbert LI, O'Connor MB, Dauphin-Villemant C. A role for betaFTZ-F1 in regulating ecdysteroid titers during post-embryonic development in Drosophila melanogaster. Dev Biol. 2005;282(1):84\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSumiya E, Ogino Y, Miyakawa H, Hiruta C, Toyota K, Miyagawa S, Iguchi T. Roles of ecdysteroids for progression of reproductive cycle in the fresh water crustacean \u003cem\u003eDaphnia magna\u003c/em\u003e. Front Zool. 2014;11(1):60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSumiya E, Ogino Y, Toyota K, Miyakawa H, Miyagawa S, Iguchi T. \u003cem\u003eNeverland\u003c/em\u003e regulates embryonic moltings through the regulation of ecdysteroid synthesis in the water flea \u003cem\u003eDaphnia magna\u003c/em\u003e, and may thus act as a target for chemical disruption of molting. J Appl Toxicol. 2016;36(11\u0026ndash;12):1476\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdhitama N, Kato Y, Matsuura T, Watanabe H. Roles of and cross-talk between ecdysteroid and sesquiterpenoid pathways in embryogenesis of branchiopod crustacean \u003cem\u003eDaphnia magna\u003c/em\u003e. PLoS ONE. 2020;15(10):e0239893.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIga M, Smagghe G. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in \u003cem\u003eSpodoptera littoralis\u003c/em\u003e. Peptides. 2010;31(3):456\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilbert LI. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in \u003cem\u003eDrosophila melanogaster\u003c/em\u003e. Mol Cell Endocrinol. 2004;215(1\u0026ndash;2):1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiwa R, Sakudoh T, Namiki T, Saida K, Fujimoto Y, Kataoka H. The ecdysteroidogenic P450 \u003cem\u003eCyp302a1\u003c/em\u003e/\u003cem\u003edisembodied\u003c/em\u003e from the silkworm, \u003cem\u003eBombyx mori\u003c/em\u003e, is transcriptionally regulated by prothoracicotropic hormone.Insect Molecular Biology. 2005;14(5):563\u0026ndash;571.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWan PJ, Jia S, Li N, Fan JM, Li GQ. RNA interference depletion of the Halloween gene \u003cem\u003edisembodied\u003c/em\u003e implies its potential application for management of planthopper \u003cem\u003eSogatella furcifera\u003c/em\u003e and \u003cem\u003eLaodelphax striatellus\u003c/em\u003e. PLoS ONE. 2014;9(1):e86675.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng DJ, Li ZQ, Meng M, Peng J, Qian WL, Kang LX, Xia QY. Characterization of cytochrome P450 genes involving in ecdysteroido genesis in Silkworm (\u003cem\u003eBombyx mori\u003c/em\u003e). Scientia Agricultura Sinica. 2014;47(3):594\u0026ndash;604.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRewitz KF, Gilbert LI. \u003cem\u003eDaphnia\u003c/em\u003e Halloween genes that encode cytochrome P450s mediating the synthesis of the arthropod molting hormone: evolutionary implications. BMC Evolutionary Biology.2008;8:60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCristescu MEA, Colbourne JK, Radivojac J, Lynch M. A microsatellite-based genetic linkage map of the waterflea, \u003cem\u003eDaphnia pulex\u003c/em\u003e: on the prospect of crustacean genomics. Genomics. 2006;88(4):415\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRouttu J, Jansen B, Colson I, De Meester L, Ebert D. The first-generation \u003cem\u003eDaphnia magna\u003c/em\u003e linkage map. BMC Genomics. 2010;11(1):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu A, Zhang M, Kong L, Wu D, Weng X, Wang D, Zhao Y. Cloning and expression profiling of a cuticular protein gene in \u003cem\u003eDaphnia carinata\u003c/em\u003e. Dev Genes Evol. 2014;224(3):129\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong L, Li HX, Wu DL, Xu GR, Wang DL, Zhao YL. Molecular characterization of the gene checkpoint homolog in \u003cem\u003eDaphnia carinata\u003c/em\u003e during different reproductive phases. Genet Mol Res. 2016;15(2):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNelson DR. Metazoan cytochrome P450 evolution. Comparative Biochemistry and Physiology-Part C: Pharmacology, Toxicology and Endocrinology. 1998;121(1):15\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldwin WS, Marko PB, Nelson DR. The cytochrome P450 (CYP) gene superfamily in \u003cem\u003eDaphnia pulex\u003c/em\u003e. BMC Genomics. 2009;10:169.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatzke MA, Birchler JA. RNAi-mediated pathways in the nucleus. Nat Rev Genet. 2005;6(1):24\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiruta C, Toyota K, Miyakawa H, Ogino Y, Miyagawa S, Tatarazako N, Shaw RJ, Iguchi T. Development of a microinjection system for RNA interference in the water flea \u003cem\u003eDaphnia pulex\u003c/em\u003e. BMC Biotechnol. 2013;13(1):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi M, Liu XN, Ma J. RNA interference of antifreeze protein gene in \u003cem\u003eTenebrio molitor\u003c/em\u003e mediated by bacterially expressed dsRNA. Biotechnol Bull. 2014;30(8):113\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian H, Peng H, Yao Q, Chen H, Xie Q, Tang B, Zhang W. Developmental control of a Lepidopteran pest \u003cem\u003eSpodoptera exigua\u003c/em\u003e by ingestion of bacteria expressing dsRNA of a non-midgut gene. PLoS ONE. 2009;4(7):e6225.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl Baki M, Vatanparast M, Kim Y. Male-biased adult production of the striped fruit fly, \u003cem\u003eZeugodacus scutellata\u003c/em\u003e, by feeding dsRNA specific to \u003cem\u003eTransformer-2\u003c/em\u003e. Insects. 2020;11(4):e211.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKato Y, Shiga Y, Kobayashi K, Tokishita SI, Yamagata H, Iguchi T, Watanabe H. Development of an RNA interference method in the cladoceran crustacean \u003cem\u003eDaphnia magna\u003c/em\u003e. Dev Genes Evol. 2011;220:337\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchumpert CA, Dudycha JL, Patel RC. Development of an efficient RNA interference method by feeding for the microcrustacean \u003cem\u003eDaphnia\u003c/em\u003e. BMC Biotechnol. 