Impact of transportation in freshwater and brackish water on Oreochromis niloticus (Nile tilapia) resistance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Impact of transportation in freshwater and brackish water on Oreochromis niloticus (Nile tilapia) resistance Mohamed Abd El Aziz Ahmed Abd El-Galil, Hala Ali Alsagheer Abd-Elaal Hassan, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4113606/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 Sep, 2024 Read the published version in BMC Veterinary Research → Version 1 posted 4 You are reading this latest preprint version Abstract Background Oreochromis niloticus has great economic value and potential for farming and development. Transportation of fish was done for breeding or trading purpose and it is a challenging aspect of aquaculture. This study aimed to investigate the effect of transportation in freshwater and brackish water on the resistance of O. niloticus as well as transportation stress mitigation effect of NaCl. Four equal groups were used; each of 50 fish, the 1st group served as the control (P 1), while the 2nd group (PT 2) was transported in water without salt, the 3rd (PT 3) and 4th (PT 4) groups were transported in water containing 5 gL − 1 and 10 gL − 1 salt respectively. PT 2, PT 3 and PT 4 were transported for 5 hours without any rest or sedative drugs. Results The serum cortisol of O. niloticus significantly increased at 0 h and then decreased at 12 and 24 h post transportation in the PT 2 group and non significantly increased at all point times in the PT 3 and PT 4 groups comparing to P 1 group. Mucin2 gene expression was non-significantly up regulated in the PT 2 group and down regulated in the PT 3 and PT 4 groups at 0 h comparing with P 1 group, but at 12 and 24 h it was significantly up regulated in the PT 2, PT 3 and PT 4 groups. The β Defensin-1 and 2 genes expression was non-significantly down-regulated in the PT 2 group and significantly up regulated in the PT 3 and PT 4 groups at 0 h., while at 12 and 24 h was significantly down regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups, it significantly down regulated in the PT 2 and PT 3 group and non significantly down regulated in the PT 4 group at 24 h. Non significant up regulation in interleukin − 1β gene expression was reported in the PT 2 group and non significant down regulation in the PT 3 and PT 4 groups at 0 h. However, significant up regulation was recorded in the PT 2, PT 3 and PT 4 groups at 12 and 24 h. The Tumor necrosis factor- alpha gene expression was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0h. However, it was significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h. Conclusion The results of this study confirmed the stressful effect of transportation on O. niloticus as well as the transportation stress mitigation effect of NaCl. O. niloticus Nile tilapia Transportation Stress NaCl cortisol Mucin β D TNF IL-1β Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Background The Nile tilapia was initially introduced in developing countries to meet protein demands [ 1 ] and it has great economic value and potential for farming and development [ 2 ]. Nile tilapia is resistant to environmental conditions and diseases, grows rapidly and adapts to various aquaculture methods, it has relatively low production cost [ 1 ]. Improving fish welfare is directly linked to the advancement of fish aquaculture industry. This is because better fish growth is associated to low-stress conditions through lives. Live fish transportation is a common work in aquaculture facilities, but it can activate the stress responses that compromise fish welfare. The impact of transportation stress is influenced by many factors including time, temperature, fish size and health, stocking density, stress level, and packing method [ 3 ]; [ 4 ] and [ 5 ]. Unfortunately, transportation stress also affects water quality as well as fish productivity and survival [ 6 ]. Transport stress is one of the factors that raise cortisol level, which activate gluconeogenesis, this process increases glucose levels to provide the energy needed to handle the stress [ 7 ]. Increased production of cutaneous mucosal secretions in response to stress has been observed many fish species [ 8 ]. Mucin genes were found to be significantly up-regulated in fish after transportation [ 9 ] and [ 10 ]. β-defensins have various activities including antibacterial, antiviral, chemotactic, immune-modulatory, and reproductive regulation. Interleukin-1 is a pro-inflammatory cytokine that plays an important role in fish immunity by activating lymphocytes and phagocytic cells. The TNF-α family is involved in regulating leukocyte homing, proliferation and migration. Reducing stress during transportation is an essential factor for supporting fish growth and survival rates [ 11 ] and [ 12 ]. Several studies have been conducted on the topic of reducing stress during transportation through using supplementary diet such as probiotics [ 13 ] and [ 14 ], turmeric [ 15 ], glycine [ 16 ], anesthetics [ 17 ] and [ 18 ] and in the addition of salt to transport water [ 19 ], [ 9 ] and [ 10 ]. Adding NaCl to transport water is a common practice in freshwater fish farms to mitigate the adverse effect of transport [ 20 ]. Salt is cheap and easy to use in fish farms and it helps alleviate osmoregulation troubles during transport [ 21 ]; [ 22 ] and [ 23 ]. This study aims to investigate the effect of 5 hours transportation in freshwater and water containing 5gL − 1 and 10gL − 1 NaCl on O. niloticus resistance as well as the stress mitigation effect of NaCl. Materials and Methods Ethics approval The protocols of this study were following the ethical consideration of experimental animals and approved by the Veterinary Medical Ethics Research Committee- Faculty of Veterinary Medicine at Sohag University, Egypt, approval number Soh.un.vet/00016 M2. Fish O. niloticus (average body weight was 53 ± 3 g) were obtained from Wadi Samhod Tilapia Private Farm in the New Vally Governorate, Egypt Transportation experiment O. niloticus was divided into 4 groups, 50 fish for each, the 1st group served as the control group (P1), the 2nd fish group was transported in water without salt (PT2) and the 3rd fish group was transported in water containing 5gL -1 Nacl (PT3) and the 4th fish group was transported in water containing 10gL -1 Nacl (PT4). The transportation water was obtained directly from the farm pond. The fish were transported for 5 hours at stocking density of 26.5gL -1 and with continuous aeration; they were transported without sedation or rest. Each fish group was transported in a separate tank with 180L capacity, containing 100 L of water. Once the fish reached to the Wet Lab. of Fish Diseases and Management Dept., Faculty of Veterinary Medicine, Sohag University, the fish were removed from the transport water to clean freshwater and each group was kept in a separate tank during the sampling time. Sampling Blood and skin samples were collected from the control group (P 1) only before transportation, and from the PT 2, PT 3 and PT 4 groups at 0 h, 12 h and 24 h. post transportation, 5 fish from each experimental group were sampled at each determined time point. The fish were anesthetized with MS-222 (150 mgL -1 ) [ 24 ] before blood and skin sampling, the blood samples were left to clot at room temperature for sera collection, which was stored at -80°C until analysis. Skin samples were collected and preserved in RNA lader and stored at -80°C for gene expression studies [ 25 ]. Cortisol level The quantity of serum cortisol was determined using ELISA method from a commercial kit (DRG Cortisol ELISA EIA‒1887, Germany). Absorbance readings were taken using a spectrophotometer with a wavelength of 500 nm (HITACHI, U‒2001). Gene expression studies Total RNA was extracted from the skin of O. niloticus from control, PT 2, PT 3 and PT 4 using Trizol. 1 µg of total RNA was denatured at 65°C for 5 minutes in the presence of 1 µl of oligo-dT17, 1 µl of dNTP (deoxynucleoside triphosphate mix 10 mM (Promega) and RNA/DNA free water (Sigma) in a volume of 13 µl to synthesize cDNA,. The synthesis was carried out using 1 µl of Superscript III reverse transcriptase enzyme (Invitrogen), 5 µl of 5x first strand buffer, 1 µl 0.1 M DTT and water to reach final volume of 25 µl. The mixture was then incubated at 55°C for 1 h. The resulting cDNA was stored at − 20°C. The expression of the mucin2 gene (MUC2), antimicrobial peptides (βD1 and 2) and cytokines (IL-1β and TNF-α) was examined before and after transport using RT-qPCR with specific primers (Table 1). For the qPCR, 3 µl of a diluted cDNA template was used following the procedures described by [ 26 ]. The relative expression levels of the genes were determined using the Pfaffl method [ 27 ] as previously explained [ 26 ] Table (1) Oligonucleotide primers were used in SYBR Green real time PCR. Gene Primer sequence (5'-3') Reference EF-1α CCTTCAACGCTCAGGTCATC Gröner et al ., 2015 [ 28 ] TGTGGGCAGTGTGGCAATC MUC2 CAACTGTTTTTGAGACAACTTCAGA Midhun et al ., 2019 [ 29 ] CTGAAGTGACCGTGGAAGG βD-1 TTCGCATTGTGTCCTCTGCTCCGTTCGAC Dong et al ., 2015 [ 30 ] TGAAACAGACAGATCCACATCAAACCCTGA βD-2 GCTGACAGCAGTGCAAGCTGATGACAC Taccki et al ., 2015 [ 31 ] GCAAAGCACAGCATCTTAATCTGC TNF alpha CCAGAAGCACTAAAGGCGAAGA Standen et al ., 2016 [ 32] CCTTGGCTTTGCTGCTGATC IL-1ß AGAGCAGCAATTCAGAGC Ming et al ., 2013 [ 33 ] GTGCTGATGTACCGT Analysis of the SYBR green Rt-PCR results. Amplification curves and CT values were determined by the stratagene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the control group according to the "ΔΔCt” method [ 34 ]. Statistical analysis Results are expressed as the mean ± standard error (SE). Data analysis was performed in GraphPad Prism version 5.0 including normality tests. All data were normally distributed. Statistically significant differences were considered when p < 0.05. The qPCR measurements were analyzed by T-test to identify statistically significant differences between groups. One-way ANOVA and Tukey post-hoc analysis test were performed to identify statistically significant differences among groups. Results Cortisol level The serum cortisol level of the control O. niloticus group (P 1) was 11.07 ± 1.0 µgdl − 1 . It significantly increased in the PT 2 group at 0h, decreased greatly but still significantly higher than P 1 group at 12h and comes back to the basal level without significant difference at 24 h post transportation compared to the control group. However It remains around the basal level and non significantly increases in the PT 3 and PT 4 groups comparing with the P 1 group at all point times and significantly decreases in the PT 3 and PT 4 groups comparing with PT 2 group at all point times, (Table- 2 and Figures − 1 and 2) Table (2) showing Cortisol values in all experimental groups at the point times and the significant differences compared to the control group. Fish group Time Cortisol level (µg/dl) (Mean ± SE) PT1 (Control group) Before transport 11.02 ± 1.0 PT2 ( without Nacl) 0 h post transport 21.27 ± 0.51*** PT3 ( 5 gL − 1 Nacl) 11.70 ± .31 ns PT4 ( 10 gL − 1 Nacl) 12.21 ± 0.71 ns PT2 12 h post transport 14.03 ± 0.60* PT3 11.33 ± 0.27 ns PT4 12.07 ± 0.72 ns PT2 24 h post transport 12.20 ± 0.55 ns PT3 11.10 ± 0.46 ns PT4 11.96 ± 1.55 ns * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001 and ns = non significant Gene’s expression MUC2 gene expression The expression of MUC2 gene in O. niloticus non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24 h. (Table − 3 and Figure − 3). Table (3) showing MUC2 gene expression in all experimental groups at the point times and the significant differences compared to the control group. Fish group Time EF1α Muc-2 CT CT Fold change (Mean ± SE) P1 (Control group) Before transport 19.36 23.29 - PT2 ( without Nacl) 0 h post transport 19.34 22.62 1.61 ± 0.26 ns PT3 ( 5gL − 1 Nacl) 20.87 25.10 0.82 ± 0.04 ns PT4 ( 10gL − 1 Nacl) 19.63 24.01 0.74 ± 0.06 ns PT2 12 h post transport 19.47 19.63 13.69 ± 0.78*** PT3 20.24 21.67 5.68 ± 0.66*** PT4 20.13 22.09 3.93 ± 0.15*** PT2 24 h post transport 20.08 19.74 19.31 ± 0.94*** PT3 20.66 21.91 6.43 ± 0.68*** PT4 20.72 22.38 4.870.54*** * p ≤ 0.05, ** p ≤ 0.01 *** p ≤ 0.001 and ns = non- significant. Antimicrobial peptides (β Defensin– 1 and β Defensin − 2) The expression of the antimicrobial peptides βD-1 and 2 genes at 0 h post transportation non-significantly down-regulated in the PT 2 group and dramatically and significantly up regulated in the PT 3 and PT 4 groups comparing with the P 1 control group. At 12 h, they significantly down regulated in the PT 2 group and non-significant down regulation in the PT 3 and PT 4 groups matching with P 1 control group. At 24 h post transportation they significantly down regulated in the PT 2 and PT 3 groups and non-significant down regulation in the PT 4 group comparing with the P 1 group. Matching with the PT 2 group; the βD-1 and 2 significantly up regulated in the PT 3 and PT 4 groups at 0 h post transportation, and they non significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h post transportation. (Table − 4 and Figure- 4). Table (4) showing βD-1 and βD-2 genes expression in all experimental groups at point times and the significant differences compared to the control group. Fish