Mineralocorticoid Receptor/Rac1-Driven Podocyte Injury in Fabry Disease: Finerenone and Spironolactone migitate the overactive signaling cascade

preprint OA: closed
Full text JSON View at publisher
AI-generated deep summary by claude@2026-07, 2026-07-06 · read from full text

This preprint studied whether mineralocorticoid receptor (MR)/Rac1/SGK1 signaling drives podocyte injury in a human in vitro Fabry disease model created by shRNA-mediated knockdown of GLA in podocytes, and it tested MR antagonists (finerenone, spironolactone) and Rac1 inhibition (NSC23766). Compared with wild-type podocytes, GLA-deficient Fabry podocytes showed increased expression of MR, aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, Cdc42, and IL-6 (with downregulated RhoA) and increased Rac1 protein, while finerenone or spironolactone reduced key components of the MR/Rac1 axis and increased RhoA transcription; Rac1 inhibition produced similar normalization. The paper’s main limitation is that the work is an in vitro cell model in a preprint that is not peer reviewed, with no in vivo or clinical validation. Relevance to endometriosis: the paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Podocyte injury is a key driver of Fabry nephropathy (FN), precipitating proteinuria and renal decline. Although mechanisms remain partially elucidated, dysregulated pathways involving mineralocorticoid receptor (MR) activation and Rac1-SGK1 signaling are implicated. This study investigates the role of MR/Rac1/SGK1 signaling and evaluates the nephroprotective potential of MR antagonists (finerenone, spironolactone) and Rac1 inhibition in FN.An in vitro FD model was established via stable shRNA-mediated knockdown of GLA in a human podocyte cell line. The model was confirmed by a significant reduction in both GLA mRNA (RT-qPCR) and α-galactosidaseA protein (Western blot). Experimental groups included wild-type (WT) and GLA-deficient podocytes, subsequently treated with finerenone, spironolactone, or the Rac1 inhibitor, NSC23766. CCK-8 assays determined non-cytotoxic concentrations as10 nM finerenone, 25 µM spironolactone, and 50 µM NSC23766. The mRNA levels of MR, aldosterone, cortisol, Rac1, SGK1, 11β-HSD1, NOX5, IL-6, RhoA, Cdc42 and Rac1 protein levels were analyzed before and after treatment with finerenone, spironolactone, or NSC23766.Compared to WT, Fabry podocytes exhibited significant upregulation in gene expression for MR, aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, Cdc42, and IL-6, alongside downregulated RhoA. Consistent with these findings, Rac1 protein levels were also elevated. Treatment with finerenone or spironolactone markedly reduced gene expression of Rac1, SGK1, NOX5, 11β-HSD1, IL-6, Cdc42, and MR, decreased Rac1 protein, and increased RhoA transcription. Pharmacological Rac1 inhibition recapitulated these effects.Hyperactive MR-Rac1-SGK1 signaling might be a pivotal driver of podocyte injury in FN. Both MR antagonists and Rac1 inhibition normalize the dysregulation and restore RhoA, suggesting cytoskeletal stabilization. Finerenone, spironolactone, and Rac1 inhibition represent promising adjunct therapies in FN.