2015;15(1):1\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEytcheson SA, LeBlanc GA. Hemoglobin levels modulate nitrite toxicity to \u003cem\u003eDaphnia magna\u003c/em\u003e. Sci Rep. 2018;8(1):1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu YR, Zhang H, Jin JS, Zhou ZS, Guo JY. Identification and expression analysis of the Halloween gene family in \u003cem\u003eAgasicles hygrophila\u003c/em\u003e. Scientia Agricultura Sinica. 2020;53(10):2009\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L. Identification and functional analysis of Halloween genes in \u003cem\u003ePlutella xylostella\u003c/em\u003e. Fujian Agriculture and Forestry University; 2018.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHannas BR, Leblanc GA. Expression and ecdysteroid responsiveness of the nuclear receptors \u003cem\u003eHR3\u003c/em\u003e and \u003cem\u003eE75\u003c/em\u003e in the crustacean \u003cem\u003eDaphnia magna\u003c/em\u003e. Mol Cell Endocrinol. 2010;315(1\u0026ndash;2):208\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRewitz KF, Rybczynski R, Warren JT, Gilbert LI. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, \u003cem\u003eManduca sexta\u003c/em\u003e. Insect Biochem Mol Biol. 2006;36(3):188\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Unsectioned Figure Details","content":"\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig1\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"12\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 1\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eHomology comparison of amino acid sequences of the \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e with other arthropods\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: Underlines are the conserved domain of helix-C, helix-I, helix-K, PERF and heme binding.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig2\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"13\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 2\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhylogenetictrees of the \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig3\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"14\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 3\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eInduced expression of L4440-DIB and L4440-EGFP fragments\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: A: Induced expression levels of HT115 strain carrying L4440-EGFP recombinant plasmid and L4440 vector plasmid; B: Induced expression level of HT115 strain carrying l4440-DIB recombinant plasmid; M: DNA molecular weight standard; 1: HT115 strain carrying L4440 vector plasmid was not induced; 2: induced product of HT115 strain carrying L4440 vector plasmid; 3: HT115 strain carrying l4440-EGFP recombinant plasmid was not induced; 4: induced product of HT115 strain carrying l4440-EGFP recombinant plasmid; 5: HT115 strain carrying l4440-DIB recombinant plasmid was not induced; 6: Induced product of HT115 strain carrying l4440-DIB recombinant plasmid.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig4\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"15\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 5\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eTheqPCR results of molting gene \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e and its downstream response gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003efed by 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: E10 (EGFP): 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-EGFP; E10 (DIB): 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-DIB.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig5\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"16\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 4\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e\u003cdiv category=\"Completeness\" id=\"17\" ruleid=\"MissingFigureCitation_01\" status=\"Neutral\" values=\"Fig. 4\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eqPCR results of ecdysis gene \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e and its downstream response gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e fed by 5% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: E5-EGFP: 5% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-EGFP; E5-DIB: 5% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-DIB. * stands for \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eP\u003c/span\u003e\u0026lt;0.05; ** stands for \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eP\u003c/span\u003e\u0026lt;0.01.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig6\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"18\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 5q\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 5q\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003ePCR results of ecdysisgene\u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e and its downstream response gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e fed by 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: E10-EGFP: 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-EGFP; E10-DIB: 10% \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eE. coli\u003c/span\u003e concentration containing L4440-DIB.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig7\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"19\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 6\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eNo. offspring at first reproduction, and no. eggs and molting time at two growth stages of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003eafter RNAi\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e\u003cdiv category=\"Standard\" float=\"Yes\" id=\"Fig8\" class=\"Figure\"\u003e\u003cdiv category=\"Completeness\" id=\"20\" ruleid=\"MissingFigureImage_01\" status=\"Neutral\" values=\"Fig. 7\" class=\"btn-xs-small Annotation tooltipped\" data-position=\"top\" data-tooltip=\"\"\u003eA\u003c/div\u003e \u003cdiv language=\"En\" class=\"Caption\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eFig. 