Eukaryotic translation initiation factor 3d regulates stress granule assembly via its RNA binding domain

Eukaryotic translation initiation factor 3d regulates stress granule assembly via its RNA binding domain | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Eukaryotic translation initiation factor 3d regulates stress granule assembly via its RNA binding domain Alan Whitmarsh, Jiaqing Lang, Aristeidis Sfakianos, Pablo Binder, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8107126/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Stress granules are cytoplasmic mRNA-protein complexes that form by liquid-liquid phase separation in response to a variety of stresses. Their assembly is contingent upon the inhibition of mRNA translation. Depending on the type of stress and severity, they can promote stress resistance or act to reduce cellular fitness. As such, stress granules are implicated in ageing and a range of related pathologies. Many translation factors are components of stress granules, but it is unclear how they contribute to granule assembly. Here we show that the eIF3d component of the eIF3 translation initiation complex is recruited to stress granules in human cells and is required for stress granule assembly in response to specific stresses. The RNA-binding domain of eIF3d mediates its recruitment to stress granules and deletion of this domain blocks granule formation and decreases cell viability. Furthermore, the exogenous expression of just the eIF3d RNA-binding domain can rescue stress granule assembly in eIF3d-depleted cells. We confirmed the importance of eIF3d for robust stress granule assembly in vivo using the nematode worm C. elegans . This study demonstrates that eIF3d is a critical evolutionary conserved stress granule assembly factor, rather than simply coalescing passively into stress granules following the inhibition of translation initiation. Biological sciences/Cell biology Biological sciences/Molecular biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Organisms need to respond to stress from their environment in order to adapt and survive. One feature of this response is a regulated change in the pattern of gene expression that can occur via both transcriptional and post-transcriptional mechanisms [ 1 , 2 ]. After an acute stress, there is suppression of global mRNA translation and a shift towards the translation of specific mRNAs encoding proteins that act to mitigate the stress [ 2 – 4 ]. This coincides with the formation of membrane-less cytoplasmic ribonucleoprotein (RNP) granules called stress granules (SGs) that contain translationally stalled 48S pre-initiation complexes (PIC) and their associated mRNAs, together with additional RNA-binding proteins (RBPs) and other proteins [ 5 – 8 ]. SG assembly occurs via a process of liquid-liquid phase separation (LLPS) that is mediated by both multivalent interactions between proteins and by protein-RNA and RNA-RNA contacts [ 9 – 14 ]. For most stresses, the paralogous RBPs RAS GTPase-activating protein-binding protein 1 (G3BP1) and G3BP2 are essential for SG formation [ 15 – 18 ], but the biophysical properties and composition of SGs vary depending on the stress and cell type [ 7 , 8 , 19 , 20 ]. SGs form rapidly and can exchange proteins and RNAs with surrounding cellular compartments throughout their lifetime, before dissolving once the stress has been resolved [ 9 , 21 – 24 ]. SGs are generally considered to be protective and enable cells to respond and adapt to stress, with reported roles in anti-viral responses [ 25 ], inflammasome-mediated pyroptosis [ 26 ] and repairing damage to endolysosomal membranes [ 27 ]. The disruption of SG regulation can contribute to disease. For example, SGs can protect cancer cells and they can lose their transient nature and become persistent with aging, which contributes to the pathological aggregation of RBPs in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) [ 19 , 28 , 29 ]. The relationship between translation inhibition, SG assembly and how this links to cell survival responses is not fully understood. Evidence suggests that SGs act as dynamic signalling hubs that regulate cell fate by coordinating stress-induced signalling with altered translation [ 3 , 30 – 34 ]. Stresses such as oxidative stress, ER stress and viral infection require eIF2a phosphorylation-induced translation inhibition for SG assembly [ 19 , 20 ], while inhibiting other translation initiation factors, for example the eIF4A RNA helicase component of the eIF4F cap-binding complex, induces SGs independently of eIF2a phosphorylation [ 35 – 37 ]. Many translation factors are found in SGs and several subunits of the eIF3 translation initiation complex have been proposed as core components of the SG interaction network that contributes to SG assembly [ 5 , 7 , 8 , 18 , 38 ], but the mechanisms involved are poorly characterised. The eIF3 complex is around 800 kDa and is made up of twelve subunits in humans and assembles into two subcomplexes: the octamer containing eIF3a, c, e, f, h, k, l, and m, and the yeast-like core (YLC) containing eIF3b, g and i [ 39 ]. eIF3d is not a core component of the eIF3 complex but is recruited to the octamer via eIF3e [ 40 , 41 ]. During canonical 7-methyl guanosine (m 7 G) cap-dependent mRNA translation initiation, the eIF3 complex coordinates multiple steps in forming the 43S PIC and critically links it to the 5’ end of mRNA via interactions between the eIF4F complex bound at the mRNA cap and the eIF3c, d and e subunits on the 43S PIC [ 42 – 44 ]. In addition, eIF3 takes part in 43S PIC scanning of the 5’ UTR for the AUG start codon and likely persists on the ribosome during early elongation [ 45 , 46 ]. eIF3 also regulates translation through alternative mechanisms. It may be recruited directly to the 5’ cap independently of the eIF4F complex via the eIF3d subunit and, in collaboration with eIF4G2/DAP5, mediates translation of subsets of mRNAs that contribute to stress survival, T-cell regulation and cell migration [ 47 – 52 ]. To start to address how eIF3 factors contribute to SG biology, we focused on eIF3d. It is an important mediator of the translational response to stress [ 48 , 50 , 53 ] and two genetic screens in the human osteosarcoma cell line U2OS have implicated it in SG formation in response to sodium arsenite and heat stress [ 18 , 38 ]. Furthermore, the knockdown of eIF3d does not affect the formation of the core eIF3 complex [ 39 , 54 ]. We therefore set out to uncover the molecular determinants of eIF3d recruitment to SGs and whether it has roles in SG assembly independently of the core eIF3 complex. RESULTS eIF3d is required for SG assembly in HeLa and U2OS cells in response to specific stress conditions. To obtain a broad picture of the role of eIF3d in SG formation in response to different stresses, we knocked-down the expression of eIF3d in human cells using siRNA. Two siRNAs were used to target eIF3d in HeLa cells and successful knock-down was confirmed by immunoblot (Suppl Fig. 1A). The cells were subjected to sodium arsenite (50 µM, 1 h), heat stress (43 o C, 1 h), ER stress (20 µM thapsigargin, 1 h) or osmotic stress (0.2 M NaCl, 1 h). eIF3d colocalised with the SG marker protein G3BP1 under all conditions indicating its recruitment to SGs (Fig. 1 ). The knock-down of eIF3d by both siRNAs strongly suppressed SG formation in response to sodium arsenite stress, heat stress and ER stress based on the loss of G3BP1 positive granules, but not in response to osmotic stress (Fig. 1 ; Suppl Fig. 2). A similar pattern of responses was observed in a second cell line, U2OS (Suppl Figs. 1B and 3). Of note, a higher dose (100 µM) of sodium arsenite was required to robustly induce SGs in U2OS compared to HeLa indicating differential sensitivities to arsenite stress between the cell lines. Arsenite stress, heat stress and ER stress induce translational repression and SG assembly via the phosphorylation of eIF2α, while osmotic stress is reported to promote SGs independently of this [ 16 , 19 , 20 , 55 ]. Another mechanism of translation inhibition which leads to SG formation independently of phosphorylated eIF2a is the targeted inhibition of the RNA helicase eIF4A [ 20 , 35 , 36 ]. We therefore treated HeLa cells with the eIF4A inhibitor FL3 (0.5 µM, 24 h) [ 56 , 57 ]. eIF3d was present in FL3-induced SGs, but its knock-down did not affect their formation (Suppl Fig. 4). In summary, eIF3d is required for SG assembly after moderate arsenite stress, heat stress and ER stress, but not in response to osmotic stress or eIF4A inhibition. The RNA binding domain of eIF3d is required for its targeting to SGs We next sought to determine how eIF3d is recruited to SGs. The eIF3d domain structure features an N-terminal region with binding sites for eIF3e and other eIF3 subunits [ 41 , 58 , 59 ], an RNA binding domain (RBD) [ 60 ], the proposed cap-binding region [ 49 ], plus a C-terminal acidic region of unknown function (Fig. 2 A). We initially generated two deletion mutants, one containing the N-terminus (amino acids 1-114) that includes the eIF3 binding region and the RBD, and one covering the rest of the protein, including the cap-binding domain and the acidic tail (amino acids 115–548) (Fig. 2 A). These protein fragments can occur due to cleavage of eIF3d by the HIV protease [ 61 ]. When expressed in HeLa cells subjected to arsenite-induced stress, the eIF3d 1-114 fragment localised to SGs but the 115–548 fragment did not (Fig. 2 B). This indicated that the key determinants of eIF3d localisation to SGs reside in the N-terminal part of the protein containing the contact sites with the core eIF3 complex and the RBD. As protein-RNA contacts are an essential feature of RNP condensates [ 9 , 12 , 13 ], we generated an eIF3d deletion mutant lacking the RBD, eIF3d(DRBD) (Fig. 2 A, C). This mutant did not localise to SGs following sodium arsenite stress, heat stress or thapsigargin-induced ER stress in HeLa cells (Figs. 2 D, E; Suppl Fig. 5). Previous studies have implicated Arg residues within RBPs in promoting phase separation [ 62 ]. As the eIF3d RBD contains several Arg residues, we mutated five of these to Lys residues and found that this mutant, eIF3d(5RK), was also excluded from SGs in response to sodium arsenite stress, heat stress and ER stress (Fig. 2 ; Suppl Fig. 5). Similarly, the loss or mutation of the RBD blocked eIF3d recruitment to SGs in U2OS cells (Suppl Fig. 6). We conclude that the RBD is the major determinant of eIF3d recruitment to SGs. The RNA binding domain of eIF3d is required and sufficient for SG formation While the RBD is critical for targeting eIF3d to SGs, it was important to determine if it was also required for SG assembly. To examine this, we depleted endogenous eIF3d from HeLa cells with siRNA and exogenously expressed wild-type eIF3d or the DRBD mutant. The expression of wild-type eIF3d, but not the DRBD mutant, rescued the suppression of arsenite-induced SG assembly caused by endogenous eIF3d knock-down. This demonstrated the requirement of the RBD for eIF3d to promote SG assembly (Fig. 3 ). We next asked the question whether the RBD alone was sufficient to be targeted to SGs and facilitate their assembly. We fused the RBD with the red fluorescent protein mCherry and found that it was predominantly nuclear. However, we did observe weak recruitment of the RBD-mCherry fusion protein to cytoplasmic SGs (Suppl Fig. 7). To avoid the complication of having a limited pool of cytoplasmic RBD-mCherry protein available for incorporation into SGs, we tagged the RBD with the strong nuclear export signal (NES) from PKI [ 63 ] (Fig. 4 A). This fusion protein displayed increased cytoplasmic localisation and was robustly recruited to SGs in response to arsenite and heat stress (Fig. 4 B). The expression of the NES-tagged RBD fused to mCherry significantly rescued SG formation in cells depleted of endogenous eIF3d, with over 50% of cells displaying SGs compared to 80% of cells that expressed the full-length eIF3d (Fig. 4 C and D). The NES-tagged RBD mutant with five Arg mutated to Lys (5RK) could not rescue SG formation in the eIF3d-depleted cells (Fig. 4 C and D). We conclude that the RBD of eIF3d is required for it to coalesce into SGs and that it can act as an autonomous SG targeting domain that it is sufficient to support SG assembly. The deletion of the eIF3d RBD impairs translation and cell survival To further test the functional importance of the eIF3d RBD, we established stable HeLa cell lines featuring doxycycline-inducible shRNA knock-down of endogenous eIF3d and re-expression of wild-type or mutant eIF3d. In agreement with our previous siRNA data (Fig. 3 ), the induction of shRNA expression greatly reduced arsenite-induced SG assembly, which was rescued by wild-type eIF3d but not the DRBD mutant (Fig. 5 A and B; Suppl Figs. 8A and B). We also investigated the second RNA interacting domain of eIF3d, the cap-binding domain. Mutation of key residues required for cap-binding [ 49 ] did not affect eIF3d localisation to SGs or SG assembly (Suppl Fig. 8C). These results confirmed that the RBD of eIF3d is the key domain required to promote SG assembly. To address the functional consequences of this, we performed a puromycin-incorporation assay to determine the importance of the eIF3d RBD for global translation. The knock-down of eIF3d reduced global translation by around 50% and this was rescued by wild-type eIF3d but not by the mutant lacking the RBD (Fig. 5 C). The mutation of the cap-binding region did not significantly impact global translation levels, supporting the evidence that the cap-binding function of eIF3d is directed towards highly specific subsets of mRNAs [ 47 , 49 , 50 – 52 ]. We next determined whether the eIF3d RBD was important for cell survival in response to arsenite stress. The knock-down of eIF3d reduced cell number by about 70% in response to prolonged sodium arsenite stress (30 µM, 14 h) indicating the importance of eIF3d for cell viability (Fig. 5 D). The expression of either wild-type or the cap-mutant eIF3d rescued this decrease in cell number, but the DRBD mutant did not (Fig. 5 D). Taken together, our data show that the RBD domain of eIF3d is critical for its role in SG formation and cell viability in response to arsenite stress. The eIF3d orthologue EIF-3.D is required for stress granule formation in C. elegans . Having established the importance of eIF3d for SG assembly in cultured human cells, we addressed if this was also the case in an animal model. The stress pathways regulating translation and the components of the translation initiation machinery are evolutionary conserved between humans and the nematode worm C. elegans [ 64 ]. We therefore employed two SG reporter strains combined with RNAi knockdown of the worm eIF3d orthologue EIF.3.D. The reporters feature pharyngeal expression of either red fluorescent protein (RFP) fused to the stress granule associated RNA binding protein PAB-1 (orthologue of human PABPC1) or Venus fluorescent protein fused to TIAR-2 (an orthologue of human TIA1/TIAR) [ 65 ]. Subjecting the reporter worms to heat stress (36 o C, 3 h) induced the formation of RFP-PAB-1 and Venus-TIAR-2 positive granules in the pharynx (Suppl Fig. 9A). When the reporter worms were fed with E. coli expressing eif-3.D RNAi, SG formation was severely diminished (Fig. 6 ). We conclude that EIF-3.D is required for heat-induced SG formation in C. elegans . To gain a broader picture of the importance of eIF3 for SG formation in vivo , we extended our RNAi analysis to the other subunits of the complex. We found that RNAi knock-down of multiple eIF3 subunits reduced granule formation to varying degrees (Suppl Figs. 9B and C). It was noted that the knock-down of some of these factors caused severe developmental defects (i.e. for EIF-3.B and G). In contrast, the knock-down of EIF-3.D and other factors, including EIF3.E and EIF-3.F, strongly impaired granule formation without having a drastic effect on development (Suppl Figs. 9 and 10). These data suggest that, in addition to eIF3d, other eIF3 factors also play important roles in SG assembly in vivo . DISCUSSION The eIF3 complex is essential for the initiation of canonical cap-dependent translation in collaboration with eIF4F and also mediates alternative mechanisms of translation initiation [ 42 , 43 , 53 ]. In this study, we find that eIF3d is required for SG assembly in both human cell lines and in C. elegans (Figs. 1 and 6 ) and that the RBD of eIF3d is essential for this (Figs. 4 and 5 ). This establishes eIF3d as an important SG regulatory factor. Our findings support experiments by Yang et al [ 18 ] who built on previous proteomic and functional screens [ 5 , 38 ] to define a core network of 36 proteins that are localised to SGs and are important for their assembly. These proteins include eIF3d, alongside well-characterised SG regulators such as G3BP1, G3BP2, TIAR, TIA1 and UBAP2L [ 18 ]. Additional eIF3 factors are also part of this network including eIF3g, eIF3i and eIF3e [ 18 ]. Our C. elegans RNAi screen also identified these factors as important SG regulators in vivo (Suppl Figs. 9 and 10). This suggests that eIF3d along with other eIF3 factors and a subset of RBPs play a central role in the coalescence of translationally stalled 48S pre-initiation complexes and their associated mRNAs into SGs in response to specific stresses. Structural analysis of translation initiation complexes indicates that eIF3d forms part of the mRNA exit channel making contacts with eIF3e, eIF3a and eIF3c, as well as associating with the eIF4G component of the eIF4F complex and contacting 40S subunits and 18S rRNA [ 40 , 44 , 59 , 66 ], The RBD is clearly important for eIF3d function in translation as the DRBD mutant fails to rescue the decreased translation observed in eIF3d-depleted cells (Fig. 5 C). An important question is whether eIF3d has a distinct role in SG assembly or is acting