Root Nodule-associated Plant Probiotics Modulate Growth and Drought Stress Responses in Horse Gram Macrotyloma uniflorum (Lam.) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Root Nodule-associated Plant Probiotics Modulate Growth and Drought Stress Responses in Horse Gram Macrotyloma uniflorum (Lam.) Shirley Evangilene, Shobana Narayanasamy, Sivakumar Uthandi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8621449/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 11 You are reading this latest preprint version Abstract Nodule-associated plant probiotics (NAPPs) are a representative group of plant growth-promoting microorganisms that establish a mutualistic relationship with leguminous plants. The present study aimed to unravel the NAPPs of horse gram and to evaluate its potential plant growth attributes. A total of ten NAPPs were isolated and identified, which belonged to bacterial strains such as Pseudomonas aeruginosa HGB1, Pseudomonas indoloxydans HGB2, Acinetobacter rhizosphaerae HGB4, Enterobacter bugandensis HGB5, Klebsiella michiganensis HGB6, and Flavobacterium anhuiense HGB7, and yeast strains such as Malassezia restricta HGY1 and HGY2, and actinobacteria ( Leucobacter aridicollis HGB3), along with Rhizobium sp. HGR1. The highest levels of indole acetic acid (IAA) (39.12 µg ml –1 ), ACC deaminase (541.2 nmol α-Ketobutyrate mg protein − 1 h − 1 ), siderophores (93.681 µg ml –1 ), phosphorus solubilization, and potassium availability were positively correlated with the isolates HGR1, HGB1, HGB2, HGY1, and HGB5. Zinc solubilization was strongly correlated with HGR1, HGY1, and HGB1. Organic acid profiling of the strains revealed their potential to enhance nutrient solubilization and drought tolerance. Rhizobium sp. HGR1 and the potential nodule-associated non-rhizobial endophytes (NREs), namely P. indoloxydans HGB2 and M. restricta HGY1, were selected for their performance and non-pathogenicity. Furthermore, the interaction between Rhizobium sp. HGR1 and multi-trait NAPPs, HGB2 and HGY1, were evaluated under 20% PEG-induced moisture-deficit stress by root exudate profiling. Metabolite profiling revealed 28 bioactive metabolites, including steroids and their derivatives, saturated hydrocarbons, quinolones and their derivatives, pyridines and their derivatives, among others. Thus, this study highlights the significant potential of NAPPs to enhance plant growth, improve drought-stress resilience, and modulate signalling pathways, thereby contributing to the sustainable production of horse gram. ACC deaminase Drought Horse gram IAA Nodule-associated plant probiotics (NAPPs) Root nodules Solubilization Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Highlights • Nodule-associated plant probiotics (NAPPs) of horse gram exhibited higher PGP traits, including the production of IAA, Siderophores, and ACC Deaminase, as well as nutrient solubilization (P, Zn, and K). • NAPPs profiled for organic acids revealed production of acetic acid, lactic acid, oxalic acid, butyric acid, citric acid, etc. • Interaction of HGR1 with NAPPs HGB2 and HGY1 increased seed germination and plant growth under induced drought stress (-0.46 Mpa). • Root-exuded metabolites, viz., stigmasterol, indole, ascorbic acid, fumaric acid, oleic acid, proline, and glucopyranoside, act as signalling cues and modulate plant growth to facilitate plant health and fitness under adverse environmental conditions. • NAPPs can serve as a novel bio-inoculant to increase drought resilience and enhance productivity in horse gram. Introduction Horse gram ( Macrotyloma uniflorum Lam.), formerly known as Dolichos biflorus , is an essential short-duration food legume native to tropical southern Asia (Amaral et al., 2022; Jeswani and Baldev, 1990). It is a rich source of bioactive compounds with antioxidant properties and high nutritional values (Prasad and Singh, 2015 ), and is widely consumed by the poorest strata of society. In addition, this protein-rich fodder is widely used as livestock feed (Prakash et al., 2008). It is grown at a wide range of temperatures (Smartt, 1985 ), at which other crops fail to thrive. In India, horse gram is typically cultivated in the late rainy season and low-fertility soils with fewer inputs (Witcombe et al. 2008). A vast array of nodule-associated plant probiotics (NAPPs) establishes mutualistic relationships with legume root nodules during symbiotic nodulation. It plays a significant role in promoting plant growth by producing phytohormones, secreting root exudates, enhancing organic acid production for effective solubilization and Fe chelation, and promoting the production of signaling compounds under harsh environmental conditions (Martínez-Hidalgo and Hirsch, 2017 ). Exploring the studies on these plant-microbe interactions reveals the complete dependency on three factors: 1) The propensity to colonize the host, 2) The supportive environment for the establishment of a symbiosis, and 3) The presence of abundant and highly diverse colonizing microbes. The NAPPs enhance plant growth through direct and indirect mechanisms, including growth promotion, stress tolerance, and resistance to pathogens and pests. Microbiome-mediated functions are believed to initiate mostly from the belowground parts of the plant, and are transmitted as plant-mediated signals to the above-ground compartments of floral organs. Direct effects include stimulation of comprehensive plant growth through stress reduction, modulation of aminocyclopropane-1-carboxylate (ACC) deaminase expression, and the production of plant hormones, detoxification enzymes, and osmoprotectants. Indirect mechanisms also protect crops against phytopathogens and pests through antagonism or the induction of systemic resistance (Trivedi et al., 2020 ). A proto-cooperative mode of interaction involving the non-rhizobial endophytes (NREs) Bacillus subtilis NANEB1 and Paenibacillus taichungensis TNEB6, along with the nodule-associated endosymbiont Rhizobium , has been proven to play essential roles in nodulation and nitrogen fixation in the black gram crop (Raja and Uthandi, 2019 ). Recent advances on plant-microbe interactions have highlighted the significant role of indole acetic acid (IAA) production as a key signalling molecule that functions as a phyto-stimulant by interacting with the plants' signalling compounds during microbial colonization (Spaepen et al., 2007 ). The inoculation of Medicago sativa with the IAA-overproducing Ensifer meliloti strain RD64 indicated the increased expression of genes related to nitrogen fixation, glucose and lipid metabolism, and abiotic stress responses by stimulating the accumulation of low-molecular-weight signalling compounds within the root nodules of the host plants (Defez et al., 2019 ). Beneficial microorganisms synthesize ACC deaminase, which lowers plant ethylene levels by cleaving ACC, thereby enhancing resistance to diverse environmental stresses (Glick, 2005 ). In addition, symbiotic rhizobia and other non-nodulating microorganisms produce siderophores that facilitate iron chelation and contribute to plant disease suppression by inducing systemic resistance (Sayyed and Patel, 2011 ), promoting plant growth, and ensuring successful pulse production. Consistent with these findings, our earlier studies on non-nodule-associated plant probiotics, including yeasts such as Candida glabrata VYP1 and Candida tropicalis VYW1, reported enhanced production of phytohormones and siderophores, along with increased ACC deaminase activity (Geetha Thanuja et al., 2020 ). Furthermore, organic acids secreted by microorganisms boost nutrient availability for plants through mineral desorption and solubilization, thereby promoting plant growth (Grover et al., 2021 ). Additionally, the secretion of organic acids by microorganisms plays a crucial role in regulating developmental processes, including signalling and responses to different abiotic stresses (Khan et al., 2023; Panchal et al., 2021). The interaction between organic acids and abiotic stimuli favorably sustained plant growth, thereby improving drought tolerance and immunity (Tschaplinski et al., 2019 ). Notably, co-inoculation of wheat with compatible strains of Paenibacillus sp. strain B2 (PB2), Arthrobacter sp. SSM-004, and Microbacterium sp. SSM-001 exhibited stable, durable resistance under induced drought stress (Samain et al., 2022 ). Extensive research on the horse gram has primarily dealt with the plant growth-promoting microbes capable of reducing the phytotoxicity of heavy metals, such as copper (Fatnassi et al., 2015 ), nickel (Edulamudi et al., 2021 ), chromium (Dhali et al., 2021 ), and pentachlorophenol (Jagadeesh et al., 2011) in polluted ecological regions. However, beyond their role in bioremediation, these plant growth-promoting microorganisms – particularly non-rhizobial endophytes have not been extensively investigated for their role in promoting plant growth. Given the widespread applications of NRE strains in enhanced plant growth and pulse production, the NAPPs of horse gram remain largely unexplored. Thus, the present study aims to isolate and characterize the potential plant growth-promoting traits exhibited by NAPPs of horse gram. In addition, the study investigates the interactions among potential NAPPs under moisture-deficit stress conditions, focusing on the production of key metabolites and the associated signalling pathways, to provide insights for the exploration of underutilized legume crops. Furthermore, the study's findings are expected to yield promising sustainable bioinputs that improve nutrient-use efficiency, enhance drought resilience, and support climate-smart cultivation of horse gram. Materials and Methods Sample collection For unravelling the NAPPs, root nodules of horse gram at the flowering stage were collected from three different zones near Hosur (745 m MSL, latitude of 12.68 ° N and longitude of 77.93 ° E), Paiyur (490 m MSL), and Thiruvannamalai (174 m MSL) in Tamil Nadu. These northwestern and northeastern zones of Tamil Nadu were characterized as semi-arid, with mean annual rainfall of less than 900 mm and temperatures ranging from 17°C to 37°C. Plant and soil samples were collected in sterile bags and transported to the Biocatalysts Laboratory, Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore. The soil samples collected were analyzed for physicochemical properties (Lelago and Buraka, 2019 ). Isolation of nodule-associated plant probiotics (NAPPs) To isolate NAPPs, the collected roots were gently washed under running tap water for 10 min to remove adhering soil particles. For surface sterilization, healthy root nodules were carefully excised from the cleaned roots of each plant, immersed in 70% ethanol for 30 s, then in 0.1% HgCl 2 for 2 min, and washed 3 times with sterile water under aseptic conditions. To confirm the efficiency of the nodule sterilization process, an aliquot of 100 µL of the third (final) wash was inoculated onto R2A agar plates, which were then incubated at 28 ± 2°C. The surface-sterilized root nodules were crushed with the sterile pestle and mortar, and 100 µL of aliquots were serially diluted and inoculated on the Luria Bertani Agar (LB Agar), the Yeast Extract Mannitol Agar (YEMA), and the Yeast Extract Malt Extract (YEME). The plates were incubated at 28°C for a week to promote NAPPs growth (Dhole et al., 2016 ). The well-grown colonies were selected and purified on appropriate media using the streak plate method. The morphologically distinct isolated colonies were examined for taxonomic identification. Furthermore, the isolates were stored in 40% glycerol at − 80°C for validation. Phylogenetic identification of the nodule-associated plant probiotics of horse gram Bacterial genomic DNA was isolated by the CTAB method, and the yeast DNA was isolated by the standard cell lysis method. The genomic DNA extracted from bacteria, actinobacteria, and yeast was amplified using the universal primers 27F (5′AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′ GGTTACCTTGTTACGACTT 3′), NL1 (5′-GCATATCAATAAGCGGAGGAAAAG-3′), and NL4 (5′GGTCCGTGTTTCAAGACGG3′), respectively (Lee et al., 2005 ) using the BIO-RAD thermal cycler (Kurtzman and Robnett, 1997 ). Sequence identity was assessed by performing sequence similarity searches against the GenBank database ( http://www.ncbi.nih.gov/BLAST ). The phylogenetic tree was constructed in MEGA10 to determine the close and distant relationships among the sequences. Screening of the nodule-associated plant probiotics for their plant growth-promoting attributes The functional attributes conferred by NAPPs in horse gram were investigated by assessing the plant growth-promoting parameters such as the production of IAA, ACC deaminase, siderophores, and organic acids, and nutrient solubilization. IAA production A Salkowski's colorimetric method was used with the Van Urk Salkowski reagent to determine the amounts of IAA produced by each isolate. The strains were cultured for 4 days at 28°C in LB broth. After incubation, the broth was centrifuged, and 1 mL of the supernatant was mixed with 2 mL of Salkowski's reagent (2% 0.5 FeCl 3 in a 35% HCLO 4 solution) and stored in the dark. After 30 min and 120 min, the optical density (OD) was measured at 530 nm (Fu et al., 2015 ). ACC deaminase activity The cultures were grown in LB and YEME broth up to the late log phase at 30°C on an orbital shaker at 150 rpm for 24 h to measure ACC deaminase activity. The cell pellets were centrifuged and then washed with 0.1 M Tris–HCl (pH 7.6) before being suspended in the minimal salt medium with 3 mM ACC as the sole nitrogen source. The amount of α-ketobutyrate produced by enzymatic hydrolysis of ACC was measured to evaluate ACC deaminase activity in the cell-free extract (Penrose and Glick, 2003 ). The amount of α-ketobutyrate was measured at 540 nm, and its concentration was determined using a standard curve. The Lowry method (Lowry et al., 1951 ) was used to determine the protein concentration. Siderophore production To conduct the qualitative assay for siderophore production, the chrome azurol sulfonate (CAS) agar plate method (Schwyn and Neilands, 1987 ) was used. All strains were inoculated in Nutrient Broth medium for 48 h at 30°C on a rotary shaker at 120 rpm, and 0.05 mL of the resulting bacterial suspension (9 × 10 8 cells ml –1 ) was spotted onto CAS-agar plates in triplicate and incubated for 5 days at 30°C. An orange halo appeared around the colonies on the CAS blue agar, indicating the production of siderophores. The ratio of the halo zone diameter or the colony diameter was assessed based on size, and the findings were represented as the mean ± standard deviation (SD). Nutrient solubilization Phosphorus solubilization The ability of the strains to solubilize the inorganic form of phosphorus from tricalcium phosphate was determined by spot inoculation of strains on the NBRIP medium, and their ability for solubilization was tested at 30°C in the medium (pH 7.0) supplemented with tricalcium phosphate (Nautiyal et al., 2000 ). Uninoculated plates were kept as the control. After 3 days of incubation, a clear zone surrounding the colonies was observed, indicating phosphate solubilization. The solubilization index was calculated as the ratio of the halo zone diameter to the colony diameter. Zinc solubilization To assess the zinc solubilization potential of the strains, the Alexandrov medium supplemented with 0.1% zinc oxide (ZnO) was used. Overnight-grown single colonies were aseptically transferred to respective zinc medium plates by spot inoculation. After spot inoculation, the plates were incubated in the dark at 28 ± 2°C for 48 h, and a distinct halo zone formed around the cultures (Sharma et al., 2012). The efficiency of zinc solubilization (SE) was estimated by dividing the diameter of the halo zone by the colony diameter. Potassium availability The spot test method was used to assess the strains' potential to solubilize potassium. A loopful of 48-hour-old grown strains was spotted on the modified Aleksandrov medium supplemented with potassium aluminosilicate minerals as an insoluble source of potassium. For three days, the Plates were incubated at 28 ± 2°C. The ability of different microbial strains to develop clear zones on media was used to detect potassium availability (Parmar and Sindhu, 2013). Uninoculated plates served as a control. Organic acid production The strains were grown in their respective culture broths—YEMA for Rhizobium , LB for bacterial strains, and YEME for yeast strains—and incubated at 28 ± 2°C until they reached the log phase. Log-phase cultures were harvested and centrifuged at 6000 rpm for 5 min. The GC-MS analysis was performed using the purified crude cell-free extract in a PerkinElmer GC-MS Clarus® SQ 8 Mass Spectrometer (MS) equipped with the DB-5MS (Agilent, USA) capillary standard non-polar column with dimensions of 0.25 mm OD x 0.25 µm ID x 30 m length and an FID detector (Lee et al., 2012). Autochrome software was used for data integration and analysis. As standards, an HPLC-grade organic acids kit (No. 47264 from Sigma-Aldrich, USA) was used. Compatibility assessment and consortium preparation The potential NAPPs were selected based on their plant growth-promoting (PGP) attributes. Non-pathogenicity of each isolate was confirmed on sheep blood agar plates (HiMedia, India; Cat. No. MP1301) by the absence of hemolytic activity. The strains selected for further experimentation were Rhizobium sp. HGR1, P. indoloxydans HGB2, and M. restricta HGY1. Compatibility among the three NAPPs was evaluated using standard cross-streak and co-culture assays. Strains showing no inhibitory interaction were considered compatible and will be used for consortium development (Annadurai et al., 2021). Estimation of NAPPs-induced seed germination efficiency under moisture deficit stress Horse gram seeds (var. Paiyur 2) obtained from the Regional Research Station, Paiyur, Krishnagiri district, Tamil Nadu, were surface sterilized in 0.1% HgCl 2 for 2 min and rinsed three times with ethanol and then five times with sterile water. After sterilization, seeds were inoculated and incubated for 1 hour with overnight-grown cultures of HGR1, HGB2, and HGY1, and with co-inoculum containing HGR1, HGB2, and HGY1. Meanwhile, horse gram seeds treated with sterile water served as a control. Inoculum-treated seeds were placed on filter paper in Petri dishes containing 0, 10, 20, and 30% polyethylene glycol (PEG 6000) corresponding to osmotic potentials of 0, − 0.14, − 0.29, and − 0.46 MPa, respectively. To prevent drying, Petri plates were wrapped in Parafilm and incubated at room temperature (28 ± 2°C). The germination percentage was estimated after 72 h of incubation using standard methods (Khodarahmpour, 2012) as follows. Germination % = \(\:\frac{\varvec{N}\varvec{o}.\:\varvec{o}\varvec{f}\:\varvec{s}\varvec{e}\varvec{e}\varvec{d}\varvec{s}\:\varvec{g}\varvec{e}\varvec{r}\varvec{m}\varvec{i}\varvec{n}\varvec{a}\varvec{t}\varvec{e}\varvec{d}}{\varvec{T}\varvec{o}\varvec{t}\varvec{a}\varvec{l}\:\varvec{n}\varvec{o}.\:\varvec{o}\varvec{f}\:\varvec{s}\varvec{e}\varvec{e}\varvec{d}\varvec{s}}\) × 100 Metabolomic profiling of root exudates The root exudates of horse gram seedlings were collected in an experimental setup. The funnel-flask setup comprised a 500 mL Erlenmeyer flask and a 150 mm diameter funnel, which was positioned at its stem end and covered with Aluminum foil with pin-sized holes. The stem was perfectly inserted into the mouth of the flask. Glass beads were poured into the funnel through the neck, and then, acid-washed sand (240 g) was added to three-fourths of the funnel. Aluminum foil was used to cover the broader opening of the funnel, and the entire setup was autoclaved for 20 min at 121°C at 15 psi. Horse gram seeds were sown in the funnel, and to induce stress in laboratory conditions, 20% PEG 6000 was added to the modified Hoagland nutrient solution. The putative root exudate metabolites produced during the interaction between HGR1, HGB2, and HGY1 were analyzed after 10 days of seedling germination with a GC-MS (Xu et al., 2021 ). The bioactive molecules were identified by comparing their mass spectra with those in the NIST 08 Mass Spectral Library (National Institute of Standards and Technology). The names, molecular weights, and structures of molecules were retrieved from NIST, PubChem, and HMDB databases, respectively (Leylaie and Zafari, 2018 ). Statistical analysis The datasets were subjected to a two-way analysis of variance (ANOVA), and means were separated using Duncan’s multiple-range test (DMRT) at the 0.05 significance level, using SPSS version 20. Heat maps were generated using GraphPad Prism 9, run on Windows 10 (Ul Haq et al., 2019 ). Principal component analysis (PCA) was performed to assess differences and similarities among the variables at the 5% significance level using XLSTAT 2021. 