group Time EF1α βD-1 βD-2 CT CT Fold change (Mean ± SE) CT Fold change (Mean ± SE) P1 - Control group Before transport 19.36 21.86 - 20.75 - PT2 (without Nacl) 0 h post transport 19.34 21.97 0.90 ± 0.03ns 21.05 0.82 ± 0.04ns PT3 (5 gL − 1 Nac)l 20.87 20.86 5.70 ± 0.34*** 20.59 3.22 ± 0.55*** PT4 (10 gL − 1 Nacl) 19.63 19.38 6.75 ± 0.29*** 18.46 5.91 ± 0.38*** PT2 12 h post transport 19.47 22.91 0.53 ± 0.08* 22.63 0.30 ± 0.04* PT3 20.24 23.23 0.71 ± 0.02ns 22.27 0.64 ± 0.06ns PT4 20.13 22.80 0.90 ± 0.07ns 22.00 0.72 ± 0.05ns PT2 24 h post transport 20.08 25.18 0.17 ± 0.05*** 25.43 0.06 ± 0.02*** PT3 20.66 24.46 0.41 ± 0.03** 23.60 0.34 ± 0.05* PT4 20.72 23.90 0.63 ± 0.05ns 23.02 0.53 ± 0.05ns * p ≤ 0.05, ** p ≤ 0.01 *** p ≤ 0.001 and ns = non- significant. Tumor Necrosis Factor (TNF) gene expression The expression of the TNF- alpha gene in O. niloticus was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups compared to the control group at 0 h post transportation. However at 12 and 24 h post transportation; there was a significant up regulation in gene expression in the PT 2, PT 3 and PT 4 groups. Matching with PT 2 group, TNF non significantly down regulated in the PT 3 group and significantly down regulated in the PT 4 group at 0 h post transportation, however at 12 and 24 h post transportation it significantly down regulated in the PY 3 and PT 4 groups. (Table − 5 and Figure- 5). Table (5) showing TNF gene expression in all experimental groups at the point times and the significant differences vs. the control group Fish group Time EF1α TNF alpha CT CT Fold change (Mean ± SE) P1 ( Control group) Before transport 19.36 22.15 - PT2 ( without Nacl) 0 h post transport 19.34 21.35 1.73 ± 0.05 ns PT3 ( 5gL − 1 Nacl) 20.87 23.97 0.81 ± 0.10 ns PT4 ( 10gL − 1 Nacl) 19.63 23.13 0.61 ± 0.05 ns PT2 12 h post transport 19.47 18.84 10.71 ± 0.59 *** PT3 20.24 21.47 2.95 ± 0.20 *** PT4 20.13 21.90 2.04 ± 0.20 * PT2 24 h post transport 20.08 18.75 17.40 ± 0.85 *** PT3 20.66 21.07 5.23 ± 0.61*** PT4 20.72 21.76 3.38 ± 0.09*** * p ≤ 0.05, *** p ≤ 0.001 and ns = non- significant. Interleukin -1β (IL-1β) gene expression The results showed that the expression of IL-1β gene in O. niloticus was non significantly up-regulated in the PT 2 group and also not significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation. However, at 12 and 24 h post transportation there was significant up regulated of IL-1β in the PT 2 and PT 4 fish groups group and non-significant up regulation in the PT 3 group comparing with the P 1 group. The IL-1β gene expression significantly up regulated in the PT 2, PT 3 and PT 4 fish groups compared to P 1 fish group at 24 h post transportation. Matching with the PT 2 group; the IL-1β gene expression non significantly down regulated at 0 h post transportation and significantly up regulated at 12 and 24 h post transportation in the PT 3 and PT 4 fish groups (Table -6 and Figure- 6). Table (6): showing IL-1β gene expression in all experimental groups at the sampling times, the interaction between group-time factors and the significant differences vs. the control group IL-1β EF1α Time Fish group Fold change (Mean±SE) CT CT - 21.44 19.36 Before transport P1 (Control group) 1.20± 0.14 ns 21.06 19.34 0 h post transport PT2 (without Nacl) 0.78±0.05 ns 23.32 20.87 PT3 (5gL -1 Nacl) 0.54±0.07 ns 22.62 19.63 PT4 (10gL -1 Nacl) 8.84±0.74*** 18.41 19.47 12 h post transport PT2 2.05±0.13* 21.28 20.24 PT3 1.47±0.18 ns 21.66 20.13 PT4 15.89±1.30*** 18.17 20.08 24 h post transport PT2 4.01±0.46*** 20.74 20.66 PT3 2.15±0.04* 21.70 20.72 PT4 * p ≤ 0.05, *** p ≤ 0.001, **** p ≤ 0.0001 and ns =non- significant. Discussion Many aquaculture operations involve the transportation of live fish from one facility to another or during restocking practices. It has been clarified that the immune response in stressed fish is suppressed [ 35 ] and [ 36 ]. Previous studies on the fish immune response to stress have primarily focused on systemic parameters such as blood cell counts and serum innate immune factors, while neglecting the role of skin immunity. In this study, we investigated the resistance of O. niloticus particularly the skin to live transport as well as the stress mitigation effect of salt. Regarding the serum cortisol, it was significantly increased at 0 h post transport in PT 2 group transported in water without salt compared to both P 1 control group and PT 3 and PT 4 fish groups transported in water containing salt. This elevation may be attributed to the stressful effect of transportation and the importance of cortisol during stress conditions as it elevates blood glucose and stimulate the central nervous system to restore fish body homeostasis [ 36 ]. These results are supported by [ 9 ] who mentioned that stressed trout had higher cortisol levels than the control group and [ 10 ] who recorded that serum cortisol levels in O. niloticus significantly increased after 5 h transportation in water without salt. A significant decrease in cortisol level was reported in the PT 3 and PT 4 fish groups compare to with PT 2 group at different sampling times, and similar findings were reported in common carp [ 12 ], matrinx˜a, Brycon amazonicus [ 37 ] and ruho carp, Labeo rohita [ 23 ]. This may be indicate that salt minimizes the stressful effect of transportation and enhances fish hydro-mineral balance by reducing the osmolality differences between the transporting water and fish body [ 38 ] and [ 39 ]. Cortisol level significantly decreased and recovered to the basal level at 12 and 24 h post transportation in PT 2 fish groups. This result came in line with [ 40 ] and [ 41 ] who found that the cortisol elevation syndrome recovered after 24 h post stress in juvenile tambaqui colossoma macropomum and Nile tilapia. The expression of MUC2 gene in O. niloticus non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and at 12 and 24 h, it significantly up regulated in the PT 3 and PT 4 groups. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24 Mucins are important high molecular weight glycoproteins for the physical barrier, mucous viscosity and trapping pathogens in fish [42). The expression of MUC2 gene in the O. niloticus of the PT 2 group was non significantly up-regulated at 0 h and significantly up-regulated at 12 and 24 h post transportation comparing with P 1 group, this up regulation may be attributed the stressful condition of transportation such as confinement, high ammonia level and shacking. This result is consistent with previous studies [ 9 ] who reported a significant up-regulation of mucin gene in trout fish post transportation and [ 10 ] who stated that the expression of mucin2 gene was significantly up regulated in O. niloticus after transportation. MUC2 gene expression of PT 3 and PT 4 groups transported in water containing salt was non significantly down regulated compared with P 1 group at 0 h post transportation. This down regulation may be attributed to the sodium chloride mitigates the transportation stress by decreasing the salinity difference between the fish body and the transporting water as well as controlling mucous secretion on the skin [ 43 ]. These results are consistent with [ 10 ] who recorded significant down regulated of the MUC2 gene expression in O. niloticus transported in water containing 5 gL -1 compared with the fish group transported in water without salt. Additionally [ 8 ] and [ 9 ] reported an increased cutaneous mucosal secretions and significant up-regulation of mucin genes in response to transport stress. Antimicrobial peptides are a component of the innate immune system of fish and found on the surface layer of epithelial tissues. They act as the first line of defense against various pathogenic invasions. The significant down-regulation of β D-1 and 2 genes expression in the skin of O. niloticus transported in water without salt (PT 2 group) at 0, 12 and 24h post transportation may be attributed to the immune suppressive effect of transportation on skin immunity. Similar down regulation of βD-1 and 2 has been reported in rainbow trout [ 9 ] and O. niloticus [ 10 ] who found that the transportation lead to a significant down regulation of βD -1 and 2 genes expression. The β D -1 and 2 gene expression was up-regulated in the PT 3 and PT 4 groups at 0 h post transportation compared to the PT 2 group, and this may be attributed to the salt mitigated the stress mitigation effect and alleviated the immune suppressive effect of transportation[ 44 ]. Moving O. niloticus from transporting water containing salt to freshwater down regulated the expression of β D-1 and 2 genes and subsequently suppressed fish immunity at 12 and 24h post transportation. These results were supported by [ 12 ] who found that the addition of 3 gL − 1 salt to transportation water for common carp mitigated immunosuppression. The results of our work demonstrate that the expression of β defensin 1 and 2 genes could be used as early response marker to acute transportation stress. The TNF- α and IL-1β cytokines in teleost fish are powerful pro-inflammatory cytokines released by several immune cells during infection or tissue damage [ 45 ]. Overall, transportation stress increases the pro-inflammatory cytokines TNF- α, and IL-1β. The results of this study showed a significant up regulation in IL-1β gene expression of the PT 2 group transported in water without salt at 12 and 24 h post transport and non significant up regulation at 0 h. This result agrees with the results of [ 10 ] who reported up regulation of IL-1β gene expression in O. niloticus transported for 5 h in water without salt. The significant up regulation of IL-1β in the PT 2 group indicates that the transported O. niloticus in water without salt may be exposed to stressful condition which stimulates IL-1β production along the 24 h investigation time post transportation because the IL-1β acts as an immune and inflammatory response mediator in fish [ 46 ]. The IL-1β gene expression in the PT 3 and PT 4 groups down regulated at 0 h post transportation, that may be attributed to the up regulation of β D-1 and 2 in these groups, which have a fascinating ability to suppress the inflammatory response [ 47 ]. The IL-1β gene expression up regulated in the PT 3 and PT 4 group at 12 and 24h post transportation, that may be attributed to the elevated cortisol level [ 48 ] and the down regulation of antimicrobial peptides β D-1 and 2 as a result of moving fish from water containing salt to freshwater. Fish TNF-α acts as regulator and amplifier for acute and chronic inflammation, it is one of the early immune genes that is expressed at the early stage of infection [ 49 ]. It has overlapping functions with IL-1β and able to activate macrophages and enhance their microbial killing activity [ 50 ]; [ 46 ] and [ 51 ]. TNF α gene expression of O. niloticus in the PT 2 fish group was significantly up regulated at 12 and 24 h post transport and non significantly up regulated at 0 h compared with the P 1 group, that indicates the transportation increased the skin inflammatory reaction up to 24 h post transportation [ 52 ]. In contrast, TNF - α gene expression was down regulated in the PT 3 and PT 4 O. niloticus groups at 0 h post transportation then up regulated at 12 and 24 h post transportation. This may explain the stress mitigation effect of salt during transportation which may extend up to 24 h post transportation. Conclusion The O. niloticus group transported in water without salt appeared higher transportation stress effects as evidenced by increased cortisol level and up regulation of Muc2, IL-1B and TNF genes as well as down regulation of β D-1 and 2. However, the addition of sodium chloride to the transportation water had a stress mitigation effect on O. niloticus. This was observed through improvements of fish physiology and mucosal health as well as enhanced skin mucous barrier and immunity; these improvements were more evident in the 5 gL − 1 group than 10 gL − 1 group. Therefore, it is recommended to use 5gL-1 salt during O. niloticus transportation as it is more beneficial and effective in reducing transportation stress. Further research is required to enhance the well-being of O. niloticus during the transportation process. Abbreviations CT Cycle Threshold DNA :Deoxyribonucleic acid IL-1β Interleukin-1 β MS-222 :Tricaine methanesulfonate MUC2 Mucin2 O. niloticus : Oreochromis niloticus RNA Ribonucleic acid TNF :Tumor Necrosis Factor βD-1 βDefinsin-1 βD-2 :βDefinsin-2 Declarations Ethics approval and consent to participate The experiment was approved by the Veterinary Medical Ethics Research Committee, Faculty of Veterinary Medicine, Sohag University, Egypt (Code no. Soh.un.vet/00016 M2) and carried out in accordance with the guidelines and regulations issued by the Veterinary Ethics Research Committee, Faculty of Veterinary Medicine. This study follows the ARRIVE guidelines (https://arriveguidelines.org). Consent for publication Not published. Availability of data and materials Datasets of this study are available from the corresponding author upon reasonable request. Competing of interest I declare that the authors have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper. Funding The Science, Technology and Innovation Funding Authority (STDF) in cooperation with the Egyptian Knowledge Bank (EKB) have