within the context of the eIF3 complex or translational initiation complexes. The RBD does not include either the region of eIF3d that binds to eIF3e or the eIF3c and eIF4G contact sites [ 40 , 44 , 59 , 66 ]. Therefore, the finding that it acts as an autonomous SG recruiting domain and supports SG assembly when fused to mCherry (Fig. 4 ) argues that the major function of eIF3d in SG assembly is independent from the rest of the eIF3 complex. However, the rescue of SG assembly in eIF3d knock-down cells is less robust when expressing the RBD alone compared to full-length eIF3d (Fig. 4 ). This suggests that, while the RBD is essential for supporting SG assembly, eIF3d interactions with the eIF3 complex or other translation factors, potentially within the context of the stalled 48S PIC, may have contributory roles. How the RBD promotes eIF3d recruitment to SGs and their formation is unclear. The mutation of Arg residues to Lys within the RBD prevents its localisation to SGs and fails to support SG assembly (Figs. 2 D and E; Figs. 4 C and D). Arg residues within RBDs can mediate multiple interactions with RNA through both hydrogen bonding and electrostatic interactions. It is possible that eIF3d is recruited to SGs via interactions with RNA and helps to nucleate and stabilise the condensates. Alternatively, or in combination, the RBD may form contacts with other proteins. Previous studies have identified multivalent interactions between Arg and aromatic side chains such as Tyr as drivers of phase separation [ 62 ]. Interestingly, the Arg residues in the eIF3d RBD can be methylated [ 67 , 68 ]. Arginine methylation within RBPs is reported to usually reduce their propensity to phase separate [ 69 ], although may promote phase separation in specific contexts [ 70 ]. It will be interesting to determine if Arg methylation of the eIF3d RBD is a key modification regulating its functions during stress. An important aspect of our study is that the requirement for eIF3d in SG formation is stress-specific. Stresses that induce canonical SGs downstream of eIF2a Ser-51 phosphorylation, including heat, moderate sodium arsenite stress and ER stress, require eIF3d for SG assembly (Fig. 1 ; Suppl Figs. 2 and 3). However, eIF3d is not required for the assembly of non-canonical SGs that form independently of eIF2a phosphorylation following eIF4A inhibition or osmotic stress, although it still localises to these granules (Fig. 1 ; Suppl Figs. 2–4). This selective requirement for eIF3d may reflect differences in the importance of specific proteins or the prominence of RNA-RNA interactions depending on the type of stress and how it impacts translation. For example, it has been shown that SGs formed after eIF4A inhibition are more reliant on RNA-RNA interactions, reflecting the proposed role of eIF4A as an RNA chaperone that limits intermolecular RNA interactions [ 37 ]. It is less clear how osmotic-stress induced SGs form as they are independent of both phosphorylated eIF2a and G3BP1 [ 16 , 20 , 55 ]. One proposed mechanism is through a combination of macromolecular crowding due to cell shrinkage, combined with the increased ionic strength reducing electrostatic repulsion between mRNAs [ 71 ]. This suggests that eIF3d may only become essential for SG assembly under conditions where RNA-RNA interactions are suppressed by eIF4A or physical and chemical changes to cells increase the likelihood for proteins and RNAs to coalesce. A remaining question is how eIF3d functions are integrated in response to stress. As we have shown, a pool of eIF3d is recruited to SGs and is required for their assembly. However, when canonical eIF4E-dependent translation initiation is suppressed, eIF3d binds to the 5’ cap of stress-specific mRNAs and mediates their translation [ 47 – 52 ]. While translation has been reported to occur in the vicinity of SGs [ 72 ], there is little evidence of this being widespread, suggesting that most stress-specific translation is occurring on ribosomes in the cytoplasm. Therefore, there may be distinct pools of eIF3d under stress conditions, one involved in the translation of essential stress-specific transcripts and one that participates in SG assembly. Furthermore, we also detect endogenous eIF3d in the nucleus (Fig. 1 ; Suppl Figs. 2 and 3) and the eIF3d RBD by itself is strongly nuclear suggesting that it may have a broader role in regulating eIF3d localisation (Suppl Fig. 7). The function of nuclear eIF3d is unclear, although a role in RNA splicing has been proposed [ 73 ]. The latter may also link to eIF3d’s role in SGs as other splicing regulators are also core SG components [ 5 , 7 , 18 ]. It will be important to determine how these different pools of eIF3d communicate and integrate as part of the cellular stress response. It is reported that eIF3d expression is upregulated in many cancers and may promote cell proliferation and survival of some cancer types [ 53 ]. While there is evidence to suggest that this may be via regulating the translation of cell-cycle regulators, it is possible that high levels of eIF3d promote SG formation in cancer cells, thus contributing to their survival and resistance to anti-cancer drugs. Previous studies have implicated other core SG proteins such as G3BP1, CAPRIN-1 and TIA1 in promoting hallmarks of cancer [ 29 ]. Therefore, manipulating core SG proteins, such as eIF3d, may limit tumourigenesis and enhance anti-cancer therapies. In conclusion, we have characterised the function of the translation initiation factor eIF3d in SG assembly, adding to its expanding functional repertoire and supporting the evidence that it is a key mediator protecting cells from stress. Our data also suggest a more extensive role for eIF3 complex components in SG regulation and it will be interesting in future to determine their precise mechanisms, whether as part of eIF3 subcomplexes or acting independently. MATERIALS AND METHODS Cell culture and treatments U2OS and HEK293T were purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagles Medium (D6429, Sigma-Aldrich). HeLa M cells were cultured in Dulbecco’s Modified Eagles Medium (D5796, Sigma-Aldrich). Both media were supplemented with 10% feotal bovine serum (FBS) (10500064, ThermoFisher). Cells were grown at 37°C in 5% CO 2 . Stress granules were induced by addition of NaASO 2 (S7400, Sigma-Aldrich) or Thapsigargin (CAY10522, Cambridge Bioscience) at the concentrations and times indicated in the figure legends. Heat stress was applied by incubating cells with 43°C in 5% CO 2 for 1 hr. Mycoplasma testing was routinely performed every month as described [ 74 ]. Transfection of plasmids and siRNAs Plasmids were transfected into cells using JetPEI (101B-010N, Polyplus Transfections). Cells were incubated 6 hr in the presence of plasmid/JetPEI followed by changing the medium and incubation overnight prior to analysis. Plasmid used were pCDNA3-Flag-eIF3d, pCDNA3-Flag-eIF3d (1-114), pCDNA3-Flag-eIF3d (115–548), pCDNA3-Flag-eIF3d (DRBD) featuring a deletion of amino acids 86 to 118, pCDNA3-Flag-eIF3d (5RK) featuring arginine residues 95, 97, 99, 103 and 106 all changed to lysine, pmCherry-N1-eIF3d, pmCherry-N1-RBD, pmCherry-N1-PKI-NES-RBD and pmCherry-N1-PKI-NES-RBD (5RK). Details of plasmid generation will be provided upon request. siRNAs were transfected into cells plated in 6 well dishes at a concentration of 20nM using Lipofectamine RNAiMAX transfection reagent (13778150, ThermoFisher Scientific). Control siRNA (5’-AGGUAGUGUAAUCGCCUUG-3’) was made by Eurofins Technologies and siRNAs targeting the EIF3D 3’UTR (Hs_EIF3D_1 SI05097344, Hs_EIF3D_7 SI04273612) were purchased from Qiagen. Generation of stable cell lines To generate doxycycline inducible shRNAs, double-stranded oligonucleotides targeting the 3’ UTR of EIF3D transcripts (Fwd: 5’-CCGGCTTAGTGGAATGTGTGTCTAACTCGAGTTAGACACACATTCCACTAAGTTTTTG-3’; Rev: 5’- AATTCAAAAACTTAGTGGAATGTGTGTCTAACTCGAGTTA GAC ACA CATTCC ACTAAG-3’) and non-targeting control (Fwd: 5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’; Rev: 5’-AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGG-3’) were synthesised by Eurofins Technologies and subcloned into Age I and Eco RI restriction enzymes in Tet-pLKO-puro lentiviral plasmid (Addgene #21915). The lentiviral plasmid expressing wild-type eIF3d fused to 3xFlag sequence under the control of the hPGK promoter was designed by the Whitmarsh Lab and purchased from VectorBuilder. The eIF3d(DRBD) mutant, eIF3d Cap Mutant (D249Q/V262I/Y263A) and empty vector control were constructed using Q5 site-directed mutagenesis kit (E0554; NEB). Lentiviral particles were generated with HEK293T cells as previously described [ 75 ]. Infected cells were selected by incubation with 2 µg/mL puromycin and 10 µg /ml blasticidin until no live cells remained in the non-infected group. Resistant colonies were pooled and expanded in antibiotic-free medium. Protein extraction and immunoblot analysis Cells were washed with PBS and lysed in RIPA buffer (R-0278, Sigma-Aldrich) supplemented with protease and phosphatase inhibitors (87786 and 78420, ThermoFisher Scientific). Protein concentrations were quantified by DC™ protein assay (500 − 0112, Bio-Rad). Protein lysates were loaded on 10% or 14% polyacrylamide gels (A2-0072, ProtoGel) and electrophoresis performed at 100 V for 2 hr. Resolved proteins were transferred to nitrocellulose (NC) membrane (1704270, Biorad transfer kit) using Trans-Blot Turbo Transfer System (25V 2.5mA 7min). Membranes were blocked with 1x casein blocking buffer (86429, Sigma-Aldrich) in TBS (J60877.K2, Thermo Scientific) for 1 hr at room temperature and incubated with primary antibodies in TBST (28360, Thermo Scientific) overnight at 4°C. Membranes were washed in TBST buffer and incubated for 1 hr at room temperature with IRDye® 800CW anti-rabbit or anti-mouse secondary antibodies (LI-COR) diluted in casein/TBST, prior to washing with TBST buffer and imaging using the Odyssey infrared system (LI-COR Biosciences). Fluorescent signals were quantified using Empiria studio v1.1. Antibodies used are described in Supplementary Table 1. Unprocessed scans of immunoblots are provided in Supplementary Fig. 11. Immunofluorescence microscopy Cells were grown on cover slips and fixed in 4% Paraformaldehyde (158127, Sigma-Aldrich) for 15min at room temperature. Cells were permeabilised with PBS (60-00010-11, PluriSelect) containing 0.2% Triton X-100 for 20min and blocked with 3% BSA (5217, Tocris) in 0.1% Triton X-100 PBST for 30min. Cover slips were incubated at 4°C with primary antibodies to eIF3d, G3BP1, TIA1 or Anti-Flag M2 (see Suppl Table 1). Following washes with 0.1% PBST, cells were incubated in 3% BSA in 0.1% PBST solution containing Alexa Fluor™ fluorescent secondary antibodies (Invitrogen; see Suppl Table 1) for 1h at room temperature, before further washes in PBST and mounting using the Prolong® Diamond-DAPI (P36962, ThermoFisher). Cover slips were sealed onto slides with antifade coverslip sealant (23005, Biotium) after mounting overnight. Imaging was performed on a Leica DM500B Fluorescence microscope with filters set for DAPI, FITC and Texas Red. Images were collected with a Leica DCF340 FX camera at a magnification of 40x and 63x. Images were processed with Image J software. Puromycin incorporation assay Cells were seeded in 3cm dishes (4 x 10 4 ) and allowed to adhere overnight before treated with 100ng/ml Dox for 2 days to knockdown expression of the endogenous eIF3d. Puromycin (A1113803, Gibco™ Puromycin Dihydrochloride) was added to cells for 10 min at a final concentration of 10 µg/ml prior to harvesting and lysis. The anti-puromycin antibody (MABE343, Merck) was used at a dilution of 1:25,000. Cell viability assay The lentiviral cell lines were seeded at a density of 6,000 cells per well in 24-well plates and allowed to adhere overnight before being treated with 100 ng/mL doxycycline for 2 days. Cell viability was evaluated using the Cell Counting Kit-8 (CCK8, 7368, Tocris) according to the manufacturer's instructions. Briefly, the cells were incubated with 10% CCK8 solution at 37°C for 2 hours. Then, 100 µL of the culture medium was transferred to 96-well plates, and the absorbance was measured at 450 nm using a plate reader (SPECTROstar Nano). C. elegans RNAi and heat shock C. elegans were fed Escherichia coli strain OP50 and maintained at 20°C on nematode growth medium (NGM) composed of 50 mM NaCl, 0.25% (w/v) Bacto-peptone, and 1.7% (w/v) agar, supplemented with 1 mM MgSO₄, 1 mM CaCl₂, 25 mM KH₂PO₄ (pH 6.0), and 5 µg/mL cholesterol. The strains used in this study included Bristol N2 (wild-type), N2; uqEx41[Pmyo-2::venus::tiar-2], and N2; uqIs24[Pmyo-2::tagRFP::pab-1], kindly provided by Della David (German Center for Neurodegenerative Diseases, Tübingen). Gravid worms were synchronised in bleaching solution (0.7M NaOH, 20% (v/v) sodium hypochlorite) on the NGM plate before the stress response experiments. RNAi plasmid containing E. coli were obtained from the Ahringer or Vidal RNAi libraries [ 76 , 77 ]. All E. coli HT115 (DE3) strains harboring RNAi constructs were confirmed by sequencing (Eurofins Scientific). RNAi by feeding was performed as previously described [ 76 ]. Briefly, NGM plates were supplemented with Carbenicillin (50 µg/ml) (1273–7149, ThermoFisher scientific), IPTG (1 mM) (11858905, Promega). Worms were randomly allocated to either control plates with HT115 (DE3) E. coli bacteria transformed with empty L4440 plasmid vector or to plates with HT115 (DE3) E. coli expressing the RNAi. Worms were synchronised in bleaching solution on plates and fed with RNAi bacteria until they grew to day 1 adults. The day 1 adult worms were placed in a 36℃ water bath for 3h prior to imaging. C. elegans imaging For live imaging, a maximum of 15 worms were paralysed with 20mM tetramisole for 2–3 min on a 2% agarose pad [0.2g agarose in 20 ml M9 buffer (42mM Na2HPO4.12H2O, 22mM KH2PO4 (pH 6), 86mM NaCl, 1mM MgSO4)] before observation. A Leica DM500 B Fluorescence microscope was used with filter sets for Texas Red and FITC. Images were collected with a Leica DCF340 FX camera at a magnification of 40x and an exposure of 168ms using LeicaSuite v4.0 software. The brightfield images were taken using DIC microscopy with an exposure of 40ms.Images were processed with Image J software. The representative and quantificational images of RNAi experiments presented here were obtained using a Dragonfly upright confocal using a 40x Plan Fluotar objective. Each C. elegans pharynx was selected as the region of interest and stress granules were segmented from the image background using a threshold range of 50–132 GV. A particle analysis script in ImageJ was then applied to quantify stress granule sizes. To minimize the influence of imaging artifacts and background noise, granules larger than 1 µm² were outlined. The total area of these granules in each worm was subsequently used to compare differences between experimental conditions. Statistical analysis For immunofluorescence experiments, statistical analysis was performed on three biological repeats unless otherwise stated. 100 cells were counted in each repeat and the analysis performed using PRISM software and one or two-way ANOVA as stated in the figure legends. For puromycin incorporation assays, quantification was performed by measuring the intensity of the puromycin signal using Image Studio Lite software in each of five biological repeats. Puromycin signal normalisation for each sample was performed against the Coomassie Blue intensity. Statistical analysis by one-way ANOVA or t-test was performed using PRISM software. For C. elegans , at least 30 worms were analysed per condition across three biological replicates and the area of TIAR-2–positive granules per worm quantified using Image J software. Statistical analysis by two-way ANOVA was performed using PRISM software. Declarations DATA AVAILABILITY Reagents are available upon request to the corresponding author. ACKNOWLEDGEMENTS We thank Della David (The Babraham Institute, Cambridge, UK) for providing the reporter strains and Laurent Désaubry for providing FL3. We thank Weitao Xiao for technical help. This work was supported by Biotechnology and Biological Sciences Research Council (BBSRC) project grants BB/V015109/1 to M.P.A and BB/X006859/1 to G.B.P. A.P.S was funded as part of a Wellcome Trust Ph.D studentship programme. CONFLICT OF INTEREST The authors declare that they have no conflict of interest. AUTHOR CONTRIBUTION AJW, MPA and GBP designed the study with assistance from JL and APS. JL, APS, PB and AJW performed the experiments. WZ and CT developed and assisted with methodology. AJW and JL wrote the paper. All authors read, helped revise and approved the final paper. ETHICS STATEMENT Study did not require ethical approval References Kultz D. Evolution of cellular stress response mechanisms. Annu Rev Physiol 67, 225–257 (2005). doi: 10.1146/annurev.physiol.67.040403.103635 . Spriggs KA, Bushell M & Willis AE. Translational regulation of gene expression during conditions of cell stress. Mol Cell 40, 228–237 (2010). doi: 10.1016/j.molcel.2010.09.028 . Advani VM & Ivanov P. Translational control under stress: reshaping the translatome. Bioessays 41, e1900009 (2019). doi: 10.1002/bies.201900009 . Simpson CE & Ashe MP. Adaption to stress: to translate or not? Biochem Soc Trans 40, 794–799 (2012). doi: 10.1042/BST20120078 . Jain S, Wheeler JR, Walters RW, Agrawal A, Barsic A & Parker R. ATPase-modulated stress granules contain a diverse proteome and substructure. Cell 164, 487–498 (2016). doi: 10.1016/j.cell.2015.12.038 . Kedersha N, Chen S, Gilks N, Li W, Miller IJ, Stahl J, et al . Evidence that ternary complex (eIF2-GTP-tRNA(i)(Met))-deficient preinitiation complexes are core constituents of mammalian stress granules. Mol Biol Cell 13:195–210 (2002). doi: 10.1091/mbc.01-05-0221 . Markmiller S, Soltanieh S, Server KL, Mak R, Jin W, Fang MY, et al. Context-dependent and disease-specific diversity in protein interactions within stress granules. Cell 172, 590–604 (2018). doi: 10.1016/j.cell.2017.12.032 . Youn, J-Y, Dyakov BJA, Zhang J, Knight JDR, Vernon RM, Forman-Kay JD, et al . Properties of stress granules and P-body proteomes. Mol Cell 76, 286–294 (2019). doi: 10.1016/j.molcel.2019.09.014 . Hofmann S, Kedersha N, Anderson P & Ivanov P. Molecular mechanisms of stress granule assembly and disassembly. Biochim Biophys Acta Mol Cell Res 1868,118876 (2021). doi: 10.1016/j.bbamcr.2020.118876 . Molliex A, Temirov J, Lee J, Coughlin M, Kanagaraj AP, Kim HJ, et al . Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization. Cell 163, 123–133 (2015). doi: 10.1016/j.cell.2015.09.015 . Parker DM, Tauber D & Parker R. G3BP1 promotes intermolecular RNA-RNA interactions during RNA condensation. Mol Cell 85, 571–584.e7 (2025). doi: 10.1016/j.molcel.2024.11.012 . Protter DS & Parker R. Principles and properties of stress granules. Trends Cell Biol. 26, 668–679 (2016). doi: 10.1016/j.tcb.2016.05.004 . Sfakianos AP, Whitmarsh AJ & Ashe MP. Ribonucleoprotein bodies are phased in. Biochem Soc Trans. 44, 1411–1416 (2016). doi: 10.1042/BST20160117 . Van Treeck B, Protter DS, Matheny T, Khong A, Link CD & Parker R. RNA self-assembly contributes to stress granule formation and defining the stress granule transcriptome. Proc Natl Acad Sci USA 115, 2734–2739 (2018). doi: 10.1073/pnas.1800038115 . Guillen-Boixet J, Kopach A, Holehouse AS, Wittmann S, Jahnel M, Schlussler R, et al. RNA-induced conformational switching and clustering of G3BP drive stress granule assembly by condensation. Cell 181, 346–361 (2020). doi: 10.1016/j.cell.2020.03.049 . Kedersha N, Panas MD, Achorn CA, Lyons S, Tisdale S, Hickman T, et al. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits. J Cell Biol 212, 845–860 (2016). doi: 10.1083/jcb.201508028 . Sanders DW, Kedersha N, Lee DSW, Strom AR, Drake V, Riback JA, et al. Competing protein-RNA interaction networks control multiphase intracellular organization. Cell 181, 306–324 (2020). doi: 10.1016/j.cell.2020.03.050 . Yang P, Mathieu C, Kolaitis R-M, Zhang P, Messing J, Yurtsever U, et al. G3BP1 is a tunable switch that triggers phase separation to assemble stress granules. Cell 181, 325–345 (2020). doi: 10.1016/j.cell.2020.03.046 . Advani VM & Ivanov P. Stress granule subtypes: an emerging link to neurodegeneration. Cell Mol Life Sci. 77, 4827–4845 (2020). doi: 10.1007/s00018-020-03565-0 . Aulas A, Fay MM, Lyons SM, Achorn CA, Kedersha N, Anderson P, et al . Stress-specific differences in assembly and composition of stress granules and related foci. J Cell Sci 130, 927–937 (2017). doi: 10.1242/jcs.199240 . Buchan JR. Stress granule and P-body clearance: seeking coherence in acts of disappearance. Sem Cell Dev Biol 159–160, 10–26 (2024). doi: 10.1016/j.semcdb.2024.01.002 . Hu S, Zhang Y, Yi Q, Yang C, Liu Y & Bai Y. Time-resolved proteomic profiling reveals compositional and functional transitions across the stress granule life cycle. Nat Commun 14, 7782 (2023). doi: 10.1038/s41467-023-43470-1 . Mollet S, Cougot N, Wilczynska A, Dautry F, Kress M, Bertrand E, et al . Translationally repressed mRNA transiently cycles through stress granules during stress. Mol Biol Cell 19, 4469–4479 (2008). doi: 10.1091/mbc.e08-05-0499 . Ren Z, Tang W, Peng L & Zou P. Profiling stress-triggered RNA condensation with photocatalytic proximity labelling. Nat Commun 14, 7390 (2023). doi: 10.1038/s41467-023-43194-2 . Eiermann N, Haneke K, Sun Z, Stoecklin G & Ruggieri A. Dance with the devil: stress granules and signalling in antiviral responses. Viruses 12, 984 (2020). doi: 10.3390/v12090984 . Samir P, Kesavardhana S, Patmore DM, Gingras S, Malireddi RKS, Karki R, et al . DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome. Nature 573: 590–594 (2019). doi: 10.1038/s41586-019-1551-2 . Bussi C, Mangiarotti A, Vanhille-Campos C, Aylan B, Pellegrino E, Athanasiadi N, et al . Stress granules plug and stabilize damaged endolysosomal membranes. Nature 263, 1062–1069 (2023). doi: 10.1038/s41586-023-06726-w . Cao X, Jin X & Liu B. The involvement of stress granules in ageing and ageing-associated diseases. Aging Cell 19, e13136 (2020). doi: 10.1111/acel.13136 . Li T, Zeng Z, Fan C & Xiong W. Role of stress granules in tumorigenesis and cancer therapy. Biochim Biophys Acta Rev Cancer 1878, 189006 (2023). doi: 10.1016/j.bbcan.2023.189006 . Arimoto K, Fukuda H, Imajoh-Ohmi S, Saito H & Takekawa M. Formation of stress granules inhibits apoptosis by suppressing stress-responsive MAPK pathways. Nat. Cell Biol. 10, 1324–1332 (2008). doi: 10.1038/ncb1791 . Fujikawa D, Nakamura T, Yoshioka D, Li Z, Moriizumi H, Taguchi M, et al . Stress granule formation inhibits stress-induced apoptosis by selectively sequestering executioner caspases. Curr Biol 33, 1967–1981 (2023). doi.org/10.1016/j.cub.2023.04.012 Kedersha N, Ivanov P & Anderson P. Stress granules and cell signaling: more than just a passing phase? Trends Biochem Sci 38, 494–506 (2013). doi: 10.1016/j.tibs.2013.07.004 . Sfakianos AP, Mellor LM, Pang YF, Kritsiligkou P, Needs H, Abou-Hamdan H, et al . The mTOR-S6 kinase pathway promotes stress granule assembly. Cell Death Diff 25, 1766–1780 (2018). doi: 10.1038/s41418-018-0076-9 . Thedieck K, Holzwarth B, Prentzell MT, Boehlke C, Kläsener K, Ruf S, et al. Inhibition of mTORC1 by astrin and stress granules prevents apoptosis in cancer cells. Cell 154, 859–874 (2013). doi: 10.1016/j.cell.2013.07.031 . Dang Y, Kedersha N, Low WK, Romo D, Gorospe M, Kaufman R, et al . Eukaryotic initiation factor 2α-independent pathway of stress granule induction by the natural product pateamine A. J. Biol. Chem. 281, 32870–32878 (2006). doi: 10.1074/jbc.M606149200 . Mazroui R, Sukarieh R, Bordeleau ME, Kaufman RJ, Northcote P, Tanaka J, et al . Inhibition of ribosome recruitment induces stress granule formation independently of eukaryotic initiation factor 2alpha phosphorylation. Mol Biol Cell 17, 4212–4219 (2006). doi: 10.1091/mbc.e06-04-0318 . Tauber D, Tauber G, Khong A, Van Treeck B, Pelletier J & Parker R. Modulation of RNA condensation by the DEAD-box protein eIF4A. Cell 180, 411–426.e16 (2020). doi: 10.1016/j.cell.2019.12.031 . Ohn T, Kedersha N, Hickman T, Tisdale S & Anderson P. A functional RNAi screen links O-GlcNAc modification of ribosomal proteins to stress granule and processing body assembly. Nat Cell Biol 10, 1224–1231 (2008). doi: 10.1038/ncb1783 . Wagner S, Herrmannova A, Sikrova D & Valasek LS. Human eIF3b and eIF3a serve as the nucleation core for the assembly of eIF3 into two interconnected modules: the yeast-like core and the octamer. Nucleic Acids Res 44, 10772–10788 (2016). doi: 10.1093/nar/gkw972 . des Georges A, Dhote V, Kuhn L, Hellen CU, Pestova TV, Frank J, et al . Structure of mammalian eIF3 in the context of the 43S preinitiation complex. Nature 525, 491–495 (2015). doi: 10.1038/nature14891 . Smith MD, Arake-Tacca L, Nitido A, Montabana E, Park A & Cate JH. Assembly of eIF3 mediated by mutually dependent subunit insertion. Structure 24, 886–896 (2016). doi: 10.1016/j.str.2016.02.024 . Cate JH. Human eIF3: from ‘blobology’ to biological insight. Phil. Trans. R. Soc. B 372, 20160176 (2017). doi: 10.1098/rstb.2016.0176 . Valasek LS, Zeman J, Wagner S, Beznoskova P, Pavlikova Z, Mohammad MP, et al . Embraced by eIF3: structural and functional insights into the roles of eIF3 across the translational cycle. Nucleic Acids Res . 45, 10948–10968 (2017). doi: 10.1093/nar/gkx805 Villa N, Do A, Hershey JW & Fraser CS. Human eukaryotic initiation factor 4G (eIF4G) protein binds to eIF3c, -d, and -e to promote mRNA recruitment to the ribosome. J Biol Chem 288, 32932–32940 (2013). doi: 10.1074/jbc.M113.517011 . Lin Y, Li F, Huang L, Polte C, Duan H, Fang J, et al. eIF3 Associates with 80S ribosomes to promote translation elongation, mitochondrial homeostasis, and muscle health. Mol Cell 79: 575–587.e7 (2020). doi: 10.1016/j.molcel.2020.06.003 . Mohammad MP, Munzarová Pondelícková V, Zeman J, Gunišová S & Valášek LS. In vivo evidence that eIF3 stays bound to ribosomes elongating and terminating on short upstream ORFs to promote reinitiation. Nucleic Acids Res 45: 2658–2674 (2017). doi: 10.1093/nar/gkx049 . de la Parra C, Ernlund A, Alard A, Ruggles K, Ueberheide B & Schneider RJ. A widespread alternate form of cap-dependent mRNA translation initiation. Nat Commun 9, 3068 (2018). doi: 10.1038/s41467-018-05539-0 . Lamper AM, Fleming RH, Ladd KM & Lee ASY. A phosphorylation-regulated eIF3d translation switch mediates cellular adaptation to metabolic stress. Science 370: 853–856 (2020). doi: 10.1126/science.abb0993 . Lee AS, Kranzusch PJ, Doudna JA & Cate JH. eIF3d is an mRNA cap-binding protein that is required for specialized translation initiation. Nature 536, 96–99 (2016). doi: 10.1038/nature18954 . Mukhopadhyay S, Amodeo ME & Lee ASY. eIF3d controls the persistent integrated stress response. Mol Cell 83, 3303–3313 (2023). doi: 10.1016/j.molcel.2023.08.008 Quartey JNK & Goss DJ. eIF3d and eIF4G2 mediate an alternative mechanism of cap-dependent but eIF4E-independent translation initiation. J Biol Chem 301, 108317 (2025). doi: 10.1016/j.jbc.2025.108317 . Volta V, Perez-Baos S, de la Parra C, Katsara O, Ernlund A, Dornbaum S, et al. A DAP5/eIF3d alternate mRNA translation mechanism promotes differentiation and immune suppression by human regulatory T cells. Nat Commun 12, 6979 (2021). doi: 10.1038/s41467-021-27087-w . Ma S, Liu J-Y & Zhang J-T. eIF3d: a driver of non-canonical cap-dependent translation of specific mRNAs and a trigger of biological/pathological processes. J Biol Chem 299, 104658 (2023). doi: 10.1016/j.jbc.2023.104658 . Herrmannova A, Jelinek J, Pospisilova K, Kerenyi F, Vomastek T, Watt K, et al. Perturbations in eIF3 subunit stoichiometry alter expression of ribosomal proteins and key components of the MAPK signaling pathways. eLife 13, RP95846 (2024). doi: 10.7554/eLife.95846 . Bevilacqua E, Wang X, Majumder M, Gaccioli F, Yuan CL, Wang C, et al. eIF2a phosphorylation tips the balance to apoptosis during osmotic stress. J Biol Chem 285, 17098–17111 (2010). doi: 10.1074/jbc.M110.109439 . Boussemart L, Malka-Mahieu H, Girault I, Allard D, Hemmingsson O, Tomasic G, et al. eIF4F is a nexus of resistance to anti-BRAF and anti-MEK cancer therapies. Nature 513, 105–109 (2014). doi: 10.1038/nature13572 . Thuaud F, Bernard Y, Tukeri G, Dirr R, Aubert G, Cresteil T, et al. Synthetic analogue of rocaglaol displays a potent selective cytotoxicity in cancer cells: involvement of apoptosis inducing factor and caspase-12. J Med Chem 52, 5176–5187 (2009). doi: 10.1021/jm900365v . Bochler A, Querido JB, Prilepskaja T, Soufari H, Simonetti A, Del Cistia ML, et al . Structural differences in translation initiation between pathogenic Trypanosomatids and their mammalian hosts. Cell Rep 33, 108534 (2020). doi: 10.1016/j.celrep.2020.108534 . Brito Querido JB, Sokabe M, Kraatz S, Gordiyenko Y, Skehel JM, Fraser CS, et al . Structure of a human 48S translation initiation complex. Science 369, 1220–1227 (2020). doi: 10.1126/science.aba4904 Asano K, Vornlocher H-P, Richter-Cook NJ, Merrick WC, Hinnebusch AG & Hershey JWB. Structure of cDNAs encoding human eukaryotic initiation factor 3 subunits. J Biol Chem 272, 27042–27052 (1997). doi: 10.1016/s0300-9084(97)86711-9 . Jager S, Cimermancic P, Gulbahce N, Johnson JR, McGovern KE, Clarke SC, et al. Global landscape of HIV-human protein complexes. Nature 481, 365–370 (2012). doi: 10.1038/nature10719 . Wang J, Choi JM, Holehouse AS, Lee HO, Zhang X, Jahnel M, et al . A molecular grammar governing the driving forces for phase separation of Prion-like RNA binding domains. Cell 174, 688–699 (2018). doi: 10.1016/j.cell.2018.06.006 . Wen W, Meinkoth JL, Tsien RY & Taylor SS. Identification of a signal for rapid export of proteins from the nucleus. Cell 82, 463–473 (1995). doi: 10.1016/0092-8674(95)90435-2 . Rhoads RE, Dinkova TD & Korneeva NL. Mechanism and regulation of translation in C. elegans. WormBook , ed. The C. elegans Research Community, WormBook (2006), doi/ 10.1895/wormbook.1.63.1 , http://www.wormbook.org . Lechler MC, Crawford ED, Groh N, Widmaier K, Jung R, Kirstein J, et al . Reduced insulin/IGF-1 signaling restores the dynamic properties of key stress granule proteins during ageing. Cell Rep. 18, 454–467 (2017). doi: 10.1016/j.celrep.2016.12.033 . Eliseev B, Yeramal L, Leitner A, Karuppasamy M, Raimondeau E, Huard K, et al . Structure of a human cap-dependent translation pre-initiation complex. Nucleic Acids Res 46, 2678–2689 (2018). doi: 10.1093/nar/gky054 Guo A, Gu H, Zhou J, Mulhern D, Wang Y, Lee KA, et al. Immunoaffinity enrichment and mass spectrometry analysis of protein methylation. Mol Cell Proteomics 13, 372–387 (2014). doi: 10.1074/mcp.O113.027870 . Lu L, Li T, Zhang R, Wang Y, Ye X, Luo Y, et al . Tudor-based proteomic strategy pan-specifically enriches and identifies protein arginine methylation. EMBO Rep . Oct 20 (2025). doi: 10.1038/s44319-025-00599-y Hofweber M & Dormann D. Friend or foe – post-translational modifications as regulators of phase separation and RNP granule dynamics. J Biol Chem 294, 7137–7150 (2018). doi: 10.1074/jbc.TM118.001189 Wang L & Li P. Arginine methylation-enabled FUS phase separation with SMN contributes to neuronal granule formation. Cell Rep 43, 114537 (2024). doi: 10.1016/j.celrep.2024.114537 Bounedjah O, Hamon L, Savarin P, Desforges B, Curmi PA & Pastre D. Macromolecular crowding regulates assembly of mRNA stress granules after osmotic stress: new role for compatible osmolytes. J Biol Chem 287, 2446–2458 (2012). doi: 10.1074/jbc.M111.292748 . Mateju D, Eichenberger B, Voigt F, Eglinger J, Roth G & Chao JA. Single-molecule imaging reveals translation of mRNAs localized to stress granules. Cell 183, 1801–1812 (2020). doi: 10.1016/j.cell.2020.11.010 . Lu D, Mihoayi M, Ablikim Y & Arikin A. RNA splicing regulator EIF3D regulates the tumor microenvironment through immunogene-related alternative splicing in head and neck squamous cell carcinoma. Aging 16: 5929–5948 (2024). doi: 10.18632/aging.205681 . Young L, Sung J, Stacey G & Masters JR. Detection of mycoplasma in cell cultures. Nature Protocol 5, 929–934 (2010). doi: 10.1038/nprot.2010.43 . Xu Q, Zhang J, Telfer BA, Zhang H, Ali N, Chen F, et al . The extracellular-regulated protein kinase 5 (ERK5) enhances metastatic burden in triple-negative breast cancer through focal adhesion protein kinase (FAK)-mediated regulation of cell adhesion. Oncogene 40, 3929–3941 (2021). doi: 10.1038/s41388-021-01798-2 Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al . Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237 (2003). doi: 10.1038/nature01278 . Rual J-F, Ceron, J, Koreth J, Hao T, Nicot A-S, Hirozane-Kishikawa, et al . Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Res 14, 2162–2168 (2004). doi: 10.1101/gr.2505604 Additional Declarations There is no duality of interest Supplementary Files LangetalSupplFigures.pdf Supplemental Figures Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8107126","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":545058530,"identity":"44bbd06e-554f-4ca1-a7a7-0f7445da03b4","order_by":0,"name":"Alan Whitmarsh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABSUlEQVRIie3RsUrDQBjA8S8EkuWk65VWfIVIIV2CeZUcQrpUEQqdSg0U2iXBtVLwGQJCVHA4OUyXgps0ZIlLpg5OxYCiOVuLTRAdHe4/3HDcj++SAxCJ/mGKylcDiC+vNqwKXyXn2xm8TSqfJxEnK2NVnTVBP5Dq4IvAmmj0F6IxOU04uVIr93522z9uPLI0ya4N01S9BF56QM6dAlGaWk6ObgayErkp6+ix3dz3ZjZx0VST3BDIpDgFdMyJz2RljiglQWzpNWnILIRtgB0HyMU2MZm63JDolfbJ5aS1zMm7ifZSkN7KRGMon+LCKScxojLxa20+hUouVkDmU0oXQ11szXEnJ3pcp4yM43a36g0PiTuzgdVD3Ch+/nQU4OcTg/gPd2m0yC92NmkFOBsemOoolJ4WPWN3TKGUVfz1m2jpVUQikUj0lz4AP5R2/Bw01RQAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-1184-6610","institution":"University of Manchester","correspondingAuthor":true,"prefix":"","firstName":"Alan","middleName":"","lastName":"Whitmarsh","suffix":""},{"id":545058531,"identity":"9d077cc7-c3d5-4669-8526-c40bbe943c97","order_by":1,"name":"Jiaqing Lang","email":"","orcid":"","institution":"University of Manchester","correspondingAuthor":false,"prefix":"","firstName":"Jiaqing","middleName":"","lastName":"Lang","suffix":""},{"id":545058532,"identity":"806a9b17-b75a-4f64-b8a1-b2b61e8f9556","order_by":2,"name":"Aristeidis Sfakianos","email":"","orcid":"","institution":"University of Manchester","correspondingAuthor":false,"prefix":"","firstName":"Aristeidis","middleName":"","lastName":"Sfakianos","suffix":""},{"id":545058533,"identity":"6cedf22f-a33c-41bf-a6f4-8150fd923e4a","order_by":3,"name":"Pablo Binder","email":"","orcid":"","institution":"University of Manchester","correspondingAuthor":false,"prefix":"","firstName":"Pablo","middleName":"","lastName":"Binder","suffix":""},{"id":545058534,"identity":"2653db73-dad7-4bf7-9742-21073cb5c220","order_by":4,"name":"Wei Zhang","email":"","orcid":"","institution":"University of Manchester","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Zhang","suffix":""},{"id":545058535,"identity":"d34036e4-fb97-4b75-b517-d6f91b977737","order_by":5,"name":"Cathy Tournier","email":"","orcid":"https://orcid.org/0000-0002-4618-2570","institution":"University of Manchester","correspondingAuthor":false,"prefix":"","firstName":"Cathy","middleName":"","lastName":"Tournier","suffix":""},{"id":545058536,"identity":"d0e6fd66-5aae-4d3d-a902-c2c750da4ddc","order_by":6,"name":"Mark Ashe","email":"","orcid":"","institution":"Manchester","correspondingAuthor":false,"prefix":"","firstName":"Mark","middleName":"","lastName":"Ashe","suffix":""},{"id":545058537,"identity":"7b2a8979-0627-4bf7-bae6-2ee53454ea58","order_by":7,"name":"Gino Poulin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Gino","middleName":"","lastName":"Poulin","suffix":""}],"badges":[],"createdAt":"2025-11-13 