3.1 (Bressani et al., 2020 ). Cytoscape software version 3.7.1 was also used to analyze metabolite data and to perform pathway enrichment analyses (He et al., 2021 ). Results The main significance of this study was to unravel the NAPPs of the underutilized crop, horse gram ( Macrotyloma uniflorum Lam.), and its importance in plant growth and drought stress mitigation. The NAPPs isolated from horse gram nodules were identified, and the metabolites in root exudates influenced by NAPPs upon their interaction under induced drought stress were profiled. Isolation of nodule-associated plant probiotics (NAPPs) from horse gram root nodules A total of 10 morphologically distinct isolates, each from the nodules of a different horse gram plant, were chosen (Table 1 ). These strains were named HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 and tested for various growth-promoting activities, which are described below. Identification and phylogenetic analysis of nodule-associated non-rhizobial endophytes A total of seven bacterial isolates and one actinobacterial isolate successfully yielded the corresponding 1500-bp 16S rRNA amplification products, and their resulting sequencing data were of high quality and were therefore analyzed in NCBI databases using the BLAST tool. The majority of the isolates were identified as gammaproteobacteria, while representatives of flavobacteria and actinomycetia were also observed. The isolates identified based on 16S rRNA gene sequencing were as follows: HGR1 - Rhizobium sp, HGB1 - P. aeruginosa (Accession number: ON461479), HGB2 - P. indoloxydans (Accession number: ON470821), HGB3 - Leucobacter aridicollis , HGB4 – A. rhizosphaerae , HGB5 – E. bugandensis , HGB6 – K. michiganensis , and HGB7 – F. anhuiense . The yeast isolate HGY1 was identified as M. restricta based on approximately 600-bp 18S rRNA gene sequences. Approximately 1500 bp of 16S rRNA gene sequences from the microbial isolates were combined to construct phylogenetic trees using the Neighbor-joining method with 100% similarity (Fig. 1 A and 1 B). Plant growth-promoting attributes IAA production Auxin, produced by NAPPs, is one of the most studied plant growth hormones. All strains were capable of synthesizing IAA (Fig. 2 ). Among them, the highest IAA production was observed in HGR1 (39.12 µg ml –1 ), followed by HGB1 (33.19 µg ml –1 ), HGB2 (17.487 µg ml –1 ), and HGB5 (13.402 µg ml –1 ), while the minimum IAA production was recorded in HGY2 (0.977 µg ml –1 ). At a 5% error margin, HGR1, HGB1, and HGB2 had significantly higher IAA yields than HGB5 (Fig. 2 A). ACC deaminase activity The ability of NAPPs to use ACC as a significant nitrogen source was investigated. The highest ACC deaminase activity among the evaluated nodule-associated endophytes was found in HGB5 (473.1 nmol α-Ketobutyrate mg protein − 1 h − 1 ), followed by HGB1 (326.4 nmol α-Ketobutyrate mg protein − 1 h − 1 ), HGB2 (281.0 nmol α-Ketobutyrate mg protein − 1 h − 1 ), and HGY1 (265.8 nmol α-Ketobutyrate mg protein − 1 h − 1 ). In contrast, the lowest was observed in HGY2 (52.2 nmol α-Ketobutyrate mg protein − 1 h − 1 ). In comparison, HGR1 (541.2 nmol α-Ketobutyrate mg protein − 1 h − 1 ) exhibited the highest ACC deaminase activity, resulting in the cleavage of ACC into ammonia and α-ketobutyrate (Fig. 2 B). Siderophore activity All strains produced siderophores that suppressed plant pathogens. Among them, HGB2 produced the highest amount of siderophore (93.681 µg ml –1 ), followed by HGR1 (90.603 µg ml –1 ), HGB5 (90.408 µg ml –1 ), and HGB3 (90.181 µg ml –1 ), whereas the minimum siderophore amount was recorded in HGY2 (42.612 µg ml –1 ) (Fig. 2 C). Phosphorus solubilization Phosphate-solubilizing strains were qualitatively screened in the modified NBRIP agar plates supplemented with insoluble tricalcium phosphate minerals were presented in Fig. 3 A. The presence of insoluble phosphate in the medium led to the development of a clear zone around colonies, which indicated the phosphate solubilization to a greater extent by the NAPPs, such as HGB2, followed by HGB1, HGY1, and HGB5, and significantly higher phosphate solubilization by HGR1 was noticed. No P solubilization efficiency was observed in HGB3, HGB4, HGB6, and HGY2 at the 95% confidence level (Fig. 3 A). Zinc solubilization Zinc is a crucial component of various enzymes that are responsible for plant metabolism. The presence of halo zones on the Bunt and Rovira medium supplemented with 0.1% ZnO indicated zinc solubilization. Zinc solubilization by the strains HGR1 and HGB1 inoculated into the medium was significantly higher than that by other strains, such as HGY1 and HGB2, at the 95% confidence level. The P solubilization efficiency was found in HGB3, HGB4, and HGB6 (Fig. 3 B). Potassium release Some potassium-releasing microorganisms can convert insoluble potassium (K) to soluble potassium, thereby making it available for plant uptake. The presence of halo zones on the Alexandrov medium supplemented with insoluble potassium aluminosilicate minerals indicated the K release by the microorganisms. In this study, HGR1, along with other NAPPs such as HGY1 and HGB6, was the most efficient K-releasing strain compared with the microbial strains tested at a 5% error margin. A few strains, such as HGB3 and HGY2, were unable to release K for plant growth (Fig. 3 C). Organic acid production GC–MS–based organic acid profiling demonstrated organic acid production by the horse-gram NAPPs, such as HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 (Fig. 4 ). The heatmap exhibited the significant variations in both the type of organic acid and their relative abundance produced. Acetic acid, lactic acid, isobutyric acid, malic acid, and quinic acid were among the most consistently detected metabolites across several strains. In contrast, fumaric acid, succinic acid, and benzoic acid were produced only by a few strains at lower intensities. Citric acid, malonic acid, maleic acid, ascorbic acid, and benzoic acid were produced in higher concentrations by HGR1. In contrast, butyric acid, maleic acid, and malonic acid were produced in higher concentrations by HGB1. HGB2 produced higher quantities of fumaric acid, malonic acid, and lactic acid. HGB3 produced considerable amounts of isobutyric acid, butyric acid, malic acid, and malonic acid. HGB4, which produced acetic acid and maleic acid in greater quantities. Propionic acid was produced in lower amounts by HGB5. HGB6 excessively produced ascorbic acid, succinic acid, and malonic acid. HGB7 produced higher amounts of propionic and oxalic acids. HGY1 could produce higher concentrations of lactic acid, ascorbic acid, and malic acid. HGY2 produced higher concentrations of quinic acid and oxalic acid. This distinct production pattern demonstrates NAPPs functional diversity in the synthesis of organic acids associated with nutrient solubilization and stress alleviation. Similarities and dissimilarities of the nutrient solubilization patterns To study the nutrient solubilization patterns, such as P, Zn, and K by the NAPPs, namely HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 and the variation in the availability of these nutrients to plants, principal component analysis (PCA) was performed for all the variables simultaneously (Fig. S1 ). The PCA explained a total variance of 83.04% (PC1: 48.01%, PC2: 35.03%) across NAPPs. The biplot revealed a clear grouping of strains, with HGR1, HGB2, and HGB5 positively correlated with P solubilization and K availability. HGB1 and HGY1 were positively correlated with Zinc solubilization, whereas HGB3 and HGY2 were negatively correlated with all three parameters of Zn and P solubilization and K availability. Dimensional variations in organic acid production by the isolates PCA of organic acids production among horse gram NAPPs showed a total variance of 55.27% (PC1: 31.12% and PC2: 24.15%). Organic acids such as butyric acid, citric acid, isobutyric acid, malonic acid, and propionic acid were the loading factors of PC1, contributing to variability. Furthermore, HGR1, HGB1, and HGB3 were positively correlated with the production of organic acids. The major components contributing to the PC2 dimension were fumaric acid, lactic acid, ascorbic acid, malic acid, and oxalic acid, which were positively correlated with HGB2, HGB7, and HGY1. HGB5, HGY2, and HGB6 were, however, negatively correlated with the production of benzoic acid, succinic acid, and quinic acid. HGB4 was positively correlated with the production of acetic acid and maleic acid at low concentrations (Fig. 5 ). Based on the plant growth-promoting traits and non-pathogenic nature (confirmed through sheep blood agar plates), three NAPPs, such as Rhizobium sp. HGR1, P. indoloxydans HGB2, and M. restricta HGY1 were selected for further studies. These strains were compatible with one another and were formulated into a consortium at a 1:1:1 volume ratio, with a cell concentration of 108 CFU mL − 1 , and evaluated for their potential role in seed germination and plant growth under induced moisture-deficit stress. Efficiency of the biotized seed germination under induced moisture deficit stress Surface-sterilized horse gram seeds were germinated under stress at 0%, 10%, 20%, and 30%. Our study found that primed seeds co-inoculated with M. restricta HGY1 could germinate even under 30% PEG-induced moisture-deficit stress. The potential germination of primed seeds was observed up to 20% PEG treatment (Table S1). At the 20% stress level, the germination percentage of co-inoculum-treated seeds was found to be higher (90%) with a vigor index of 5058, compared with that of the seeds inoculated with only HGR1 (88% and 4224), HGY1 (86% and 4110), and HGB2 (84% and 3780). In contrast, lower germination percentages (54% and 2230) were recorded in the uninoculated control under induced moisture-deficit stress (Table 2 ). Seeds biotized with NAPPs showed a significant increase in root and shoot length. The co-inoculum-treated seeds exhibited the highest root and shoot length of 28.8 ± 0.570 and 27.4 ± 0.057 cm, respectively, which showed a significant increase over the uninoculated control (20.9 ± 0.076 cm and 20.4 ± 0.403 cm, respectively). Profiling of metabolites in root exudates under induced moisture deficit stress upon interaction The analysis of root exudate metabolites produced by Rhizobium sp. HGR1, P. indoloxydans HGB2, M. restricta HGY1, and their interactions under induced moisture stress using the funnel method revealed the presence of 28 compounds. The major compounds included steroids and steroid derivatives, saturated hydrocarbons, quinolones and derivatives, pyridines and derivatives, prenol lipids, piperidines, phenylpropanoids and polyketides, phenol esters, organosulfur compounds, organooxygen compounds, organohalogen compounds, organonitrogen compounds, organic acids and derivatives, organoheterocyclic compounds, naphthalenes, keto acids and derivatives, indole and derivatives, glycerolipids, flavonoids, fatty acyls, diazines, carboxylic acid and derivatives, benzenoids, benzene and substituted derivatives, alkyl halides, alkaloids and derivatives, azoles, alcohols, and polyols (Fig. 6 ). Primary root exudate metabolites produced by Rhizobium sp. HGR1 were organoheterocyclic compounds, fatty acyls, benzene, and substituted derivatives. P. indoloxydans HGB2 produced higher amounts of benzene and substituted derivatives, steroid and steroid derivatives, prenol lipids, organoheterocyclic compounds, and quinolones and derivatives. The root exudates of plants inoculated with M. restricta HGY1 were mainly composed of organoheterocyclic compounds, fatty acyls, benzene and substituted derivatives, steroids and steroid derivatives, and prenol lipids. During a tripartite interaction, the potential NAPPs produced benzene and substituted derivatives, carboxylic acids and derivatives, organoheterocyclic compounds, fatty acyls, indoles and derivatives, steroids and steroid derivatives, and flavonoids under induced moisture stress. The biochemical pathway analysis of metabolites produced during the interaction between Rhizobium sp. HGR1, P. indoloxydans HGB2, and M. restricta HGY1 is shown in Fig. 7 . The study of metabolic pathways in Cytoscape revealed that the key metabolic pathways, including choline metabolism, TCA cycle, glycolysis and gluconeogenesis, proline and alanine metabolism, galactose metabolism, ascorbic acid synthesis, butanoate metabolism, tryptophan metabolism, fatty acid biosynthesis, phenol metabolism, and secondary metabolite synthesis are interestingly involved in the interaction between potential NAPPs. Discussion The Rhizobium -legume interaction is a well-known symbiosis that regulates symbiotic nitrogen fixation, and the comprehensive mechanisms of root nodule formation are also well explored. In addition to Rhizobium , a vast array of NAPPs is found in the root nodules of leguminous plants, and together they establish a mutualistic relationship that facilitates symbiotic nodulation and promotes plant growth. Several reports on NRE have explored their potential roles in nodulation, signal exchange, and plant health promotion in legume root nodules (Geetha Thanuja et al., 2020 ; Isaeva et al., 2010 ). However, horse gram remains underutilized and underexploited, despite being a rich source of bioactive compounds that confer benefits relative to other crops, including drought resistance, the ability to germinate in poor soil conditions, and tolerance to moderate salinity. Our previous study dealt with the exploration of structural and functional diversity of bacterial communities present in the soil, rhizosphere region, root nodules, and seeds of the horse gram by using 16S rRNA high-throughput amplicon sequencing technology for a better understanding of survival strategies employed by soil and plant microbiome to upgrade the bioinoculant development strategies (Evangilene and Uthandi, 2022). The present investigation revealed that the NAPPs isolated from horse gram root nodules were a Rhizobium sp. HGR1, NRE bacteria viz., P. aeruginosa HGB1, P. indoloxydans HGB2, Acinetobacter rhizosphaerae HGB4, Enterobacter bugadensis HGB5, Klebsiella michiganensis HGB6, Flavobacterium anhuiense HGB7, M. restricta HGY1, and HGY2, and an actinobacterium Leucobacter aridicollis HGB3. Similarly, the nodule-associated bacterium Paenibacillus taichungensis TNEB6 and the yeast Candida tropicalis VWY1 were found and identified in root nodules of black gram (Geetha Thanuja et al., 2020 ; Raja and Uthandi, 2019 ). To the best of our knowledge, this is the first report to document the presence of yeast in horse gram root nodules and its role in promoting plant growth and drought tolerance. In the present study, NAPPs of horse gram were evaluated for their potential role in plant growth promotion by assessing the IAA and siderophore production and ACC deaminase activity. Auxins produced by plant growth-promoting microorganisms exert distinct effects on plant growth and development. Furthermore, nodule morphogenesis is regulated by auxin production stimulated by phenolic compounds, which act as signaling molecules (Ghosh et al., 2015 ). In the present study, all NAPPs produced significant amounts of IAA. Among them, the highest IAA production was observed in the nodule partner Rhizobium HGR1 (39.12 µg ml –1 ), followed by the NRE P. aeruginosa HGB1(33.19 µg ml –1 ) and P. indoloxydans HGB2 (17.487 µg ml –1 ). Similarly, several reports on the nodule microbiota indicated that IAA production by nodule-associated endophytes ranged from 70 to 80 mg g –1 of dry cell weight (Fu et al., 2015 ; Geetha Thanuja et al., 2020 ; Raja and Uthandi, 2019 ). Microbial siderophores have a higher affinity for Fe in Fe 3+ -containing complexes and play a critical role in suppressing populations of plant-pathogenic microorganisms. The present study reported the production of siderophores by NAPPs, among which P. indoloxydans HGB2 (93.681 µg ml –1 ) showed the highest siderophore production, followed by Rhizobium HGR1 (90.603 µg ml –1 ). These results suggest that co-inoculating with these efficient siderophore-producing strains can be used as a reliable approach to overcome Fe limitation and suppress pathogen proliferation by sequestering Fe 3+ in the root zone (Ferreira et al., 2019 ). The hydrolysis of ACC, a direct precursor of ethylene in plants, is a significant mechanism by which microorganisms facilitate plant growth and development (Zarei et al., 2020 ). The present study revealed that the nodule partner Rhizobium HGR1 exhibited a higher ACC deaminase activity (541.2 nmol α-Ketobutyrate mg protein − 1 h − 1 ), followed by the endophytic bacteria Enterobacter bugandensis HGB5 (473.1 nmol α-Ketobutyrate mg protein − 1 h − 1 ) and M. restricta HGY1 (265.8 nmol α-Ketobutyrate mg protein − 1 h − 1 ). These findings on the ACC deaminase activity are in line with those of earlier reports on the nodule-associated endophytes, such as the bacteria P. taichungensis TNEB6 and Bacillus mojavensis PJN13 and the yeasts Candida tropicalis VYW1, Hansenula saturnus , and Issatchenkia occidentalis (Geetha Thanuja et al., 2020 ; Raja and Uthandi, 2019 ; Ríos-Ruiz et al., 2019 ; Singh et al., 2015 ). Further, these results confirmed that the plants grown in the presence of the beneficial ACC deaminase-producing microbes have longer roots and shoots and are more resistant to ethylene-induced stress (Glick, 2014 ). Nutrients such as phosphorus and zinc were effectively solubilized by the nodule endophytes, viz., HGR1, HGB1, HGB2, and HGY1. This solubilization efficiency was achieved by the secretion of organic acids. Organic acids produced by microorganisms, such as citric acid, oxalic acid, lactic acid, and succinic acid, lower soil pH by chelating cations bound to phosphate via their carboxyl and hydroxyl groups, thereby promoting efficient solubilization (Wei et al., 2018 ). Application of oxalic acid along with the phosphorus-solubilizing bacteria Bacillus sp. PSB16 significantly influenced rhizospheric populations of aerobic rice, thereby solubilizing immobilized P via acidification, chelation, and exchange reactions (Panhwar et al., 2013 ). The lower the acidity constant of organic acids, the higher the P solubilization (Zúñiga-Silgado et al., 2020 ). Our study showed that most of the nodule-associated strains were capable of producing organic acids with a low acidity constant, such as lactic acid, isobutyric acid, butyric acid, oxalic acid, ascorbic acid, citric acid, malic acid, malonic acid, propionic acid, and fumaric acid, which can solubilize tricalcium phosphate into soluble phosphate to facilitate plant growth. The Rhizobium sp. HGR1 is exceptionally capable of producing an organic acid with a high pKa, namely benzoic acid, which requires more energy to synthesize via the shikimate pathway. Conserving metabolic energy would prevent cells from secreting organic acids with high pKa values, thereby preventing solubilization. Zinc-solubilizing microbes produce various organic acids that lower pH and chelate zinc cations via acidification, and they also employ other mechanisms of solubilization, such as siderophore production, proton extrusion, and the plasma membrane redox system (Kamran et al., 2017 ). The amounts of organic acids secreted are predicted based on the zinc sources available to the zinc-solubilizing isolates. The findings of the present study were similar to those reported for efficient zinc solubilization via the production of organic acids, namely lactic, malonic, and malic acids, by B. aryabhattai , Pseudomonas taiwanensis , and Bacillus sp. PAN- TM1 (Vidyashree et al., 2018 ). Potassium availability to crops improves root and shoot elongation and yield-related characteristics through the acidolysis mechanism employed by potassium-releasing bacteria, which release significant amounts of organic acids that break down insoluble potassium into an active biomineral form (Ahmad et al., 2016 ). In addition to nutrient solubilization, the organic acids produced by NAPPs mitigate drought stress (Khan et al., 2020; Kleiber et al., 2024; Panchal et al., 2021). Kleiber et al. (2024) reported that organic acids treatment in lettuce enhanced drought tolerance by bolstering photosynthetic efficiency and strengthening oxidative defence mechanisms. Several organic acids, such as fumaric, malic, citric, malonic, ascorbic, and acetic acids, have been implicated in osmotic adjustments, ROS scavenging, and maintenance of membrane stability under water deficit conditions (Guo et al., 2018 ; Rahman et al., 2021 ; Tahjib-Ul-Arif et al., 2021 ; Utsumi et al., 2019 ). Furthermore, acetic acid enhances drought tolerance in plants by activating ABA biosynthesis and signaling, reducing stomatal conductance and transpiration, and mitigating ROS damage through the upregulation of key antioxidant enzymes (Rahman et al., 2021 ; Utsumi et al., 2019 ). Our results provide evidence that the organic acids produced by all ten NAPPs can promote plant growth by enhancing mechanisms involved in solubilization and by conferring drought-stress tolerance. Furthermore, the coexistence of NREs and Rhizobium had improving effects on the communication with the host plant in terms of colonization, elongation of infection threads, nodulation, nitrogen fixation, and extension of host range in legumes (Lu et al., 2017 ). PCA analysis proved strain-specific nutrient-solubilizing potential. Thus, the best-performing horse gram strains—HGR1, HGB2, and HGY1—emerge as metabolically compatible options for improving stress resilience and nutrient-use efficiency. Furthermore, the improved seed germination, vigor index, and seedling growth observed in NAPPs-biotized horse gram under induced moisture deficit stress (20% PEG 6000) exhibited the synergistic role of Rhizobium sp. HGR1, P. indoloxydans HGB2, and M. restricta HGY1 in imparting early-stage drought tolerance, consistent with reports that microbial priming boosts stress resilience and seedling vigor (Priyadharshini et al., 2023; Khatri et al., 2020). To assess the potential role of organic acid-producing NAPPs, root exudate metabolites were profiled under induced drought stress. The metabolomic study of root exudates revealed that most of the heterocyclic compounds secreted upon interaction with NAPPs, namely Rhizobium sp. HGR1, with Pseudomonas indoloxydans