provided open access funding. This research was supported by the Faculty of Veterinary Medicine, Sohag University, Egypt. Author’s contributions M.A.A.A., H.A.A.A.H. and A.E.O. contributed to experimental design, sampling, methodology design, serum analysis and gene expression and wrote the draft of the manuscript. H.A.A.A.H., F.E.A.A., M.A.M., A.M.E. and A.E.O. contributed to the analysis of serum biochemical parameters and genes expression, prepared the tables and figures as well as contribute in the manuscript draft writing. All authors had read, revised and approved the final manuscript. Acknowledgments The authors would like to express their gratitude to the Faculty of Veterinary Medicine at Sohag University, Egypt for providing the research labs and experimental platform. Thanks a lot to STDF and EKB for their providing an open access funding. Author information Mohamed Abd El Aziz Ahmed Abd El-Galil Authors and Affiliations Fish Diseases and Management Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt Mohamed Abd El Aziz Ahmed Abd El-Galil Hala Ali Alsagheer Abd-Elaal Hassan Zoology Department, Faculty of Sciences, Sohag University, Sohag, Egypt Fatma Elzahraa Abd Alhamed Ahmed Nutrition and Clinical Nutrition Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt Mohamed Abd Allah Mousa Fish Diseases Department, National Institute of Oceanography and Fisheries, NIOF, Cairo, Egypt Arafah M. Emam Biochemistry Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt Ahmed Elsayed Osman Corresponding author; Mohamed Abd El Aziz Ahmed Abd El-Galil References FAO Cultured Aquatic Species Information Program, Rome, Italy, 2022 Suprayudi MA, Faisal B, Setiawati M The growth of red tilapia fed on organic‒selenium supplemented diet. Journal Akuakultur Indonesia, 2013; 12: 48‒53. Iverson M, Finstad B, Mckinley RS, Eliassen RA, Carlsen KT, Evjen T Stress responses in Atlantic salmon Salmo salar L. smolts during commercial well boat transports and effects on survival after transfer to sea. Aquaculture, 2005; 243: 373‒382. Ashley PJ Fish welfare current issues in aquaculture. Applied Animal Behavior Science, 2007, 104: 199‒235. Tang S, Thorarensen H, Brauner CJ, Wood CM, Farrell AP Modeling the accumulation of CO2 during high density re-circulating transport of adult Atlantic salmon, Salmo salar, from observations aboard a sea‒going commercial live‒haul vessel. Aquaculture, 2009; 296: 102‒109 . Emmanuel BE, Fayinka DO, Aladetohun NF Transportation and the effects of stocking density on the survival and growth of Nile tilapia Oreochromis niloticus (Linnaeus). World Journal Agricultural Sciences, 2013; 1: 001‒007. Faught E, Vijayan MM Mechanisms of cortisol action in fish hepatocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2016; 199, 136–145. Ángeles EM An overview of the immunological defenses in fish skin. International Scholarly Research Notices, 2012. Tacchi L, Lowrey L, Musharrafieh R, Crossey, K, Larragoite ET, Salinas I Effects of transportation stress and addition of salt to transport water on the skin mucosal homeostasis of rainbow trout ( Oncorhynchus mykiss ). Aquaculture . 2015; January 1; 435: 120–127. Hanna Heba NS Effect of transportation on skin immunity of Oreochromis niloticus. PhD, Fish Diseases and Management, Faculty of Veterinary Medicine, Sohag University, 2023. Navarro RD, França RP, Paludo GR, Bizarro YWS, Silva RF, Navarro FKSP Physiological and hematological responses of Nile tilapia Oreochromis niloticus to different anesthetics during simulated transport conditions. Actascitechnol, 2016; 38: 301‒306. Taheri Mirghaed A, Ghelichpour M Effects of anesthesia and salt treatment on stress responses, and immunological and hydromineral characteristics of common carp (Cyprinus carpio, Linnaeus, 1758) subjected to transportation. Aquaculture, 2019; 501: 1–6. Gomes LC, Brinn RP, Marcon JL, Dantas LA, Brand˜ao FR, De Abreu JS, Lemos PEM, McComb DM, Baldisserotto B Benefits of using the probiotic Efinol®L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon. Aquac. Res. 2009; 40, 157–165. da Silva E, de Moraes AV, Pereira MDO, Bittencourt M, Weber RA, Jatob´a A Autochthonous and allochthonous dietary probiotics mitigate acute stress in Astyanax bimaculatus during transport. Aquac. Res. 2022; 53, 3253–3256. Hoseini SM, Gupta SK, Yousefi M, Kulikov EV, Drukovsky SG, Petrov AK, Taheri Mirghaed A, Hoseinifar SH, Van Doan H Mitigation of transportation stress in common carp, Cyprinus carpio, by dietary administration of turmeric. Aquaculture, 2022b; 546, 737380. Hoseini SM, Majidiyan N, Mirghaed AT, Hoseinifar SH, Van Doan H Dietary glycine supplementation alleviates transportation-induced stress in common carp, Cyprinus carpio. Aquaculture, 2022a; 551, 737959. Santos ELR, Rezende FP, Moron SE Stress-related physiological and histological responses of tambaqui (Colossoma macropomum) to transportation in water with tea tree and clove essential oil anesthetics. Aquaculture, 2020; 523, 735164. Ferreira AL, Favero GC, Boaventura TP, de Freitas Souza C, Ferreira NS, Descovi SN, Baldisserotto B, Heinzmann BM, Luz RK Essential oil of Ocimum gratissimum (Linnaeus, 1753): efficacy for anesthesia and transport of Oreochromis niloticus. Fish. Physiol. Biochem., 2021; 47, 135–152. Boaventura TP, Pedras PPC, Júlio GSC, dos Santos FAC, Ferreira A L, de Souza Silva W, Luz RK Use of eugenol, benzocaine or salt during the transport of panga, Pangasianodon hypophthalmus (Sauvage, 1878): effects on water quality, haematology and blood biochemistry. Aquac. Res., 2022; 53, 1395–1403. Takata R, Luz RK Aquicultura no Brasil: novas perspectivas, Techniques for aquatic animals; Tavares-Dias M, Mariano WS (eds.). 2015; pp: 523-543. Editora Pedro & João, São Carlos. Crosby TC, Hill JE, Watson CA, Yanong RP, Strange R Effects of tricaine methane sulfonate, Hypno, metomidate, quinaldine, and salt on plasma cortisol levels following acute stress in three spot gourami Trichogaster trichopterus. J. Aquat Anim. Health, 2006; 18:58–63. Oyoo-Okoth E, Cherop L, Ngugi CC Survival and physiological response of Labeo victorianus (Pisces: Cyprinidae, Boulenger 1901) juveniles to transport stress under a salinity gradient. Aquaculture, 2011; 319, 226–231. Biswal A, Srivastava PP, Pal P, Gupta S, Varghese T, Jayant M A multi-biomarker approach to evaluate the effect of sodium chloride in alleviating the long-term transportation stress of Labeo rohita fingerlings. Aquaculture, 2021; 531, 735979. Neiffer DL, Stamper MA Fish sedation, anesthesia, analgesia, and euthanasia: considerations, methods, and types of drugs. ILAR J, 2009; 50:343–360 Tacchi L, Larragoite E, Salinas I Discovery of J Chain in African Lungfish Protopterus dolloi, Sarcopterygii) Using High Throughput Transcriptome Sequencing: Implications in Mucosal Immunity. PLoS One. 2013; 8:e70650. [PubMed: 23967082] Hoseini SM, Yousefi M, Hoseinifar SH, Van Doan H Cytokines' gene expression, humoral immune and biochemical responses of common carp ( Cyprinus carpio, Linnaeus, 1758) to transportation density and recovery in brackish water. Aquaculture, 2019; 504, 13-21. Pfaffl MW A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29. [PubMed: 11125041] Gr ö ner F, Zikova A, Kloās W. effect of the pharmaceutical diclofenac and metoprolol on gene expression levels of enzymes of biotransformation excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus). Comparative Biochemistry and Physiology Part C; Toxicology and Pharmacology, 167, 51-57. Midhun SJ, Neethu S, Arun D, Vysakh A, Divya L, Radhakrishnan EK, Jyothis M Dietary supplementation of Bacillus lisheniformis hga8b improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus. Aquaculture, 2019, 505, 289-296. Dong JJ, Wu F,Ye X, Sun CF, Tian YY, Lu MX, Zhang R, Chen ZH. Beta-Defensin in Nile tilapia (Oreochromis niloticus): Sequence, tissue expression, and anti-bacterial activity of synthetic peptides. Gene 2015, 566 (1), 23-31. Standen BT, Peggs DL, Rawling MD, Foey A, Davies SJ, Santos GA, Merrifield DL Dietary administration of a commercial mixed –species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish and shellfish Immunology, 2016, 49, 427-435. Ming C, Rui W, Liping L, Huang T, Weiyi H. Jain L et al., Sequence and evolution differences of Oreochromis niloticus CXC contribute to the diversification of cellular immune response in tilapias with treatment of streptococcus iniae . J Amin Vet Adv 2013, 12 (3): 303-311 Yuan JS, Reed A, Chen F, Stewart CN Statistical analysis of real-time PCR data. BMC Bioinformatics 2006; 7:85. Tort L Stress and immune modulation in fish. Dev. Comp. Immunol. 2011; 35 (12), 1366–1375. Van Kemenade B, Chadzinska M The impact of stress on immune regulation. Wszechswiat, 2009. Skomal GB, Mandelman JW The physiological response to anthropogenic stressors in marine elasmobranch fishes: a review with a focus on the secondary response. Comparative Biochemistry and Physiology, 2012; 162A:146–155. McDonald G, Milligan L Ionic, osmotic and acid-base regulation in stress in Fish Stress and Health in Aquaculture. Cambridge: Cambridge University Press, 1997 Sumpter JP The endocrinology of stress,” in Fish Stress and Health inAquaculture, Soc. Exp. Biol. Seminar, Cambridge: Cambridge University Press, 1997; 95–118. Gomes LC, Araujo-Lima CARM, Roubach AR Chippari-Gomes NP Lopes, Urbinati EC Effect of fish density during transportation on stress and mortality of juvenile tambaqui colossoma macropomum. Journal of the World Aquaculture Society, 2003; 34(1):76–84. Sherif AH, Eldessouki EA, Sabry NM, Ali NG The protective role of iodine and MS-222 against stress response and bacterial infections during Nile tilapia (Oreochromis niloticus) transportation. Aquac. Int. In press. 2022 Johansson ME, Hansson GC Immunological aspects of intestinal mucus and mucins. Nature Reviews Immunology, 2016; 16(10), 639-649. Hoseinifar SH, Mirvaghefi A, Amoozegar MA, Sharifian M, Esteban MA Modulation of Innate Immune Response, Mucosal Parameters and Disease Resistance, 2015. Noga EJ, Ullal AJ, Corrales J, Fernandes JM Application of antimicrobial polypeptide host defenses to aquaculture: Exploitation of down regulation and up regulation responses. Comp. Biochemistry and Physiology Part D: Genomics and Proteomics, 2011; 6 (1), 44-54 Hong S, Peddie S, Campos-Pérez JJ, Zou J, Secombes CJ The effect of intraperitoneally Administered ce in Rainbow Trout (Oncorhynchus Mykiss) Upon Synbiotic Feeding. Fish Shellfish Immun., 2003; 45:27–32. Zhulling R, Wang S, Yan C, Yue W, Liangjin T, Jingqui L, Shaoqun W, Liu J, Weiliang G, Yangcan Z G Effects of dietary mannan oligosaccharide supplementation on growth performance, antioxidant capacity, non-specific immunity and immune-related gene expression of juvenile hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus. March, July 2020; OI 529:735642. 10.1016/j.aquaculture. 2020735642 Fiona S , Julia RD β-Defensins: Multifunctional Modulators of Infection, Inflammation and More. J Innate Immun, 2012; 4 (4): 337–348. Claire H Holland , John D Lambris The complement system in teleosts Fish Shellfish Immunol. 2002; May; 12 (5): 399-420. doi: 10.1006/fsim.2001.0408. Li J, Sultan Y, Sun Y, Zhang S, Liu Y, Li X Expression analysis of Hsp90α and cytokines in zebrafish caudal fin regeneration. Dev. Comp. Immunol. 2021; 116 , 103922 Zhang A, Chen D, Wei H, Du L, Zhao T, Wang X, Zhou H Functional characterization of TNF-α in grass carp head kidney leukocytes: Induction and involvement in the regulation of NF-κB signaling. Fish Shellfish Immunol., 2012; 33, 1123–1132. Garcia-Castillo J, Chaves-Pozo E, Olivares P, Pelegrin P, Meseguer J, Mulero V The tumor necrosis factor alpha of the bony fish seabream exhibits the in vivo proinflammatory and proliferative activities of its mammalian counterparts, yet it functions in a species-specific manner. Cell Mol. Life Sci. , 2004; 61, 1331–1340 . Zou J, Secombes C.J, Long S, Miller N, Clem LW, Chinchar VG Molecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus). Dev. Comp. Immunol., 2003; 27, 845–858. Gabriel Olmos, Jerònia Lladó Tumor Necrosis Factor Alpha: A Link between Neuroinflammation and Excitotoxicity. Hindawi Publishing Corporation, 2014; Mediators of inflammation, Article ID 861231. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 06 Sep, 2024 Read the published version in BMC Veterinary Research → Version 1 posted Editorial decision: Revision requested 12 Apr, 2024 Submission checks completed at journal 06 Apr, 2024 Editor assigned by journal 06 Apr, 2024 First submitted to journal 16 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4113606","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":288163992,"identity":"02869a94-8b04-4300-b54c-cc7a967d91d4","order_by":0,"name":"Mohamed Abd El Aziz Ahmed Abd El-Galil","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABXklEQVRIie2RMWvCQBSAnxzE5UrWk5T4CwongUjJ4F+5IJjlhEJBHCRYBF1su1pc+hP0H5wcxCVoxwM7pHR1CB2KUCpNdDGttHQrNN/w7h6P7969O4CcnD8JTgMCIEAhStNid1+gu6j9oLA0xQJA/EZJNux75WxwPXtRbQf0cW8asY5/Wr5bV55j8M1qcf4AcUuCrt8fKna4qBs89IA8BpeUBRoujLlFBUjrfMgvCqOFhNIoyiiKU6PZlwCK24RpGCOj0SAChDsRnKGTpESV+KRYb82thLLi1Q3bEqyVAm8jwHcnyzVD74lS+6LYRrObHsVtcPsUY4KCZHzkTpQnUCHtonezs4S2wwMPV5JZiHvDMMF1SUIqLarWMBsuPExU5sXs+dBa8Y5jmqveNI5f/Vp5MLuK223fpEvvKdq0HFO/zVws8zsH7D4FU7ErEXZMOUox2q/60S45OTk5/4YPVBt/EZlY2eQAAAAASUVORK5CYII=","orcid":"","institution":"Sohag University","correspondingAuthor":true,"prefix":"","firstName":"Mohamed","middleName":"Abd El Aziz Ahmed Abd","lastName":"El-Galil","suffix":""},{"id":288163993,"identity":"e2f8fe01-6027-4d49-b4ca-1e62c87b3ed0","order_by":1,"name":"Hala Ali Alsagheer Abd-Elaal Hassan","email":"","orcid":"","institution":"Sohag University","correspondingAuthor":false,"prefix":"","firstName":"Hala","middleName":"Ali Alsagheer Abd-Elaal","lastName":"Hassan","suffix":""},{"id":288163994,"identity":"52228149-f906-47dc-a2c9-5e952630ad4a","order_by":2,"name":"Fatma Elzahraa Abd Alhamed Ahmed","email":"","orcid":"","institution":"Sohag University","correspondingAuthor":false,"prefix":"","firstName":"Fatma","middleName":"Elzahraa Abd Alhamed","lastName":"Ahmed","suffix":""},{"id":288163995,"identity":"4394e449-8935-45be-aad0-581c18507b29","order_by":3,"name":"Mohamed Abd Allah Mousa","email":"","orcid":"","institution":"Sohag University","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Abd Allah","lastName":"Mousa","suffix":""},{"id":288163996,"identity":"ee095751-7c26-4ae2-90f2-f684b0a1ac04","order_by":4,"name":"Arafah M. Emam","email":"","orcid":"","institution":"National Institute of Oceanography and Fisheries","correspondingAuthor":false,"prefix":"","firstName":"Arafah","middleName":"M.","lastName":"Emam","suffix":""},{"id":288163997,"identity":"8806aa80-52e9-41d1-93e5-43b9b81bddb1","order_by":5,"name":"Ahmed Elsayed Osman","email":"","orcid":"","institution":"Sohag University","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"Elsayed","lastName":"Osman","suffix":""}],"badges":[],"createdAt":"2024-03-16 14:30:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4113606/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4113606/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12917-024-04194-6","type":"published","date":"2024-09-06T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54486521,"identity":"fbc7ab00-c63f-4d87-95bc-c32a2c1b4d3a","added_by":"auto","created_at":"2024-04-11 09:22:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":146234,"visible":true,"origin":"","legend":"\u003cp\u003eshowing\u003cstrong\u003e \u003c/strong\u003eCortisol values in all experimental groups at the sampling times and the significant differences compared to the control group\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/1d786aa52c6d76063e79aaf0.png"},{"id":54486522,"identity":"186eed0f-8ae7-4e8f-95c5-c5cd0d6e2cdb","added_by":"auto","created_at":"2024-04-11 09:22:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":160855,"visible":true,"origin":"","legend":"\u003cp\u003eshowing cortisol values in all experimental groups at sampling times as well as the interaction between group-time factors and the significant differences compared to PT2 group.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/6a48f64f6aea7bcb68c0bbd9.png"},{"id":54486523,"identity":"5535486e-0319-4fb0-8879-3b032c6877ce","added_by":"auto","created_at":"2024-04-11 09:22:12","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":67415,"visible":true,"origin":"","legend":"\u003cp\u003eMUC2 gene expression in all experimental groups at the sampling times and the interaction between group-time factors and the significant differences vs. PT2 group.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/e6d5f77fefb7dfd002dfe01c.png"},{"id":54486524,"identity":"b3579587-b894-40dd-a713-4816c82f9dc0","added_by":"auto","created_at":"2024-04-11 09:22:13","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":176798,"visible":true,"origin":"","legend":"\u003cp\u003eshowing βD-1 and βD-2 genes expression in all experimental groups at the sampling times, the interaction between group- time factors and the significant differences vs. PT2 group\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/7bf914c13b9655080fbd8366.png"},{"id":54487271,"identity":"3b06280f-91bc-4601-bda3-0d1ce07d33da","added_by":"auto","created_at":"2024-04-11 09:30:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":59969,"visible":true,"origin":"","legend":"\u003cp\u003eshowing TNF-α measurement in all experimental groups at different times and the\u003c/p\u003e\n\u003cp\u003einteraction between group-time factors and the significant differences vs PT2 group\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/0ce1fc714a01e11205b70ebd.png"},{"id":54486526,"identity":"e06994e7-e4ae-43b8-aa40-3c070517d8ed","added_by":"auto","created_at":"2024-04-11 09:22:13","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":138296,"visible":true,"origin":"","legend":"\u003cp\u003eIL-1β gene expression measurements in all experimental groups and the interaction between group-time factors and the significant differences vs. the PT2 group.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/6168df71801e02b2df2e0abd.jpeg"},{"id":64186077,"identity":"28d954c0-cc48-4c08-a3c5-1b504934bc7f","added_by":"auto","created_at":"2024-09-09 16:24:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2066193,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4113606/v1/d50ed213-1e44-496a-84f0-e4143fbc267a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of transportation in freshwater and brackish water on Oreochromis niloticus (Nile tilapia) resistance","fulltext":[{"header":"Background","content":"\u003cp\u003eThe Nile tilapia was initially introduced in developing countries to meet protein demands [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and it has great economic value and potential for farming and development [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Nile tilapia is resistant to environmental conditions and diseases, grows rapidly and adapts to various aquaculture methods, it has relatively low production cost [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Improving fish welfare is directly linked to the advancement of fish aquaculture industry. This is because better fish growth is associated to low-stress conditions through lives. Live fish transportation is a common work in aquaculture facilities, but it can activate the stress responses that compromise fish welfare. The impact of transportation stress is influenced by many factors including time, temperature, fish size and health, stocking density, stress level, and packing method [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]; [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] and [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Unfortunately, transportation stress also affects water quality as well as fish productivity and survival [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTransport stress is one of the factors that raise cortisol level, which activate gluconeogenesis, this process increases glucose levels to provide the energy needed to handle the stress [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Increased production of cutaneous mucosal secretions in response to stress has been observed many fish species [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Mucin genes were found to be significantly up-regulated in fish after transportation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] and [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. β-defensins have various activities including antibacterial, antiviral, chemotactic, immune-modulatory, and reproductive regulation. Interleukin-1 is a pro-inflammatory cytokine that plays an important role in fish immunity by activating lymphocytes and phagocytic cells. The TNF-α family is involved in regulating leukocyte homing, proliferation and migration.\u003c/p\u003e \u003cp\u003eReducing stress during transportation is an essential factor for supporting fish growth and survival rates [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] and [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Several studies have been conducted on the topic of reducing stress during transportation through using supplementary diet such as probiotics [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], turmeric [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], glycine [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], anesthetics [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] and in the addition of salt to transport water [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] and [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Adding NaCl to transport water is a common practice in freshwater fish farms to mitigate the adverse effect of transport [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Salt is cheap and easy to use in fish farms and it helps alleviate osmoregulation troubles during transport [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]; [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This study aims to investigate the effect of 5 hours transportation in freshwater and water containing 5gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 10gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e NaCl on \u003cem\u003eO. niloticus\u003c/em\u003e resistance as well as the stress mitigation effect of NaCl.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics approval\u003c/h2\u003e \u003cp\u003e The protocols of this study were following the ethical consideration of experimental animals and approved by the Veterinary Medical Ethics Research Committee- Faculty of Veterinary Medicine at Sohag University, Egypt, approval number Soh.un.vet/00016 M2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eFish\u003c/h2\u003e \u003cp\u003e \u003cem\u003eO. niloticus\u003c/em\u003e (average body weight was 53\u0026thinsp;\u0026plusmn;\u0026thinsp;3 g) were obtained from Wadi Samhod Tilapia\u003c/p\u003e \u003cp\u003ePrivate Farm in the New Vally Governorate, Egypt\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eTransportation experiment\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cem\u003eO. niloticus\u003c/em\u003e was divided into 4 groups, 50 fish for each, the 1st group served as the control group (P1), the 2nd fish group was transported in water without salt (PT2) and the 3rd fish group was transported in water containing 5gL\u003csup\u003e-1\u003c/sup\u003e Nacl (PT3) and the 4th fish group was transported in water containing 10gL\u003csup\u003e-1\u003c/sup\u003e Nacl (PT4). The transportation water was obtained directly from the farm pond. The fish were transported for 5 hours at stocking density of 26.5gL\u003csup\u003e-1\u003c/sup\u003e and with continuous aeration; they were transported without sedation or rest. Each fish group was transported in a separate tank with 180L capacity, containing 100 L of water. Once the fish reached to the Wet Lab. of Fish Diseases and Management Dept., Faculty of Veterinary Medicine, Sohag University, the fish were removed from the transport water to clean freshwater and each group was kept in a separate tank during the sampling time.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSampling\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eBlood and skin samples were collected from the control group (P 1) only before transportation, and from the PT 2, PT 3 and PT 4 groups at 0 h, 12 h and 24 h. post transportation, 5 fish from each experimental group were sampled at each determined time point. The fish were anesthetized with MS-222 (150 mgL\u003csup\u003e-1\u003c/sup\u003e) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] before blood and skin sampling, the blood samples were left to clot at room temperature for sera collection, which was stored at -80\u0026deg;C until analysis. Skin samples were collected and preserved in RNA \u003cem\u003elader\u003c/em\u003e and stored at -80\u0026deg;C for gene expression studies [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCortisol level\u003c/h2\u003e \u003cp\u003eThe quantity of serum cortisol was determined using ELISA method from a commercial kit (DRG\u003c/p\u003e \u003cp\u003eCortisol ELISA EIA‒1887, Germany). Absorbance readings were taken using a spectrophotometer with a wavelength of 500 nm (HITACHI, U‒2001).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eGene expression studies\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the skin of \u003cem\u003eO. niloticus\u003c/em\u003e from control, PT 2, PT 3 and PT 4 using Trizol. 1 \u0026micro;g of total RNA was denatured at 65\u0026deg;C for 5 minutes in the presence of 1 \u0026micro;l of oligo-dT17, 1 \u0026micro;l of dNTP (deoxynucleoside triphosphate mix 10 mM (Promega) and RNA/DNA free water (Sigma) in a volume of 13 \u0026micro;l to synthesize cDNA,. The synthesis was carried out using 1 \u0026micro;l of Superscript III reverse transcriptase enzyme (Invitrogen), 5 \u0026micro;l of 5x first strand buffer, 1 \u0026micro;l 0.1 M DTT and water to reach final volume of 25 \u0026micro;l. The mixture was then incubated at 55\u0026deg;C for 1 h. The resulting cDNA was stored at \u0026minus;\u0026thinsp;20\u0026deg;C. The expression of the mucin2 gene (MUC2), antimicrobial peptides (βD1 and 2) and cytokines (IL-1β and TNF-α) was examined before and after transport using RT-qPCR with specific primers (Table\u0026nbsp;1). For the qPCR, 3 \u0026micro;l of a diluted cDNA template was used following the procedures described by [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The relative expression levels of the genes were determined using the Pfaffl method [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] as previously explained [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/p\u003e \u003cp\u003e \u003cb\u003eTable\u0026nbsp;(1)\u003c/b\u003e Oligonucleotide primers were used in SYBR Green real time PCR.