15:11:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8107126/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8107126/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":96904054,"identity":"e6ad1f86-a315-4932-8d6d-9fd35a99c329","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4314029,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/542b71a53570034c282ab3ee.png"},{"id":96904044,"identity":"8f7eb9c8-4a0a-4648-a7ad-b16aca79b8fd","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":91450,"visible":true,"origin":"","legend":"","description":"","filename":"Langetaltext.docx","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/b9f1dd5416482a32477a923f.docx"},{"id":96904049,"identity":"4a078208-2bce-45c3-a51b-78b3a37b8a7a","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3441491,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/cba658c62248ecd82f3db99a.png"},{"id":96904051,"identity":"99e42e29-0818-4957-87b1-a2e5d65bbd2e","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1679298,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/85c6af69117044f58ecbc62f.png"},{"id":96920866,"identity":"07a3fdf5-2dbc-47b5-bc12-0d1dc6638313","added_by":"auto","created_at":"2025-11-27 14:15:28","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2205740,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/2bbd3bcba18836eb25716fbb.png"},{"id":96920465,"identity":"2ab60241-0953-464e-b798-b7307b8ad210","added_by":"auto","created_at":"2025-11-27 14:15:11","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1917940,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/0930c396b50477f9b87b868d.png"},{"id":96904055,"identity":"dea82626-16f6-40f0-8a98-bb6fad19b392","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1628107,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/9db4ff3881bcbab9d1728bab.png"},{"id":96904046,"identity":"790202b1-c8b5-4372-8f10-5bf560410adf","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9017,"visible":true,"origin":"","legend":"","description":"","filename":"CDD254213.json","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/912ca81e173928e0cdb855f7.json"},{"id":96920956,"identity":"581d674b-1886-4360-ae49-f6b2cd57d456","added_by":"auto","created_at":"2025-11-27 14:15:32","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14355185,"visible":true,"origin":"","legend":"","description":"","filename":"LangetalSupplFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/77e2f76fe204a93d848c8fed.pdf"},{"id":96904060,"identity":"fe59b39b-b267-4fbf-bf74-8657c9ffbe09","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":192830,"visible":true,"origin":"","legend":"","description":"","filename":"CDD2542130enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/e7c18dabc92ba7c2b706fdd8.xml"},{"id":96920991,"identity":"32a6e12d-2d12-420d-bc9d-2b57876c2452","added_by":"auto","created_at":"2025-11-27 14:15:34","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4314029,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/0f82f4ab34b228a29b840052.png"},{"id":96921049,"identity":"80638624-9599-413a-bc84-48a193bc072f","added_by":"auto","created_at":"2025-11-27 14:15:37","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3441491,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/2b439b958c80a6481ff7ff73.png"},{"id":96920359,"identity":"328cdd1b-b989-4308-abff-03fda6d8f6dd","added_by":"auto","created_at":"2025-11-27 14:15:06","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1679298,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/8c36c545e2cd7a0b04490bae.png"},{"id":96904069,"identity":"c3e61ada-9022-4658-964f-a066fa037217","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2205740,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/af83e75274d1eac69cc761e9.png"},{"id":96904056,"identity":"22805a82-9c9d-40ef-861b-8d0f5fe0451d","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1917940,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/57e2c10d8b0dc89a2ff06cc3.png"},{"id":96920420,"identity":"b7a064eb-bdba-4223-880b-13907a553c88","added_by":"auto","created_at":"2025-11-27 14:15:09","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1628107,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/774da55ea2a6d5aafb423a38.png"},{"id":96920016,"identity":"2d78ef17-1022-48fb-b469-74a2b71e28ef","added_by":"auto","created_at":"2025-11-27 14:14:42","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":607416,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/c10dca93cf5715c50cb58e41.png"},{"id":96920704,"identity":"7c235cec-f86c-4046-92e4-a747fbaa90b8","added_by":"auto","created_at":"2025-11-27 14:15:22","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":472071,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/1a15c9b0066862f713f3e437.png"},{"id":96920881,"identity":"98adbf94-10e0-45c1-af3d-1d0e5a194952","added_by":"auto","created_at":"2025-11-27 14:15:29","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":232441,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/6917d5d622e91a7f886497c4.png"},{"id":96920283,"identity":"dc83672d-1ba1-4af3-8152-0b766aecd0c5","added_by":"auto","created_at":"2025-11-27 14:15:01","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":324319,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/67a5676f44a97bc9a25cc14c.png"},{"id":96920663,"identity":"9659cc16-0402-4b4e-83b2-5e6ab567a6fa","added_by":"auto","created_at":"2025-11-27 14:15:21","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":290516,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/1a2b9b92ea0e511f3846e97c.png"},{"id":96904064,"identity":"ab6895fa-9694-4561-8d12-38e295a8cd4e","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":135605,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/a9b4dfb3e423278a3293d551.png"},{"id":96904072,"identity":"c7ec67e0-c00e-4b9a-afb6-5bb3665e359e","added_by":"auto","created_at":"2025-11-27 12:00:25","extension":"xml","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":191051,"visible":true,"origin":"","legend":"","description":"","filename":"CDD2542130structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/49cc4259a97a5f23893c49b0.xml"},{"id":96904070,"identity":"9c1fb644-9b0c-4a99-8892-25a9c7d18756","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"html","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":207738,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/7c9ed4ffc1a8203ce23b9245.html"},{"id":96920863,"identity":"641ff804-7cdc-4190-81b8-7d8c804d9859","added_by":"auto","created_at":"2025-11-27 14:15:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4314029,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eeIF3d is selectively required for SG formation induced by different stress. \u003c/strong\u003eHeLa cells were transfected with either control (Cont) siRNA or eIF3d siRNA-1 for 48 h before treatment with the indicated stresses. Cells were probed with antibodies against eIF3d and G3BP1. Nuclei were stained with DAPI. Representative images of cells are shown in the left-hand panels. Scale bar = 20 μm. Quantification of cells with G3BP1-positive granules is shown in the right-hand panels. A total of 100 cells were analysed in each of three biological replicates. Error bars represent standard deviation. Statistical analysis was performed using unpaired t-tests (\u003cem\u003ens\u003c/em\u003e = not significant, ****P \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/dd4dad573c47b0309e4d53ae.png"},{"id":96921041,"identity":"60d297ce-a6bc-4490-93d4-a95fedf02db8","added_by":"auto","created_at":"2025-11-27 14:15:37","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3441491,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe RNA binding domain (RBD) of eIF3d is required for its recruitment to SGs. A.\u003c/strong\u003e Schematic representation of the domain structure of eIF3d and the mutants generated. RBD = RNA-binding domain. 5RK = five arginine residues mutated to lysine within the RBD. \u003cstrong\u003eB.\u003c/strong\u003e HeLa cells were transfected with plasmids expressing Flag-tagged eIF3d (WT) or the truncated eIF3d mutants: 1–114 (containing the RBD) and 115–548 (lacking the RBD). Cells were treated with 50 µM sodium arsenite for 1 h. TIA1 immunofluorescence was used to visualise stress granules (SGs). Scale bar = 20 µm. \u003cstrong\u003eC.\u003c/strong\u003e Protein expression levels of the WT and the DRBD and 5RK mutants were assessed by immunoblotting with anti-Flag antibody. β-tubulin was used as a control to ensure equal protein input. \u003cstrong\u003eD-E.\u003c/strong\u003e HeLa cells were transfected with plasmids expressing Flag-tagged eIF3d wild-type (WT), ΔRBD, or 5RK mutants and treated with 50 µM sodium arsenite for 1 h. TIA1 immunofluorescence was used for SG visualisation. Scale bar = 20 µm. Representative images of cells are shown in D and quantification of the percentage of cells with eIF3d-positive granules is shown in E. A total of 100 cells were analysed in each of three biological replicates. Error bars represent standard deviation. Data were analysed using one-way ANOVA (****P \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/e11f2c466c0bb1264680ce10.png"},{"id":96904043,"identity":"6be7ac54-432b-4f50-bf02-a0ee6b7e8efb","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1650385,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe RBD is required for eIF3d to support SG assembly. A. \u003c/strong\u003eHeLa cells were transfected with eIF3d siRNA and either a plasmid expressing Flag-tagged wild-type eIF3d (WT) or eIF3d DRBD. Cells were then left untreated or treated with sodium arsenite (50 mM, 1h) and probed with antibodies against the Flag-tag and TIA1. Scale bar = 20 µm. \u003cstrong\u003eB\u003c/strong\u003e. Quantification of the percentage of cells with TIA1-positive granules. A total of 100 cells were analysed in each of three biological replicates. Error bars represent standard deviation. Data were analysed using unpaired t-tests (\u003cem\u003ens\u003c/em\u003e= not significant, ***P \u0026lt;0.0005).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/6a6a3658359f83ae9370db14.png"},{"id":96904041,"identity":"70678d69-b049-47bc-beb1-19b1d23dc679","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2293789,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe RBD of eIF3d can act as an autonomous SG targeting domain and support SG assembly. A. \u003c/strong\u003eSchematic representation of the eIF3d-mCherry fusion mutants generated. RBD = RNA-binding domain. 5RK = five arginine residues mutated to lysine within the RBD. NES = the nuclear export sequence from PKI. \u003cstrong\u003eB\u003c/strong\u003e. HeLa cells were transfected with a plasmid expressing the NES-RBD fused to mCherry. Cells were then treated with either 50 µM sodium arsenite or heat stress at 43 °C for 1 h. TIA1 immunofluorescence was used to visualise SGs. Scale bar = 20 µm. \u003cstrong\u003eC\u003c/strong\u003e. HeLa cells were transfected with eIF3d siRNA and plasmids expressing either mCherry alone, full-length (FL) eIF3d fused to mCherry, the NES-RBD fused to mCherry, or the NES-RBD-5RK mutant fused to mCherry. Cells were then treated with 50 µM sodium arsenite for 1 h. Scale bar = 20 µm. \u003cstrong\u003eD\u003c/strong\u003e. Quantification of cells with G3BP1-positive granules for the indicated mutants. A total of 100 cells were analysed in each of three biological replicates. Error bars represent the standard deviation. Data was analysed using one-way ANOVA (\u003cem\u003ens\u003c/em\u003e = not significant, ****P \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/5a870dfdc909f9e01eccbe53.png"},{"id":96904047,"identity":"02afcb2e-f57a-4102-b0bd-0d64caeaaad7","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1876473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe eIF3d RBD is required for \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ede novo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e protein synthesis and cell viability in response to arsenite stress. \u003c/strong\u003eStable cell lines expressing an inducible shRNA targeting endogenous eIF3d and either empty vector (E.V), Flag-eIF3d WT, Flag-eIF3d ΔRBD or Flag-eIF3d Cap Mut were established. \u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eB\u003c/strong\u003e. The eIF3d shRNA was induced with 100 ng/ml doxycycline for 48 h before treatment with 50 mM sodium arsenite for 1 h. TIA1 immunofluorescence was used for SG visualisation. Flag-eIF3d WT and Flag-eIF3d ΔRBD were detected with an anti-Flag-tag antibody. Scale bar = 20µm. Representative images of cells are shown in A and quantification of cells with TIA1-positive granules under the indicated conditions is shown in B. 100 cells were analysed in each of 3 biological repeats. Error bars represent the standard deviation. Data was analysed using two-sample t-test (ns = not significant, ***P\u0026lt;0.0002). \u003cstrong\u003eC.\u003c/strong\u003e The Flag-eIF3d, Flag-eIF3d DRBD and Flag-eIF3d Cap Mut stable cell lines were induced with 100 ng/ml doxycycline for 48 h to knock down endogenous eIF3d expression. Incorporation of puromycin into newly synthesised proteins was assessed by immunoblotting. Lysates were also probed with antibodies against eIF3d and the Flag epitope. Band intensities from five independent experiments were quantified and normalised to β-tubulin levels. Quantification of newly synthesised protein is presented as fold change relative to the -Dox controls. Data were analysed using t-tests (ns = not significant; ****P \u0026lt;0.0001). \u003cstrong\u003eD.\u003c/strong\u003e The stable cell lines were induced with 100 ng/ml doxycycline for 48 h to knock down endogenous eIF3d expression and then treated with 30 µM sodium arsenite for 14 h. Cell density was quantified. Error bars represent the standard deviation. Data were analysed using t-tests (ns = not significant; *P \u0026lt;0.015, ***P \u0026lt;0.0005).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/1edd178fd191e290497e748e.png"},{"id":96920330,"identity":"ca3db235-dcea-4ed7-9e25-3a4023bb1984","added_by":"auto","created_at":"2025-11-27 14:15:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1332340,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eC. elegans\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e EIF-3.D is required for stress granule formation in vivo. A, B. \u003c/strong\u003eWorms expressing pharyngeal RFP::PAB-1 and Venus::TIAR-2 reporters were fed \u003cem\u003eeif-3.D\u003c/em\u003eRNAi and subjected to heat shock at 36 °C for 3 h. Representative confocal images of the pharynx are shown for the indicated conditions. The right-hand panel in B shows a magnified area. Scale bar = 25 μm. \u003cstrong\u003eC. \u003c/strong\u003eQuantification of the total area of TIAR-2–positive granules per worm for each of the indicated conditions. At least 30 worms were analysed per condition across three biological replicates. Error bars represent s.e.m. Data were analysed by two-way ANOVA (\u003cem\u003ens\u003c/em\u003e = not significant; ***p\u0026lt;0.0005; ****p \u0026lt; 0.0001).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/fe4e293284db427e1cf95ab4.png"},{"id":99796284,"identity":"51673ef2-b687-4162-9061-1ba3f545e0f3","added_by":"auto","created_at":"2026-01-08 13:41:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16584922,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/cb984169-c94e-4399-9c63-29e748fef3c2.pdf"},{"id":96904052,"identity":"626f5f52-90cf-4364-8bdb-637c8f0d34a3","added_by":"auto","created_at":"2025-11-27 12:00:24","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":14355185,"visible":true,"origin":"","legend":"Supplemental Figures","description":"","filename":"LangetalSupplFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8107126/v1/5c0ca0d19b74b23f320a41d5.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"Eukaryotic translation initiation factor 3d regulates stress granule assembly via its RNA binding domain","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eOrganisms need to respond to stress from their environment in order to adapt and survive. One feature of this response is a regulated change in the pattern of gene expression that can occur via both transcriptional and post-transcriptional mechanisms [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. After an acute stress, there is suppression of global mRNA translation and a shift towards the translation of specific mRNAs encoding proteins that act to mitigate the stress [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This coincides with the formation of membrane-less cytoplasmic ribonucleoprotein (RNP) granules called stress granules (SGs) that contain translationally stalled 48S pre-initiation complexes (PIC) and their associated mRNAs, together with additional RNA-binding proteins (RBPs) and other proteins [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. SG assembly occurs via a process of liquid-liquid phase separation (LLPS) that is mediated by both multivalent interactions between proteins and by protein-RNA and RNA-RNA contacts [\u003cspan additionalcitationids=\"CR10 CR11 CR12 CR13\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. For most stresses, the paralogous RBPs RAS GTPase-activating protein-binding protein 1 (G3BP1) and G3BP2 are essential for SG formation [\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], but the biophysical properties and composition of SGs vary depending on the stress and cell type [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. SGs form rapidly and can exchange proteins and RNAs with surrounding cellular compartments throughout their lifetime, before dissolving once the stress has been resolved [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. SGs are generally considered to be protective and enable cells to respond and adapt to stress, with reported roles in anti-viral responses [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], inflammasome-mediated pyroptosis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] and repairing damage to endolysosomal membranes [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The disruption of SG regulation can contribute to disease. For example, SGs can protect cancer cells and they can lose their transient nature and become persistent with aging, which contributes to the pathological aggregation of RBPs in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe relationship between translation inhibition, SG assembly and how this links to cell survival responses is not fully understood. Evidence suggests that SGs act as dynamic signalling hubs that regulate cell fate by coordinating stress-induced signalling with altered translation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan additionalcitationids=\"CR31 CR32 CR33\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Stresses such as oxidative stress, ER stress and viral infection require eIF2a phosphorylation-induced translation inhibition for SG assembly [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], while inhibiting other translation initiation factors, for example the eIF4A RNA helicase component of the eIF4F cap-binding complex, induces SGs independently of eIF2a phosphorylation [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Many translation factors are found in SGs and several subunits of the eIF3 translation initiation complex have been proposed as core components of the SG interaction network that contributes to SG assembly [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], but the mechanisms involved are poorly characterised.