HGB2, Malassezia restricta HGY1, and their co-inoculum (HGR1 + HGB2 + HGY1) under induced moisture-deficit stress, exhibits antibacterial, antifungal, and herbicidal activities (Saini et al., 2013 ). The quinolone-based quorum-sensing system in Pseudomonas plays an essential role in the production of virulence factors. Interestingly, the Pseudomonas quinolone signal (PQS) acts as a siderophore by scavenging iron, storing it in the cell membrane, and transporting it into cells with iron deficiency (Lin et al., 2018 ). Compounds belonging to the group of fatty acyls and prenol lipids with lipid origin are thought to be involved in signaling mechanisms of the plant-microbe and microbe-microbe interactions for effective colonization (Macabuhay et al., 2022 ). Indole and its derivatives have been shown to regulate virulence by activating quorum-sensing molecules (QSMs) (Lee and Lee, 2010 ). The accumulation of flavonoids scavenges the free radicals and promotes plant growth under water-deficient (drought) conditions. In addition, derivatives of flavanone interact with phytohormone pathways by inhibiting auxin biosynthesis, thereby promoting drought tolerance (Aslam et al., 2022 ). Several metabolites released from seeds are associated with the tricarboxylic acid cycle, which is involved in the synthesis of sugars, amino acids, and lipids. Consistent with this, amino acids and lipids strongly influence the plant’s resistance to severe drought stress through interactions between microbes and the host plant (Wang et al., 2022 ). The present study identified most pyrimidine derivatives with significant radical-scavenging activity due to the presence of electron-donating substituents on the pyrimidine nucleus. The highest antioxidant scavenging activity of this particular compound relates to the electron with the lowest density in the outermost ring of pyrimidine derivatives (Nair et al., 2022 ). The most crucial metabolite discovered during the interaction between the C . tropicalis VYW1 and the Rhizobium sp. VRE1 was a glucopyranoside. It serves a specific function as a recognition receptor, implying that its ability to bind diverse sugar structures and activate lectin during interactions with potential NAPPs has been documented (Barre et al., 2001 ; Geetha Thanuja et al., 2020 ). In turn, lectin acts as a glue for saccharide receptors in the interaction between root hair tips and legume nodulating bacteria. Amino acid biosynthesis and metabolism upregulate the expression of ion-uptake genes by increasing membrane permeability, adjusting osmotic potential, and maintaining homeostasis during drought. A study supported the enhancement of the amino acid synthesis pathway under drought stress, in association with nodule development, during the Rhizobium -legume symbiosis (Liu et al., 2022 ). Our study highlights the roles of NREs in enhancing plant growth attributes, including the production of plant growth-promoting hormones, nutrient solubilization, and drought tolerance in horse gram associated with Rhizobium sp., under induced moisture-deficit stress. In conclusion, the adoption of sustainable agricultural practices would be enhanced by improving bioinoculant formulations, incorporating eco-friendly metabolites that promote plant growth in extreme environments, and developing built-in resistance to phytopathogens. Conclusion The present study characterized the NAPPs of horse gram and identified strains that promote plant growth and establishment under both normal and stress conditions. These strains may contribute to lateral root formation, increased root and shoot elongation, antioxidant accumulation for scavenging free radicals, nutrient acquisition, and mitigation of drought-induced signaling imbalances through the production of organic acids. Besides, the profiling of root exudate metabolites revealed that the interaction between the Rhizobium sp. HGR1 and NAPPs ( P. indoloxydans HGB2 and M. restricta HGY1) within the nodules increased nodulation efficiency by producing signaling molecules. Additionally, they produced several metabolites that promote plant growth and enhance resilience to adverse environmental conditions. Further investigations into seed priming with co-inocula of NAPPs under greenhouse and open-field conditions may pave the way for the development of new bio-inoculants that enhance plant growth, fitness, and stress tolerance. Declarations Acknowledgments This research was supported by the Ministry of Human Resource Development, Government of India, through MHRD-FAST-CoE (F. No. 5–6/2013-TSVII) sanctioned to SU. Financial support from the DST-FIST Programme-2022 (TPN 83972) is also acknowledged. Author contributions SE: Data curation, Methodology, formal analysis, Writing- Original draft, SU: Conceptualization, Funding acquisition, Project administration, investigation, supervision, Writing-review and editing; NS: Data curation, formal analysis, software, validation, Writing-review and editing. All authors read and approved the final manuscript. Funding This research was supported by the Ministry of Human Resource Development, Government of India, through MHRD-FAST-CoE (F. No. 5–6/2013-TSVII) sanctioned to SU. Financial support from the DST-FIST Programme-2022 (TPN 83972) is also acknowledged. Data availability All data generated or analysed during this study are included in this manuscript. The nucleotide sequence data from this study have been deposited in the NCBI GenBank database under the accession numbers ON461479 and ON470821. Ethics approval and consent to participate Not applicable Consent to publish Not applicable Competing interests The authors declare no competing interest. References Ahmad M, Nadeem SM, Naveed M, Zahir ZA. Potassium-solubilizing bacteria and their application in agriculture. In: Meena V, Maurya B, Verma J, Meena R, editors. Potassium Solubilizing Microorganisms for Sustainable Agriculture. New Delhi: Springer; 2016. https://doi.org/10.1007/978-81-322-2776-2_21 . Aslam MM, Idris AL, Zhang Q, Weifeng X, Karanja JK, Wei Y. Rhizosphere microbiomes can regulate plant drought tolerance. Pedosphere. 2022;32(1):61–74. https://doi.org/10.1016/S1002-0160(21)60061-9 . Barre A, Bourne Y, Van Damme EJ, Peumans WJ, Rougé P. Mannose-binding plant lectins: different structural scaffolds for a common sugar-recognition process. Biochimie. 2001;83(7):645–51. https://doi.org/10.1016/s0300-9084(01)01315-3 . Bressani APP, Martinez SJ, Sarmento ABI, Borém FM, Schwan RF. Organic acids produced during fermentation and sensory perception in specialty coffee using yeast starter culture. Food Res Int. 2020;128:108773. https://doi.org/10.1016/j.foodres.2019.108773 . Lelago A, Buraka T. Determination of physico-chemical properties and agricultural potentials of soils in Tembaro District, KembataTembaro Zone, Southern Ethiopia. Eurasian J Soil Sci. 2019;8:118–30. https://doi.org/10.18393/ejss.533454 . Defez R, Andreozzi A, Romano S, Pocsfalvi G, Fiume I, Esposito R, Angelini C, Bianco C. Bacterial IAA-delivery into Medicago root nodules triggers a balanced stimulation of C and N metabolism leading to a biomass increase. Microorganisms. 2019;7(10):403. https://doi.org/10.3390/microorganisms7100403 . Dhali S, Pradhan M, Sahoo RK, Mohanty S, Pradhan C. Alleviating Cr (VI) stress in horse gram ( Macrotyloma uniflorum Var. Madhu) by native Cr-tolerant nodule endophytes isolated from the contaminated site of Sukinda. Environ Sci Pollut Res. 2021;28(24):31717–30. https://doi.org/10.1007/s11356-021-13009-2 . Dhole A, Shelat H, Vyas R, Jhala Y, Bhange M. Endophytic occupation of legume root nodules by nifH-positive non-rhizobial bacteria, and their efficacy in the groundnut ( Arachis hypogaea ). Ann Microbiol. 2016;66(4):1397–407. https://doi.org/10.1007/s13213-016-1227-1 . Edulamudi P, Antony Masilamani AJ, Vanga UR, Divi VRSG, Konada VM. (2021) Nickel tolerance and biosorption potential of rhizobia associated with horse gram [ Macrotyloma uniflorum (Lam.) Verdc.]. Int J Phytoremediation 23(11):1184–1190. https://doi.org/10.1080/15226514.2021.1884182 Fatnassi IC, Chiboub M, Saadani O, Jebara M, Jebara SH. Impact of dual inoculation with Rhizobium and PGPR on growth and antioxidant status of Vicia faba L. under copper stress. C R Biol. 2015;338(4):241–54. https://doi.org/10.1016/j.crvi.2015.02.001 . Ferreira MJ, Silva H, Cunha A. Siderophore-producing rhizobacteria as a promising tool for empowering plants to cope with iron limitation in saline soils: A review. Pedosphere. 2019;29(4):409–20. https://doi.org/10.1016/S1002-0160(19)60810-6 . Fu SF, Wei JY, Chen HW, Liu YY, Lu HY, Chou JY. Indole-3-acetic acid: A widespread physiological code in interactions of fungi with other organisms. Plant Signal Behav. 2015;10(8):e1048052. https://doi.org/10.1080/15592324.2015.1048052 . Geetha Thanuja K, Annadurai B, Thankappan S, Uthandi S. Non-rhizobial endophytic (NRE) yeasts assist nodulation of Rhizobium in root nodules of blackgram ( Vigna mungo L). Arch Microbiol. 2020;202(10):2739–49. https://doi.org/10.1007/s00203-020-01983-z . Ghosh PK, Kumar De T, Maiti TK. Production and metabolism of indole acetic acid in root nodules and symbiont ( Rhizobium undicola ) isolated from root nodule of aquatic medicinal legume ( Neptunia oleracea ). J Bot. 2015;575067. https://doi.org/10.1155/2015/575067 . Glick BR. Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase. FEMS Microbiol Lett. 2005;251(1):1–7. https://doi.org/10.1016/j.femsle.2005.07.030 . Glick BR. Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res. 2014;169(1):30–9. https://doi.org/10.1016/j.micres.2013.09.009 . Grover M, Bodhankar S, Sharma A, Sharma P, Singh J, Nain L. PGPR Mediated Alterations in Root Traits: Way Toward Sustainable Crop Production. Front Sustain Food Syst. 2021;4. https://doi.org/10.3389/fsufs.2020.618230 . Guo R, Shi L, Jiao Y, Li M, Zhong X, Gu F, Liu Q, Xia X, Li H. Metabolic responses to drought stress in the tissues of drought-tolerant and drought-sensitive wheat genotype seedlings. AoB PLANTS. 2018;10(2). https://doi.org/10.1093/aobpla/ply016 . He X, Zhang Q, Li B, Jin Y, Jiang L, Wu R. Network mapping of root–microbe interactions in Arabidopsis thaliana . NPJ Biofilms Microbiomes. 2021;7(1):72. https://doi.org/10.1038/s41522-021-00241-4 . Isaeva OV, Glushakova AM, Garbuz SA, Kachalkin AV, Chernov IY. Endophytic yeast fungi in plant storage tissues. Biol Bull Russ Acad Sci. 2010;37:26–34. https://doi.org/10.1134/S1062359010010048 . Itam M, Mega R, Tadano S, Abdelrahman M, Matsunaga S, Yamasaki Y, Akashi K, Tsujimoto H. Metabolic and physiological responses to progressive drought stress in bread wheat. Sci Rep. 2020;10(1):17189. https://doi.org/10.1038/s41598-020-74303-6 . Jagadeesh K, Marihal AK, Sinha S. (2010) Bioremediation of pentachlorophenol (PCP)-polluted soil by plant growth-promoting rhizobacteria (PGPR). In: Maheshwari DK, editor Plant growth-promoting rhizobacteria (PGPR) for sustainable agriculture, Springer; 2011. pp. 225–235. Jeswani L. Advances in pulse production technology. In: Baldev B, editor. Advances in pulse production technology. Indian Council of Agricultural Research (ICAR); 1990. pp. 190–8. Jisha KC, Puthur JT. Seed priming with beta-amino butyric acid improves abiotic stress tolerance in rice seedlings. Rice Sci. 2016;23(5):242–54. https://doi.org/10.1016/j.rsci.2016.08.002 . Kamran S, Shahid I, Baig DN, Rizwan M, Malik KA, Mehnaz S. Contribution of zinc solubilizing bacteria in growth promotion and zinc content of wheat. Front Microbiol. 2017;28:2593. https://doi.org/10.3389/fmicb.2017.02593 . Kurtzman C, Robnett C. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5'end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol. 1997;35(5):1216–23. https://doi.org/10.1128/jcm.35.5.1216-1223.1997 . Lee JH, Lee J. Indole as an intercellular signal in microbial communities. FEMS Microbiol Rev. 2010;34(4):426–44. https://doi.org/10.1111/j.1574-6976.2009.00204.x . Lee K, Bai Y, Smith D, Han H, Supanjani S. Isolation of plant-growth-promoting endophytic bacteria from bean nodules. Res J Agric Biol Sci. 2005;1(3):232–6. Leylaie S, Zafari D. Antiproliferative and antimicrobial activities of secondary metabolites and phylogenetic study of endophytic Trichoderma species from Vinca plants. Front Microbiol. 2018;9:1484. https://doi.org/10.3389/fmicb.2018.01484 . Lin J, Cheng J, Wang Y, Shen X. The Pseudomonas Quinolone Signal (PQS): Not Just for Quorum Sensing Anymore. Front Cell Infect Microbiol. 2018;8. https://doi.org/10.3389/fcimb.2018.00230 . Liu Y, Guo Z, Shi H. Rhizobium symbiosis leads to increased drought tolerance in Chinese milk vetch ( Astragalus sinicus L). Agronomy. 2022;12(3):725. https://doi.org/10.3390/agronomy12030725 . Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–75. Lu J, Yang F, Wang S, Ma H, Liang J, Chen Y. Co-existence of rhizobia and diverse non-rhizobial bacteria in the rhizosphere and nodules of Dalbergia odorifera seedlings inoculated with Bradyrhizobium elkanii , Rhizobium multihospitium -like, and Burkholderia pyrrocinia -like strains. Front Microbiol. 2017;8:2255–2255. https://doi.org/10.3389/fmicb.2017.02255 . Macabuhay A, Arsova B, Walker R, Johnson A, Watt M, Roessner U. Modulators or facilitators? Roles of lipids in plant root-microbe interactions. Trends Plant Sci. 2022;27(2):180–90. https://doi.org/10.1016/j.tplants.2021.08.004 . Martínez-Hidalgo P, Hirsch AM. The nodule microbiome: N 2 -fixing rhizobia do not live alone. Phytobiomes. 2017;1(2):70–82. https://doi.org/10.1094/PBIOMES-12-16-0019-RVW . Nair N, Majeed J, Sweety R, Thakur R. Antioxidant potential of pyrimidine derivatives against oxidative stress. Indian J Pharm Sci. 2022;84(1):14–26. https://doi.org/10.36468/pharmaceutical-sciences.890 . Nautiyal CS, Bhadauria S, Kumar P, Lal H, Mondal R, Verma D. Stress-induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol Lett. 2000;182(2):291–6. https://doi.org/10.1111/j.1574-6968.2000.tb08910.x . Naylor D, Coleman-Derr D. Drought stress and root-associated bacterial communities. Front Plant Sci. 2018;8. https://doi.org/10.3389/fpls.2017.02223 . Panhwar QA, Jusop S, Naher UA, Othman R, Razi MI. Application of potential phosphate-solubilizing bacteria and organic acids on phosphate solubilization from phosphate rock in aerobic rice. Sci World J. 2013;272409. https://doi.org/10.1155/2013/272409 . Parmar P, Sindhu S. Potassium solubilization by rhizosphere bacteria: influence of nutritional and environmental conditions. J Microbiol Res. 2012;3(1):25–31. https://doi.org/10.5923/j.microbiology.20130301.04 . Penrose DM, Glick BR. Methods for isolating and characterizing ACC deaminase-containing plant growth‐promoting rhizobacteria. Physiol Plant. 2003;118(1):10–5. https://doi.org/10.1034/j.1399-3054.2003.00086.x . Prakash B, Guled M, Bhosale AM. (2010) Identification of suitable horsegram varieties for northern dry zone of Karnataka. Karnataka J Agricultural Sci 21(3). Prasad SK, Singh MK. Horse gram-an underutilized nutraceutical pulse crop: a review. J Food Sci Tech. 2015;52(5):2489–99. https://doi.org/10.1007/s13197-014-1312-z . Rahman M, Mostofa MG, Keya SS, Rahman A, Das AK, Islam R, Abdelrahman M, Bhuiyan SU, Naznin T, Ansary MU. Acetic acid improves drought acclimation in soybean: an integrative response of photosynthesis, osmoregulation, mineral uptake and antioxidant defense. Physiol Plant. 2021;172(2):334–50. https://doi.org/10.1111/ppl.13191 . Raja S, Uthandi S. Non-rhizobial nodule-associated bacteria (NAB) from blackgram ( Vigna mungo L.) and their possible role in plant growth promotion. Mad Agric J. 2019;106(1–3):1. https://doi.org/10.29321/MAJ.2019.000291 . Ríos-Ruiz WF, Valdez-Nuñez RA, Bedmar EJ, Castellano-Hinojosa A. Utilization of Endophytic Bacteria Isolated from Legume Root Nodules for Plant Growth Promotion. In: Maheshwari D, Dheeman S, editors. Field Crops: Sustainable Management by PGPR. Sustainable Development and Biodiversity. Volume 23. Cham: Springer; 2019. https://doi.org/10.1007/978-3-030-30926-8_6 . Saini MS, Kumar A, Dwivedi J, Singh R. A review: biological significances of heterocyclic compounds. Int J Pharm Sci Res. 2013;4(3):66–77. Samain E, Ernenwein C, Aussenac T, Selim S. Efficacy and Durability of Paenibacillus sp. strain B2 in co-Inoculation with Arthrobacter Sp. SSM-004 and Microbacterium sp. SSM-001 for growth promotion and resistance induction in wheat against Mycosphaerella graminicola and drought stress. J Plant Pathol Microbiol. 2022;13:603. Sayyed RZ, Patel PR. (2011) Biocontrol potential of siderophore producing heavy metal resistant Alcaligenes sp. and Pseudomonas aeruginosa RZS3 vis-à-vis organophosphorus fungicide. Indian J Microbiol 51(3):266–272. https://doi.org/10.1007/s12088-011-0170-x Schwyn B, Neilands J. Universal chemical assay for the detection and determination of siderophores. Anal Biochem. 1987;160(1):47–56. https://doi.org/10.1016/0003-2697(87)90612-9 . Sharma SKMP, Ramesh A, Joshi OP. Characterization of zinc-solubilizing Bacillus isolates and their potential to influence zinc assimilation in soybean seeds. J Microbiol biotechnol. 2011;22(3):352–9. https://doi.org/10.4014/jmb.1106.05063 . Singh RP, Shelke GM, Kumar A, Jha PN. Biochemistry and genetics of ACC deaminase: a weapon to stress ethylene produced in plants. Front Microbiol. 2015;6:937. https://doi.org/10.3389/fmicb.2015.00937 . Smartt J. Evolution of grain legumes. II. Old and new world pulses of lesser economic importance. Exp Agric. 1985;21(1):1–18. https://doi.org/10.1017/S0014479700012205 . Spaepen S, Vanderleyden J, Remans R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol Rev. 2007;31(4):425–48. https://doi.org/10.1111/j.1574-6976.2007.00072.x . Tahjib-Ul-Arif M, Zahan MI, Karim MM, Imran S, Hunter CT, Islam MS, Mia MA, Hannan MA, Rhaman MS, Hossain MA, Brestic M, Skalicky M, Murata Y. Citric acid-mediated abiotic stress tolerance in plants. Int J Mol Sci. 2021;22(13):7235. https://doi.org/10.3390/ijms22137235 . Trivedi P, Leach JE, Tringe SG, Sa T, Singh BK. Plant-microbiome interactions: from community assembly to plant health. Nat Rev Microbiol. 2020;18(11):607–21. https://doi.org/10.1038/s41579-020-0412-1 . Tschaplinski TJ, Abraham PE, Jawdy SS, Gunter LE, Martin MZ, Engle NL, Yang X, Tuskan GA. The nature of the progression of drought stress drives differential metabolomic responses in Populus deltoides . Ann Bot. 2019;124(4):617–26. https://doi.org/10.1093/aob/mcz002 . Ul Haq F, Ali A, Khan M, Shah S, Kandel R, Aziz N, Adhikari A, Choudhary M, Rahman A-u, El-Seedi H, Musharraf S. Metabolite profiling and quantitation of cucurbitacins in cucurbitaceae plants by liquid chromatography coupled to tandem mass spectrometry. Sci Rep. 2019;9. https://doi.org/10.1038/s41598-019-52404-1 . Utsumi Y, Utsumi C, Tanaka M, Ha CV, Takahashi S, Matsui A, Matsunaga TM, Matsunaga S, Kanno Y, Seo M, Okamoto Y, Moriya E, Seki M. Acetic acid treatment enhances drought avoidance in cassava ( Manihot esculenta crantz). Front Plant Sci. 2019;10:521–521. https://doi.org/10.3389/fpls.2019.00521 . Vidyashree DN, Ramaiah M, Panneerselvam P, Mitra D. Organic acids production by zinc-solubilizing bacterial isolates. Int J Curr Microbiol Appl Sci. 2018;7:626–33. https://doi.org/10.20546/ijcmas.2018.710.070 . Wang X, Li Y, Wang X, Li X, Dong S. Physiology and metabonomics reveal differences in drought resistance among soybean varieties. Bot Stud. 2022;63(1):8. https://doi.org/10.1186/s40529-022-00339-8 . Wei Y, Zhao Y, Shi M, Cao Z, Lu Q, Yang T, Fan Y, Wei Z. Effect of organic acids production and bacterial community on the possible mechanism of phosphorus solubilization during composting with enriched phosphate-solubilizing bacteria inoculation. Bioresour Technol. 2018;247:190–9. https://doi.org/10.1016/j.biortech.2017.09.092 . Xu Q, Fu H, Zhu B, Hussain HA, Zhang K, Tian X, Duan M, Xie X, Wang L. Potassium improves drought stress tolerance in plants by affecting root morphology, root exudates, and microbial diversity. Metabolites. 2021;11(3):131. https://doi.org/10.3390/metabo11030131 . Zahra K. Evaluation of maize ( Zea mays L.) hybrids, seed germination, and seedling characters in water stress conditions. Afr J Agric Res. 2012;7:6049–53. https://doi.org/10.5897/AJAR12.2113 . Zarei T, Moradi A, Kazemeini SA, Akhgar A, Rahi AA. The role of ACC deaminase producing bacteria in improving sweet corn ( Zea mays L. var saccharata ) productivity under limited availability of irrigation water. Sci Rep. 2020;10(1):20361. https://doi.org/10.1038/s41598-020-77305-6 . Zúñiga-Silgado D, Rivera-Leyva JC, Coleman JJ, Sánchez-Reyez A, Valencia-Díaz S, Serrano M, de-Bashan LE, Folch-Mallol JL. Soil type affects organic acid production and phosphorus solubilization efficiency mediated by several native fungal strains from Mexico. Microorganisms. 