Full text 104,292 characters · extracted from preprint-html · click to expand
Mineralocorticoid Receptor/Rac1-Driven Podocyte Injury in Fabry Disease: Finerenone and Spironolactone migitate the overactive signaling cascade | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mineralocorticoid Receptor/Rac1-Driven Podocyte Injury in Fabry Disease: Finerenone and Spironolactone migitate the overactive signaling cascade Kultigin Turkmen, Sedef Akcaalan, Canan Eroglu Gunes, Ercan Kurar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7674021/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Podocyte injury is a key driver of Fabry nephropathy (FN), precipitating proteinuria and renal decline. Although mechanisms remain partially elucidated, dysregulated pathways involving mineralocorticoid receptor (MR) activation and Rac1-SGK1 signaling are implicated. This study investigates the role of MR/Rac1/SGK1 signaling and evaluates the nephroprotective potential of MR antagonists (finerenone, spironolactone) and Rac1 inhibition in FN. An in vitro FD model was established via stable shRNA-mediated knockdown of GLA in a human podocyte cell line. The model was confirmed by a significant reduction in both GLA mRNA (RT-qPCR) and α-galactosidaseA protein (Western blot). Experimental groups included wild-type (WT) and GLA-deficient podocytes, subsequently treated with finerenone, spironolactone, or the Rac1 inhibitor, NSC23766. CCK-8 assays determined non-cytotoxic concentrations as10 nM finerenone, 25 µM spironolactone, and 50 µM NSC23766. The mRNA levels of MR, aldosterone, cortisol, Rac1, SGK1, 11β-HSD1, NOX5, IL-6, RhoA, Cdc42 and Rac1 protein levels were analyzed before and after treatment with finerenone, spironolactone, or NSC23766. Compared to WT, Fabry podocytes exhibited significant upregulation in gene expression for MR, aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, Cdc42, and IL-6, alongside downregulated RhoA. Consistent with these findings, Rac1 protein levels were also elevated. Treatment with finerenone or spironolactone markedly reduced gene expression of Rac1, SGK1, NOX5, 11β-HSD1, IL-6, Cdc42, and MR, decreased Rac1 protein, and increased RhoA transcription. Pharmacological Rac1 inhibition recapitulated these effects. Hyperactive MR-Rac1-SGK1 signaling might be a pivotal driver of podocyte injury in FN. Both MR antagonists and Rac1 inhibition normalize the dysregulation and restore RhoA, suggesting cytoskeletal stabilization. Finerenone, spironolactone, and Rac1 inhibition represent promising adjunct therapies in FN. Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Molecular biology Health sciences/Nephrology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Fabry disease (FD) stems from GLA gene mutations, causing α-galactosidase A deficiency and subsequent globotriacylceramide (Gb3) accumulation in organs like the kidneys [1]. Podocyte injury is a critical driver of Fabry nephropathy (FN), leading to proteinuria, glomerulosclerosis, and progressive renal decline [2] which enzyme replacement therapy (ERT) often fails to fully halt [3,4]. As terminally differentiated cells, podocytes are essential for maintaining the glomerular filtration barrier, and their apoptosis is a key event in proteinuric kidney diseases including diabetic kidney disease (DKD) [5]. The mineralocorticoid receptor (MR/NR3C2) expression has been demonstrated in cultured human podocytes, mesangial cells, and fibroblasts. Excessive MR expression was found as a key mediator of renal injury via promoting inflammation, fibrosis, and oxidative stress [6]. Additionally, 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme expressed in kidney tissues including podocytes that converts inactive cortisone into its active form, cortisol. Increased expression of 11β-HSD1 may lead to excessive cortisol activation, potentially exacerbating podocyte injury [6]. Rac1 (Ras-related C3 botulinum toxin substrate 1), a small GTPase, plays