\u003c/p\u003e\u003cp\u003eThe eIF3 complex is around 800 kDa and is made up of twelve subunits in humans and assembles into two subcomplexes: the octamer containing eIF3a, c, e, f, h, k, l, and m, and the yeast-like core (YLC) containing eIF3b, g and i [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. eIF3d is not a core component of the eIF3 complex but is recruited to the octamer via eIF3e [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. During canonical 7-methyl guanosine (m\u003csup\u003e7\u003c/sup\u003eG) cap-dependent mRNA translation initiation, the eIF3 complex coordinates multiple steps in forming the 43S PIC and critically links it to the 5\u0026rsquo; end of mRNA via interactions between the eIF4F complex bound at the mRNA cap and the eIF3c, d and e subunits on the 43S PIC [\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. In addition, eIF3 takes part in 43S PIC scanning of the 5\u0026rsquo; UTR for the AUG start codon and likely persists on the ribosome during early elongation [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. eIF3 also regulates translation through alternative mechanisms. It may be recruited directly to the 5\u0026rsquo; cap independently of the eIF4F complex via the eIF3d subunit and, in collaboration with eIF4G2/DAP5, mediates translation of subsets of mRNAs that contribute to stress survival, T-cell regulation and cell migration [\u003cspan additionalcitationids=\"CR48 CR49 CR50 CR51\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo start to address how eIF3 factors contribute to SG biology, we focused on eIF3d. It is an important mediator of the translational response to stress [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e] and two genetic screens in the human osteosarcoma cell line U2OS have implicated it in SG formation in response to sodium arsenite and heat stress [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Furthermore, the knockdown of eIF3d does not affect the formation of the core eIF3 complex [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. We therefore set out to uncover the molecular determinants of eIF3d recruitment to SGs and whether it has roles in SG assembly independently of the core eIF3 complex.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eeIF3d is required for SG assembly in HeLa and U2OS cells in response to specific stress conditions.\u003c/b\u003e To obtain a broad picture of the role of eIF3d in SG formation in response to different stresses, we knocked-down the expression of eIF3d in human cells using siRNA. Two siRNAs were used to target eIF3d in HeLa cells and successful knock-down was confirmed by immunoblot (Suppl Fig.\u0026nbsp;1A). The cells were subjected to sodium arsenite (50 \u0026micro;M, 1 h), heat stress (43\u003csup\u003eo\u003c/sup\u003eC, 1 h), ER stress (20 \u0026micro;M thapsigargin, 1 h) or osmotic stress (0.2 M NaCl, 1 h). eIF3d colocalised with the SG marker protein G3BP1 under all conditions indicating its recruitment to SGs (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The knock-down of eIF3d by both siRNAs strongly suppressed SG formation in response to sodium arsenite stress, heat stress and ER stress based on the loss of G3BP1 positive granules, but not in response to osmotic stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Suppl Fig.\u0026nbsp;2). A similar pattern of responses was observed in a second cell line, U2OS (Suppl Figs.\u0026nbsp;1B and 3). Of note, a higher dose (100 \u0026micro;M) of sodium arsenite was required to robustly induce SGs in U2OS compared to HeLa indicating differential sensitivities to arsenite stress between the cell lines. Arsenite stress, heat stress and ER stress induce translational repression and SG assembly via the phosphorylation of eIF2α, while osmotic stress is reported to promote SGs independently of this [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Another mechanism of translation inhibition which leads to SG formation independently of phosphorylated eIF2a is the targeted inhibition of the RNA helicase eIF4A [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. We therefore treated HeLa cells with the eIF4A inhibitor FL3 (0.5 \u0026micro;M, 24 h) [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. eIF3d was present in FL3-induced SGs, but its knock-down did not affect their formation (Suppl Fig.\u0026nbsp;4). In summary, eIF3d is required for SG assembly after moderate arsenite stress, heat stress and ER stress, but not in response to osmotic stress or eIF4A inhibition.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eThe RNA binding domain of eIF3d is required for its targeting to SGs\u003c/h2\u003e\u003cp\u003eWe next sought to determine how eIF3d is recruited to SGs. The eIF3d domain structure features an N-terminal region with binding sites for eIF3e and other eIF3 subunits [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], an RNA binding domain (RBD) [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e], the proposed cap-binding region [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], plus a C-terminal acidic region of unknown function (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We initially generated two deletion mutants, one containing the N-terminus (amino acids 1-114) that includes the eIF3 binding region and the RBD, and one covering the rest of the protein, including the cap-binding domain and the acidic tail (amino acids 115\u0026ndash;548) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These protein fragments can occur due to cleavage of eIF3d by the HIV protease [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. When expressed in HeLa cells subjected to arsenite-induced stress, the eIF3d 1-114 fragment localised to SGs but the 115\u0026ndash;548 fragment did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). This indicated that the key determinants of eIF3d localisation to SGs reside in the N-terminal part of the protein containing the contact sites with the core eIF3 complex and the RBD. As protein-RNA contacts are an essential feature of RNP condensates [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], we generated an eIF3d deletion mutant lacking the RBD, eIF3d(DRBD) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C). This mutant did not localise to SGs following sodium arsenite stress, heat stress or thapsigargin-induced ER stress in HeLa cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E; Suppl Fig.\u0026nbsp;5). Previous studies have implicated Arg residues within RBPs in promoting phase separation [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. As the eIF3d RBD contains several Arg residues, we mutated five of these to Lys residues and found that this mutant, eIF3d(5RK), was also excluded from SGs in response to sodium arsenite stress, heat stress and ER stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; Suppl Fig.\u0026nbsp;5). Similarly, the loss or mutation of the RBD blocked eIF3d recruitment to SGs in U2OS cells (Suppl Fig.\u0026nbsp;6). We conclude that the RBD is the major determinant of eIF3d recruitment to SGs.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eThe RNA binding domain of eIF3d is required and sufficient for SG formation\u003c/h3\u003e\n\u003cp\u003eWhile the RBD is critical for targeting eIF3d to SGs, it was important to determine if it was also required for SG assembly. To examine this, we depleted endogenous eIF3d from HeLa cells with siRNA and exogenously expressed wild-type eIF3d or the DRBD mutant. The expression of wild-type eIF3d, but not the DRBD mutant, rescued the suppression of arsenite-induced SG assembly caused by endogenous eIF3d knock-down. This demonstrated the requirement of the RBD for eIF3d to promote SG assembly (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). We next asked the question whether the RBD alone was sufficient to be targeted to SGs and facilitate their assembly. We fused the RBD with the red fluorescent protein mCherry and found that it was predominantly nuclear. However, we did observe weak recruitment of the RBD-mCherry fusion protein to cytoplasmic SGs (Suppl Fig.\u0026nbsp;7). To avoid the complication of having a limited pool of cytoplasmic RBD-mCherry protein available for incorporation into SGs, we tagged the RBD with the strong nuclear export signal (NES) from PKI [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). This fusion protein displayed increased cytoplasmic localisation and was robustly recruited to SGs in response to arsenite and heat stress (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The expression of the NES-tagged RBD fused to mCherry significantly rescued SG formation in cells depleted of endogenous eIF3d, with over 50% of cells displaying SGs compared to 80% of cells that expressed the full-length eIF3d (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). The NES-tagged RBD mutant with five Arg mutated to Lys (5RK) could not rescue SG formation in the eIF3d-depleted cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). We conclude that the RBD of eIF3d is required for it to coalesce into SGs and that it can act as an autonomous SG targeting domain that it is sufficient to support SG assembly.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eThe deletion of the eIF3d RBD impairs translation and cell survival\u003c/h3\u003e\n\u003cp\u003eTo further test the functional importance of the eIF3d RBD, we established stable HeLa cell lines featuring doxycycline-inducible shRNA knock-down of endogenous eIF3d and re-expression of wild-type or mutant eIF3d. In agreement with our previous siRNA data (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), the induction of shRNA expression greatly reduced arsenite-induced SG assembly, which was rescued by wild-type eIF3d but not the DRBD mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and B; Suppl Figs.\u0026nbsp;8A and B). We also investigated the second RNA interacting domain of eIF3d, the cap-binding domain. Mutation of key residues required for cap-binding [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] did not affect eIF3d localisation to SGs or SG assembly (Suppl Fig.\u0026nbsp;8C). These results confirmed that the RBD of eIF3d is the key domain required to promote SG assembly. To address the functional consequences of this, we performed a puromycin-incorporation assay to determine the importance of the eIF3d RBD for global translation. The knock-down of eIF3d reduced global translation by around 50% and this was rescued by wild-type eIF3d but not by the mutant lacking the RBD (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The mutation of the cap-binding region did not significantly impact global translation levels, supporting the evidence that the cap-binding function of eIF3d is directed towards highly specific subsets of mRNAs [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan additionalcitationids=\"CR51\" citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. We next determined whether the eIF3d RBD was important for cell survival in response to arsenite stress. The knock-down of eIF3d reduced cell number by about 70% in response to prolonged sodium arsenite stress (30 \u0026micro;M, 14 h) indicating the importance of eIF3d for cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). The expression of either wild-type or the cap-mutant eIF3d rescued this decrease in cell number, but the DRBD mutant did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Taken together, our data show that the RBD domain of eIF3d is critical for its role in SG formation and cell viability in response to arsenite stress.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eThe eIF3d orthologue EIF-3.D is required for stress granule formation in\u003c/b\u003e \u003cb\u003eC. elegans\u003c/b\u003e.\u003c/p\u003e\u003cp\u003eHaving established the importance of eIF3d for SG assembly in cultured human cells, we addressed if this was also the case in an animal model. The stress pathways regulating translation and the components of the translation initiation machinery are evolutionary conserved between humans and the nematode worm \u003cem\u003eC. elegans\u003c/em\u003e [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. We therefore employed two SG reporter strains combined with RNAi knockdown of the worm eIF3d orthologue EIF.3.D. The reporters feature pharyngeal expression of either red fluorescent protein (RFP) fused to the stress granule associated RNA binding protein PAB-1 (orthologue of human PABPC1) or Venus fluorescent protein fused to TIAR-2 (an orthologue of human TIA1/TIAR) [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Subjecting the reporter worms to heat stress (36\u003csup\u003eo\u003c/sup\u003eC, 3 h) induced the formation of RFP-PAB-1 and Venus-TIAR-2 positive granules in the pharynx (Suppl Fig.\u0026nbsp;9A). When the reporter worms were fed with \u003cem\u003eE. coli\u003c/em\u003e expressing \u003cem\u003eeif-3.D\u003c/em\u003e RNAi, SG formation was severely diminished (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). We conclude that EIF-3.D is required for heat-induced SG formation in \u003cem\u003eC. elegans\u003c/em\u003e. To gain a broader picture of the importance of eIF3 for SG formation \u003cem\u003ein vivo\u003c/em\u003e, we extended our RNAi analysis to the other subunits of the complex. We found that RNAi knock-down of multiple eIF3 subunits reduced granule formation to varying degrees (Suppl Figs.\u0026nbsp;9B and C). It was noted that the knock-down of some of these factors caused severe developmental defects (i.e. for EIF-3.B and G). In contrast, the knock-down of EIF-3.D and other factors, including EIF3.E and EIF-3.F, strongly impaired granule formation without having a drastic effect on development (Suppl Figs.\u0026nbsp;9 and 10). These data suggest that, in addition to eIF3d, other eIF3 factors also play important roles in SG assembly \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eThe eIF3 complex is essential for the initiation of canonical cap-dependent translation in collaboration with eIF4F and also mediates alternative mechanisms of translation initiation [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. In this study, we find that eIF3d is required for SG assembly in both human cell lines and in \u003cem\u003eC. elegans\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e) and that the RBD of eIF3d is essential for this (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This establishes eIF3d as an important SG regulatory factor. Our findings support experiments by Yang et al [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] who built on previous proteomic and functional screens [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] to define a core network of 36 proteins that are localised to SGs and are important for their assembly. These proteins include eIF3d, alongside well-characterised SG regulators such as G3BP1, G3BP2, TIAR, TIA1 and UBAP2L [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additional eIF3 factors are also part of this network including eIF3g, eIF3i and eIF3e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Our \u003cem\u003eC. elegans\u003c/em\u003e RNAi screen also identified these factors as important SG regulators \u003cem\u003ein vivo\u003c/em\u003e (Suppl Figs.\u0026nbsp;9 and 10). This suggests that eIF3d along with other eIF3 factors and a subset of RBPs play a central role in the coalescence of translationally stalled 48S pre-initiation complexes and their associated mRNAs into SGs in response to specific stresses.\u003c/p\u003e\u003cp\u003eStructural analysis of translation initiation complexes indicates that eIF3d forms part of the mRNA exit channel making contacts with eIF3e, eIF3a and eIF3c, as well as associating with the eIF4G component of the eIF4F complex and contacting 40S subunits and 18S rRNA [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], The RBD is clearly important for eIF3d function in translation as the DRBD mutant fails to rescue the decreased translation observed in eIF3d-depleted cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). An important question is whether eIF3d has a distinct role in SG assembly or is acting within the context of the eIF3 complex or translational initiation complexes. The RBD does not include either the region of eIF3d that binds to eIF3e or the eIF3c and eIF4G contact sites [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Therefore, the finding that it acts as an autonomous SG recruiting domain and supports SG assembly when fused to mCherry (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) argues that the major function of eIF3d in SG assembly is independent from the rest of the eIF3 complex. However, the rescue of SG assembly in eIF3d knock-down cells is less robust when expressing the RBD alone compared to full-length eIF3d (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This suggests that, while the RBD is essential for supporting SG assembly, eIF3d interactions with the eIF3 complex or other translation factors, potentially within the context of the stalled 48S PIC, may have contributory roles.