2020;8(9):1337. https://doi.org/10.3390/microorganisms8091337 . Tables Table 1 Gram staining, cell shape, and morphological characteristics of the colony (shape, size, color, edge, and elevation) of nodule-associated plant probiotics of horse gram Isolate name Shape Colour Elevation Edge Gram Staining HGR1 Circular Creamy white Convex Entire Negative HGB1 Circular Blue-Green Raised Undulate Negative HGB2 Irregular Greenish Blue Flat Irregular Negative HGB3 Circular Whitish Brown Raised Smooth Positive HGB4 Circular White Convex Entire Negative HGB5 Circular Pale Yellow Raised Entire Negative HGB6 Circular Light Yellow Convex Entire Negative HGB7 Circular Yellow Raised Smooth Negative HGY1 Irregular White, Opaque Raised Undulate - HGY2 Circular Creamy White Convex Entire - Table 2 Seed biotization of NAPPs induced Germination and vigour index of horse gram under moisture-deficient (20% PEG 6000) conditions. NAPPs Germination % Root length Shoot length Vigor Index Control 54 (20.9 ± 0.403) d (20.4 ± 0.213) d 2230 HGR1 88 (24.1 ± 0.125) b (23.9 ± 0.41) b 4224 HGB2 84 (22.8 ± 0.0.143) c (22.2 ± 0.08) c 3780 HGY1 86 (24.2 ± 0.088) b (23.6 ± 0.111) b 4110 Co-inoculum 90 (28.8 ± 0.0.570) a (27.4 ± 0.057) a 5058 Control – Absolute control treatment without any inoculants; HGR1- Rhizobium sp. HGR1; HGB2- P. indoloxydans HGB2; HGY1- M. restricta HGY1; Consortium-HGR1+HGB2+HGY1. Values are mean ± (standard error) (n=5) and values with the same letter in each column differ substantially on the observation day, as indicated by DMRT (p ≤ 0.05). Additional Declarations No competing interests reported. Supplementary Files TableS1.docx FigS1.docx GA.png Graphical Abstract Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 23 Mar, 2026 Reviews received at journal 23 Mar, 2026 Reviews received at journal 19 Mar, 2026 Reviewers agreed at journal 27 Feb, 2026 Reviewers agreed at journal 05 Feb, 2026 Reviewers agreed at journal 22 Jan, 2026 Reviewers invited by journal 21 Jan, 2026 Editor invited by journal 20 Jan, 2026 Editor assigned by journal 20 Jan, 2026 Submission checks completed at journal 20 Jan, 2026 First submitted to journal 16 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8621449","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":578548674,"identity":"e07ab732-1c94-4694-8f48-5d0bd0c5d502","order_by":0,"name":"Shirley Evangilene","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shirley","middleName":"","lastName":"Evangilene","suffix":""},{"id":578548675,"identity":"9f5218bd-b574-41be-9dd8-6213461458ff","order_by":1,"name":"Shobana Narayanasamy","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shobana","middleName":"","lastName":"Narayanasamy","suffix":""},{"id":578548676,"identity":"39893bda-c200-4a05-a4e8-4d387aea3869","order_by":2,"name":"Sivakumar Uthandi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtklEQVRIiWNgGAWjYFACxgYGhgo4T4JYLWcMSNIC0tVmQFgRHBicP9wm8XPenzz+GQmMH34wWOQR1nIjsU2yd5tBscSNBGbJHgaJYiK0MDYb8G4zSGy4kcAgDfRLYgNhhx1sNvw7xyBxPtCW38RpOZDY+Ji3wSBxw40ENuJskbwB1CJzzDhx45mHbZY9BkRo4Tt//MHBNzVyifOOJx++8aOijrAWJACKU1LiZxSMglEwCkYBbgAAR1888LGmztkAAAAASUVORK5CYII=","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Sivakumar","middleName":"","lastName":"Uthandi","suffix":""}],"badges":[],"createdAt":"2026-01-16 18:08:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8621449/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8621449/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101202668,"identity":"3fb4eb50-9dea-470f-b6c6-a9866c08f89c","added_by":"auto","created_at":"2026-01-27 09:37:00","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2798039,"visible":true,"origin":"","legend":"","description":"","filename":"Shirleyetal.WJMB2025R1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/47718cf0ac3e9ed22a964e62.docx"},{"id":100958574,"identity":"3d431287-af2f-4f6e-9c6f-cba22326fd16","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6054,"visible":true,"origin":"","legend":"","description":"","filename":"667fa090771a4399a4ec39c181a7e08d.json","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/0e8e808e8721b0fdb4f7a7cb.json"},{"id":100958576,"identity":"f070e084-23b0-4ec3-a44d-758811f4db1c","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":201021,"visible":true,"origin":"","legend":"","description":"","filename":"667fa090771a4399a4ec39c181a7e08d1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/1939bbec04a4a9e44ed20806.xml"},{"id":101202497,"identity":"16a43c5d-2c85-4f71-bf65-a0208858d237","added_by":"auto","created_at":"2026-01-27 09:35:15","extension":"jpeg","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":488456,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/cdbe97c0ac7c157cbc7e768b.jpeg"},{"id":101203121,"identity":"c7481abf-5db4-40f8-bd05-85500831fdad","added_by":"auto","created_at":"2026-01-27 09:38:49","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":231966,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/7187364ca6497ad9162c2970.jpeg"},{"id":101202853,"identity":"bd026448-2d4d-46d3-9147-d4802872a652","added_by":"auto","created_at":"2026-01-27 09:37:54","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":161346,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/bea96162f64c82391c417714.jpeg"},{"id":101202705,"identity":"cd515478-3b9b-4163-946b-f3fbbf8a5b15","added_by":"auto","created_at":"2026-01-27 09:37:18","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":267082,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage12.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/26d6d9f48fe4e5445659549e.jpeg"},{"id":100958577,"identity":"229bb465-190a-407a-9b00-425261ab69f5","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149416,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage13.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/92ad0f4e90d5c998a782ef6e.jpeg"},{"id":100958584,"identity":"6f197cf2-15bc-4cf6-9e6d-53b2e72b03e7","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":799225,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/a0a78cb1f21058572163df51.jpeg"},{"id":101203012,"identity":"ddc9d84a-20ae-4ff4-9860-f23c6bb0c8bd","added_by":"auto","created_at":"2026-01-27 09:38:30","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3918,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/d789ce1b5950e54fb57866db.jpeg"},{"id":100958579,"identity":"5c949ae4-59c9-4d27-9d79-5c1caabe13c3","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":236710,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/4734a8adfd09b62de3dd8f24.jpeg"},{"id":100958596,"identity":"92f5349d-9d15-4bcb-8edc-6f194bfd9084","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":332372,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/763c06f0558c134bad111800.jpeg"},{"id":101203040,"identity":"fbfc3a5c-5bc6-4ddb-a592-cce7019136db","added_by":"auto","created_at":"2026-01-27 09:38:38","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":284964,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/4e0707db46a27e1d51d99ea5.jpeg"},{"id":100958592,"identity":"166893bd-e8fa-4b39-b65b-a1de5b77c2e4","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":287580,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/17bc50c1480cf290ebc91a6a.jpeg"},{"id":101202688,"identity":"1b63a9c3-8979-4b10-bc5d-cd8fb155237a","added_by":"auto","created_at":"2026-01-27 09:37:09","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":215339,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/bfeb0c2c7442c9fa23d46929.jpeg"},{"id":100958590,"identity":"f82ec045-cd15-4886-bb0d-05d2b3731b8e","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"jpeg","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":198962,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/1ded0adfbafa47ee79c8d91c.jpeg"},{"id":100958593,"identity":"21adf4e0-7c9f-4fc2-ac5d-e395dd453d65","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":61451,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/3ef2fadbc46eb59bdc502d81.png"},{"id":100958599,"identity":"335d5e26-7239-4a4a-9d3e-9abfef014f75","added_by":"auto","created_at":"2026-01-23 08:04:40","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21358,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/126068e798bf36b3846ac795.png"},{"id":100958580,"identity":"09a7d984-ddb1-4534-aef5-ce276b2defe0","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33332,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/7654888a88d75cd3bf376c27.png"},{"id":100958601,"identity":"5b111c41-05f5-4257-b414-255043cb94a5","added_by":"auto","created_at":"2026-01-23 08:04:40","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":44909,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage12.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/21eb4150fc84d4ceb1da846d.png"},{"id":100958594,"identity":"d5c5c237-2be9-49d2-8d8a-c8fb07733100","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19326,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage13.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/5284b1769e45cfa9bf66b097.png"},{"id":100958586,"identity":"3aefa325-d41f-4eb7-b01d-9caf609875ed","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199827,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/cba7f49baa8d322c8cb0c078.png"},{"id":101202611,"identity":"c53e59c5-c706-443d-a520-b2d65758440a","added_by":"auto","created_at":"2026-01-27 09:36:43","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1518,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/f9776eece32bde280e50cb6f.png"},{"id":100958595,"identity":"954f398b-8fbf-4797-9035-f871463447c4","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":54181,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/d468f6319873a240b5b3d15c.png"},{"id":100958598,"identity":"738a38b6-6ae1-44ba-8a70-d77fcd21cfea","added_by":"auto","created_at":"2026-01-23 08:04:40","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70413,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/cc938026587ccc3fe5a5d79f.png"},{"id":100958582,"identity":"3394fec9-5a49-4892-b6b1-ee427b317f42","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68648,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/c11aeb7567a7a0d7f47fea0e.png"},{"id":100958585,"identity":"92f1ddfc-1eff-48ff-83c8-adc1b7f6279e","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53658,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/3e608c70e580604622e9032d.png"},{"id":101202535,"identity":"ebb4f7cf-6d7e-4266-8ef5-9963dc90d301","added_by":"auto","created_at":"2026-01-27 09:35:56","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":47866,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/3d1920a080a729906c84fc6e.png"},{"id":100958589,"identity":"31649029-6896-483c-8805-d75a05abcb70","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19333,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/48932a4003d42cdc3df13252.png"},{"id":100958602,"identity":"e1f2e225-8458-4d39-9021-51af572e7698","added_by":"auto","created_at":"2026-01-23 08:04:40","extension":"xml","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":195657,"visible":true,"origin":"","legend":"","description":"","filename":"667fa090771a4399a4ec39c181a7e08d1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/9e870c9f410ae7babdf2c880.xml"},{"id":101751157,"identity":"4143f0f7-f9e3-4f53-a98d-aace8f804e6b","added_by":"auto","created_at":"2026-02-03 10:17:00","extension":"html","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":214033,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/0360f07cbcb7d74f6799a16b.html"},{"id":100958567,"identity":"068cee1c-ce7d-4d84-b54c-71455e93e711","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":249023,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic analysis of 16S rRNA sequences using the reference sequences from NCBI\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/26b6971ba4a49efed20699bc.png"},{"id":100958571,"identity":"e3b3389f-8f6d-47ba-bd0f-bc5787c851b1","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":405944,"visible":true,"origin":"","legend":"\u003cp\u003ePlant growth-promoting traits of the nodule-associated plant probiotics (NAPPs) of horse gram. A) IAA production (µg ml\u003csup\u003e–1\u003c/sup\u003e), B) ACC deaminase activity (n mol α-Ketobutyrate mg protein\u003csup\u003e−1 \u003c/sup\u003eh\u003csup\u003e−1\u003c/sup\u003e), and C) Siderophore production (µg ml\u003csup\u003e–1\u003c/sup\u003e). Data represent the mean ± standard error of three replications (n = 3).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/35d489ec36bbc3a2a4377b4a.png"},{"id":101202973,"identity":"8d1a67b7-78c4-482c-818f-db1408c3cfdd","added_by":"auto","created_at":"2026-01-27 09:38:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":292534,"visible":true,"origin":"","legend":"\u003cp\u003eNutrient solubilization efficiency by the nodule-associated plant probiotics (NAPPs) of horse gram; A) Phosphorus solubilization, B) Zinc solubilization, and C) Potassium release. Data in the graph represent the mean ± standard error of three replications (n = 3).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/45bfce402da9438935572462.png"},{"id":101202860,"identity":"b84174a4-3404-415a-803e-db82c50e6a0c","added_by":"auto","created_at":"2026-01-27 09:37:57","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":155469,"visible":true,"origin":"","legend":"\u003cp\u003eHeat map depicting the total amount of each organic acid (ppm) produced by nodule-associated plant probiotics (NAPPs) of horse gram\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/a18f5f5bbc26f4b18f7c2b47.png"},{"id":100958572,"identity":"2fe8ad4f-bf58-47fc-8fa4-4670456c9899","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":251104,"visible":true,"origin":"","legend":"\u003cp\u003eBioplot of principal component analysis (PCA) for the production of organic acids by the nodule-associated plant probiotics (NAPPs).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/70443f2ff1f42337f1e4968d.png"},{"id":100958583,"identity":"89668d92-5f15-46df-9ac6-071fb7e485e0","added_by":"auto","created_at":"2026-01-23 08:04:39","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":290742,"visible":true,"origin":"","legend":"\u003cp\u003eRoot exudates profiling based on different classes of metabolites produced upon interaction under induced moisture deficit stress conditions HGR1 - \u003cem\u003eRhizobium\u003c/em\u003esp, HGB2 – \u003cem\u003eP. indoloxydans\u003c/em\u003e,\u003cem\u003e \u003c/em\u003eHGY1 \u003cem\u003e– M. restricta\u003c/em\u003e, Consortium (HGR1 + HGB2 + HGY1), and Control -uninoculated\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/be852b07c10b2edc19d16714.png"},{"id":101202769,"identity":"6ad2be3f-6f7a-447f-9f3b-7145aab68a14","added_by":"auto","created_at":"2026-01-27 09:37:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":439073,"visible":true,"origin":"","legend":"\u003cp\u003ePresence of biochemical pathway expressed upon the interaction between potential NAPPs under induced moisture deficit stress conditions in Cytoscape 3.4.0. HGR1 - \u003cem\u003eRhizobium\u003c/em\u003esp, HGB2 – \u003cem\u003eP. indoloxydans\u003c/em\u003e,\u003cem\u003e \u003c/em\u003eHGY1 \u003cem\u003e– M. restricta\u003c/em\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/be60b20378a9b336d7e41fe4.png"},{"id":101754845,"identity":"9ca53051-e0ac-4041-92b2-dae00c9ab1c1","added_by":"auto","created_at":"2026-02-03 10:47:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3196994,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/4786cebe-9e3d-4fc7-b4e0-933444fd6f57.pdf"},{"id":100958568,"identity":"9c11d4b7-0ef5-4605-bbba-f24698f86dc8","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":15154,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/c14452a89278ced068bb9f8f.docx"},{"id":101202854,"identity":"3de3f50a-a1f5-4c91-a224-410665614d3a","added_by":"auto","created_at":"2026-01-27 09:37:54","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":164090,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/e6358b2380f4dcd417a374e6.docx"},{"id":100958569,"identity":"03ab3c92-3811-424a-aa82-9a2c4783fd72","added_by":"auto","created_at":"2026-01-23 08:04:38","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":422131,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical Abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"GA.png","url":"https://assets-eu.researchsquare.com/files/rs-8621449/v1/020e9159dcce34aedfdbb9b2.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Root Nodule-associated Plant Probiotics Modulate Growth and Drought Stress Responses in Horse Gram Macrotyloma uniflorum (Lam.)","fulltext":[{"header":"Highlights","content":"\u003cp\u003e\u0026bull; Nodule-associated plant probiotics (NAPPs) of horse gram exhibited higher PGP traits, including the production of IAA, Siderophores, and ACC Deaminase, as well as nutrient solubilization (P, Zn, and K).\u003c/p\u003e\u003cp\u003e\u0026bull; NAPPs profiled for organic acids revealed production of acetic acid, lactic acid, oxalic acid, butyric acid, citric acid, etc.\u003c/p\u003e\u003cp\u003e\u0026bull; Interaction of HGR1 with NAPPs HGB2 and HGY1 increased seed germination and plant growth under induced drought stress (-0.46 Mpa).\u003c/p\u003e\u003cp\u003e\u0026bull; Root-exuded metabolites, viz., stigmasterol, indole, ascorbic acid, fumaric acid, oleic acid, proline, and glucopyranoside, act as signalling cues and modulate plant growth to facilitate plant health and fitness under adverse environmental conditions.\u003c/p\u003e\u003cp\u003e\u0026bull; NAPPs can serve as a novel bio-inoculant to increase drought resilience and enhance productivity in horse gram.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eHorse gram (\u003cem\u003eMacrotyloma uniflorum\u003c/em\u003e Lam.), formerly known as \u003cem\u003eDolichos biflorus\u003c/em\u003e, is an essential short-duration food legume native to tropical southern Asia (Amaral et al., 2022; Jeswani and Baldev, 1990). It is a rich source of bioactive compounds with antioxidant properties and high nutritional values (Prasad and Singh, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), and is widely consumed by the poorest strata of society. In addition, this protein-rich fodder is widely used as livestock feed (Prakash et al., 2008). It is grown at a wide range of temperatures (Smartt, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1985\u003c/span\u003e), at which other crops fail to thrive. In India, horse gram is typically cultivated in the late rainy season and low-fertility soils with fewer inputs (Witcombe et al. 2008).\u003c/p\u003e \u003cp\u003eA vast array of nodule-associated plant probiotics (NAPPs) establishes mutualistic relationships with legume root nodules during symbiotic nodulation. It plays a significant role in promoting plant growth by producing phytohormones, secreting root exudates, enhancing organic acid production for effective solubilization and Fe chelation, and promoting the production of signaling compounds under harsh environmental conditions (Mart\u0026iacute;nez-Hidalgo and Hirsch, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Exploring the studies on these plant-microbe interactions reveals the complete dependency on three factors: 1) The propensity to colonize the host, 2) The supportive environment for the establishment of a symbiosis, and 3) The presence of abundant and highly diverse colonizing microbes.\u003c/p\u003e \u003cp\u003eThe NAPPs enhance plant growth through direct and indirect mechanisms, including growth promotion, stress tolerance, and resistance to pathogens and pests. Microbiome-mediated functions are believed to initiate mostly from the belowground parts of the plant, and are transmitted as plant-mediated signals to the above-ground compartments of floral organs. Direct effects include stimulation of comprehensive plant growth through stress reduction, modulation of aminocyclopropane-1-carboxylate (ACC) deaminase expression, and the production of plant hormones, detoxification enzymes, and osmoprotectants. Indirect mechanisms also protect crops against phytopathogens and pests through antagonism or the induction of systemic resistance (Trivedi et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). A proto-cooperative mode of interaction involving the non-rhizobial endophytes (NREs) \u003cem\u003eBacillus subtilis\u003c/em\u003e NANEB1 and \u003cem\u003ePaenibacillus taichungensis\u003c/em\u003e TNEB6, along with the nodule-associated endosymbiont \u003cem\u003eRhizobium\u003c/em\u003e, has been proven to play essential roles in nodulation and nitrogen fixation in the black gram crop (Raja and Uthandi, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecent advances on plant-microbe interactions have highlighted the significant role of indole acetic acid (IAA) production as a key signalling molecule that functions as a phyto-stimulant by interacting with the plants' signalling compounds during microbial colonization (Spaepen et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). The inoculation of \u003cem\u003eMedicago sativa\u003c/em\u003e with the IAA-overproducing \u003cem\u003eEnsifer meliloti\u003c/em\u003e strain RD64 indicated the increased expression of genes related to nitrogen fixation, glucose and lipid metabolism, and abiotic stress responses by stimulating the accumulation of low-molecular-weight signalling compounds within the root nodules of the host plants (Defez et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Beneficial microorganisms synthesize ACC deaminase, which lowers plant ethylene levels by cleaving ACC, thereby enhancing resistance to diverse environmental stresses (Glick, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). In addition, symbiotic rhizobia and other non-nodulating microorganisms produce siderophores that facilitate iron chelation and contribute to plant disease suppression by inducing systemic resistance (Sayyed and Patel, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), promoting plant growth, and ensuring successful pulse production. Consistent with these findings, our earlier studies on non-nodule-associated plant probiotics, including yeasts such as \u003cem\u003eCandida glabrata\u003c/em\u003e VYP1 and \u003cem\u003eCandida tropicalis\u003c/em\u003e VYW1, reported enhanced production of phytohormones and siderophores, along with increased ACC deaminase activity (Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, organic acids secreted by microorganisms boost nutrient availability for plants through mineral desorption and solubilization, thereby promoting plant growth (Grover et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Additionally, the secretion of organic acids by microorganisms plays a crucial role in regulating developmental processes, including signalling and responses to different abiotic stresses (Khan et al., 2023; Panchal et al., 2021). The interaction between organic acids and abiotic stimuli favorably sustained plant growth, thereby improving drought tolerance and immunity (Tschaplinski et al., \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Notably, co-inoculation of wheat with compatible strains of \u003cem\u003ePaenibacillus\u003c/em\u003e sp. strain B2 (PB2), \u003cem\u003eArthrobacter\u003c/em\u003e sp. SSM-004, and \u003cem\u003eMicrobacterium\u003c/em\u003e sp. SSM-001 exhibited stable, durable resistance under induced drought stress (Samain et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eExtensive research on the horse gram has primarily dealt with the plant growth-promoting microbes capable of reducing the phytotoxicity of heavy metals, such as copper (Fatnassi et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), nickel (Edulamudi et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), chromium (Dhali et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and pentachlorophenol (Jagadeesh et al., 2011) in polluted ecological regions. However, beyond their role in bioremediation, these plant growth-promoting microorganisms \u0026ndash; particularly non-rhizobial endophytes have not been extensively investigated for their role in promoting plant growth. Given the widespread applications of NRE strains in enhanced plant growth and pulse production, the NAPPs of horse gram remain largely unexplored. Thus, the present study aims to isolate and characterize the potential plant growth-promoting traits exhibited by NAPPs of horse gram. In addition, the study investigates the interactions among potential NAPPs under moisture-deficit stress conditions, focusing on the production of key metabolites and the associated signalling pathways, to provide insights for the exploration of underutilized legume crops. Furthermore, the study's findings are expected to yield promising sustainable bioinputs that improve nutrient-use efficiency, enhance drought resilience, and support climate-smart cultivation of horse gram.