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eEF-1α\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTCAACGCTCAGGTCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGr\u0026ouml;ner \u003cem\u003eet al\u003c/em\u003e., 2015 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTGGGCAGTGTGGCAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eMUC2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAACTGTTTTTGAGACAACTTCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMidhun \u003cem\u003eet al\u003c/em\u003e., 2019 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGAAGTGACCGTGGAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eβD-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCGCATTGTGTCCTCTGCTCCGTTCGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDong \u003cem\u003eet al\u003c/em\u003e., 2015 [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAACAGACAGATCCACATCAAACCCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eβD-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGACAGCAGTGCAAGCTGATGACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTaccki \u003cem\u003eet al\u003c/em\u003e., 2015 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAAAGCACAGCATCTTAATCTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eTNF alpha\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAGAAGCACTAAAGGCGAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eStanden \u003cem\u003eet al\u003c/em\u003e., 2016 [ 32]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTGGCTTTGCTGCTGATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eIL-1\u0026szlig;\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGCAGCAATTCAGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMing \u003cem\u003eet al\u003c/em\u003e., 2013 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTGCTGATGTACCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnalysis of the SYBR green Rt-PCR results.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAmplification curves and CT values were determined by the stratagene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the control group according to the \"ΔΔCt\u0026rdquo; method [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eResults are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SE). Data analysis was performed in GraphPad Prism version 5.0 including normality tests. All data were normally distributed. Statistically significant differences were considered when p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The qPCR measurements were analyzed by T-test to identify statistically significant differences between groups. One-way ANOVA and Tukey post-hoc analysis test were performed to identify statistically significant differences among groups.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCortisol level\u003c/h2\u003e \u003cp\u003eThe serum cortisol level of the control \u003cem\u003eO. niloticus\u003c/em\u003e group (P 1) was 11.07\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0 \u0026micro;gdl\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e. It significantly increased in the PT 2 group at 0h, decreased greatly but still significantly higher than P 1 group at 12h and comes back to the basal level without significant difference at 24 h post transportation compared to the control group. However It remains around the basal level and non significantly increases in the PT 3 and PT 4 groups comparing with the P 1 group at all point times and significantly decreases in the PT 3 and PT 4 groups comparing with PT 2 group at all point times, (Table- 2 and Figures \u0026minus;\u0026thinsp;1 and 2)\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;(2)\u003c/strong\u003e \u003cp\u003eshowing Cortisol values in all experimental groups at the point times and the significant differences compared to the control group.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabb\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFish group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCortisol level (\u0026micro;g/dl)\u003c/p\u003e \u003cp\u003e(Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT1 (Control group)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBefore transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.02\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2 ( without Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3 ( 5 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.70\u0026thinsp;\u0026plusmn;\u0026thinsp;.31\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4 ( 10 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e12 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.03\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.07\u0026thinsp;\u0026plusmn;\u0026thinsp;0.72\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.46\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.96\u0026thinsp;\u0026plusmn;\u0026thinsp;1.55\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003csup\u003e*\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, \u003csup\u003e**\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001 and ns\u0026thinsp;=\u0026thinsp;non significant\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGene\u0026rsquo;s expression\u003c/h2\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003eMUC2 gene expression\u003c/h2\u003e \u003cp\u003eThe expression of MUC2 gene \u003cem\u003ein O. niloticus\u003c/em\u003e non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24 h. (Table \u0026minus;\u0026thinsp;3 and Figure \u0026minus;\u0026thinsp;3).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;(3)\u003c/strong\u003e \u003cp\u003eshowing MUC2 gene expression in all experimental groups at the point times and the significant differences compared to the control group.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabc\" border=\"1\"\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFish group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEF1α\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eMuc-2\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003cp\u003e(Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP1 (Control group)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBefore transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2 ( without Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3 ( 5gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4 ( 10gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.74\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e12 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.78***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e19.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.94***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.870.54***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003e* p\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01 *** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001 and ns\u0026thinsp;=\u0026thinsp;non- significant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAntimicrobial peptides (β Defensin\u0026ndash; 1 and β Defensin \u0026minus;\u0026thinsp;2)\u003c/h2\u003e \u003cp\u003eThe expression of the antimicrobial peptides βD-1 and 2 genes at 0 h post transportation non-significantly down-regulated in the PT 2 group and dramatically and significantly up regulated in the PT 3 and PT 4 groups comparing with the P 1 control group. At 12 h, they significantly down regulated in the PT 2 group and non-significant down regulation in the PT 3 and PT 4 groups matching with P 1 control group. At 24 h post transportation they significantly down regulated in the PT 2 and PT 3 groups and non-significant down regulation in the PT 4 group comparing with the P 1 group. Matching with the PT 2 group; the βD-1 and 2 significantly up regulated in the PT 3 and PT 4 groups at 0 h post transportation, and they non significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h post transportation. (Table \u0026minus;\u0026thinsp;4 and Figure- 4).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;(4)\u003c/strong\u003e \u003cp\u003eshowing βD-1 and βD-2 genes expression in all experimental groups at point times and the significant differences compared to the control group.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabd\" border=\"1\"\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFish group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEF1α\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eβD-1\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e\u003cem\u003eβD-2\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change (Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003cp\u003e(Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP1 - Control group\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBefore transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2 (without Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e21.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.82\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3 (5 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nac)l\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e20.59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4 (10 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e18.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.91\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e12 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08*\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e22.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e22.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.64\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e22.00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e25.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05***\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e25.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03**\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05*\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05ns\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05ns\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003e* p\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.01 *** \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001 and ns\u0026thinsp;=\u0026thinsp;non- significant.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eTumor Necrosis Factor (TNF) gene expression\u003c/h2\u003e \u003cp\u003eThe expression of the TNF- alpha gene in \u003cem\u003eO. niloticus\u003c/em\u003e was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups compared to the control group at 0 h post transportation. However at 12 and 24 h post transportation; there was a significant up regulation in gene expression in the PT 2, PT 3 and PT 4 groups. Matching with PT 2 group, TNF non significantly down regulated in the PT 3 group and significantly down regulated in the PT 4 group at 0 h post transportation, however at 12 and 24 h post transportation it significantly down regulated in the PY 3 and PT 4 groups. (Table \u0026minus;\u0026thinsp;5 and Figure- 5).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;(5)\u003c/strong\u003e \u003cp\u003eshowing TNF gene expression in all experimental groups at the point times and the significant differences vs. the control group\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabe\" border=\"1\"\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFish group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eEF1α\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eTNF alpha\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFold change\u003c/p\u003e \u003cp\u003e(Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP1 ( Control group)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eBefore transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2 ( without Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e0 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.73\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3 ( 5gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.81\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4 ( 10gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Nacl)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e12 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.71\u0026thinsp;\u0026plusmn;\u0026thinsp;0.59 ***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20 ***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20 *\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003cp\u003epost transport\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.85 ***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePT4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21.76\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09***\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e* \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05, ***\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.001 and ns\u0026thinsp;=\u0026thinsp;non- significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003cp\u003e\u003cstrong\u003eInterleukin -1\u0026beta; (IL-1\u0026beta;) gene expression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results showed that the expression of IL-1\u0026beta; gene in \u003cem\u003eO. niloticus\u003c/em\u003e was non significantly up-regulated in the PT 2 group and also not significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation. However, at 12 and 24 h post transportation there was significant up regulated of IL-1\u0026beta; in the PT 2 and PT 4 fish groups group and non-significant up regulation in the PT 3 group comparing with the P 1 group. The IL-1\u0026beta; gene expression significantly up regulated in the PT 2, PT 3 and PT 4 fish groups compared to P 1 fish group at 24 h post transportation. Matching with the PT 2 group; the IL-1\u0026beta; gene expression non significantly down regulated at 0 h post transportation and significantly up regulated at 12 and 24 h post transportation in the PT 3 and PT 4 fish groups (Table -6 and Figure- 6).