\u003c/p\u003e\u003cp\u003eHow the RBD promotes eIF3d recruitment to SGs and their formation is unclear. The mutation of Arg residues to Lys within the RBD prevents its localisation to SGs and fails to support SG assembly (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and E; Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). Arg residues within RBDs can mediate multiple interactions with RNA through both hydrogen bonding and electrostatic interactions. It is possible that eIF3d is recruited to SGs via interactions with RNA and helps to nucleate and stabilise the condensates. Alternatively, or in combination, the RBD may form contacts with other proteins. Previous studies have identified multivalent interactions between Arg and aromatic side chains such as Tyr as drivers of phase separation [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Interestingly, the Arg residues in the eIF3d RBD can be methylated [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Arginine methylation within RBPs is reported to usually reduce their propensity to phase separate [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e], although may promote phase separation in specific contexts [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. It will be interesting to determine if Arg methylation of the eIF3d RBD is a key modification regulating its functions during stress.\u003c/p\u003e\u003cp\u003eAn important aspect of our study is that the requirement for eIF3d in SG formation is stress-specific. Stresses that induce canonical SGs downstream of eIF2a Ser-51 phosphorylation, including heat, moderate sodium arsenite stress and ER stress, require eIF3d for SG assembly (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Suppl Figs.\u0026nbsp;2 and 3). However, eIF3d is not required for the assembly of non-canonical SGs that form independently of eIF2a phosphorylation following eIF4A inhibition or osmotic stress, although it still localises to these granules (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Suppl Figs.\u0026nbsp;2\u0026ndash;4). This selective requirement for eIF3d may reflect differences in the importance of specific proteins or the prominence of RNA-RNA interactions depending on the type of stress and how it impacts translation. For example, it has been shown that SGs formed after eIF4A inhibition are more reliant on RNA-RNA interactions, reflecting the proposed role of eIF4A as an RNA chaperone that limits intermolecular RNA interactions [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. It is less clear how osmotic-stress induced SGs form as they are independent of both phosphorylated eIF2a and G3BP1 [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. One proposed mechanism is through a combination of macromolecular crowding due to cell shrinkage, combined with the increased ionic strength reducing electrostatic repulsion between mRNAs [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. This suggests that eIF3d may only become essential for SG assembly under conditions where RNA-RNA interactions are suppressed by eIF4A or physical and chemical changes to cells increase the likelihood for proteins and RNAs to coalesce.\u003c/p\u003e\u003cp\u003eA remaining question is how eIF3d functions are integrated in response to stress. As we have shown, a pool of eIF3d is recruited to SGs and is required for their assembly. However, when canonical eIF4E-dependent translation initiation is suppressed, eIF3d binds to the 5\u0026rsquo; cap of stress-specific mRNAs and mediates their translation [\u003cspan additionalcitationids=\"CR48 CR49 CR50 CR51\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. While translation has been reported to occur in the vicinity of SGs [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e], there is little evidence of this being widespread, suggesting that most stress-specific translation is occurring on ribosomes in the cytoplasm. Therefore, there may be distinct pools of eIF3d under stress conditions, one involved in the translation of essential stress-specific transcripts and one that participates in SG assembly. Furthermore, we also detect endogenous eIF3d in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Suppl Figs.\u0026nbsp;2 and 3) and the eIF3d RBD by itself is strongly nuclear suggesting that it may have a broader role in regulating eIF3d localisation (Suppl Fig.\u0026nbsp;7). The function of nuclear eIF3d is unclear, although a role in RNA splicing has been proposed [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. The latter may also link to eIF3d\u0026rsquo;s role in SGs as other splicing regulators are also core SG components [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. It will be important to determine how these different pools of eIF3d communicate and integrate as part of the cellular stress response.\u003c/p\u003e\u003cp\u003eIt is reported that eIF3d expression is upregulated in many cancers and may promote cell proliferation and survival of some cancer types [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. While there is evidence to suggest that this may be via regulating the translation of cell-cycle regulators, it is possible that high levels of eIF3d promote SG formation in cancer cells, thus contributing to their survival and resistance to anti-cancer drugs. Previous studies have implicated other core SG proteins such as G3BP1, CAPRIN-1 and TIA1 in promoting hallmarks of cancer [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, manipulating core SG proteins, such as eIF3d, may limit tumourigenesis and enhance anti-cancer therapies.\u003c/p\u003e\u003cp\u003eIn conclusion, we have characterised the function of the translation initiation factor eIF3d in SG assembly, adding to its expanding functional repertoire and supporting the evidence that it is a key mediator protecting cells from stress. Our data also suggest a more extensive role for eIF3 complex components in SG regulation and it will be interesting in future to determine their precise mechanisms, whether as part of eIF3 subcomplexes or acting independently.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eCell culture and treatments\u003c/h2\u003e\u003cp\u003eU2OS and HEK293T were purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco\u0026rsquo;s Modified Eagles Medium (D6429, Sigma-Aldrich). HeLa M cells were cultured in Dulbecco\u0026rsquo;s Modified Eagles Medium (D5796, Sigma-Aldrich). Both media were supplemented with 10% feotal bovine serum (FBS) (10500064, ThermoFisher). Cells were grown at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e. Stress granules were induced by addition of NaASO\u003csub\u003e2\u003c/sub\u003e (S7400, Sigma-Aldrich) or Thapsigargin (CAY10522, Cambridge Bioscience) at the concentrations and times indicated in the figure legends. Heat stress was applied by incubating cells with 43\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e for 1 hr. Mycoplasma testing was routinely performed every month as described [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eTransfection of plasmids and siRNAs\u003c/h3\u003e\n\u003cp\u003ePlasmids were transfected into cells using JetPEI (101B-010N, Polyplus Transfections). Cells were incubated 6 hr in the presence of plasmid/JetPEI followed by changing the medium and incubation overnight prior to analysis. Plasmid used were pCDNA3-Flag-eIF3d, pCDNA3-Flag-eIF3d (1-114), pCDNA3-Flag-eIF3d (115\u0026ndash;548), pCDNA3-Flag-eIF3d (DRBD) featuring a deletion of amino acids 86 to 118, pCDNA3-Flag-eIF3d (5RK) featuring arginine residues 95, 97, 99, 103 and 106 all changed to lysine, pmCherry-N1-eIF3d, pmCherry-N1-RBD, pmCherry-N1-PKI-NES-RBD and pmCherry-N1-PKI-NES-RBD (5RK). Details of plasmid generation will be provided upon request. siRNAs were transfected into cells plated in 6 well dishes at a concentration of 20nM using Lipofectamine RNAiMAX transfection reagent (13778150, ThermoFisher Scientific). Control siRNA (5\u0026rsquo;-AGGUAGUGUAAUCGCCUUG-3\u0026rsquo;) was made by Eurofins Technologies and siRNAs targeting the \u003cem\u003eEIF3D\u003c/em\u003e 3\u0026rsquo;UTR (Hs_EIF3D_1 SI05097344, Hs_EIF3D_7 SI04273612) were purchased from Qiagen.\u003c/p\u003e\u003cp\u003e\u003cb\u003eGeneration of stable cell lines\u003c/b\u003e To generate doxycycline inducible shRNAs, double-stranded oligonucleotides targeting the 3\u0026rsquo; UTR of \u003cem\u003eEIF3D\u003c/em\u003e transcripts (Fwd: 5\u0026rsquo;-CCGGCTTAGTGGAATGTGTGTCTAACTCGAGTTAGACACACATTCCACTAAGTTTTTG-3\u0026rsquo;; Rev: 5\u0026rsquo;- AATTCAAAAACTTAGTGGAATGTGTGTCTAACTCGAGTTA GAC ACA CATTCC ACTAAG-3\u0026rsquo;) and non-targeting control (Fwd: 5\u0026rsquo;-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3\u0026rsquo;; Rev: 5\u0026rsquo;-AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGG CGACTTAACCTTAGG-3\u0026rsquo;) were synthesised by Eurofins Technologies and subcloned into Age I and Eco RI restriction enzymes in Tet-pLKO-puro lentiviral plasmid (Addgene #21915). The lentiviral plasmid expressing wild-type eIF3d fused to 3xFlag sequence under the control of the hPGK promoter was designed by the Whitmarsh Lab and purchased from VectorBuilder. The eIF3d(DRBD) mutant, eIF3d Cap Mutant (D249Q/V262I/Y263A) and empty vector control were constructed using Q5 site-directed mutagenesis kit (E0554; NEB). Lentiviral particles were generated with HEK293T cells as previously described [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Infected cells were selected by incubation with 2 \u0026micro;g/mL puromycin and 10 \u0026micro;g /ml blasticidin until no live cells remained in the non-infected group. Resistant colonies were pooled and expanded in antibiotic-free medium.\u003c/p\u003e\n\u003ch3\u003eProtein extraction and immunoblot analysis\u003c/h3\u003e\n\u003cp\u003eCells were washed with PBS and lysed in RIPA buffer (R-0278, Sigma-Aldrich) supplemented with protease and phosphatase inhibitors (87786 and 78420, ThermoFisher Scientific). Protein concentrations were quantified by DC\u0026trade; protein assay (500\u0026thinsp;\u0026minus;\u0026thinsp;0112, Bio-Rad). Protein lysates were loaded on 10% or 14% polyacrylamide gels (A2-0072, ProtoGel) and electrophoresis performed at 100 V for 2 hr. Resolved proteins were transferred to nitrocellulose (NC) membrane (1704270, Biorad transfer kit) using Trans-Blot Turbo Transfer System (25V 2.5mA 7min). Membranes were blocked with 1x casein blocking buffer (86429, Sigma-Aldrich) in TBS (J60877.K2, Thermo Scientific) for 1 hr at room temperature and incubated with primary antibodies in TBST (28360, Thermo Scientific) overnight at 4\u0026deg;C. Membranes were washed in TBST buffer and incubated for 1 hr at room temperature with IRDye\u0026reg; 800CW anti-rabbit or anti-mouse secondary antibodies (LI-COR) diluted in casein/TBST, prior to washing with TBST buffer and imaging using the Odyssey infrared system (LI-COR Biosciences). Fluorescent signals were quantified using Empiria studio v1.1. Antibodies used are described in Supplementary Table\u0026nbsp;1. Unprocessed scans of immunoblots are provided in Supplementary Fig.\u0026nbsp;11.\u003c/p\u003e\u003cp\u003e\u003cb\u003eImmunofluorescence microscopy\u003c/b\u003e Cells were grown on cover slips and fixed in 4% Paraformaldehyde (158127, Sigma-Aldrich) for 15min at room temperature. Cells were permeabilised with PBS (60-00010-11, PluriSelect) containing 0.2% Triton X-100 for 20min and blocked with 3% BSA (5217, Tocris) in 0.1% Triton X-100 PBST for 30min. Cover slips were incubated at 4\u0026deg;C with primary antibodies to eIF3d, G3BP1, TIA1 or Anti-Flag M2 (see Suppl Table\u0026nbsp;1). Following washes with 0.1% PBST, cells were incubated in 3% BSA in 0.1% PBST solution containing Alexa Fluor\u0026trade; fluorescent secondary antibodies (Invitrogen; see Suppl Table\u0026nbsp;1) for 1h at room temperature, before further washes in PBST and mounting using the Prolong\u0026reg; Diamond-DAPI (P36962, ThermoFisher). Cover slips were sealed onto slides with antifade coverslip sealant (23005, Biotium) after mounting overnight. Imaging was performed on a Leica DM500B Fluorescence microscope with filters set for DAPI, FITC and Texas Red. Images were collected with a Leica DCF340 FX camera at a magnification of 40x and 63x. Images were processed with Image J software.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePuromycin incorporation assay\u003c/b\u003e Cells were seeded in 3cm dishes (4 x 10\u003csup\u003e4\u003c/sup\u003e) and allowed to adhere overnight before treated with 100ng/ml Dox for 2 days to knockdown expression of the endogenous eIF3d. Puromycin (A1113803, Gibco\u0026trade; Puromycin Dihydrochloride) was added to cells for 10 min at a final concentration of 10 \u0026micro;g/ml prior to harvesting and lysis. The anti-puromycin antibody (MABE343, Merck) was used at a dilution of 1:25,000.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell viability assay\u003c/b\u003e The lentiviral cell lines were seeded at a density of 6,000 cells per well in 24-well plates and allowed to adhere overnight before being treated with 100 ng/mL doxycycline for 2 days. Cell viability was evaluated using the Cell Counting Kit-8 (CCK8, 7368, Tocris) according to the manufacturer's instructions. Briefly, the cells were incubated with 10% CCK8 solution at 37\u0026deg;C for 2 hours. Then, 100 \u0026micro;L of the culture medium was transferred to 96-well plates, and the absorbance was measured at 450 nm using a plate reader (SPECTROstar Nano).\u003c/p\u003e\u003cp\u003e\u003cb\u003eC. elegans\u003c/b\u003e \u003cb\u003eRNAi and heat shock\u003c/b\u003e \u003cem\u003eC. elegans\u003c/em\u003e were fed \u003cem\u003eEscherichia coli\u003c/em\u003e strain OP50 and maintained at 20\u0026deg;C on nematode growth medium (NGM) composed of 50 mM NaCl, 0.25% (w/v) Bacto-peptone, and 1.7% (w/v) agar, supplemented with 1 mM MgSO₄, 1 mM CaCl₂, 25 mM KH₂PO₄ (pH 6.0), and 5 \u0026micro;g/mL cholesterol. The strains used in this study included Bristol N2 (wild-type), N2; uqEx41[Pmyo-2::venus::tiar-2], and N2; uqIs24[Pmyo-2::tagRFP::pab-1], kindly provided by Della David (German Center for Neurodegenerative Diseases, T\u0026uuml;bingen). Gravid worms were synchronised in bleaching solution (0.7M NaOH, 20% (v/v) sodium hypochlorite) on the NGM plate before the stress response experiments. RNAi plasmid containing \u003cem\u003eE. coli\u003c/em\u003e were obtained from the Ahringer or Vidal RNAi libraries [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. All \u003cem\u003eE. coli\u003c/em\u003e HT115 (DE3) strains harboring RNAi constructs were confirmed by sequencing (Eurofins Scientific). RNAi by feeding was performed as previously described [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. Briefly, NGM plates were supplemented with Carbenicillin (50 \u0026micro;g/ml) (1273\u0026ndash;7149, ThermoFisher scientific), IPTG (1 mM) (11858905, Promega). Worms were randomly allocated to either control plates with HT115 (DE3) \u003cem\u003eE. coli\u003c/em\u003e bacteria transformed with empty L4440 plasmid vector or to plates with HT115 (DE3) \u003cem\u003eE. coli\u003c/em\u003e expressing the RNAi. Worms were synchronised in bleaching solution on plates and fed with RNAi bacteria until they grew to day 1 adults. The day 1 adult worms were placed in a 36℃ water bath for 3h prior to imaging.\u003c/p\u003e\u003cp\u003e\u003cb\u003eC. elegans\u003c/b\u003e \u003cb\u003eimaging\u003c/b\u003e For live imaging, a maximum of 15 worms were paralysed with 20mM tetramisole for 2\u0026ndash;3 min on a 2% agarose pad [0.2g agarose in 20 ml M9 buffer (42mM Na2HPO4.12H2O, 22mM KH2PO4 (pH 6), 86mM NaCl, 1mM MgSO4)] before observation. A Leica DM500 B Fluorescence microscope was used with filter sets for Texas Red and FITC. Images were collected with a Leica DCF340 FX camera at a magnification of 40x and an exposure of 168ms using LeicaSuite v4.0 software. The brightfield images were taken using DIC microscopy with an exposure of 40ms.Images were processed with Image J software. The representative and quantificational images of RNAi experiments presented here were obtained using a Dragonfly upright confocal using a 40x Plan Fluotar objective. Each \u003cem\u003eC. elegans\u003c/em\u003e pharynx was selected as the region of interest and stress granules were segmented from the image background using a threshold range of 50\u0026ndash;132 GV. A particle analysis script in ImageJ was then applied to quantify stress granule sizes. To minimize the influence of imaging artifacts and background noise, granules larger than 1 \u0026micro;m\u0026sup2; were outlined. The total area of these granules in each worm was subsequently used to compare differences between experimental conditions.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eFor immunofluorescence experiments, statistical analysis was performed on three biological repeats unless otherwise stated. 