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003eFor unravelling the NAPPs, root nodules of horse gram at the flowering stage were collected from three different zones near Hosur (745 m MSL, latitude of 12.68 \u003csup\u003e\u0026deg;\u003c/sup\u003eN and longitude of 77.93 \u003csup\u003e\u0026deg;\u003c/sup\u003eE), Paiyur (490 m MSL), and Thiruvannamalai (174 m MSL) in Tamil Nadu. These northwestern and northeastern zones of Tamil Nadu were characterized as semi-arid, with mean annual rainfall of less than 900 mm and temperatures ranging from 17\u0026deg;C to 37\u0026deg;C. Plant and soil samples were collected in sterile bags and transported to the Biocatalysts Laboratory, Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore. The soil samples collected were analyzed for physicochemical properties (Lelago and Buraka, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIsolation of nodule-associated plant probiotics (NAPPs)\u003c/h3\u003e\n\u003cp\u003eTo isolate NAPPs, the collected roots were gently washed under running tap water for 10 min to remove adhering soil particles. For surface sterilization, healthy root nodules were carefully excised from the cleaned roots of each plant, immersed in 70% ethanol for 30 s, then in 0.1% HgCl\u003csub\u003e2\u003c/sub\u003e for 2 min, and washed 3 times with sterile water under aseptic conditions. To confirm the efficiency of the nodule sterilization process, an aliquot of 100 \u0026micro;L of the third (final) wash was inoculated onto R2A agar plates, which were then incubated at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. The surface-sterilized root nodules were crushed with the sterile pestle and mortar, and 100 \u0026micro;L of aliquots were serially diluted and inoculated on the Luria Bertani Agar (LB Agar), the Yeast Extract Mannitol Agar (YEMA), and the Yeast Extract Malt Extract (YEME). The plates were incubated at 28\u0026deg;C for a week to promote NAPPs growth (Dhole et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The well-grown colonies were selected and purified on appropriate media using the streak plate method. The morphologically distinct isolated colonies were examined for taxonomic identification. Furthermore, the isolates were stored in 40% glycerol at \u0026minus;\u0026thinsp;80\u0026deg;C for validation.\u003c/p\u003e\n\u003ch3\u003ePhylogenetic identification of the nodule-associated plant probiotics of horse gram\u003c/h3\u003e\n\u003cp\u003eBacterial genomic DNA was isolated by the CTAB method, and the yeast DNA was isolated by the standard cell lysis method. The genomic DNA extracted from bacteria, actinobacteria, and yeast was amplified using the universal primers 27F (5\u0026prime;AGAGTTTGATCCTGGCTCAG 3\u0026prime;) and 1492R (5\u0026prime; GGTTACCTTGTTACGACTT 3\u0026prime;), NL1 (5\u0026prime;-GCATATCAATAAGCGGAGGAAAAG-3\u0026prime;), and NL4 (5\u0026prime;GGTCCGTGTTTCAAGACGG3\u0026prime;), respectively (Lee et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) using the BIO-RAD thermal cycler (Kurtzman and Robnett, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Sequence identity was assessed by performing sequence similarity searches against the GenBank database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nih.gov/BLAST\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nih.gov/BLAST\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The phylogenetic tree was constructed in MEGA10 to determine the close and distant relationships among the sequences.\u003c/p\u003e\n\u003ch3\u003eScreening of the nodule-associated plant probiotics for their plant growth-promoting attributes\u003c/h3\u003e\n\u003cp\u003eThe functional attributes conferred by NAPPs in horse gram were investigated by assessing the plant growth-promoting parameters such as the production of IAA, ACC deaminase, siderophores, and organic acids, and nutrient solubilization.\u003c/p\u003e\n\u003ch3\u003eIAA production\u003c/h3\u003e\n\u003cp\u003eA Salkowski's colorimetric method was used with the Van Urk Salkowski reagent to determine the amounts of IAA produced by each isolate. The strains were cultured for 4 days at 28\u0026deg;C in LB broth. After incubation, the broth was centrifuged, and 1 mL of the supernatant was mixed with 2 mL of Salkowski's reagent (2% 0.5 FeCl\u003csub\u003e3\u003c/sub\u003e in a 35% HCLO\u003csub\u003e4\u003c/sub\u003e solution) and stored in the dark. After 30 min and 120 min, the optical density (OD) was measured at 530 nm (Fu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eACC deaminase activity\u003c/h2\u003e \u003cp\u003eThe cultures were grown in LB and YEME broth up to the late log phase at 30\u0026deg;C on an orbital shaker at 150 rpm for 24 h to measure ACC deaminase activity. The cell pellets were centrifuged and then washed with 0.1 M Tris\u0026ndash;HCl (pH 7.6) before being suspended in the minimal salt medium with 3 mM ACC as the sole nitrogen source. The amount of α-ketobutyrate produced by enzymatic hydrolysis of ACC was measured to evaluate ACC deaminase activity in the cell-free extract (Penrose and Glick, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). The amount of α-ketobutyrate was measured at 540 nm, and its concentration was determined using a standard curve. The Lowry method (Lowry et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e1951\u003c/span\u003e) was used to determine the protein concentration.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eSiderophore production\u003c/h3\u003e\n\u003cp\u003eTo conduct the qualitative assay for siderophore production, the chrome azurol sulfonate (CAS) agar plate method (Schwyn and Neilands, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1987\u003c/span\u003e) was used. All strains were inoculated in Nutrient Broth medium for 48 h at 30\u0026deg;C on a rotary shaker at 120 rpm, and 0.05 mL of the resulting bacterial suspension (9 \u0026times; 10\u003csup\u003e8\u003c/sup\u003e cells ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e) was spotted onto CAS-agar plates in triplicate and incubated for 5 days at 30\u0026deg;C. An orange halo appeared around the colonies on the CAS blue agar, indicating the production of siderophores. The ratio of the halo zone diameter or the colony diameter was assessed based on size, and the findings were represented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD).\u003c/p\u003e\n\u003ch3\u003eNutrient solubilization\u003c/h3\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePhosphorus solubilization\u003c/h2\u003e \u003cp\u003eThe ability of the strains to solubilize the inorganic form of phosphorus from tricalcium phosphate was determined by spot inoculation of strains on the NBRIP medium, and their ability for solubilization was tested at 30\u0026deg;C in the medium (pH 7.0) supplemented with tricalcium phosphate (Nautiyal et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Uninoculated plates were kept as the control. After 3 days of incubation, a clear zone surrounding the colonies was observed, indicating phosphate solubilization. The solubilization index was calculated as the ratio of the halo zone diameter to the colony diameter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eZinc solubilization\u003c/h2\u003e \u003cp\u003eTo assess the zinc solubilization potential of the strains, the Alexandrov medium supplemented with 0.1% zinc oxide (ZnO) was used. Overnight-grown single colonies were aseptically transferred to respective zinc medium plates by spot inoculation. After spot inoculation, the plates were incubated in the dark at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for 48 h, and a distinct halo zone formed around the cultures (Sharma et al., 2012). The efficiency of zinc solubilization (SE) was estimated by dividing the diameter of the halo zone by the colony diameter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePotassium availability\u003c/h2\u003e \u003cp\u003eThe spot test method was used to assess the strains' potential to solubilize potassium. A loopful of 48-hour-old grown strains was spotted on the modified Aleksandrov medium supplemented with potassium aluminosilicate minerals as an insoluble source of potassium. For three days, the Plates were incubated at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. The ability of different microbial strains to develop clear zones on media was used to detect potassium availability (Parmar and Sindhu, 2013). Uninoculated plates served as a control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eOrganic acid production\u003c/h2\u003e \u003cp\u003eThe strains were grown in their respective culture broths\u0026mdash;YEMA for \u003cem\u003eRhizobium\u003c/em\u003e, LB for bacterial strains, and YEME for yeast strains\u0026mdash;and incubated at 28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C until they reached the log phase. Log-phase cultures were harvested and centrifuged at 6000 rpm for 5 min. The GC-MS analysis was performed using the purified crude cell-free extract in a PerkinElmer GC-MS Clarus\u0026reg; SQ 8 Mass Spectrometer (MS) equipped with the DB-5MS (Agilent, USA) capillary standard non-polar column with dimensions of 0.25 mm OD x 0.25 \u0026micro;m ID x 30 m length and an FID detector (Lee et al., 2012). Autochrome software was used for data integration and analysis. As standards, an HPLC-grade organic acids kit (No. 47264 from Sigma-Aldrich, USA) was used.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCompatibility assessment and consortium preparation\u003c/h2\u003e \u003cp\u003eThe potential NAPPs were selected based on their plant growth-promoting (PGP) attributes. Non-pathogenicity of each isolate was confirmed on sheep blood agar plates (HiMedia, India; Cat. No. MP1301) by the absence of hemolytic activity. The strains selected for further experimentation were \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, and \u003cem\u003eM. restricta\u003c/em\u003e HGY1. Compatibility among the three NAPPs was evaluated using standard cross-streak and co-culture assays. Strains showing no inhibitory interaction were considered compatible and will be used for consortium development (Annadurai et al., 2021).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEstimation of NAPPs-induced seed germination efficiency under moisture deficit stress\u003c/h2\u003e \u003cp\u003eHorse gram seeds (var. Paiyur 2) obtained from the Regional Research Station, Paiyur, Krishnagiri district, Tamil Nadu, were surface sterilized in 0.1% HgCl\u003csub\u003e2\u003c/sub\u003e for 2 min and rinsed three times with ethanol and then five times with sterile water. After sterilization, seeds were inoculated and incubated for 1 hour with overnight-grown cultures of HGR1, HGB2, and HGY1, and with co-inoculum containing HGR1, HGB2, and HGY1. Meanwhile, horse gram seeds treated with sterile water served as a control. Inoculum-treated seeds were placed on filter paper in Petri dishes containing 0, 10, 20, and 30% polyethylene glycol (PEG 6000) corresponding to osmotic potentials of 0, \u0026minus;\u0026thinsp;0.14, \u0026minus;\u0026thinsp;0.29, and \u0026minus;\u0026thinsp;0.46 MPa, respectively. To prevent drying, Petri plates were wrapped in Parafilm and incubated at room temperature (28\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C). The germination percentage was estimated after 72 h of incubation using standard methods (Khodarahmpour, 2012) as follows.\u003c/p\u003e \u003cp\u003eGermination % = \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\frac{\\varvec{N}\\varvec{o}.\\:\\varvec{o}\\varvec{f}\\:\\varvec{s}\\varvec{e}\\varvec{e}\\varvec{d}\\varvec{s}\\:\\varvec{g}\\varvec{e}\\varvec{r}\\varvec{m}\\varvec{i}\\varvec{n}\\varvec{a}\\varvec{t}\\varvec{e}\\varvec{d}}{\\varvec{T}\\varvec{o}\\varvec{t}\\varvec{a}\\varvec{l}\\:\\varvec{n}\\varvec{o}.\\:\\varvec{o}\\varvec{f}\\:\\varvec{s}\\varvec{e}\\varvec{e}\\varvec{d}\\varvec{s}}\\)\u003c/span\u003e\u003c/span\u003e \u003cb\u003e\u0026times; 100\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMetabolomic profiling of root exudates\u003c/h2\u003e \u003cp\u003eThe root exudates of horse gram seedlings were collected in an experimental setup. The funnel-flask setup comprised a 500 mL Erlenmeyer flask and a 150 mm diameter funnel, which was positioned at its stem end and covered with Aluminum foil with pin-sized holes. The stem was perfectly inserted into the mouth of the flask. Glass beads were poured into the funnel through the neck, and then, acid-washed sand (240 g) was added to three-fourths of the funnel. Aluminum foil was used to cover the broader opening of the funnel, and the entire setup was autoclaved for 20 min at 121\u0026deg;C at 15 psi. Horse gram seeds were sown in the funnel, and to induce stress in laboratory conditions, 20% PEG 6000 was added to the modified Hoagland nutrient solution. The putative root exudate metabolites produced during the interaction between HGR1, HGB2, and HGY1 were analyzed after 10 days of seedling germination with a GC-MS (Xu et al., \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The bioactive molecules were identified by comparing their mass spectra with those in the NIST 08 Mass Spectral Library (National Institute of Standards and Technology). The names, molecular weights, and structures of molecules were retrieved from NIST, PubChem, and HMDB databases, respectively (Leylaie and Zafari, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eThe datasets were subjected to a two-way analysis of variance (ANOVA), and means were separated using Duncan\u0026rsquo;s multiple-range test (DMRT) at the 0.05 significance level, using SPSS version 20. Heat maps were generated using GraphPad Prism 9, run on Windows 10 (Ul Haq et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Principal component analysis (PCA) was performed to assess differences and similarities among the variables at the 5% significance level using XLSTAT 2021. 3.1 (Bressani et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Cytoscape software version 3.7.1 was also used to analyze metabolite data and to perform pathway enrichment analyses (He et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe main significance of this study was to unravel the NAPPs of the underutilized crop, horse gram (\u003cem\u003eMacrotyloma uniflorum\u003c/em\u003e Lam.), and its importance in plant growth and drought stress mitigation. The NAPPs isolated from horse gram nodules were identified, and the metabolites in root exudates influenced by NAPPs upon their interaction under induced drought stress were profiled.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation of nodule-associated plant probiotics (NAPPs) from horse gram root nodules\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA total of 10 morphologically distinct isolates, each from the nodules of a different horse gram plant, were chosen (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). These strains were named HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 and tested for various growth-promoting activities, which are described below.\u003c/p\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eIdentification and phylogenetic analysis of nodule-associated non-rhizobial endophytes\u003c/h2\u003e \u003cp\u003eA total of seven bacterial isolates and one actinobacterial isolate successfully yielded the corresponding 1500-bp 16S rRNA amplification products, and their resulting sequencing data were of high quality and were therefore analyzed in NCBI databases using the BLAST tool. The majority of the isolates were identified as gammaproteobacteria, while representatives of flavobacteria and actinomycetia were also observed. The isolates identified based on 16S rRNA gene sequencing were as follows: HGR1 - \u003cem\u003eRhizobium\u003c/em\u003e sp, HGB1 - \u003cem\u003eP. aeruginosa\u003c/em\u003e (Accession number: ON461479), HGB2 - \u003cem\u003eP. indoloxydans\u003c/em\u003e (Accession number: ON470821), HGB3 - \u003cem\u003eLeucobacter aridicollis\u003c/em\u003e, HGB4 \u0026ndash; \u003cem\u003eA. rhizosphaerae\u003c/em\u003e, HGB5 \u0026ndash; \u003cem\u003eE. bugandensis\u003c/em\u003e, HGB6 \u0026ndash; \u003cem\u003eK. michiganensis\u003c/em\u003e, and HGB7 \u0026ndash; \u003cem\u003eF. anhuiense\u003c/em\u003e. The yeast isolate HGY1 was identified as \u003cem\u003eM. restricta\u003c/em\u003e based on approximately 600-bp 18S rRNA gene sequences. Approximately 1500 bp of 16S rRNA gene sequences from the microbial isolates were combined to construct phylogenetic trees using the Neighbor-joining method with 100% similarity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003ePlant growth-promoting attributes\u003c/h2\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003eIAA production\u003c/h2\u003e \u003cp\u003eAuxin, produced by NAPPs, is one of the most studied plant growth hormones. All strains were capable of synthesizing IAA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Among them, the highest IAA production was observed in HGR1 (39.12 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), followed by HGB1 (33.19 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), HGB2 (17.487 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), and HGB5 (13.402 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), while the minimum IAA production was recorded in HGY2 (0.977 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e). At a 5% error margin, HGR1, HGB1, and HGB2 had significantly higher IAA yields than HGB5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eACC deaminase activity\u003c/h2\u003e \u003cp\u003eThe ability of NAPPs to use ACC as a significant nitrogen source was investigated. The highest ACC deaminase activity among the evaluated nodule-associated endophytes was found in HGB5 (473.1 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), followed by HGB1 (326.4 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), HGB2 (281.0 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), and HGY1 (265.8 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). In contrast, the lowest was observed in HGY2 (52.2 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). In comparison, HGR1 (541.2 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003cb\u003e)\u003c/b\u003e exhibited the highest ACC deaminase activity, resulting in the cleavage of ACC into ammonia and α-ketobutyrate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eSiderophore activity\u003c/h2\u003e \u003cp\u003eAll strains produced siderophores that suppressed plant pathogens. Among them, HGB2 produced the highest amount of siderophore (93.681 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), followed by HGR1 (90.603 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), HGB5 (90.408 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), and HGB3 (90.181 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), whereas the minimum siderophore amount was recorded in HGY2 (42.612 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003ePhosphorus solubilization\u003c/h2\u003e \u003cp\u003ePhosphate-solubilizing strains were qualitatively screened in the modified NBRIP agar plates supplemented with