a crucial role in maintaining cytoskeletal dynamics and podocyte structural integrity in podocyte health and diseases [7]. Activation of Rac1 and related pathways including cell division protein 42 (Cdc42), serine/threonine kinase 1 (SGK1) via increased podocyte motility have been shown in proteinuric and diabetic kidney diseases [8]. Dysregulation of the Rac1-Cdc42-SGK1 pathways contribute to cytoskeletal disorganization, increased oxidative stress, and heightened susceptibility to podocyte damage [8,9]. NADPH oxidase 5 (NOX 5) enzyme is encoded in humans that is also closely related podocyte injury by increasing oxidative stress [10]. Spironolactone, steroidal MR antagonist and finerenone, a non-steroidal MR antagonist, have both shown promise as a therapeutic agent in renal diseases by modulating inflammatory and fibrotic processes [11]. Finerenone also confers nephroprotection in DKD by ameliorating podocyte injury through multi-targeted inhibition of MR-dependent signaling pathways [12]. Based on this background, this study aimed to investigate the involvement of the MR-Rac1-SGK1 pathway, the oxidative stress and inflammation markers in human Fabry podocytes. Furthermore, we evaluated the effects of spironolactone, finerenone, and direct Rac1 inhibition on this signaling axis. 2. Materials and Methods 2.1. Cell Culture and Conditions The human podocyte cells were purchased from Celprogen and cultured following manufacturer’s instructions. Podocytes were maintained and proliferated in a 37°C, 5% CO2, 95% humidified incubator. Podocytes were grown and maintained in Human Podocyte Cell Culture Complete Media with Serum (Celprogen). Media were renewed every 2–3 days and cells were subcultured at 60–70% confluency, at a 1:2 cell density. 2.2. Fabry Disease Model Establishment A cell model of Fabry disease was created using shRNA targeting the α-Gal A mRNA sequence, delivered to cells using lentiviral vector. V2LHS_82973 (Antisense: ATAAAGAGGCCACTCACAG) and V2LHS_82975 (Antisense: TATCATAGCTACAGCCCAG) were obtained as distinct viral stocks of GIPZ lentiviral particles. (Dharmacon, UK). The efficiency of cell transduction in this study was first assessed using GIPZ non-silencing control viral particles. Following this, podocyte cells were transduced in line with the manufacturer’s protocol. Cells were plated in 24-well plates at a density of 5×10⁴ cells per well and maintained at 37°C with 5% CO₂ for 24 h. After incubation, the medium was replaced with 225 µL of serum-free medium containing 25 µL of viral particles pre-diluted at a ratio of 1:25. The cells were then exposed to this mixture for 4 h at 37°C in a CO₂ incubator, after which 1 mL of complete medium was added. To remove non-transduced cells, puromycin selection was carried out by treating the cultures with puromycin-containing medium (5 µg/mL). The selective medium was refreshed every 2–3 days over a period of 10–14 days until stable populations of transduced cells were established. A Fabry disease podocyte model was established by supressing GLA gene expression using shRNA in a commercially purchased human podocyte cell line. The control group (wild type, -wt controls) and GLA-suppressed cells (Fabry podocytes as sh-controls) were used for subsequent experiments. 2.3. Drug Treatments To determine the highest non-toxic concentrations of finerenone and spironolactone, a CCK8 assay was conducted. Briefly, podocyte cells were seeded into 96-well plates and incubated at 37°C in a CO₂ incubator for 24 h. The medium was then replaced with fresh medium containing different concentrations of finerenone or spironolactone, while control wells received only medium. After 48 h of incubation, CCK8 solution was added to each well and incubated for an additional 4 h, followed by measurement of absorbance at 450 nm using a spectrophotometer. Cell viability was compared with that of the control group, and the percentage of viable cells was calculated using the following formula: % Cell Viability = (Sample optical density value) / (Control optical density value) × 100. Based on the assay results, 25 nM spironolactone and 10 nM finerenone was selected for treatment. Additionally, 50 µM of the Rac1 inhibitor (NSC23766) was chosen based on literature data and applied to experimental groups. 