100 cells were counted in each repeat and the analysis performed using PRISM software and one or two-way ANOVA as stated in the figure legends. For puromycin incorporation assays, quantification was performed by measuring the intensity of the puromycin signal using Image Studio Lite software in each of five biological repeats. Puromycin signal normalisation for each sample was performed against the Coomassie Blue intensity. Statistical analysis by one-way ANOVA or t-test was performed using PRISM software. For \u003cem\u003eC. elegans\u003c/em\u003e, at least 30 worms were analysed per condition across three biological replicates and the area of TIAR-2\u0026ndash;positive granules per worm quantified using Image J software. Statistical analysis by two-way ANOVA was performed using PRISM software.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDATA AVAILABILITY\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eReagents are available upon request to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGEMENTS\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Della David (The Babraham Institute, Cambridge, UK) for providing the reporter strains and Laurent Désaubry for providing FL3. We thank Weitao Xiao for technical help. This work was supported by Biotechnology and Biological Sciences Research Council (BBSRC) project grants BB/V015109/1\u0026nbsp;to M.P.A and BB/X006859/1 to G.B.P. A.P.S was funded as part of a Wellcome Trust Ph.D studentship programme.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTION\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAJW, MPA and GBP designed the study with assistance from JL and APS.\u0026nbsp;JL, APS, PB and AJW performed the experiments. WZ and CT developed and assisted with methodology. AJW and JL wrote the paper. All authors read, helped revise and approved the final paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eETHICS STATEMENT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStudy did not require ethical approval\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKultz D. Evolution of cellular stress response mechanisms. \u003cem\u003eAnnu Rev Physiol\u003c/em\u003e 67, 225\u0026ndash;257 (2005). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.physiol.67.040403.103635\u003c/span\u003e\u003cspan address=\"10.1146/annurev.physiol.67.040403.103635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSpriggs KA, Bushell M \u0026amp; Willis AE. Translational regulation of gene expression during conditions of cell stress. \u003cem\u003eMol Cell\u003c/em\u003e 40, 228\u0026ndash;237 (2010). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2010.09.028\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2010.09.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdvani VM \u0026amp; Ivanov P. Translational control under stress: reshaping the translatome. \u003cem\u003eBioessays\u003c/em\u003e 41, e1900009 (2019). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bies.201900009\u003c/span\u003e\u003cspan address=\"10.1002/bies.201900009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSimpson CE \u0026amp; Ashe MP. Adaption to stress: to translate or not? \u003cem\u003eBiochem Soc Trans\u003c/em\u003e 40, 794\u0026ndash;799 (2012). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/BST20120078\u003c/span\u003e\u003cspan address=\"10.1042/BST20120078\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJain S, Wheeler JR, Walters RW, Agrawal A, Barsic A \u0026amp; Parker R. ATPase-modulated stress granules contain a diverse proteome and substructure. \u003cem\u003eCell\u003c/em\u003e 164, 487\u0026ndash;498 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2015.12.038\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2015.12.038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKedersha N, Chen S, Gilks N, Li W, Miller IJ, Stahl J, \u003cem\u003eet al\u003c/em\u003e. Evidence that ternary complex (eIF2-GTP-tRNA(i)(Met))-deficient preinitiation complexes are core constituents of mammalian stress granules. \u003cem\u003eMol Biol Cell\u003c/em\u003e 13:195\u0026ndash;210 (2002). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/mbc.01-05-0221\u003c/span\u003e\u003cspan address=\"10.1091/mbc.01-05-0221\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMarkmiller S, Soltanieh S, Server KL, Mak R, Jin W, Fang MY, \u003cem\u003eet al.\u003c/em\u003e Context-dependent and disease-specific diversity in protein interactions within stress granules. \u003cem\u003eCell\u003c/em\u003e 172, 590\u0026ndash;604 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2017.12.032\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2017.12.032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoun, J-Y, Dyakov BJA, Zhang J, Knight JDR, Vernon RM, Forman-Kay JD, \u003cem\u003eet al\u003c/em\u003e. Properties of stress granules and P-body proteomes. \u003cem\u003eMol Cell\u003c/em\u003e 76, 286\u0026ndash;294 (2019). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2019.09.014\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2019.09.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHofmann S, Kedersha N, Anderson P \u0026amp; Ivanov P. Molecular mechanisms of stress granule assembly and disassembly. \u003cem\u003eBiochim Biophys Acta Mol Cell Res\u003c/em\u003e 1868,118876 (2021). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbamcr.2020.118876\u003c/span\u003e\u003cspan address=\"10.1016/j.bbamcr.2020.118876\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMolliex A, Temirov J, Lee J, Coughlin M, Kanagaraj AP, Kim HJ, \u003cem\u003eet al\u003c/em\u003e. Phase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillization. \u003cem\u003eCell\u003c/em\u003e 163, 123\u0026ndash;133 (2015). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2015.09.015\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2015.09.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParker DM, Tauber D \u0026amp; Parker R. G3BP1 promotes intermolecular RNA-RNA interactions during RNA condensation. \u003cem\u003eMol Cell\u003c/em\u003e 85, 571\u0026ndash;584.e7 (2025). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2024.11.012\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2024.11.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eProtter DS \u0026amp; Parker R. Principles and properties of stress granules. \u003cem\u003eTrends Cell Biol.\u003c/em\u003e 26, 668\u0026ndash;679 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tcb.2016.05.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tcb.2016.05.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSfakianos AP, Whitmarsh AJ \u0026amp; Ashe MP. Ribonucleoprotein bodies are phased in. \u003cem\u003eBiochem Soc Trans.\u003c/em\u003e 44, 1411\u0026ndash;1416 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1042/BST20160117\u003c/span\u003e\u003cspan address=\"10.1042/BST20160117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Treeck B, Protter DS, Matheny T, Khong A, Link CD \u0026amp; Parker R. RNA self-assembly contributes to stress granule formation and defining the stress granule transcriptome. \u003cem\u003eProc Natl Acad Sci USA\u003c/em\u003e 115, 2734\u0026ndash;2739 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1800038115\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1800038115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuillen-Boixet J, Kopach A, Holehouse AS, Wittmann S, Jahnel M, Schlussler R, \u003cem\u003eet al.\u003c/em\u003e RNA-induced conformational switching and clustering of G3BP drive stress granule assembly by condensation. \u003cem\u003eCell\u003c/em\u003e 181, 346\u0026ndash;361 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2020.03.049\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.03.049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKedersha N, Panas MD, Achorn CA, Lyons S, Tisdale S, Hickman T, \u003cem\u003eet al.\u003c/em\u003e G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits. \u003cem\u003eJ Cell Biol\u003c/em\u003e 212, 845\u0026ndash;860 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1083/jcb.201508028\u003c/span\u003e\u003cspan address=\"10.1083/jcb.201508028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSanders DW, Kedersha N, Lee DSW, Strom AR, Drake V, Riback JA, \u003cem\u003eet al.\u003c/em\u003e Competing protein-RNA interaction networks control multiphase intracellular organization. \u003cem\u003eCell\u003c/em\u003e 181, 306\u0026ndash;324 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2020.03.050\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.03.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang P, Mathieu C, Kolaitis R-M, Zhang P, Messing J, Yurtsever U, \u003cem\u003eet al.\u003c/em\u003e G3BP1 is a tunable switch that triggers phase separation to assemble stress granules. \u003cem\u003eCell\u003c/em\u003e 181, 325\u0026ndash;345 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2020.03.046\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.03.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdvani VM \u0026amp; Ivanov P. Stress granule subtypes: an emerging link to neurodegeneration. \u003cem\u003eCell Mol Life Sci.\u003c/em\u003e 77, 4827\u0026ndash;4845 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-020-03565-0\u003c/span\u003e\u003cspan address=\"10.1007/s00018-020-03565-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAulas A, Fay MM, Lyons SM, Achorn CA, Kedersha N, Anderson P, \u003cem\u003eet al\u003c/em\u003e. Stress-specific differences in assembly and composition of stress granules and related foci. \u003cem\u003eJ Cell Sci\u003c/em\u003e 130, 927\u0026ndash;937 (2017). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1242/jcs.199240\u003c/span\u003e\u003cspan address=\"10.1242/jcs.199240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBuchan JR. Stress granule and P-body clearance: seeking coherence in acts of disappearance. \u003cem\u003eSem Cell Dev Biol\u003c/em\u003e 159\u0026ndash;160, 10\u0026ndash;26 (2024). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.semcdb.2024.01.002\u003c/span\u003e\u003cspan address=\"10.1016/j.semcdb.2024.01.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu S, Zhang Y, Yi Q, Yang C, Liu Y \u0026amp; Bai Y. Time-resolved proteomic profiling reveals compositional and functional transitions across the stress granule life cycle. \u003cem\u003eNat Commun\u003c/em\u003e 14, 7782 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-43470-1\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-43470-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMollet S, Cougot N, Wilczynska A, Dautry F, Kress M, Bertrand E, \u003cem\u003eet al\u003c/em\u003e. Translationally repressed mRNA transiently cycles through stress granules during stress. \u003cem\u003eMol Biol Cell\u003c/em\u003e 19, 4469\u0026ndash;4479 (2008). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/mbc.e08-05-0499\u003c/span\u003e\u003cspan address=\"10.1091/mbc.e08-05-0499\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen Z, Tang W, Peng L \u0026amp; Zou P. Profiling stress-triggered RNA condensation with photocatalytic proximity labelling. \u003cem\u003eNat Commun\u003c/em\u003e 14, 7390 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-023-43194-2\u003c/span\u003e\u003cspan address=\"10.1038/s41467-023-43194-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEiermann N, Haneke K, Sun Z, Stoecklin G \u0026amp; Ruggieri A. Dance with the devil: stress granules and signalling in antiviral responses. \u003cem\u003eViruses\u003c/em\u003e 12, 984 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/v12090984\u003c/span\u003e\u003cspan address=\"10.3390/v12090984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSamir P, Kesavardhana S, Patmore DM, Gingras S, Malireddi RKS, Karki R, \u003cem\u003eet al\u003c/em\u003e. DDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasome. \u003cem\u003eNature\u003c/em\u003e 573: 590\u0026ndash;594 (2019). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-019-1551-2\u003c/span\u003e\u003cspan address=\"10.1038/s41586-019-1551-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBussi C, Mangiarotti A, Vanhille-Campos C, Aylan B, Pellegrino E, Athanasiadi N, \u003cem\u003eet al\u003c/em\u003e. Stress granules plug and stabilize damaged endolysosomal membranes. \u003cem\u003eNature\u003c/em\u003e 263, 1062\u0026ndash;1069 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41586-023-06726-w\u003c/span\u003e\u003cspan address=\"10.1038/s41586-023-06726-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCao X, Jin X \u0026amp; Liu B. The involvement of stress granules in ageing and ageing-associated diseases. \u003cem\u003eAging Cell\u003c/em\u003e 19, e13136 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/acel.13136\u003c/span\u003e\u003cspan address=\"10.1111/acel.13136\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi T, Zeng Z, Fan C \u0026amp; Xiong W. Role of stress granules in tumorigenesis and cancer therapy. \u003cem\u003eBiochim Biophys Acta Rev Cancer\u003c/em\u003e 1878, 189006 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbcan.2023.189006\u003c/span\u003e\u003cspan address=\"10.1016/j.bbcan.2023.189006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eArimoto K, Fukuda H, Imajoh-Ohmi S, Saito H \u0026amp; Takekawa M. Formation of stress granules inhibits apoptosis by suppressing stress-responsive MAPK pathways. \u003cem\u003eNat. Cell Biol.\u003c/em\u003e 10, 1324\u0026ndash;1332 (2008). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncb1791\u003c/span\u003e\u003cspan address=\"10.1038/ncb1791\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFujikawa D, Nakamura T, Yoshioka D, Li Z, Moriizumi H, Taguchi M, \u003cem\u003eet al\u003c/em\u003e. Stress granule formation inhibits stress-induced apoptosis by selectively sequestering executioner caspases. \u003cem\u003eCurr Biol\u003c/em\u003e 33, 1967\u0026ndash;1981 (2023). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1016/j.cub.2023.04.012\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2023.04.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKedersha N, Ivanov P \u0026amp; Anderson P. Stress granules and cell signaling: more than just a passing phase? \u003cem\u003eTrends Biochem Sci\u003c/em\u003e 38, 494\u0026ndash;506 (2013). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tibs.2013.07.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tibs.2013.07.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSfakianos AP, Mellor LM, Pang YF, Kritsiligkou P, Needs H, Abou-Hamdan H, \u003cem\u003eet al\u003c/em\u003e. The mTOR-S6 kinase pathway promotes stress granule assembly. \u003cem\u003eCell Death Diff\u003c/em\u003e 25, 1766\u0026ndash;1780 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41418-018-0076-9\u003c/span\u003e\u003cspan address=\"10.1038/s41418-018-0076-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThedieck K, Holzwarth B, Prentzell MT, Boehlke C, Kl\u0026auml;sener K, Ruf S, \u003cem\u003eet al.\u003c/em\u003e Inhibition of mTORC1 by astrin and stress granules prevents apoptosis in cancer cells. \u003cem\u003eCell\u003c/em\u003e 154, 859\u0026ndash;874 (2013). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2013.07.031\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2013.07.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDang Y, Kedersha N, Low WK, Romo D, Gorospe M, Kaufman R, \u003cem\u003eet al\u003c/em\u003e. Eukaryotic initiation factor 2α-independent pathway of stress granule induction by the natural product pateamine A. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e 281, 32870\u0026ndash;32878 (2006). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M606149200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M606149200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMazroui R, Sukarieh R, Bordeleau ME, Kaufman RJ, Northcote P, Tanaka J, \u003cem\u003eet al\u003c/em\u003e. Inhibition of ribosome recruitment induces stress granule formation independently of eukaryotic initiation factor 2alpha phosphorylation. \u003cem\u003eMol Biol Cell\u003c/em\u003e 17, 4212\u0026ndash;4219 (2006). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1091/mbc.e06-04-0318\u003c/span\u003e\u003cspan address=\"10.1091/mbc.e06-04-0318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTauber D, Tauber G, Khong A, Van Treeck B, Pelletier J \u0026amp; Parker R. Modulation of RNA condensation by the DEAD-box protein eIF4A. \u003cem\u003eCell\u003c/em\u003e 180, 411\u0026ndash;426.e16 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2019.12.031\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2019.12.031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOhn T, Kedersha N, Hickman T, Tisdale S \u0026amp; Anderson P. A functional RNAi screen links O-GlcNAc modification of ribosomal proteins to stress granule and processing body assembly. \u003cem\u003eNat Cell Biol\u003c/em\u003e 10, 1224\u0026ndash;1231 (2008). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncb1783\u003c/span\u003e\u003cspan address=\"10.1038/ncb1783\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWagner S, Herrmannova A, Sikrova D \u0026amp; Valasek LS. Human eIF3b and eIF3a serve as the nucleation core for the assembly of eIF3 into two interconnected modules: the yeast-like core and the octamer. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 44, 10772\u0026ndash;10788 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkw972\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkw972\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003edes Georges A, Dhote V, Kuhn L, Hellen CU, Pestova TV, Frank J, \u003cem\u003eet al\u003c/em\u003e. Structure of mammalian eIF3 in the context of the 43S preinitiation complex. \u003cem\u003eNature\u003c/em\u003e 525, 491\u0026ndash;495 (2015). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature14891\u003c/span\u003e\u003cspan address=\"10.1038/nature14891\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSmith MD, Arake-Tacca L, Nitido A, Montabana E, Park A \u0026amp; Cate JH. Assembly of eIF3 mediated by mutually dependent subunit insertion. \u003cem\u003eStructure\u003c/em\u003e 24, 886\u0026ndash;896 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.str.2016.02.024\u003c/span\u003e\u003cspan address=\"10.1016/j.str.2016.02.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCate JH. Human eIF3: from \u0026lsquo;blobology\u0026rsquo; to biological insight. \u003cem\u003ePhil. Trans. R. Soc. B\u003c/em\u003e 372, 20160176 (2017). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1098/rstb.2016.0176\u003c/span\u003e\u003cspan address=\"10.1098/rstb.2016.0176\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eValasek LS, Zeman J, Wagner S, Beznoskova P, Pavlikova Z, Mohammad MP, \u003cem\u003eet al\u003c/em\u003e. Embraced by eIF3: structural and functional insights into the roles of eIF3 across the translational cycle. \u003cem\u003eNucleic Acids Res\u003c/em\u003e. 45, 10948\u0026ndash;10968 (2017). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkx805\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkx805\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVilla N, Do A, Hershey JW \u0026amp; Fraser CS. Human eukaryotic initiation factor 4G (eIF4G) protein binds to eIF3c, -d, and -e to promote mRNA recruitment to the ribosome. \u003cem\u003eJ Biol Chem\u003c/em\u003e 288, 32932\u0026ndash;32940 (2013). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M113.517011\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M113.517011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin Y, Li F, Huang L, Polte C, Duan H, Fang J, \u003cem\u003eet al.\u003c/em\u003e eIF3 Associates with 80S ribosomes to promote translation elongation, mitochondrial homeostasis, and muscle health. \u003cem\u003eMol Cell\u003c/em\u003e 79: 575\u0026ndash;587.e7 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2020.06.003\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2020.06.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMohammad MP, Munzarov\u0026aacute; Pondel\u0026iacute;ckov\u0026aacute; V, Zeman J, Gunišov\u0026aacute; S \u0026amp; Val\u0026aacute;šek LS. In vivo evidence that eIF3 stays bound to ribosomes elongating and terminating on short upstream ORFs to promote reinitiation. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 45: 2658\u0026ndash;2674 (2017). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkx049\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkx049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede la Parra C, Ernlund A, Alard A, Ruggles K, Ueberheide B \u0026amp; Schneider RJ. A widespread alternate form of cap-dependent mRNA translation initiation. \u003cem\u003eNat Commun\u003c/em\u003e 9, 3068 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-018-05539-0\u003c/span\u003e\u003cspan address=\"10.1038/s41467-018-05539-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLamper AM, Fleming RH, Ladd KM \u0026amp; Lee ASY. A phosphorylation-regulated eIF3d translation switch mediates cellular adaptation to metabolic stress. \u003cem\u003eScience\u003c/em\u003e 370: 853\u0026ndash;856 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.abb0993\u003c/span\u003e\u003cspan address=\"10.1126/science.abb0993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee AS, Kranzusch PJ, Doudna JA \u0026amp; Cate JH. eIF3d is an mRNA cap-binding protein that is required for specialized translation initiation. \u003cem\u003eNature\u003c/em\u003e 536, 96\u0026ndash;99 (2016). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature18954\u003c/span\u003e\u003cspan address=\"10.1038/nature18954\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMukhopadhyay S, Amodeo ME \u0026amp; Lee ASY. eIF3d controls the persistent integrated stress response. \u003cem\u003eMol Cell\u003c/em\u003e 83, 3303\u0026ndash;3313 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.molcel.2023.08.008\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2023.08.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQuartey JNK \u0026amp; Goss DJ. eIF3d and eIF4G2 mediate an alternative mechanism of cap-dependent but eIF4E-independent translation initiation. \u003cem\u003eJ Biol Chem\u003c/em\u003e 301, 108317 (2025). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbc.2025.108317\u003c/span\u003e\u003cspan address=\"10.1016/j.jbc.2025.108317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVolta V, Perez-Baos S, de la Parra C, Katsara O, Ernlund A, Dornbaum S, \u003cem\u003eet al.\u003c/em\u003e A DAP5/eIF3d alternate mRNA translation mechanism promotes differentiation and immune suppression by human regulatory T cells. \u003cem\u003eNat Commun\u003c/em\u003e 12, 6979 (2021). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-021-27087-w\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-27087-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa S, Liu J-Y \u0026amp; Zhang J-T. eIF3d: a driver of non-canonical cap-dependent translation of specific mRNAs and a trigger of biological/pathological processes. \u003cem\u003eJ Biol Chem\u003c/em\u003e 299, 104658 (2023). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbc.2023.104658\u003c/span\u003e\u003cspan address=\"10.1016/j.jbc.2023.104658\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHerrmannova A, Jelinek J, Pospisilova K, Kerenyi F, Vomastek T, Watt K, \u003cem\u003eet al.\u003c/em\u003e Perturbations in eIF3 subunit stoichiometry alter expression of ribosomal proteins and key components of the MAPK signaling pathways. \u003cem\u003eeLife\u003c/em\u003e 13, RP95846 (2024). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7554/eLife.95846\u003c/span\u003e\u003cspan address=\"10.7554/eLife.95846\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBevilacqua E, Wang X, Majumder M, Gaccioli F, Yuan CL, Wang C, \u003cem\u003eet al.\u003c/em\u003e eIF2a phosphorylation tips the balance to apoptosis during osmotic stress. \u003cem\u003eJ Biol Chem\u003c/em\u003e 285, 17098\u0026ndash;17111 (2010). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M110.109439\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M110.109439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoussemart L, Malka-Mahieu H, Girault I, Allard D, Hemmingsson O, Tomasic G, \u003cem\u003eet al.\u003c/em\u003e eIF4F is a nexus of resistance to anti-BRAF and anti-MEK cancer therapies. \u003cem\u003eNature\u003c/em\u003e 513, 105\u0026ndash;109 (2014). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature13572\u003c/span\u003e\u003cspan address=\"10.1038/nature13572\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThuaud F, Bernard Y, Tukeri G, Dirr R, Aubert G, Cresteil T, \u003cem\u003eet al.\u003c/em\u003e Synthetic analogue of rocaglaol displays a potent selective cytotoxicity in cancer cells: involvement of apoptosis inducing factor and caspase-12. \u003cem\u003eJ Med Chem\u003c/em\u003e 52, 5176\u0026ndash;5187 (2009). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/jm900365v\u003c/span\u003e\u003cspan address=\"10.1021/jm900365v\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBochler A, Querido JB, Prilepskaja T, Soufari H, Simonetti A, Del Cistia ML, \u003cem\u003eet al\u003c/em\u003e. Structural differences in translation initiation between pathogenic Trypanosomatids and their mammalian hosts. \u003cem\u003eCell Rep\u003c/em\u003e 33, 108534 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2020.108534\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2020.108534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBrito Querido JB, Sokabe M, Kraatz S, Gordiyenko Y, Skehel JM, Fraser CS, \u003cem\u003eet al\u003c/em\u003e. Structure of a human 48S translation initiation complex. \u003cem\u003eScience\u003c/em\u003e 369, 1220\u0026ndash;1227 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.aba4904\u003c/span\u003e\u003cspan address=\"10.1126/science.aba4904\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAsano K, Vornlocher H-P, Richter-Cook NJ, Merrick WC, Hinnebusch AG \u0026amp; Hershey JWB. Structure of cDNAs encoding human eukaryotic initiation factor 3 subunits. \u003cem\u003eJ Biol Chem\u003c/em\u003e 272, 27042\u0026ndash;27052 (1997). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0300-9084(97)86711-9\u003c/span\u003e\u003cspan address=\"10.1016/s0300-9084(97)86711-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJager S, Cimermancic P, Gulbahce N, Johnson JR, McGovern KE, Clarke SC, \u003cem\u003eet al.\u003c/em\u003e Global landscape of HIV-human protein complexes. \u003cem\u003eNature\u003c/em\u003e 481, 365\u0026ndash;370 (2012). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature10719\u003c/span\u003e\u003cspan address=\"10.1038/nature10719\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang J, Choi JM, Holehouse AS, Lee HO, Zhang X, Jahnel M, \u003cem\u003eet al\u003c/em\u003e. A molecular grammar governing the driving forces for phase separation of Prion-like RNA binding domains. \u003cem\u003eCell\u003c/em\u003e 174, 688\u0026ndash;699 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2018.06.006\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2018.06.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWen W, Meinkoth JL, Tsien RY \u0026amp; Taylor SS. Identification of a signal for rapid export of proteins from the nucleus. \u003cem\u003eCell\u003c/em\u003e 82, 463\u0026ndash;473 (1995). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0092-8674(95)90435-2\u003c/span\u003e\u003cspan address=\"10.1016/0092-8674(95)90435-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRhoads RE, Dinkova TD \u0026amp; Korneeva NL. Mechanism and regulation of translation in \u003cem\u003eC. elegans. WormBook\u003c/em\u003e, ed. The \u003cem\u003eC. elegans\u003c/em\u003e Research Community, WormBook (2006), doi/\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1895/wormbook.1.63.1\u003c/span\u003e\u003cspan address=\"10.1895/wormbook.1.63.1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.wormbook.org\u003c/span\u003e\u003cspan address=\"http://www.wormbook.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLechler MC, Crawford ED, Groh N, Widmaier K, Jung R, Kirstein J, \u003cem\u003eet al\u003c/em\u003e. Reduced insulin/IGF-1 signaling restores the dynamic properties of key stress granule proteins during ageing. \u003cem\u003eCell Rep.\u003c/em\u003e 18, 454\u0026ndash;467 (2017). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2016.12.033\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.12.033\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEliseev B, Yeramal L, Leitner A, Karuppasamy M, Raimondeau E, Huard K, \u003cem\u003eet al\u003c/em\u003e. Structure of a human cap-dependent translation pre-initiation complex. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 46, 2678\u0026ndash;2689 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gky054\u003c/span\u003e\u003cspan address=\"10.1093/nar/gky054\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo A, Gu H, Zhou J, Mulhern D, Wang Y, Lee KA, \u003cem\u003eet al.\u003c/em\u003e Immunoaffinity enrichment and mass spectrometry analysis of protein methylation. \u003cem\u003eMol Cell Proteomics\u003c/em\u003e 13, 372\u0026ndash;387 (2014). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/mcp.O113.027870\u003c/span\u003e\u003cspan address=\"10.1074/mcp.O113.027870\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu L, Li T, Zhang R, Wang Y, Ye X, Luo Y, \u003cem\u003eet al\u003c/em\u003e. Tudor-based proteomic strategy pan-specifically enriches and identifies protein arginine methylation. \u003cem\u003eEMBO Rep\u003c/em\u003e. Oct 20 (2025). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s44319-025-00599-y\u003c/span\u003e\u003cspan address=\"10.1038/s44319-025-00599-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHofweber M \u0026amp; Dormann D. Friend or foe \u0026ndash; post-translational modifications as regulators of phase separation and RNP granule dynamics. \u003cem\u003eJ Biol Chem\u003c/em\u003e 294, 7137\u0026ndash;7150 (2018). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.TM118.001189\u003c/span\u003e\u003cspan address=\"10.1074/jbc.TM118.001189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang L \u0026amp; Li P. Arginine methylation-enabled FUS phase separation with SMN contributes to neuronal granule formation. \u003cem\u003eCell Rep\u003c/em\u003e 43, 114537 (2024). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2024.114537\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2024.114537\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBounedjah O, Hamon L, Savarin P, Desforges B, Curmi PA \u0026amp; Pastre D. Macromolecular crowding regulates assembly of mRNA stress granules after osmotic stress: new role for compatible osmolytes. \u003cem\u003eJ Biol Chem\u003c/em\u003e 287, 2446\u0026ndash;2458 (2012). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.M111.292748\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M111.292748\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMateju D, Eichenberger B, Voigt F, Eglinger J, Roth G \u0026amp; Chao JA. Single-molecule imaging reveals translation of mRNAs localized to stress granules. \u003cem\u003eCell\u003c/em\u003e 183, 1801\u0026ndash;1812 (2020). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2020.11.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.11.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu D, Mihoayi M, Ablikim Y \u0026amp; Arikin A. RNA splicing regulator EIF3D regulates the tumor microenvironment through immunogene-related alternative splicing in head and neck squamous cell carcinoma. \u003cem\u003eAging\u003c/em\u003e 16: 5929\u0026ndash;5948 (2024). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.18632/aging.205681\u003c/span\u003e\u003cspan address=\"10.18632/aging.205681\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYoung L, Sung J, Stacey G \u0026amp; Masters JR. Detection of mycoplasma in cell cultures. \u003cem\u003eNature Protocol\u003c/em\u003e 5, 929\u0026ndash;934 (2010). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nprot.2010.43\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2010.43\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu Q, Zhang J, Telfer BA, Zhang H, Ali N, Chen F, \u003cem\u003eet al\u003c/em\u003e. The extracellular-regulated protein kinase 5 (ERK5) enhances metastatic burden in triple-negative breast cancer through focal adhesion protein kinase (FAK)-mediated regulation of cell adhesion. \u003cem\u003eOncogene\u003c/em\u003e 40, 3929\u0026ndash;3941 (2021). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41388-021-01798-2\u003c/span\u003e\u003cspan address=\"10.1038/s41388-021-01798-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, \u003cem\u003eet al\u003c/em\u003e. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. \u003cem\u003eNature\u003c/em\u003e 421, 231\u0026ndash;237 (2003). doi: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nature01278\u003c/span\u003e\u003cspan address=\"10.1038/nature01278\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRual J-F, Ceron, J, Koreth J, Hao T, Nicot A-S, Hirozane-Kishikawa, \u003cem\u003eet al\u003c/em\u003e. Toward improving \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e phenome mapping with an ORFeome-based RNAi library. \u003cem\u003eGenome Res\u003c/em\u003e 14, 2162\u0026ndash;2168 (2004). doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/gr.2505604\u003c/span\u003e\u003cspan address=\"10.1101/gr.2505604\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8107126/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8107126/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eStress granules are cytoplasmic mRNA-protein complexes that form by liquid-liquid phase separation in response to a variety of stresses. Their assembly is contingent upon the inhibition of mRNA translation. Depending on the type of stress and severity, they can promote stress resistance or act to reduce cellular fitness. As such, stress granules are implicated in ageing and a range of related pathologies. Many translation factors are components of stress granules, but it is unclear how they contribute to granule assembly. Here we show that the eIF3d component of the eIF3 translation initiation complex is recruited to stress granules in human cells and is required for stress granule assembly in response to specific stresses. The RNA-binding domain of eIF3d mediates its recruitment to stress granules and deletion of this domain blocks granule formation and decreases cell viability. Furthermore, the exogenous expression of just the eIF3d RNA-binding domain can rescue stress granule assembly in eIF3d-depleted cells. We confirmed the importance of eIF3d for robust stress granule assembly \u003cem\u003ein vivo\u003c/em\u003e using the nematode worm \u003cem\u003eC. elegans\u003c/em\u003e. This study demonstrates that eIF3d is a critical evolutionary conserved stress granule assembly factor, rather than simply coalescing passively into stress granules following the inhibition of translation initiation.\u003c/p\u003e","manuscriptTitle":"Eukaryotic translation initiation factor 3d regulates stress granule assembly via its RNA binding domain","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-27 12:00:19","doi":"10.21203/rs.3.rs-8107126/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d4a86426-346c-45ec-b375-bf64a14cecbb","owner":[],"postedDate":"November 27th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":57992763,"name":"Biological sciences/Cell biology"},{"id":57992764,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-01-07T09:32:01+00:00","versionOfRecord":[],"versionCreatedAt":"2025-11-27 12:00:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8107126","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8107126","identity":"rs-8107126","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}