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;Table (6):\u003c/strong\u003e showing IL-1\u0026beta; gene expression in all experimental groups at the sampling times, the interaction between group-time factors and the significant differences vs. the control group\u0026nbsp;\u003c/p\u003e\n\u003ctable dir=\"rtl\" border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"97%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"38.144329896907216%\" colspan=\"2\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cem\u003eIL-1\u0026beta;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e\u003cem\u003eEF1\u0026alpha;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\" rowspan=\"2\"\u003e\n \u003cp dir=\"LTR\"\u003eTime\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.8659793814433%\" rowspan=\"2\"\u003e\n \u003cp dir=\"LTR\"\u003eFish group\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"57.4468085106383%\"\u003e\n \u003cp dir=\"LTR\"\u003eFold change\u0026nbsp;(Mean\u0026plusmn;SE)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.27659574468085%\"\u003e\n \u003cp dir=\"LTR\"\u003eCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.27659574468085%\"\u003e\n \u003cp dir=\"LTR\"\u003eCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.835051546391753%\"\u003e\n \u003cp dir=\"LTR\"\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e21.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e19.36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\"\u003e\n \u003cp dir=\"LTR\"\u003eBefore transport\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.8659793814433%\"\u003e\n \u003cp dir=\"LTR\"\u003eP1 (Control group)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.835051546391753%\"\u003e\n \u003cp dir=\"LTR\"\u003e1.20\u0026plusmn; 0.14 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e21.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e19.34\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\" rowspan=\"3\"\u003e\n \u003cp dir=\"LTR\"\u003e0 h\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003epost transport\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.8659793814433%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT2 (without Nacl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e0.78\u0026plusmn;0.05 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e23.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT3 (5gL\u003csup\u003e-1\u003c/sup\u003e Nacl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e0.54\u0026plusmn;0.07 \u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e22.62\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e19.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT4 (10gL\u003csup\u003e-1\u003c/sup\u003e\u0026nbsp; Nacl)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.835051546391753%\"\u003e\n \u003cp dir=\"LTR\"\u003e8.84\u0026plusmn;0.74***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e18.41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e19.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\" rowspan=\"3\"\u003e\n \u003cp dir=\"LTR\"\u003e12 h\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003epost transport\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.8659793814433%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e2.05\u0026plusmn;0.13*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e21.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e1.47\u0026plusmn;0.18\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e21.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.835051546391753%\"\u003e\n \u003cp dir=\"LTR\"\u003e15.89\u0026plusmn;1.30***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e18.17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"10.309278350515465%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.68041237113402%\" rowspan=\"3\"\u003e\n \u003cp dir=\"LTR\"\u003e24 h\u003c/p\u003e\n \u003cp dir=\"LTR\"\u003epost transport\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.8659793814433%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e4.01\u0026plusmn;0.46***\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.66\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"36%\"\u003e\n \u003cp dir=\"LTR\"\u003e2.15\u0026plusmn;0.04*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e21.70\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"13.333333333333334%\"\u003e\n \u003cp dir=\"LTR\"\u003e20.72\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.333333333333336%\"\u003e\n \u003cp dir=\"LTR\"\u003ePT4\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e* \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026le; 0.05, ***\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026le; 0.001, ****\u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026le; 0.0001 and ns =non- significant.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMany aquaculture operations involve the transportation of live fish from one facility to another or during restocking practices. It has been clarified that the immune response in stressed fish is suppressed [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Previous studies on the fish immune response to stress have primarily focused on systemic parameters such as blood cell counts and serum innate immune factors, while neglecting the role of skin immunity. In this study, we investigated the resistance of \u003cem\u003eO. niloticus\u003c/em\u003e particularly the skin to live transport as well as the stress mitigation effect of salt.\u003c/p\u003e \u003cp\u003eRegarding the serum cortisol, it was significantly increased at 0 h post transport in PT 2 group transported in water without salt compared to both P 1 control group and PT 3 and PT 4 fish groups transported in water containing salt. This elevation may be attributed to the stressful effect of transportation and the importance of cortisol during stress conditions as it elevates blood glucose and stimulate the central nervous system to restore fish body homeostasis [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These results are supported by [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] who mentioned that stressed trout had higher cortisol levels than the control group and [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who recorded that serum cortisol levels in \u003cem\u003eO. niloticus\u003c/em\u003e significantly increased after 5 h transportation in water without salt. A significant decrease in cortisol level was reported in the PT 3 and PT 4 fish groups compare to with PT 2 group at different sampling times, and similar findings were reported in common carp [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], matrinx˜a, \u003cem\u003eBrycon amazonicus\u003c/em\u003e [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and ruho carp, \u003cem\u003eLabeo rohita\u003c/em\u003e [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This may be indicate that salt minimizes the stressful effect of transportation and enhances fish hydro-mineral balance by reducing the osmolality differences between the transporting water and fish body [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Cortisol level significantly decreased and recovered to the basal level at 12 and 24 h post transportation in PT 2 fish groups. This result came in line with [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] who found that the cortisol elevation syndrome recovered after 24 h post stress in juvenile tambaqui \u003cem\u003ecolossoma macropomum\u003c/em\u003e and Nile tilapia.\u003c/p\u003e \u003cp\u003eThe expression of MUC2 gene \u003cem\u003ein O. niloticus\u003c/em\u003e non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and at 12 and 24 h, it significantly up regulated in the PT 3 and PT 4 groups. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24\u003c/p\u003e \u003cp\u003eMucins are important high molecular weight glycoproteins for the physical barrier, mucous viscosity and trapping pathogens in fish [42). The expression of MUC2 gene in the \u003cem\u003eO. niloticus\u003c/em\u003e of the PT 2 group was non significantly up-regulated at 0 h and significantly up-regulated at 12 and 24 h post transportation comparing with P 1 group, this up regulation may be attributed the stressful condition of transportation such as confinement, high ammonia level and shacking. This result is consistent with previous studies [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] who reported a significant up-regulation of mucin gene in trout fish post transportation and [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who stated that the expression of mucin2 gene was significantly up regulated in \u003cem\u003eO. niloticus\u003c/em\u003e after transportation. MUC2 gene expression of PT 3 and PT 4 groups transported in water containing salt was non significantly down regulated compared with P 1 group at 0 h post transportation. This down regulation may be attributed to the sodium chloride mitigates the transportation stress by decreasing the salinity difference between the fish body and the transporting water as well as controlling mucous secretion on the skin [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These results are consistent with [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who recorded significant down regulated of the MUC2 gene expression in \u003cem\u003eO. niloticus\u003c/em\u003e transported in water containing 5 gL\u003csup\u003e-1\u003c/sup\u003e compared with the fish group transported in water without salt. Additionally [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] and [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] reported an increased cutaneous mucosal secretions and significant up-regulation of mucin genes in response to transport stress.\u003c/p\u003e \u003cp\u003eAntimicrobial peptides are a component of the innate immune system of fish and found on the surface layer of epithelial tissues. They act as the first line of defense against various pathogenic invasions. The significant down-regulation of β D-1 and 2 genes expression in the skin of \u003cem\u003eO. niloticus\u003c/em\u003e transported in water without salt (PT 2 group) at 0, 12 and 24h post transportation may be attributed to the immune suppressive effect of transportation on skin immunity. Similar down regulation of βD-1 and 2 has been reported in rainbow trout [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e] and \u003cem\u003eO. niloticus\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who found that the transportation lead to a significant down regulation of βD -1 and 2 genes expression. The β D -1 and 2 gene expression was up-regulated in the PT 3 and PT 4 groups at 0 h post transportation compared to the PT 2 group, and this may be attributed to the salt mitigated the stress mitigation effect and alleviated the immune suppressive effect of transportation[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Moving \u003cem\u003eO. niloticus\u003c/em\u003e from transporting water containing salt to freshwater down regulated the expression of β D-1 and 2 genes and subsequently suppressed fish immunity at 12 and 24h post transportation. These results were supported by [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] who found that the addition of 3 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e salt to transportation water for common carp mitigated immunosuppression. The results of our work demonstrate that the expression of β defensin 1 and 2 genes could be used as early response marker to acute transportation stress.