insoluble tricalcium phosphate minerals were presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. The presence of insoluble phosphate in the medium led to the development of a clear zone around colonies, which indicated the phosphate solubilization to a greater extent by the NAPPs, such as HGB2, followed by HGB1, HGY1, and HGB5, and significantly higher phosphate solubilization by HGR1 was noticed. No P solubilization efficiency was observed in HGB3, HGB4, HGB6, and HGY2 at the 95% confidence level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eZinc solubilization\u003c/h2\u003e \u003cp\u003eZinc is a crucial component of various enzymes that are responsible for plant metabolism. The presence of halo zones on the Bunt and Rovira medium supplemented with 0.1% ZnO indicated zinc solubilization. Zinc solubilization by the strains HGR1 and HGB1 inoculated into the medium was significantly higher than that by other strains, such as HGY1 and HGB2, at the 95% confidence level. The P solubilization efficiency was found in HGB3, HGB4, and HGB6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003ePotassium release\u003c/h2\u003e \u003cp\u003eSome potassium-releasing microorganisms can convert insoluble potassium (K) to soluble potassium, thereby making it available for plant uptake. The presence of halo zones on the Alexandrov medium supplemented with insoluble potassium aluminosilicate minerals indicated the K release by the microorganisms. In this study, HGR1, along with other NAPPs such as HGY1 and HGB6, was the most efficient K-releasing strain compared with the microbial strains tested at a 5% error margin. A few strains, such as HGB3 and HGY2, were unable to release K for plant growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eOrganic acid production\u003c/h2\u003e \u003cp\u003eGC\u0026ndash;MS\u0026ndash;based organic acid profiling demonstrated organic acid production by the horse-gram NAPPs, such as HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The heatmap exhibited the significant variations in both the type of organic acid and their relative abundance produced. Acetic acid, lactic acid, isobutyric acid, malic acid, and quinic acid were among the most consistently detected metabolites across several strains. In contrast, fumaric acid, succinic acid, and benzoic acid were produced only by a few strains at lower intensities. Citric acid, malonic acid, maleic acid, ascorbic acid, and benzoic acid were produced in higher concentrations by HGR1. In contrast, butyric acid, maleic acid, and malonic acid were produced in higher concentrations by HGB1. HGB2 produced higher quantities of fumaric acid, malonic acid, and lactic acid. HGB3 produced considerable amounts of isobutyric acid, butyric acid, malic acid, and malonic acid. HGB4, which produced acetic acid and maleic acid in greater quantities. Propionic acid was produced in lower amounts by HGB5. HGB6 excessively produced ascorbic acid, succinic acid, and malonic acid. HGB7 produced higher amounts of propionic and oxalic acids. HGY1 could produce higher concentrations of lactic acid, ascorbic acid, and malic acid. HGY2 produced higher concentrations of quinic acid and oxalic acid. This distinct production pattern demonstrates NAPPs functional diversity in the synthesis of organic acids associated with nutrient solubilization and stress alleviation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eSimilarities and dissimilarities of the nutrient solubilization patterns\u003c/h2\u003e \u003cp\u003eTo study the nutrient solubilization patterns, such as P, Zn, and K by the NAPPs, namely HGR1, HGB1, HGB2, HGB3, HGB4, HGB5, HGB6, HGB7, HGY1, and HGY2 and the variation in the availability of these nutrients to plants, principal component analysis (PCA) was performed for all the variables simultaneously (Fig.\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The PCA explained a total variance of 83.04% (PC1: 48.01%, PC2: 35.03%) across NAPPs. The biplot revealed a clear grouping of strains, with HGR1, HGB2, and HGB5 positively correlated with P solubilization and K availability. HGB1 and HGY1 were positively correlated with Zinc solubilization, whereas HGB3 and HGY2 were negatively correlated with all three parameters of Zn and P solubilization and K availability.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDimensional variations in organic acid production by the isolates\u003c/h3\u003e\n\u003cp\u003ePCA of organic acids production among horse gram NAPPs showed a total variance of 55.27% (PC1: 31.12% and PC2: 24.15%). Organic acids such as butyric acid, citric acid, isobutyric acid, malonic acid, and propionic acid were the loading factors of PC1, contributing to variability. Furthermore, HGR1, HGB1, and HGB3 were positively correlated with the production of organic acids. The major components contributing to the PC2 dimension were fumaric acid, lactic acid, ascorbic acid, malic acid, and oxalic acid, which were positively correlated with HGB2, HGB7, and HGY1. HGB5, HGY2, and HGB6 were, however, negatively correlated with the production of benzoic acid, succinic acid, and quinic acid. HGB4 was positively correlated with the production of acetic acid and maleic acid at low concentrations (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e5\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBased on the plant growth-promoting traits and non-pathogenic nature (confirmed through sheep blood agar plates), three NAPPs, such as \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, and \u003cem\u003eM. restricta\u003c/em\u003e HGY1 were selected for further studies. These strains were compatible with one another and were formulated into a consortium at a 1:1:1 volume ratio, with a cell concentration of 108 CFU mL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and evaluated for their potential role in seed germination and plant growth under induced moisture-deficit stress.\u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eEfficiency of the biotized seed germination under induced moisture deficit stress\u003c/h2\u003e \u003cp\u003eSurface-sterilized horse gram seeds were germinated under stress at 0%, 10%, 20%, and 30%. Our study found that primed seeds co-inoculated with \u003cem\u003eM. restricta\u003c/em\u003e HGY1 could germinate even under 30% PEG-induced moisture-deficit stress. The potential germination of primed seeds was observed up to 20% PEG treatment (Table S1). At the 20% stress level, the germination percentage of co-inoculum-treated seeds was found to be higher (90%) with a vigor index of 5058, compared with that of the seeds inoculated with only HGR1 (88% and 4224), HGY1 (86% and 4110), and HGB2 (84% and 3780). In contrast, lower germination percentages (54% and 2230) were recorded in the uninoculated control under induced moisture-deficit stress (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Seeds biotized with NAPPs showed a significant increase in root and shoot length. The co-inoculum-treated seeds exhibited the highest root and shoot length of 28.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.570 and 27.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.057 cm, respectively, which showed a significant increase over the uninoculated control (20.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.076 cm and 20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.403 cm, respectively).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eProfiling of metabolites in root exudates under induced moisture deficit stress upon interaction\u003c/h2\u003e \u003cp\u003eThe analysis of root exudate metabolites produced by \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, \u003cem\u003eM. restricta\u003c/em\u003e HGY1, and their interactions under induced moisture stress using the funnel method revealed the presence of 28 compounds. The major compounds included steroids and steroid derivatives, saturated hydrocarbons, quinolones and derivatives, pyridines and derivatives, prenol lipids, piperidines, phenylpropanoids and polyketides, phenol esters, organosulfur compounds, organooxygen compounds, organohalogen compounds, organonitrogen compounds, organic acids and derivatives, organoheterocyclic compounds, naphthalenes, keto acids and derivatives, indole and derivatives, glycerolipids, flavonoids, fatty acyls, diazines, carboxylic acid and derivatives, benzenoids, benzene and substituted derivatives, alkyl halides, alkaloids and derivatives, azoles, alcohols, and polyols (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePrimary root exudate metabolites produced by \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1 were organoheterocyclic compounds, fatty acyls, benzene, and substituted derivatives. \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2 produced higher amounts of benzene and substituted derivatives, steroid and steroid derivatives, prenol lipids, organoheterocyclic compounds, and quinolones and derivatives. The root exudates of plants inoculated with \u003cem\u003eM. restricta\u003c/em\u003e HGY1 were mainly composed of organoheterocyclic compounds, fatty acyls, benzene and substituted derivatives, steroids and steroid derivatives, and prenol lipids. During a tripartite interaction, the potential NAPPs produced benzene and substituted derivatives, carboxylic acids and derivatives, organoheterocyclic compounds, fatty acyls, indoles and derivatives, steroids and steroid derivatives, and flavonoids under induced moisture stress. The biochemical pathway analysis of metabolites produced during the interaction between \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, and \u003cem\u003eM. restricta\u003c/em\u003e HGY1 is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e7\u003c/span\u003e. The study of metabolic pathways in Cytoscape revealed that the key metabolic pathways, including choline metabolism, TCA cycle, glycolysis and gluconeogenesis, proline and alanine metabolism, galactose metabolism, ascorbic acid synthesis, butanoate metabolism, tryptophan metabolism, fatty acid biosynthesis, phenol metabolism, and secondary metabolite synthesis are interestingly involved in the interaction between potential NAPPs.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe \u003cem\u003eRhizobium\u003c/em\u003e-legume interaction is a well-known symbiosis that regulates symbiotic nitrogen fixation, and the comprehensive mechanisms of root nodule formation are also well explored. In addition to \u003cem\u003eRhizobium\u003c/em\u003e, a vast array of NAPPs is found in the root nodules of leguminous plants, and together they establish a mutualistic relationship that facilitates symbiotic nodulation and promotes plant growth. Several reports on NRE have explored their potential roles in nodulation, signal exchange, and plant health promotion in legume root nodules (Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Isaeva et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). However, horse gram remains underutilized and underexploited, despite being a rich source of bioactive compounds that confer benefits relative to other crops, including drought resistance, the ability to germinate in poor soil conditions, and tolerance to moderate salinity. Our previous study dealt with the exploration of structural and functional diversity of bacterial communities present in the soil, rhizosphere region, root nodules, and seeds of the horse gram by using 16S rRNA high-throughput amplicon sequencing technology for a better understanding of survival strategies employed by soil and plant microbiome to upgrade the bioinoculant development strategies (Evangilene and Uthandi, 2022).\u003c/p\u003e \u003cp\u003eThe present investigation revealed that the NAPPs isolated from horse gram root nodules were a \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, NRE bacteria viz., \u003cem\u003eP. aeruginosa\u003c/em\u003e HGB1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, \u003cem\u003eAcinetobacter rhizosphaerae\u003c/em\u003e HGB4, \u003cem\u003eEnterobacter bugadensis\u003c/em\u003e HGB5, \u003cem\u003eKlebsiella michiganensis\u003c/em\u003e HGB6, \u003cem\u003eFlavobacterium anhuiense\u003c/em\u003e HGB7, \u003cem\u003eM. restricta\u003c/em\u003e HGY1, and HGY2, and an actinobacterium \u003cem\u003eLeucobacter aridicollis\u003c/em\u003e HGB3. Similarly, the nodule-associated bacterium \u003cem\u003ePaenibacillus taichungensis\u003c/em\u003e TNEB6 and the yeast \u003cem\u003eCandida tropicalis\u003c/em\u003e VWY1 were found and identified in root nodules of black gram (Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Raja and Uthandi, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). To the best of our knowledge, this is the first report to document the presence of yeast in horse gram root nodules and its role in promoting plant growth and drought tolerance. In the present study, NAPPs of horse gram were evaluated for their potential role in plant growth promotion by assessing the IAA and siderophore production and ACC deaminase activity. Auxins produced by plant growth-promoting microorganisms exert distinct effects on plant growth and development. Furthermore, nodule morphogenesis is regulated by auxin production stimulated by phenolic compounds, which act as signaling molecules (Ghosh et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In the present study, all NAPPs produced significant amounts of IAA. Among them, the highest IAA production was observed in the nodule partner \u003cem\u003eRhizobium\u003c/em\u003e HGR1 (39.12 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e), followed by the NRE \u003cem\u003eP. aeruginosa\u003c/em\u003e HGB1(33.19 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e) and \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2 (17.487 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e). Similarly, several reports on the nodule microbiota indicated that IAA production by nodule-associated endophytes ranged from 70 to 80 mg g\u003csup\u003e\u0026ndash;1\u003c/sup\u003e of dry cell weight (Fu et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Raja and Uthandi, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eMicrobial siderophores have a higher affinity for Fe in Fe\u003csup\u003e3+\u003c/sup\u003e-containing complexes and play a critical role in suppressing populations of plant-pathogenic microorganisms. The present study reported the production of siderophores by NAPPs, among which \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2 (93.681 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e) showed the highest siderophore production, followed by \u003cem\u003eRhizobium\u003c/em\u003e HGR1 (90.603 \u0026micro;g ml\u003csup\u003e\u0026ndash;1\u003c/sup\u003e). These results suggest that co-inoculating with these efficient siderophore-producing strains can be used as a reliable approach to overcome Fe limitation and suppress pathogen proliferation by sequestering Fe\u003csup\u003e3+\u003c/sup\u003e in the root zone (Ferreira et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The hydrolysis of ACC, a direct precursor of ethylene in plants, is a significant mechanism by which microorganisms facilitate plant growth and development (Zarei et al., \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The present study revealed that the nodule partner \u003cem\u003eRhizobium\u003c/em\u003e HGR1 exhibited a higher ACC deaminase activity (541.2 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e), followed by the endophytic bacteria \u003cem\u003eEnterobacter bugandensis\u003c/em\u003e HGB5 (473.1 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) and \u003cem\u003eM. restricta\u003c/em\u003e HGY1 (265.8 nmol α-Ketobutyrate mg protein\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e). These findings on the ACC deaminase activity are in line with those of earlier reports on the nodule-associated endophytes, such as the bacteria \u003cem\u003eP. taichungensis\u003c/em\u003e TNEB6 and \u003cem\u003eBacillus mojavensis\u003c/em\u003e PJN13 and the yeasts \u003cem\u003eCandida tropicalis\u003c/em\u003e VYW1, \u003cem\u003eHansenula saturnus\u003c/em\u003e, and \u003cem\u003eIssatchenkia occidentalis\u003c/em\u003e (Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Raja and Uthandi, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; R\u0026iacute;os-Ruiz et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Singh et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Further, these results confirmed that the plants grown in the presence of the beneficial ACC deaminase-producing microbes have longer roots and shoots and are more resistant to ethylene-induced stress (Glick, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNutrients such as phosphorus and zinc were effectively solubilized by the nodule endophytes, viz., HGR1, HGB1, HGB2, and HGY1. This solubilization efficiency was achieved by the secretion of organic acids. Organic acids produced by microorganisms, such as citric acid, oxalic acid, lactic acid, and succinic acid, lower soil pH by chelating cations bound to phosphate via their carboxyl and hydroxyl groups, thereby promoting efficient solubilization (Wei et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Application of oxalic acid along with the phosphorus-solubilizing bacteria \u003cem\u003eBacillus\u003c/em\u003e sp. PSB16 significantly influenced rhizospheric populations of aerobic rice, thereby solubilizing immobilized P via acidification, chelation, and exchange reactions (Panhwar et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The lower the acidity constant of organic acids, the higher the P solubilization (Z\u0026uacute;\u0026ntilde;iga-Silgado et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Our study showed that most of the nodule-associated strains were capable of producing organic acids with a low acidity constant, such as lactic acid, isobutyric acid, butyric acid, oxalic acid, ascorbic acid, citric acid, malic acid, malonic acid, propionic acid, and fumaric acid, which can solubilize tricalcium phosphate into soluble phosphate to facilitate plant growth. The \u003cem\u003eRhizobium sp.\u003c/em\u003e HGR1 is exceptionally capable of producing an organic acid with a high pKa, namely benzoic acid, which requires more energy to synthesize via the shikimate pathway. Conserving metabolic energy would prevent cells from secreting organic acids with high pKa values, thereby preventing solubilization. Zinc-solubilizing microbes produce various organic acids that lower pH and chelate zinc cations via acidification, and they also employ other mechanisms of solubilization, such as siderophore production, proton extrusion, and the plasma membrane redox system (Kamran et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The amounts of organic acids secreted are predicted based on the zinc sources available to the zinc-solubilizing isolates. The findings of the present study were similar to those reported for efficient zinc solubilization via the production of organic acids, namely lactic, malonic, and malic acids, by \u003cem\u003eB. aryabhattai\u003c/em\u003e, \u003cem\u003ePseudomonas taiwanensis\u003c/em\u003e, and \u003cem\u003eBacillus\u003c/em\u003e sp. PAN- TM1 (Vidyashree et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Potassium availability to crops improves root and shoot elongation and yield-related characteristics through the acidolysis mechanism employed by potassium-releasing bacteria, which release significant amounts of organic acids that break down insoluble potassium into an active biomineral form (Ahmad et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn addition to nutrient solubilization, the organic acids produced by NAPPs mitigate drought stress (Khan et al., 2020; Kleiber et al., 2024; Panchal et al., 2021). Kleiber et al. (2024) reported that organic acids treatment in lettuce enhanced drought tolerance by bolstering photosynthetic efficiency and strengthening oxidative defence mechanisms. Several organic acids, such as fumaric, malic, citric, malonic, ascorbic, and acetic acids, have been implicated in osmotic adjustments, ROS scavenging, and maintenance of membrane stability under water deficit conditions (Guo et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Rahman et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Tahjib-Ul-Arif et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Utsumi et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFurthermore, acetic acid enhances drought tolerance in plants by activating ABA biosynthesis and signaling, reducing stomatal conductance and transpiration, and mitigating ROS damage through the upregulation of key antioxidant enzymes (Rahman et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Utsumi et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Our results provide evidence that the organic acids produced by all ten NAPPs can promote plant growth by enhancing mechanisms involved in solubilization and by conferring drought-stress tolerance. Furthermore, the coexistence of NREs and \u003cem\u003eRhizobium\u003c/em\u003e had improving effects on the communication with the host plant in terms of colonization, elongation of infection threads, nodulation, nitrogen fixation, and extension of host range in legumes (Lu et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). PCA analysis proved strain-specific nutrient-solubilizing potential. Thus, the best-performing horse gram strains\u0026mdash;HGR1, HGB2, and HGY1\u0026mdash;emerge as metabolically compatible options for improving stress resilience and nutrient-use efficiency. Furthermore, the improved seed germination, vigor index, and seedling growth observed in NAPPs-biotized horse gram under induced moisture deficit stress (20% PEG 6000) exhibited the synergistic role of \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2, and \u003cem\u003eM. restricta\u003c/em\u003e HGY1 in imparting early-stage drought tolerance, consistent with reports that microbial priming boosts stress resilience and seedling vigor (Priyadharshini et al., 2023; Khatri et al., 2020).