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eExpression sites of the \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eCYP302A1\u003c/span\u003e gene in \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e\u003c/div\u003e \u003cdiv class=\"SimplePara\"\u003e Note: Blue is the positive signal; A: in situ hybridization map of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e without RNAi (antisense probe); B: in situ hybridization map of \u003cspan type=\"Italic\" class=\"Italic\" name=\"Emphasis\"\u003eD. sinensis\u003c/span\u003e after RNAi (antisense probe); C: negative control (sense probe); D1: first antennal nerve; D2: ovary; D3: gastric coeca; D4: olfactory hair; D5: thoracic limb; D6: spine.\u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e\u003cbr/\u003e"},{"header":"Unsectioned Paragraphs","content":"\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"frontiers-in-zoology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"finz","sideBox":"Learn more about [Frontiers in Zoology](http://frontiersinzoology.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/finz/default.aspx","title":"Frontiers in Zoology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-2219024/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2219024/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMolting is an important physiological process in the growth and development of arthropoda, which is mainly regulated by juvenile hormone and ecdysone. CYP302A1 is a key enzyme which plays a critical role in the synthesis of ecdysone in insects, but it has not been identified in cladocera.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eCYP302Al\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e was cloned and its function was analyzed in this paper. The \u003cem\u003eCYP302Al\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e was 5926 bp in full-length, with an open reading frame (ORF) of 1596 bp that encoded 531 amino acids, a molecular weight of 60.82 kDa and an isoelectric point of 9.29. The amino acid sequence analysis revealed that there were five characteristic conserved regions of cytochrome P450 family (namely helix-C, helix-K, helix-I, PERF and heme-binding). In dsRNA mediated experiment, the expression level of \u003cem\u003eCYP302A1\u003c/em\u003e gene decreased significantly (knock-down of 56.22%) in the 5% \u003cem\u003eEscherichia coli\u003c/em\u003e concentration treatment. In addition, the expression levels of \u003cem\u003eEcR\u003c/em\u003e and \u003cem\u003eUSP\u003c/em\u003e and \u003cem\u003eHR3\u003c/em\u003e genes in the downstream decreased also significantly, whereas that of \u003cem\u003eFTZ\u003c/em\u003e-f1 gene increased significantly. In the 5% \u003cem\u003eE. coli\u003c/em\u003e concentration treatment, the molting time at first pregnancy of \u003cem\u003eD. sinensis\u003c/em\u003e prolonged, and the development of embryos in the incubation capsule appeared abnormal or disintegrated. The whole-mount in situ hybridization showed that the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e had six expression sites before RNA interference (RNAi), which located in the first antennal ganglion, ovary, gastric coeca, olfactory hair, thoracic limb and tail spine. However, the expression signal of the \u003cem\u003eCYP302A1\u003c/em\u003e gene of \u003cem\u003eD. sinensis\u003c/em\u003e disappeared in the first antennal ganglion and obviously attenuated in the ovary after RNAi.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eIn conclusion, the \u003cem\u003eCYP302A1\u003c/em\u003e gene played an important role in the ecdysone synthesis pathway of \u003cem\u003eD. sinensis\u003c/em\u003e, and the knock-down of the gene affected the molting and reproduction of \u003cem\u003eD. sinensis\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Cloning and functional analysis of the molting gene CYP302A1 of Daphnia sinensis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-11-11 05:17:28","doi":"10.21203/rs.3.rs-2219024/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-12-11T07:55:39+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2022-11-26T15:07:23+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-11-08T10:26:26+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-10-31T15:55:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"Frontiers in Zoology","date":"2022-10-30T11:55:49+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"frontiers-in-zoology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"finz","sideBox":"Learn more about [Frontiers in Zoology](http://frontiersinzoology.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/finz/default.aspx","title":"Frontiers in Zoology","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a2eb06d2-d8d8-45e4-a682-7f35aae1d17d","owner":[],"postedDate":"November 11th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T18:27:20+00:00","versionOfRecord":{"articleIdentity":"rs-2219024","link":"https://doi.org/10.1186/s12983-023-00483-2","journal":{"identity":"frontiers-in-zoology","isVorOnly":false,"title":"Frontiers in Zoology"},"publishedOn":"2023-01-12 18:18:19","publishedOnDateReadable":"January 12th, 2023"},"versionCreatedAt":"2022-11-11 05:17:28","video":"","vorDoi":"10.1186/s12983-023-00483-2","vorDoiUrl":"https://doi.org/10.1186/s12983-023-00483-2","workflowStages":[]},"version":"v1","identity":"rs-2219024","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2219024","identity":"rs-2219024","version":["v1"]},"buildId":"rHA-KDH7Qsr4HCuvH75dn","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.