\u003c/p\u003e \u003cp\u003eThe TNF- α and IL-1β cytokines in teleost fish are powerful pro-inflammatory cytokines released by several immune cells during infection or tissue damage [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Overall, transportation stress increases the pro-inflammatory cytokines TNF- α, and IL-1β. The results of this study showed a significant up regulation in IL-1β gene expression of the PT 2 group transported in water without salt at 12 and 24 h post transport and non significant up regulation at 0 h. This result agrees with the results of [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] who reported up regulation of IL-1β gene expression in \u003cem\u003eO. niloticus\u003c/em\u003e transported for 5 h in water without salt. The significant up regulation of IL-1β in the PT 2 group indicates that the transported \u003cem\u003eO. niloticus\u003c/em\u003e in water without salt may be exposed to stressful condition which stimulates IL-1β production along the 24 h investigation time post transportation because the IL-1β acts as an immune and inflammatory response mediator in fish [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The IL-1β gene expression in the PT 3 and PT 4 groups down regulated at 0 h post transportation, that may be attributed to the up regulation of β D-1 and 2 in these groups, which have a fascinating ability to suppress the inflammatory response [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. The IL-1β gene expression up regulated in the PT 3 and PT 4 group at 12 and 24h post transportation, that may be attributed to the elevated cortisol level [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] and the down regulation of antimicrobial peptides β D-1 and 2 as a result of moving fish from water containing salt to freshwater.\u003c/p\u003e \u003cp\u003eFish TNF-α acts as regulator and amplifier for acute and chronic inflammation, it is one of the early immune genes that is expressed at the early stage of infection [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. It has overlapping functions with IL-1β and able to activate macrophages and enhance their microbial killing activity [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]; [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. TNF α gene expression of \u003cem\u003eO. niloticus\u003c/em\u003e in the PT 2 fish group was significantly up regulated at 12 and 24 h post transport and non significantly up regulated at 0 h compared with the P 1 group, that indicates the transportation increased the skin inflammatory reaction up to 24 h post transportation [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In contrast, TNF - α gene expression was down regulated in the PT 3 and PT 4 \u003cem\u003eO. niloticus\u003c/em\u003e groups at 0 h post transportation then up regulated at 12 and 24 h post transportation. This may explain the stress mitigation effect of salt during transportation which may extend up to 24 h post transportation.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConclusion\u003c/strong\u003e \u003cp\u003eThe \u003cem\u003eO. niloticus\u003c/em\u003e group transported in water without salt appeared higher transportation stress effects as evidenced by increased cortisol level and up regulation of Muc2, IL-1B and TNF genes as well as down regulation of β D-1 and 2. However, the addition of sodium chloride to the transportation water had a stress mitigation effect on O. niloticus. This was observed through improvements of fish physiology and mucosal health as well as enhanced skin mucous barrier and immunity; these improvements were more evident in the 5 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e group than 10 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e group. Therefore, it is recommended to use 5gL-1 salt during O. niloticus transportation as it is more beneficial and effective in reducing transportation stress. Further research is required to enhance the well-being of O. niloticus during the transportation process.\u003c/p\u003e \u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCT\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCycle Threshold \u003cb\u003eDNA\u003c/b\u003e:Deoxyribonucleic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIL-1β\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eInterleukin-1 \u003cb\u003eβ MS-222\u003c/b\u003e:Tricaine methanesulfonate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eMUC2\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMucin2 \u003cb\u003eO. niloticus\u003c/b\u003e:\u003cem\u003eOreochromis niloticus\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eRNA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRibonucleic acid \u003cb\u003eTNF\u003c/b\u003e:Tumor Necrosis Factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eβD-1\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eβDefinsin-1 \u003cb\u003eβD-2\u003c/b\u003e:βDefinsin-2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experiment was approved by the Veterinary Medical Ethics Research Committee, Faculty of Veterinary Medicine, Sohag University, Egypt (Code no. Soh.un.vet/00016 M2) and carried out in accordance with the guidelines and regulations issued by the Veterinary Ethics Research Committee, Faculty of Veterinary Medicine. This study follows the ARRIVE guidelines (https://arriveguidelines.org).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot published.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDatasets of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eI declare that the authors have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe Science, Technology and Innovation Funding Authority (STDF) in cooperation with the Egyptian Knowledge Bank (EKB) have provided open access funding.\u0026nbsp;This research was supported by the Faculty of Veterinary Medicine, Sohag University, Egypt.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor\u0026rsquo;s contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.A.A.A., H.A.A.A.H. and A.E.O. contributed to experimental design, sampling, methodology design, serum analysis and gene expression and wrote the draft of the manuscript. H.A.A.A.H., F.E.A.A., M.A.M., A.M.E. and A.E.O. contributed to the analysis of serum biochemical parameters and genes expression, prepared the tables and figures as well as contribute in the manuscript draft writing. All authors had read, revised and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to express their gratitude to the Faculty of Veterinary Medicine at Sohag University, Egypt for providing the research labs and experimental platform. Thanks a lot to STDF and EKB for their providing an open access funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMohamed Abd El Aziz Ahmed Abd El-Galil\u003c/p\u003e\n\u003ch3\u003eAuthors and Affiliations\u003c/h3\u003e\n\u003cp\u003eFish Diseases and Management Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt\u003c/p\u003e\n\u003cp\u003eMohamed Abd El Aziz Ahmed Abd El-Galil\u003c/p\u003e\n\u003cp\u003eHala Ali Alsagheer Abd-Elaal Hassan\u003c/p\u003e\n\u003cp\u003eZoology Department, Faculty of Sciences, Sohag University,\u0026nbsp;Sohag, Egypt\u003c/p\u003e\n\u003cp\u003eFatma Elzahraa Abd Alhamed Ahmed\u003c/p\u003e\n\u003cp\u003eNutrition and Clinical Nutrition Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt\u003c/p\u003e\n\u003cp\u003eMohamed Abd Allah Mousa\u003c/p\u003e\n\u003cp\u003eFish Diseases Department, National Institute of Oceanography and Fisheries, NIOF, Cairo, Egypt\u003c/p\u003e\n\u003cp\u003eArafah M. Emam\u003c/p\u003e\n\u003cp\u003eBiochemistry Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt\u003c/p\u003e\n\u003cp\u003eAhmed Elsayed Osman\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author;\u003c/strong\u003e Mohamed Abd El Aziz Ahmed Abd El-Galil\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003e\u003cstrong\u003eFAO \u003c/strong\u003eCultured Aquatic Species Information Program, Rome, Italy, \u003cstrong\u003e2022\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSuprayudi MA, Faisal B, Setiawati M \u003c/strong\u003eThe growth of red tilapia fed on organic‒selenium supplemented diet. Journal Akuakultur Indonesia, 2013; 12: 48‒53. \u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eIverson M, Finstad B, Mckinley RS, Eliassen RA, Carlsen KT, Evjen T \u003c/strong\u003eStress responses in Atlantic salmon Salmo salar L. smolts during commercial well boat transports and effects on survival after transfer to sea. Aquaculture, 2005; 243: 373‒382.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eAshley PJ \u003c/strong\u003eFish welfare current issues in aquaculture. Applied Animal Behavior Science, 2007, 104: 199‒235.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTang S, Thorarensen H, Brauner CJ, Wood CM, Farrell AP \u003c/strong\u003eModeling the accumulation of CO2 during high density re-circulating transport of adult Atlantic salmon, Salmo salar, from observations aboard a sea‒going commercial live‒haul vessel. Aquaculture, 2009; 296: 102‒109\u003cstrong\u003e.\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eEmmanuel BE, Fayinka DO, Aladetohun NF \u003c/strong\u003eTransportation and the effects of stocking density on the survival and growth of Nile tilapia Oreochromis niloticus (Linnaeus). World Journal Agricultural Sciences, 2013; 1: 001‒007.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eFaught E, Vijayan MM \u003c/strong\u003eMechanisms of cortisol action in fish hepatocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2016; 199, 136\u0026ndash;145.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003e\u0026Aacute;ngeles EM \u003c/strong\u003eAn overview of the immunological defenses in fish skin. International Scholarly Research Notices, 2012.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTacchi L, Lowrey L, Musharrafieh R, Crossey, K, Larragoite ET, Salinas I\u003c/strong\u003e Effects of transportation stress and addition of salt to transport water on the skin mucosal homeostasis of rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). \u003cem\u003eAquaculture\u003c/em\u003e. 2015; January 1; 435: 120\u0026ndash;127.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHanna Heba NS \u003c/strong\u003eEffect of transportation on skin immunity of Oreochromis niloticus. PhD, Fish Diseases and Management, Faculty of Veterinary Medicine, Sohag University, 2023.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eNavarro RD, Fran\u0026ccedil;a RP, Paludo GR, Bizarro YWS, Silva RF, Navarro FKSP \u003c/strong\u003ePhysiological and hematological responses of Nile tilapia Oreochromis niloticus to different anesthetics during simulated transport conditions. Actascitechnol, 2016; 38: 301‒306.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTaheri Mirghaed A, Ghelichpour M \u003c/strong\u003eEffects of anesthesia and salt treatment on stress responses, and immunological and hydromineral characteristics of common carp (Cyprinus carpio, Linnaeus, 1758) subjected to transportation. Aquaculture, 2019; 501: 1\u0026ndash;6.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGomes LC, Brinn RP, Marcon JL, Dantas LA, Brand\u0026tilde;ao FR, De Abreu JS, Lemos PEM, McComb DM, Baldisserotto B \u003c/strong\u003eBenefits of using the probiotic Efinol\u0026reg;L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon. Aquac. Res. 2009; 40, 157\u0026ndash;165.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eda Silva E, de Moraes AV, Pereira MDO, Bittencourt M, Weber RA, Jatob\u0026acute;a A\u003c/strong\u003e Autochthonous and allochthonous dietary probiotics mitigate acute stress in Astyanax bimaculatus during transport. Aquac. Res. 2022; 53, 3253\u0026ndash;3256.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHoseini SM, Gupta SK, Yousefi M, Kulikov EV, Drukovsky SG, Petrov AK, Taheri Mirghaed A, Hoseinifar SH, Van Doan H \u003c/strong\u003eMitigation of transportation stress in common carp, Cyprinus carpio, by dietary administration of turmeric. Aquaculture, 2022b; 546, 737380.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHoseini SM, Majidiyan N, Mirghaed AT, Hoseinifar SH, Van Doan H \u003c/strong\u003eDietary glycine supplementation alleviates transportation-induced stress in common carp, Cyprinus carpio. Aquaculture, 2022a; 551, 737959.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSantos ELR, Rezende FP, Moron SE \u003c/strong\u003eStress-related physiological and histological responses of tambaqui (Colossoma macropomum) to transportation in water with tea tree and clove essential oil anesthetics. Aquaculture, 2020; 523, 735164. \u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eFerreira AL, Favero GC, Boaventura TP, de Freitas Souza C, Ferreira NS, Descovi SN, Baldisserotto B, Heinzmann BM, Luz RK \u003c/strong\u003eEssential oil of Ocimum gratissimum (Linnaeus, 1753): efficacy for anesthesia and transport of Oreochromis niloticus. Fish. Physiol. Biochem., 2021; 47, 135\u0026ndash;152.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBoaventura TP, Pedras PPC, J\u0026uacute;lio GSC, dos Santos FAC, Ferreira A L, de Souza Silva W, Luz RK \u003c/strong\u003eUse of eugenol, benzocaine or salt during the transport of panga, Pangasianodon hypophthalmus (Sauvage, 1878): effects on water quality, haematology and blood biochemistry. Aquac. Res., 2022; 53, 1395\u0026ndash;1403.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTakata R, Luz RK\u003c/strong\u003e Aquicultura no Brasil: novas perspectivas, Techniques for aquatic animals; Tavares-Dias M, Mariano WS (eds.). 2015; pp: 523-543. Editora Pedro \u0026amp; Jo\u0026atilde;o, S\u0026atilde;o Carlos.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eCrosby TC, Hill JE, Watson CA, Yanong RP, Strange R \u003c/strong\u003eEffects of tricaine methane sulfonate, Hypno, metomidate, quinaldine, and salt on plasma cortisol levels following acute stress in three spot gourami Trichogaster trichopterus. J. Aquat Anim. Health, 2006; 18:58\u0026ndash;63.