2.4. Real-time quantitative PCR (RT-qPCR) analysis Podocyte cells were grown in 6-well plates, and total RNA was isolated using the RiboEx reagent (GeneAll) according to the manufacturer’s guidelines. To remove residual genomic DNA, RNA samples were treated with DNase I (Thermo Scientific) and subsequently converted into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). RT-qPCR was then conducted on the Bio-Rad CFX platform with SYBR Green detection. Each reaction contained cDNA templates along with gene-specific primers (Table 1). Briefly, The RT-qPCR reactions were prepared to a final concentration of 1X, containing 5X SYBR Green mix, 12.5 pmol forward primer, 12.5 pmol reverse primer, 2 µL of cDNA template, and nuclease-free RNase/DNase-free water to a final volume of 10 µL. The thermal cycling conditions consisted of an initial denaturation step at 95°C for 15 min, followed by 40 cycles of amplification (95°C for 15 s, 60°C for 20 s, and 72°C for 20 s). Subsequently, a melt curve analysis was conducted by gradually increasing the temperature from 60°C to 95°C at a rate of 0.5°C/s with continuous fluorescence detection. The Ct values obtained from qPCR were recorded, and target gene expression levels were normalized against the reference genes ACTB, CYCA, and 18S rRNA. Gene Forward primer (5'→3') Reverse primer (5'→3') Length (bp) References GLA GCAACCTTGACTGCCAGGAAGA CTCATAACCTGCATCCTTCCAGC 231/108 This study RAC1 CCTTGTGAGTCCTGCATCAT CACTAGGATGATGGGAGTGTTG 91 This study RhoA TCTGTCCCAACGTGCCCATCAT CTGCCTTCTTCAGGTTTCACCG 118/257 This study Cdc42 TGACAGATTACGACCGCTGAGTT GGAGTCTTTGGACAGTGGTGAG 135 This study SGK1 GCTGAAATAGCCAGTGCCTTGG GTTCTCCTTGCAGAGTCCGAAG 132 This study MR AAATCACACGGCGACCTGTCGT ATGGCATCCTGAAGCCTCATCC 162 This study MAPK14 GAGCGTTACCAGAACCTGTCTC AGTAACCGCAGTTCTCTGTAGGT 161 This study 11β-HSD1 GTTACGTGGTCCTGACTGTAGC GCAGCAACCATTGGATAAGCCAC 109 This study NOX5 CCACCATTGCTCGCTATGAGTG GCCTTGAAGGACTCATACAGCC 127 This study IL6 CTATGCTGCCTGCTCTTACTG GGGAAGTGGGTGCAGTTATT 83 This study CYP11B1 GGTGCTGAAACACCTCCA GAACATGCTGGGCCTCAATA 85 This study CYP11B2 GCACCTGCACCTGGAGATG CACACACCATGCGTGGTCC 86 [13] ACTB AGCACGGCATCGTCACCAACT TGGCTGGGGTGTTGAAGGTCT 179 [14] CYCA TATCTGCACTGCCAAGACTGAGTG CTTCTTGCTGGTCTTGCCATTCC 126 [15] 18SrRNA ACGGACCAGAGCGAAAGCAT TGTCAATCCTGTCCGTGTCC 310 This study 2.5. Western Blotting Cells were lysed in RIPA buffer (VWR, USA) containing protease inhibitors (Thermo Scientific), and the resulting lysates were centrifuged at 14,000 × g for 15 min at 4°C. Protein concentrations were quantified using the Bradford assay with BSA standards. A total of 50 µg of protein per sample was separated by SDS-PAGE and transferred onto PVDF membranes (Millipore) using the Trans-Blot® Turbo™ transfer system (Bio-Rad). The membranes were blocked with 3% skim milk for 1 h, then incubated overnight at 4°C with the respective primary antibodies, followed by incubation with HRP-conjugated secondary antibodies for 2 h at room temperature. Detection was performed using an ECL substrate (Boster AR1170), and protein bands were visualized on an Azure C280 imaging system. The primary antibodies used included anti-GLA (1:1000 Elabscience Bionovation Inc; Cat# -AB-6701 and anti-GAPDH (Santa Cruz Biotechnology; Cat# sc-25778, 1:1000), while goat anti-rabbit IgG (Santa Cruz Biotechnology; Cat# sc-2054, 1:5000) was employed as the secondary antibody. 