\u003c/p\u003e \u003cp\u003eTo assess the potential role of organic acid-producing NAPPs, root exudate metabolites were profiled under induced drought stress. The metabolomic study of root exudates revealed that most of the heterocyclic compounds secreted upon interaction with NAPPs, namely \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1, with \u003cem\u003ePseudomonas indoloxydans\u003c/em\u003e HGB2, \u003cem\u003eMalassezia restricta\u003c/em\u003e HGY1, and their co-inoculum (HGR1\u0026thinsp;+\u0026thinsp;HGB2\u0026thinsp;+\u0026thinsp;HGY1) under induced moisture-deficit stress, exhibits antibacterial, antifungal, and herbicidal activities (Saini et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The quinolone-based quorum-sensing system in Pseudomonas plays an essential role in the production of virulence factors. Interestingly, the Pseudomonas quinolone signal (PQS) acts as a siderophore by scavenging iron, storing it in the cell membrane, and transporting it into cells with iron deficiency (Lin et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Compounds belonging to the group of fatty acyls and prenol lipids with lipid origin are thought to be involved in signaling mechanisms of the plant-microbe and microbe-microbe interactions for effective colonization (Macabuhay et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Indole and its derivatives have been shown to regulate virulence by activating quorum-sensing molecules (QSMs) (Lee and Lee, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe accumulation of flavonoids scavenges the free radicals and promotes plant growth under water-deficient (drought) conditions. In addition, derivatives of flavanone interact with phytohormone pathways by inhibiting auxin biosynthesis, thereby promoting drought tolerance (Aslam et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Several metabolites released from seeds are associated with the tricarboxylic acid cycle, which is involved in the synthesis of sugars, amino acids, and lipids. Consistent with this, amino acids and lipids strongly influence the plant\u0026rsquo;s resistance to severe drought stress through interactions between microbes and the host plant (Wang et al., \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present study identified most pyrimidine derivatives with significant radical-scavenging activity due to the presence of electron-donating substituents on the pyrimidine nucleus. The highest antioxidant scavenging activity of this particular compound relates to the electron with the lowest density in the outermost ring of pyrimidine derivatives (Nair et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The most crucial metabolite discovered during the interaction between the \u003cem\u003eC\u003c/em\u003e. \u003cem\u003etropicalis\u003c/em\u003e VYW1 and the \u003cem\u003eRhizobium\u003c/em\u003e sp. VRE1 was a glucopyranoside. It serves a specific function as a recognition receptor, implying that its ability to bind diverse sugar structures and activate lectin during interactions with potential NAPPs has been documented (Barre et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Geetha Thanuja et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In turn, lectin acts as a glue for saccharide receptors in the interaction between root hair tips and legume nodulating bacteria. Amino acid biosynthesis and metabolism upregulate the expression of ion-uptake genes by increasing membrane permeability, adjusting osmotic potential, and maintaining homeostasis during drought. A study supported the enhancement of the amino acid synthesis pathway under drought stress, in association with nodule development, during the \u003cem\u003eRhizobium\u003c/em\u003e-legume symbiosis (Liu et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our study highlights the roles of NREs in enhancing plant growth attributes, including the production of plant growth-promoting hormones, nutrient solubilization, and drought tolerance in horse gram associated with \u003cem\u003eRhizobium\u003c/em\u003e sp., under induced moisture-deficit stress. In conclusion, the adoption of sustainable agricultural practices would be enhanced by improving bioinoculant formulations, incorporating eco-friendly metabolites that promote plant growth in extreme environments, and developing built-in resistance to phytopathogens.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe present study characterized the NAPPs of horse gram and identified strains that promote plant growth and establishment under both normal and stress conditions. These strains may contribute to lateral root formation, increased root and shoot elongation, antioxidant accumulation for scavenging free radicals, nutrient acquisition, and mitigation of drought-induced signaling imbalances through the production of organic acids. Besides, the profiling of root exudate metabolites revealed that the interaction between the \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1 and NAPPs (\u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2 and \u003cem\u003eM. restricta\u003c/em\u003e HGY1) within the nodules increased nodulation efficiency by producing signaling molecules. Additionally, they produced several metabolites that promote plant growth and enhance resilience to adverse environmental conditions. Further investigations into seed priming with co-inocula of NAPPs under greenhouse and open-field conditions may pave the way for the development of new bio-inoculants that enhance plant growth, fitness, and stress tolerance.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Ministry of Human Resource Development, Government of India, through MHRD-FAST-CoE (F. No. 5\u0026ndash;6/2013-TSVII) sanctioned to SU. Financial support from the DST-FIST Programme-2022 (TPN 83972) is also acknowledged.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSE: Data curation, Methodology, formal analysis, Writing- Original draft, SU: Conceptualization, Funding acquisition, Project administration, investigation, supervision, Writing-review and editing; NS: Data curation, formal analysis, software, validation, Writing-review and editing. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Ministry of Human Resource Development, Government of India, through MHRD-FAST-CoE (F. No. 5\u0026ndash;6/2013-TSVII) sanctioned to SU. Financial support from the DST-FIST Programme-2022 (TPN 83972) is also acknowledged.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this manuscript. The nucleotide sequence data from this study have been deposited in the NCBI GenBank database under the accession numbers ON461479 and\u0026nbsp;ON470821.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to publish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAhmad M, Nadeem SM, Naveed M, Zahir ZA. Potassium-solubilizing bacteria and their application in agriculture. In: Meena V, Maurya B, Verma J, Meena R, editors. Potassium Solubilizing Microorganisms for Sustainable Agriculture. New Delhi: Springer; 2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-81-322-2776-2_21\u003c/span\u003e\u003cspan address=\"10.1007/978-81-322-2776-2_21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAslam MM, Idris AL, Zhang Q, Weifeng X, Karanja JK, Wei Y. Rhizosphere microbiomes can regulate plant drought tolerance. Pedosphere. 2022;32(1):61\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1002-0160(21)60061-9\u003c/span\u003e\u003cspan address=\"10.1016/S1002-0160(21)60061-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarre A, Bourne Y, Van Damme EJ, Peumans WJ, Roug\u0026eacute; P. Mannose-binding plant lectins: different structural scaffolds for a common sugar-recognition process. Biochimie. 2001;83(7):645\u0026ndash;51. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0300-9084(01)01315-3\u003c/span\u003e\u003cspan address=\"10.1016/s0300-9084(01)01315-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBressani APP, Martinez SJ, Sarmento ABI, Bor\u0026eacute;m FM, Schwan RF. Organic acids produced during fermentation and sensory perception in specialty coffee using yeast starter culture. Food Res Int. 2020;128:108773. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodres.2019.108773\u003c/span\u003e\u003cspan address=\"10.1016/j.foodres.2019.108773\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLelago A, Buraka T. Determination of physico-chemical properties and agricultural potentials of soils in Tembaro District, KembataTembaro Zone, Southern Ethiopia. Eurasian J Soil Sci. 2019;8:118\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18393/ejss.533454\u003c/span\u003e\u003cspan address=\"10.18393/ejss.533454\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDefez R, Andreozzi A, Romano S, Pocsfalvi G, Fiume I, Esposito R, Angelini C, Bianco C. Bacterial IAA-delivery into \u003cem\u003eMedicago\u003c/em\u003e root nodules triggers a balanced stimulation of C and N metabolism leading to a biomass increase. Microorganisms. 2019;7(10):403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms7100403\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms7100403\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhali S, Pradhan M, Sahoo RK, Mohanty S, Pradhan C. Alleviating Cr (VI) stress in horse gram (\u003cem\u003eMacrotyloma uniflorum\u003c/em\u003e Var. Madhu) by native Cr-tolerant nodule endophytes isolated from the contaminated site of Sukinda. Environ Sci Pollut Res. 2021;28(24):31717\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-021-13009-2\u003c/span\u003e\u003cspan address=\"10.1007/s11356-021-13009-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhole A, Shelat H, Vyas R, Jhala Y, Bhange M. Endophytic occupation of legume root nodules by nifH-positive non-rhizobial bacteria, and their efficacy in the groundnut (\u003cem\u003eArachis hypogaea\u003c/em\u003e). Ann Microbiol. 2016;66(4):1397\u0026ndash;407. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13213-016-1227-1\u003c/span\u003e\u003cspan address=\"10.1007/s13213-016-1227-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEdulamudi P, Antony Masilamani AJ, Vanga UR, Divi VRSG, Konada VM. (2021) Nickel tolerance and biosorption potential of rhizobia associated with horse gram [\u003cem\u003eMacrotyloma uniflorum\u003c/em\u003e (Lam.) Verdc.]. Int J Phytoremediation 23(11):1184\u0026ndash;1190. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15226514.2021.1884182\u003c/span\u003e\u003cspan address=\"10.1080/15226514.2021.1884182\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFatnassi IC, Chiboub M, Saadani O, Jebara M, Jebara SH. Impact of dual inoculation with \u003cem\u003eRhizobium\u003c/em\u003e and PGPR on growth and antioxidant status of \u003cem\u003eVicia faba\u003c/em\u003e L. under copper stress. C R Biol. 2015;338(4):241\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.crvi.2015.02.001\u003c/span\u003e\u003cspan address=\"10.1016/j.crvi.2015.02.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira MJ, Silva H, Cunha A. Siderophore-producing rhizobacteria as a promising tool for empowering plants to cope with iron limitation in saline soils: A review. Pedosphere. 2019;29(4):409\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1002-0160(19)60810-6\u003c/span\u003e\u003cspan address=\"10.1016/S1002-0160(19)60810-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu SF, Wei JY, Chen HW, Liu YY, Lu HY, Chou JY. Indole-3-acetic acid: A widespread physiological code in interactions of fungi with other organisms. Plant Signal Behav. 2015;10(8):e1048052. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15592324.2015.1048052\u003c/span\u003e\u003cspan address=\"10.1080/15592324.2015.1048052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeetha Thanuja K, Annadurai B, Thankappan S, Uthandi S. Non-rhizobial endophytic (NRE) yeasts assist nodulation of \u003cem\u003eRhizobium\u003c/em\u003e in root nodules of blackgram (\u003cem\u003eVigna mungo\u003c/em\u003e L). Arch Microbiol. 2020;202(10):2739\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00203-020-01983-z\u003c/span\u003e\u003cspan address=\"10.1007/s00203-020-01983-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhosh PK, Kumar De T, Maiti TK. Production and metabolism of indole acetic acid in root nodules and symbiont (\u003cem\u003eRhizobium undicola\u003c/em\u003e) isolated from root nodule of aquatic medicinal legume (\u003cem\u003eNeptunia oleracea\u003c/em\u003e). J Bot. 2015;575067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2015/575067\u003c/span\u003e\u003cspan address=\"10.1155/2015/575067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlick BR. Modulation of plant ethylene levels by the bacterial enzyme ACC deaminase. FEMS Microbiol Lett. 2005;251(1):1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.femsle.2005.07.030\u003c/span\u003e\u003cspan address=\"10.1016/j.femsle.2005.07.030\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlick BR. Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol Res. 2014;169(1):30\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.micres.2013.09.009\u003c/span\u003e\u003cspan address=\"10.1016/j.micres.2013.09.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrover M, Bodhankar S, Sharma A, Sharma P, Singh J, Nain L. PGPR Mediated Alterations in Root Traits: Way Toward Sustainable Crop Production. Front Sustain Food Syst. 2021;4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fsufs.2020.618230\u003c/span\u003e\u003cspan address=\"10.3389/fsufs.2020.618230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo R, Shi L, Jiao Y, Li M, Zhong X, Gu F, Liu Q, Xia X, Li H. Metabolic responses to drought stress in the tissues of drought-tolerant and drought-sensitive wheat genotype seedlings. AoB PLANTS. 2018;10(2). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aobpla/ply016\u003c/span\u003e\u003cspan address=\"10.1093/aobpla/ply016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHe X, Zhang Q, Li B, Jin Y, Jiang L, Wu R. Network mapping of root\u0026ndash;microbe interactions in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. NPJ Biofilms Microbiomes. 2021;7(1):72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41522-021-00241-4\u003c/span\u003e\u003cspan address=\"10.1038/s41522-021-00241-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsaeva OV, Glushakova AM, Garbuz SA, Kachalkin AV, Chernov IY. Endophytic yeast fungi in plant storage tissues. Biol Bull Russ Acad Sci. 2010;37:26\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S1062359010010048\u003c/span\u003e\u003cspan address=\"10.1134/S1062359010010048\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItam M, Mega R, Tadano S, Abdelrahman M, Matsunaga S, Yamasaki Y, Akashi K, Tsujimoto H. Metabolic and physiological responses to progressive drought stress in bread wheat. Sci Rep. 2020;10(1):17189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-74303-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-74303-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJagadeesh K, Marihal AK, Sinha S. (2010) Bioremediation of pentachlorophenol (PCP)-polluted soil by plant growth-promoting rhizobacteria (PGPR). In: Maheshwari DK, editor Plant growth-promoting rhizobacteria (PGPR) for sustainable agriculture, Springer; 2011. pp. 225\u0026ndash;235.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeswani L. Advances in pulse production technology. In: Baldev B, editor. Advances in pulse production technology. Indian Council of Agricultural Research (ICAR); 1990. pp. 190\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJisha KC, Puthur JT. Seed priming with beta-amino butyric acid improves abiotic stress tolerance in rice seedlings. Rice Sci. 2016;23(5):242\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rsci.2016.08.002\u003c/span\u003e\u003cspan address=\"10.1016/j.rsci.2016.08.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamran S, Shahid I, Baig DN, Rizwan M, Malik KA, Mehnaz S. Contribution of zinc solubilizing bacteria in growth promotion and zinc content of wheat. Front Microbiol. 2017;28:2593. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2017.02593\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2017.02593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurtzman C, Robnett C. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5'end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol. 1997;35(5):1216\u0026ndash;23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/jcm.35.5.1216-1223.1997\u003c/span\u003e\u003cspan address=\"10.1128/jcm.35.5.1216-1223.1997\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee JH, Lee J. Indole as an intercellular signal in microbial communities. FEMS Microbiol Rev. 2010;34(4):426\u0026ndash;44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6976.2009.00204.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6976.2009.00204.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee K, Bai Y, Smith D, Han H, Supanjani S. Isolation of plant-growth-promoting endophytic bacteria from bean nodules. Res J Agric Biol Sci. 2005;1(3):232\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeylaie S, Zafari D. Antiproliferative and antimicrobial activities of secondary metabolites and phylogenetic study of endophytic \u003cem\u003eTrichoderma\u003c/em\u003e species from \u003cem\u003eVinca\u003c/em\u003e plants. Front Microbiol. 2018;9:1484. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2018.01484\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2018.01484\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin J, Cheng J, Wang Y, Shen X. The \u003cem\u003ePseudomonas\u003c/em\u003e Quinolone Signal (PQS): Not Just for Quorum Sensing Anymore. Front Cell Infect Microbiol. 2018;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcimb.2018.00230\u003c/span\u003e\u003cspan address=\"10.3389/fcimb.2018.00230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Guo Z, Shi H. \u003cem\u003eRhizobium\u003c/em\u003e symbiosis leads to increased drought tolerance in Chinese milk vetch (\u003cem\u003eAstragalus sinicus\u003c/em\u003e L). Agronomy. 2022;12(3):725. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agronomy12030725\u003c/span\u003e\u003cspan address=\"10.3390/agronomy12030725\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu J, Yang F, Wang S, Ma H, Liang J, Chen Y. Co-existence of rhizobia and diverse non-rhizobial bacteria in the rhizosphere and nodules of \u003cem\u003eDalbergia odorifera\u003c/em\u003e seedlings inoculated with \u003cem\u003eBradyrhizobium elkanii\u003c/em\u003e, \u003cem\u003eRhizobium multihospitium\u003c/em\u003e-like, and \u003cem\u003eBurkholderia pyrrocinia\u003c/em\u003e-like strains. Front Microbiol. 2017;8:2255\u0026ndash;2255. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2017.02255\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2017.02255\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMacabuhay A, Arsova B, Walker R, Johnson A, Watt M, Roessner U. Modulators or facilitators? Roles of lipids in plant root-microbe interactions. Trends Plant Sci. 2022;27(2):180\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2021.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2021.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Hidalgo P, Hirsch AM. The nodule microbiome: N\u003csub\u003e2\u003c/sub\u003e-fixing rhizobia do not live alone. Phytobiomes. 2017;1(2):70\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/PBIOMES-12-16-0019-RVW\u003c/span\u003e\u003cspan address=\"10.1094/PBIOMES-12-16-0019-RVW\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNair N, Majeed J, Sweety R, Thakur R. Antioxidant potential of pyrimidine derivatives against oxidative stress. Indian J Pharm Sci. 2022;84(1):14\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.36468/pharmaceutical-sciences.890\u003c/span\u003e\u003cspan address=\"10.36468/pharmaceutical-sciences.890\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNautiyal CS, Bhadauria S, Kumar P, Lal H, Mondal R, Verma D. Stress-induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol Lett. 2000;182(2):291\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6968.2000.tb08910.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6968.2000.tb08910.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaylor D, Coleman-Derr D. Drought stress and root-associated bacterial communities. Front Plant Sci. 2018;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2017.02223\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2017.02223\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanhwar QA, Jusop S, Naher UA, Othman R, Razi MI. Application of potential phosphate-solubilizing bacteria and organic acids on phosphate solubilization from phosphate rock in aerobic rice. Sci World J. 2013;272409. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2013/272409\u003c/span\u003e\u003cspan address=\"10.1155/2013/272409\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParmar P, Sindhu S. Potassium solubilization by rhizosphere bacteria: influence of nutritional and environmental conditions. J Microbiol Res. 2012;3(1):25\u0026ndash;31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5923/j.microbiology.20130301.04\u003c/span\u003e\u003cspan address=\"10.5923/j.microbiology.20130301.04\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePenrose DM, Glick BR. Methods for isolating and characterizing ACC deaminase-containing plant growth‐promoting rhizobacteria. Physiol Plant. 2003;118(1):10\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1034/j.1399-3054.2003.00086.x\u003c/span\u003e\u003cspan address=\"10.1034/j.1399-3054.2003.00086.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrakash B, Guled M, Bhosale AM. (2010) Identification of suitable horsegram varieties for northern dry zone of Karnataka. Karnataka J Agricultural Sci 21(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrasad SK, Singh MK. Horse gram-an underutilized nutraceutical pulse crop: a review. J Food Sci Tech. 2015;52(5):2489\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13197-014-1312-z\u003c/span\u003e\u003cspan address=\"10.1007/s13197-014-1312-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahman M, Mostofa MG, Keya SS, Rahman A, Das AK, Islam R, Abdelrahman M, Bhuiyan SU, Naznin T, Ansary MU. Acetic acid improves drought acclimation in soybean: an integrative response of photosynthesis, osmoregulation, mineral uptake and antioxidant defense. Physiol Plant. 2021;172(2):334\u0026ndash;50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ppl.13191\u003c/span\u003e\u003cspan address=\"10.1111/ppl.13191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaja S, Uthandi S. Non-rhizobial nodule-associated bacteria (NAB) from blackgram (\u003cem\u003eVigna mungo\u003c/em\u003e L.) and their possible role in plant growth promotion. Mad Agric J. 2019;106(1\u0026ndash;3):1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.29321/MAJ.2019.000291\u003c/span\u003e\u003cspan address=\"10.29321/MAJ.2019.000291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR\u0026iacute;os-Ruiz WF, Valdez-Nu\u0026ntilde;ez RA, Bedmar EJ, Castellano-Hinojosa A. Utilization of Endophytic Bacteria Isolated from Legume Root Nodules for Plant Growth Promotion. In: Maheshwari D, Dheeman S, editors. Field Crops: Sustainable Management by PGPR. Sustainable Development and Biodiversity. Volume 23. Cham: Springer; 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-30926-8_6\u003c/span\u003e\u003cspan address=\"10.1007/978-3-030-30926-8_6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaini MS, Kumar A, Dwivedi J, Singh R. A review: biological significances of heterocyclic compounds. Int J Pharm Sci Res. 2013;4(3):66\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamain E, Ernenwein C, Aussenac T, Selim S. Efficacy and Durability of \u003cem\u003ePaenibacillus\u003c/em\u003e sp. strain B2 in co-Inoculation with \u003cem\u003eArthrobacter\u003c/em\u003e Sp. SSM-004 and \u003cem\u003eMicrobacterium\u003c/em\u003e sp. SSM-001 for growth promotion and resistance induction in wheat against \u003cem\u003eMycosphaerella graminicola\u003c/em\u003e and drought stress. J Plant Pathol Microbiol. 2022;13:603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayyed RZ, Patel PR. (2011) Biocontrol potential of siderophore producing heavy metal resistant \u003cem\u003eAlcaligenes\u003c/em\u003e sp. and \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e RZS3 vis-\u0026agrave;-vis organophosphorus fungicide. Indian J Microbiol 51(3):266\u0026ndash;272.\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12088-011-0170-x\u003c/span\u003e\u003cspan address=\"10.1007/s12088-011-0170-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchwyn B, Neilands J. Universal chemical assay for the detection and determination of siderophores. Anal Biochem. 1987;160(1):47\u0026ndash;56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0003-2697(87)90612-9\u003c/span\u003e\u003cspan address=\"10.1016/0003-2697(87)90612-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma SKMP, Ramesh A, Joshi OP. Characterization of zinc-solubilizing \u003cem\u003eBacillus\u003c/em\u003e isolates and their potential to influence zinc assimilation in soybean seeds. J Microbiol biotechnol. 2011;22(3):352\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4014/jmb.1106.05063\u003c/span\u003e\u003cspan address=\"10.4014/jmb.1106.05063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh RP, Shelke GM, Kumar A, Jha PN. Biochemistry and genetics of ACC deaminase: a weapon to stress ethylene produced in plants. Front Microbiol. 2015;6:937. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2015.00937\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2015.00937\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmartt J. Evolution of grain legumes. II. Old and new world pulses of lesser economic importance. Exp Agric. 1985;21(1):1\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0014479700012205\u003c/span\u003e\u003cspan address=\"10.1017/S0014479700012205\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpaepen S, Vanderleyden J, Remans R. Indole-3-acetic acid in microbial and microorganism-plant signaling. FEMS Microbiol Rev. 2007;31(4):425\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1574-6976.2007.00072.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6976.2007.00072.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTahjib-Ul-Arif M, Zahan MI, Karim MM, Imran S, Hunter CT, Islam MS, Mia MA, Hannan MA, Rhaman MS, Hossain MA, Brestic M, Skalicky M, Murata Y. Citric acid-mediated abiotic stress tolerance in plants. Int J Mol Sci. 2021;22(13):7235. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22137235\u003c/span\u003e\u003cspan address=\"10.3390/ijms22137235\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrivedi P, Leach JE, Tringe SG, Sa T, Singh BK. Plant-microbiome interactions: from community assembly to plant health. Nat Rev Microbiol. 2020;18(11):607\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41579-020-0412-1\u003c/span\u003e\u003cspan address=\"10.1038/s41579-020-0412-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTschaplinski TJ, Abraham PE, Jawdy SS, Gunter LE, Martin MZ, Engle NL, Yang X, Tuskan GA. The nature of the progression of drought stress drives differential metabolomic responses in \u003cem\u003ePopulus deltoides\u003c/em\u003e. Ann Bot. 2019;124(4):617\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aob/mcz002\u003c/span\u003e\u003cspan address=\"10.1093/aob/mcz002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUl Haq F, Ali A, Khan M, Shah S, Kandel R, Aziz N, Adhikari A, Choudhary M, Rahman A-u, El-Seedi H, Musharraf S. Metabolite profiling and quantitation of cucurbitacins in cucurbitaceae plants by liquid chromatography coupled to tandem mass spectrometry. Sci Rep. 2019;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-019-52404-1\u003c/span\u003e\u003cspan address=\"10.1038/s41598-019-52404-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUtsumi Y, Utsumi C, Tanaka M, Ha CV, Takahashi S, Matsui A, Matsunaga TM, Matsunaga S, Kanno Y, Seo M, Okamoto Y, Moriya E, Seki M. Acetic acid treatment enhances drought avoidance in cassava (\u003cem\u003eManihot esculenta\u003c/em\u003e crantz). Front Plant Sci. 2019;10:521\u0026ndash;521. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2019.00521\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2019.00521\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVidyashree DN, Ramaiah M, Panneerselvam P, Mitra D. Organic acids production by zinc-solubilizing bacterial isolates. Int J Curr Microbiol Appl Sci. 2018;7:626\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.20546/ijcmas.2018.710.070\u003c/span\u003e\u003cspan address=\"10.20546/ijcmas.2018.710.070\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Li Y, Wang X, Li X, Dong S. Physiology and metabonomics reveal differences in drought resistance among soybean varieties. Bot Stud. 2022;63(1):8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40529-022-00339-8\u003c/span\u003e\u003cspan address=\"10.1186/s40529-022-00339-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWei Y, Zhao Y, Shi M, Cao Z, Lu Q, Yang T, Fan Y, Wei Z. Effect of organic acids production and bacterial community on the possible mechanism of phosphorus solubilization during composting with enriched phosphate-solubilizing bacteria inoculation. Bioresour Technol. 2018;247:190\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biortech.2017.09.092\u003c/span\u003e\u003cspan address=\"10.1016/j.biortech.2017.09.092\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Q, Fu H, Zhu B, Hussain HA, Zhang K, Tian X, Duan M, Xie X, Wang L. Potassium improves drought stress tolerance in plants by affecting root morphology, root exudates, and microbial diversity. Metabolites. 2021;11(3):131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/metabo11030131\u003c/span\u003e\u003cspan address=\"10.3390/metabo11030131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZahra K. Evaluation of maize (\u003cem\u003eZea mays\u003c/em\u003e L.) hybrids, seed germination, and seedling characters in water stress conditions. Afr J Agric Res. 2012;7:6049\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5897/AJAR12.2113\u003c/span\u003e\u003cspan address=\"10.5897/AJAR12.2113\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZarei T, Moradi A, Kazemeini SA, Akhgar A, Rahi AA. The role of ACC deaminase producing bacteria in improving sweet corn (\u003cem\u003eZea mays\u003c/em\u003e L. var \u003cem\u003esaccharata\u003c/em\u003e) productivity under limited availability of irrigation water. Sci Rep. 2020;10(1):20361. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-77305-6\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-77305-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZ\u0026uacute;\u0026ntilde;iga-Silgado D, Rivera-Leyva JC, Coleman JJ, S\u0026aacute;nchez-Reyez A, Valencia-D\u0026iacute;az S, Serrano M, de-Bashan LE, Folch-Mallol JL. Soil type affects organic acid production and phosphorus solubilization efficiency mediated by several native fungal strains from Mexico. Microorganisms. 2020;8(9):1337. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/microorganisms8091337\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms8091337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"},{"header":"Tables","content":" \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eGram staining, cell shape, and morphological characteristics of the colony (shape, size, color, edge, and elevation) of nodule-associated plant probiotics of horse gram\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIsolate name\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eShape\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eColour\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eElevation\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEdge\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eGram Staining\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGR1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eCreamy white\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eConvex\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEntire\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eBlue-Green\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eRaised\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eUndulate\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB2\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eIrregular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eGreenish Blue\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eFlat\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eIrregular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB3\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eWhitish Brown\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eRaised\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eSmooth\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003ePositive\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB4\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eWhite\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eConvex\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEntire\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB5\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003ePale Yellow\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eRaised\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEntire\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB6\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eLight Yellow\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eConvex\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEntire\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB7\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eYellow\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eRaised\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eSmooth\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003eNegative\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGY1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eIrregular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eWhite, Opaque\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eRaised\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eUndulate\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003e-\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGY2\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCircular\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eCreamy White\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eConvex\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eEntire\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cdiv class=\"SimplePara\"\u003e-\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003cbr/\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cdiv class=\"SimplePara\"\u003eSeed biotization of NAPPs induced Germination and vigour index of horse gram under moisture-deficient (20% PEG 6000) conditions.\u003c/div\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eNAPPs\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eGermination %\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003eRoot length\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003eShoot length\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003eVigor Index\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eControl\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e54\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e(20.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.403)\u003csup\u003ed\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e(20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.213)\u003csup\u003ed\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e2230\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGR1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e88\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e(24.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.125)\u003csup\u003eb\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e(23.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41)\u003csup\u003eb\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e4224\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGB2\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e84\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e(22.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0.143)\u003csup\u003ec\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e(22.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08)\u003csup\u003ec\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e3780\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eHGY1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e86\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e(24.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.088)\u003csup\u003eb\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e(23.6\u0026thinsp;\u0026plusmn;\u0026thinsp;0.111)\u003csup\u003eb\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e4110\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCo-inoculum\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e90\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cdiv class=\"SimplePara\"\u003e(28.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.0.570)\u003csup\u003ea\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cdiv class=\"SimplePara\"\u003e(27.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.057)\u003csup\u003ea\u003c/sup\u003e\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cdiv class=\"SimplePara\"\u003e5058\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e\u003cp\u003eControl \u0026ndash; Absolute control treatment without any inoculants; HGR1-\u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1; HGB2- \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2; HGY1- \u003cem\u003eM. restricta\u003c/em\u003e HGY1; Consortium-HGR1+HGB2+HGY1. Values are mean \u0026plusmn; (standard error) (n=5) and values with the same letter in each column differ substantially on the observation day, as indicated by DMRT (p \u0026le; 0.05).\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ACC deaminase, Drought, Horse gram, IAA, Nodule-associated plant probiotics (NAPPs), Root nodules, Solubilization","lastPublishedDoi":"10.21203/rs.3.rs-8621449/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8621449/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNodule-associated plant probiotics (NAPPs) are a representative group of plant growth-promoting microorganisms that establish a mutualistic relationship with leguminous plants. The present study aimed to unravel the NAPPs of horse gram and to evaluate its potential plant growth attributes. A total of ten NAPPs were isolated and identified, which belonged to bacterial strains such as \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e HGB1, \u003cem\u003ePseudomonas indoloxydans\u003c/em\u003e HGB2, \u003cem\u003eAcinetobacter rhizosphaerae\u003c/em\u003e HGB4, \u003cem\u003eEnterobacter bugandensis\u003c/em\u003e HGB5, \u003cem\u003eKlebsiella michiganensis\u003c/em\u003e HGB6, and \u003cem\u003eFlavobacterium anhuiense\u003c/em\u003e HGB7, and yeast strains such as \u003cem\u003eMalassezia restricta\u003c/em\u003e HGY1 and HGY2, and actinobacteria (\u003cem\u003eLeucobacter aridicollis\u003c/em\u003e HGB3), along with \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1. The highest levels of indole acetic acid (IAA) (39.12 µg ml\u003csup\u003e–1\u003c/sup\u003e), ACC deaminase (541.2 nmol α-Ketobutyrate mg protein\u003csup\u003e− 1\u003c/sup\u003e h\u003csup\u003e− 1\u003c/sup\u003e), siderophores (93.681 µg ml\u003csup\u003e–1\u003c/sup\u003e), phosphorus solubilization, and potassium availability were positively correlated with the isolates HGR1, HGB1, HGB2, HGY1, and HGB5. Zinc solubilization was strongly correlated with HGR1, HGY1, and HGB1. Organic acid profiling of the strains revealed their potential to enhance nutrient solubilization and drought tolerance. \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1 and the potential nodule-associated non-rhizobial endophytes (NREs), namely \u003cem\u003eP. indoloxydans\u003c/em\u003e HGB2 and \u003cem\u003eM. restricta\u003c/em\u003e HGY1, were selected for their performance and non-pathogenicity. Furthermore, the interaction between \u003cem\u003eRhizobium\u003c/em\u003e sp. HGR1 and multi-trait NAPPs, HGB2 and HGY1, were evaluated under 20% PEG-induced moisture-deficit stress by root exudate profiling. Metabolite profiling revealed 28 bioactive metabolites, including steroids and their derivatives, saturated hydrocarbons, quinolones and their derivatives, pyridines and their derivatives, among others. Thus, this study highlights the significant potential of NAPPs to enhance plant growth, improve drought-stress resilience, and modulate signalling pathways, thereby contributing to the sustainable production of horse gram.\u003c/p\u003e","manuscriptTitle":"Root Nodule-associated Plant Probiotics Modulate Growth and Drought Stress Responses in Horse Gram Macrotyloma uniflorum (Lam.)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-23 08:04:33","doi":"10.21203/rs.3.rs-8621449/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-23T10:44:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-23T06:29:55+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-19T08:54:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"16566378564418773074935023070840324063","date":"2026-02-27T07:18:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"282392367025865107860064385130232012806","date":"2026-02-06T01:22:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"43322088245709057689416572723985449814","date":"2026-01-22T07:05:38+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-21T14:44:36+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-01-20T12:17:42+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-20T09:25:48+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-20T09:23:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2026-01-16T17:49:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fcdc3106-7470-4baf-b5c3-653052251b1b","owner":[],"postedDate":"January 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T10:55:23+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-23 08:04:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8621449","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8621449","identity":"rs-8621449","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.