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eOyoo-Okoth E, Cherop L, Ngugi CC \u003c/strong\u003eSurvival and physiological response of Labeo victorianus (Pisces: Cyprinidae, Boulenger 1901) juveniles to transport stress under a salinity gradient. Aquaculture, 2011; 319, 226\u0026ndash;231.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eBiswal A, Srivastava PP, Pal P, Gupta S, Varghese T, Jayant M \u003c/strong\u003eA multi-biomarker approach to evaluate the effect of sodium chloride in alleviating the long-term transportation stress of Labeo rohita fingerlings. Aquaculture, 2021; 531, 735979.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eNeiffer DL, Stamper MA \u003c/strong\u003eFish sedation, anesthesia, analgesia, and euthanasia: considerations, methods, and types of drugs. ILAR J, 2009; 50:343\u0026ndash;360\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTacchi L, Larragoite E, Salinas I \u003c/strong\u003eDiscovery of J Chain in African Lungfish Protopterus dolloi, Sarcopterygii) Using High Throughput Transcriptome Sequencing: Implications in Mucosal Immunity. PLoS One. 2013; 8:e70650. [PubMed: 23967082]\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHoseini SM, Yousefi M, Hoseinifar SH, Van Doan H\u003c/strong\u003e Cytokines\u0026apos; gene expression, humoral immune and biochemical responses of common carp (\u003cem\u003eCyprinus carpio,\u003c/em\u003e Linnaeus, 1758) to transportation density and recovery in brackish water. Aquaculture, 2019; 504, 13-21.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003ePfaffl MW\u003c/strong\u003e A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29. [PubMed: 11125041]\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGr\u003c/strong\u003e\u003cstrong\u003e\u0026ouml;\u003c/strong\u003e\u003cstrong\u003ener F, Zikova A, Kloās W. \u003c/strong\u003eeffect of the pharmaceutical diclofenac and metoprolol on gene expression levels of enzymes of biotransformation excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus). Comparative Biochemistry and Physiology Part C; Toxicology and Pharmacology, 167, 51-57.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eMidhun SJ, Neethu S, Arun D, Vysakh A, Divya L, Radhakrishnan EK, Jyothis M \u003c/strong\u003eDietary supplementation of Bacillus lisheniformis hga8b improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus. Aquaculture, 2019, 505, 289-296.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eDong JJ, Wu F,Ye X, Sun CF, Tian YY, Lu MX, Zhang R, Chen ZH.\u003c/strong\u003e Beta-Defensin in Nile tilapia (Oreochromis niloticus): Sequence, tissue expression, and anti-bacterial activity of synthetic peptides. Gene 2015, 566 (1), 23-31.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eStanden BT, Peggs DL, Rawling MD, Foey A, Davies SJ, Santos GA, Merrifield DL \u003c/strong\u003eDietary administration of a commercial mixed \u0026ndash;species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish and shellfish Immunology, 2016, 49, 427-435.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eMing C, Rui W, Liping L, Huang T, Weiyi H. Jain L et al., \u003c/strong\u003eSequence and evolution differences of \u003cem\u003eOreochromis niloticus\u003c/em\u003e CXC contribute to the diversification of cellular immune response in tilapias with treatment of \u003cem\u003estreptococcus iniae\u003c/em\u003e. J Amin Vet Adv 2013, 12 (3): 303-311 \u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eYuan JS, Reed A, Chen F, Stewart CN \u003c/strong\u003eStatistical analysis of real-time PCR data. BMC Bioinformatics 2006; 7:85.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eTort L \u003c/strong\u003eStress and immune modulation in fish. Dev. Comp. Immunol. 2011; 35 (12), 1366\u0026ndash;1375. \u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eVan Kemenade B, Chadzinska M \u003c/strong\u003eThe impact of stress on immune regulation. Wszechswiat, 2009.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSkomal GB, Mandelman JW \u003c/strong\u003eThe physiological response to anthropogenic stressors in marine elasmobranch fishes: a review with a focus on the secondary response. Comparative Biochemistry and Physiology, 2012; 162A:146\u0026ndash;155.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eMcDonald G, Milligan L \u003c/strong\u003eIonic, osmotic and acid-base regulation in stress in Fish Stress and Health in Aquaculture. Cambridge: Cambridge University Press, 1997\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSumpter JP \u003c/strong\u003eThe endocrinology of stress,\u0026rdquo; in Fish Stress and Health inAquaculture, Soc. Exp. Biol. Seminar, Cambridge: Cambridge University Press, 1997; 95\u0026ndash;118.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGomes LC, Araujo-Lima CARM, Roubach AR Chippari-Gomes NP Lopes, Urbinati EC \u003c/strong\u003eEffect of fish density during transportation on stress and mortality of juvenile tambaqui colossoma macropomum. Journal of the World Aquaculture Society, 2003; 34(1):76\u0026ndash;84.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eSherif AH, Eldessouki EA, Sabry NM, Ali NG \u003c/strong\u003eThe protective role of iodine and MS-222 against stress response and bacterial infections during Nile tilapia (Oreochromis niloticus) transportation. Aquac. Int. In press. 2022\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eJohansson ME, Hansson GC\u003c/strong\u003e Immunological aspects of intestinal mucus and mucins. Nature Reviews Immunology, 2016; 16(10), 639-649.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHoseinifar SH, Mirvaghefi A, Amoozegar MA, Sharifian M, Esteban MA \u003c/strong\u003eModulation of Innate Immune Response, Mucosal Parameters and Disease Resistance, 2015.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eNoga EJ, Ullal AJ, Corrales J, Fernandes JM\u003c/strong\u003e Application of antimicrobial polypeptide host defenses to aquaculture: Exploitation of down regulation and up regulation responses. Comp. Biochemistry and Physiology Part D: Genomics and Proteomics, 2011; 6 (1), 44-54\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eHong S, Peddie S, Campos-P\u0026eacute;rez JJ, Zou J, Secombes CJ \u003c/strong\u003eThe effect of intraperitoneally Administered ce in Rainbow Trout (Oncorhynchus Mykiss) Upon Synbiotic Feeding. Fish Shellfish Immun., 2003; 45:27\u0026ndash;32.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eZhulling R, Wang S, Yan C, Yue W, Liangjin T, Jingqui L, Shaoqun W, Liu J, Weiliang G, \u003c/strong\u003e\u003cstrong\u003eYangcan Z \u003c/strong\u003e\u003cstrong\u003eG\u003c/strong\u003e Effects of dietary mannan oligosaccharide supplementation on growth performance, antioxidant capacity, non-specific immunity and immune-related gene expression of juvenile hybrid grouper (Epinephelus lanceolatus♂ \u0026times; Epinephelus fuscoguttatus. March, July 2020; OI 529:735642. 10.1016/j.aquaculture. 2020735642\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eFiona S\u003c/strong\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cstrong\u003eJulia RD\u003c/strong\u003e\u0026beta;-Defensins: Multifunctional Modulators of Infection, Inflammation and More. J Innate Immun, 2012; 4 (4): 337\u0026ndash;348.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eClaire H Holland\u003c/strong\u003e\u003cstrong\u003e, \u003c/strong\u003e\u003cstrong\u003eJohn D Lambris\u003c/strong\u003eThe complement system in teleosts Fish Shellfish Immunol. 2002; May; 12 (5): 399-420. doi: 10.1006/fsim.2001.0408.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eLi J, Sultan Y, Sun Y, Zhang S, Liu Y, Li X\u003c/strong\u003e Expression analysis of Hsp90\u0026alpha; and cytokines in zebrafish caudal fin regeneration. \u003cem\u003eDev. Comp. Immunol.\u003c/em\u003e 2021; \u003cem\u003e116\u003c/em\u003e, 103922\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eZhang A, Chen D, Wei H, Du L, Zhao T, Wang X, Zhou H \u003c/strong\u003eFunctional characterization of TNF-\u0026alpha; in grass carp head kidney leukocytes: Induction and involvement in the regulation of NF-\u0026kappa;B signaling. Fish Shellfish Immunol., 2012; 33, 1123\u0026ndash;1132. \u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGarcia-Castillo J, Chaves-Pozo E, Olivares P, Pelegrin P, Meseguer J, Mulero V \u003c/strong\u003eThe tumor necrosis factor alpha of the bony fish seabream exhibits the in vivo proinflammatory and proliferative activities of its mammalian counterparts, yet it functions in a species-specific manner. Cell Mol. Life Sci. , 2004; 61, 1331\u0026ndash;1340\u003cstrong\u003e. \u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eZou J, Secombes C.J, Long S, Miller N, Clem LW, Chinchar VG \u003c/strong\u003eMolecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus). Dev. Comp. Immunol., 2003; 27, 845\u0026ndash;858.\u003c/li\u003e\n\u003cli\u003e\u003cstrong\u003eGabriel Olmos, Jer\u0026ograve;nia Llad\u0026oacute; \u003c/strong\u003eTumor Necrosis Factor Alpha: A Link between Neuroinflammation and Excitotoxicity. Hindawi Publishing Corporation, 2014; Mediators of inflammation, Article ID 861231. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"O. niloticus, Nile tilapia, Transportation, Stress, NaCl, cortisol, Mucin, β D, TNF, IL-1β","lastPublishedDoi":"10.21203/rs.3.rs-4113606/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4113606/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eOreochromis niloticus\u003c/em\u003e has great economic value and potential for farming and development. Transportation of fish was done for breeding or trading purpose and it is a challenging aspect of aquaculture. This study aimed to investigate the effect of transportation in freshwater and brackish water on the resistance of \u003cem\u003eO. niloticus\u003c/em\u003e as well as transportation stress mitigation effect of NaCl. Four equal groups were used; each of 50 fish, the 1st group served as the control (P 1), while the 2nd group (PT 2) was transported in water without salt, the 3rd (PT 3) and 4th (PT 4) groups were transported in water containing 5 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e and 10 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e salt respectively. PT 2, PT 3 and PT 4 were transported for 5 hours without any rest or sedative drugs.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe serum cortisol of \u003cem\u003eO. niloticus\u003c/em\u003e significantly increased at 0 h and then decreased at 12 and 24 h post transportation in the PT 2 group and non significantly increased at all point times in the PT 3 and PT 4 groups comparing to P 1 group. Mucin2 gene expression was non-significantly up regulated in the PT 2 group and down regulated in the PT 3 and PT 4 groups at 0 h comparing with P 1 group, but at 12 and 24 h it was significantly up regulated in the PT 2, PT 3 and PT 4 groups. The β Defensin-1 and 2 genes expression was non-significantly down-regulated in the PT 2 group and significantly up regulated in the PT 3 and PT 4 groups at 0 h., while at 12 and 24 h was significantly down regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups, it significantly down regulated in the PT 2 and PT 3 group and non significantly down regulated in the PT 4 group at 24 h. Non significant up regulation in interleukin \u0026minus;\u0026thinsp;1β gene expression was reported in the PT 2 group and non significant down regulation in the PT 3 and PT 4 groups at 0 h. However, significant up regulation was recorded in the PT 2, PT 3 and PT 4 groups at 12 and 24 h. The Tumor necrosis factor- alpha gene expression was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0h. However, it was significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThe results of this study confirmed the stressful effect of transportation on \u003cem\u003eO. niloticus\u003c/em\u003e as well as the transportation stress mitigation effect of NaCl.\u003c/p\u003e","manuscriptTitle":"Impact of transportation in freshwater and brackish water on Oreochromis niloticus (Nile tilapia) resistance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-11 09:22:08","doi":"10.21203/rs.3.rs-4113606/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-12T07:48:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-06T07:21:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-06T07:21:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2024-03-16T14:28:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"31f52eff-85bb-4d0b-8e20-522c3b66fa1c","owner":[],"postedDate":"April 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-09-09T16:15:35+00:00","versionOfRecord":{"articleIdentity":"rs-4113606","link":"https://doi.org/10.1186/s12917-024-04194-6","journal":{"identity":"bmc-veterinary-research","isVorOnly":false,"title":"BMC Veterinary Research"},"publishedOn":"2024-09-06 15:57:52","publishedOnDateReadable":"September 6th, 2024"},"versionCreatedAt":"2024-04-11 09:22:08","video":"","vorDoi":"10.1186/s12917-024-04194-6","vorDoiUrl":"https://doi.org/10.1186/s12917-024-04194-6","workflowStages":[]},"version":"v1","identity":"rs-4113606","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4113606","identity":"rs-4113606","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.