2.6. Rac1 Enzyme-Linked Immunosorbent Assay (ELISA) Rac1 levels in podocyte cells were measured using a Rac1 ELISA kit. After lysis of ~ 10⁶ cells, 40 µL of supernatant was added to each well, followed by antibody and streptavidin-HRP incubation at 37°C for 60 min. After washing, substrate solutions A and B were added, incubated for 10 min in the dark, and the reaction was stopped. Absorbance was recorded at 450 nm. 2.7. Statistical Analysis qPCR expression data were normalized to housekeeping gene levels, and gene expression was analyzed using the 2 (−ΔCT) method. Statistical comparisons between groups were performed using the “One-way ANOVA” multiple comparison test in GraphPad® Prism version 9.3.0. A p-value of < 0.05 was considered statistically significant for all analyses. 3. Results Suppression of GLA mRNA and protein was confirmed by RT-qPCR and Western blot, respectively (Fig. 1 ). shRNA treatment significantly reduced GLA mRNA expression: 5.01-fold with sh1, 16.90-fold with sh2, and 8.37-fold with sh1 + sh2, compared to the negative control. The difference between sh2 and sh1 + sh2 was not statistically significant (p = 0.09). Western blot analysis confirmed a corresponding reduction in GLA protein levels, with the most pronounced silencing observed in the sh2 group. Consequently, the sh2-silenced group, designated GLA (-), was selected for all subsequent experiments. The cytotoxic effects of different concentrations of spironolactone and finerenone on podocyte cell viability were evaluated at 48th hour using the CCK8 cell viability assay. Based on the assay results, the highest non-toxic concentrations 25 nM spironolactone and 10 nM finerenone was selected for treatment (Figure. 2). Gene expression analysis revealed significant upregulation of MR (NR3C2), aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, MAPK14, Cdc42, and IL-6 in Fabry podocytes compared to wild-type (WT) controls (Figs. 3 – 5 ). Treatment with spironolactone or finerenone significantly reduced the expression of these genes. The Rac1 inhibitor NSC23766 produced similar but less pronounced reductions (Figs. 3 – 5 ). In contrast, RhoA expression was unchanged in Fabry podocytes. Notably, finerenone and NSC23766 increased RhoA expression, whereas spironolactone had no effect (Figs. 3 – 5 ). Elevated Rac1 protein levels were detected in the supernatant of Fabry podocytes compared to wt podocytes in ELISA (Fig. 6 ). Finerenone and NSC23766 treatment led to a significant decrease in Rac1 protein levels. Sprinolactone treatment also reduced Rac1 protein levels but to a lesser extent than finerenone and Rac 1 inhibitor (Fig. 6 ). 4. Discussion This study elucidates novel molecular mechanisms driving podocyte injury in Fabry nephropathy. The principal findings of our study are as follows; i) Fabry podocytes exhibit significantly increased gene expression of MR, aldosterone, cortisol and 11β-HSD1 compared to normal podocytes. ii) Gene expression of key intracellular effectors regulating podocyte integrity including Rac1, SGK1, CDC42, and MAPK14 were also upregulated and RHOA gene expression is downregulated in Fabry podocytes. iii) Furthermore, Rac1 protein levels, the oxidative stress marker NOX5 and inflammation marker IL-6 gene expression were also elevated. iv) Additionaly, these pathological alterations were effectively reversed by treatment with the non-steroidal mineralocorticoid receptor blocker finerenone, steroidal MR blocker sprinolactone and the Rac1 inhibitor, NSC23766. Increased MR levels render podocytes hyper-responsive to mineralocorticoids. This pathological alteration is similarly observed in podocytes of DKD patients and contributes to their heightened susceptibility to podocyte injury [13]. Previous studies also indicated that elevated MR levels in podocytes may increase susceptibility to injury in various disorders [14,15]. To our knowledge, our study provides the first report in the literature of elevated MR levels in Fabry podocytes, a finding analogous to that seen in patients with DKD. Consequently, this mechanism may underlie the inability of ERT to completely reverse podocyte loss in FD. Additionally, we demonstrated that both the steroidal MRA spironolactone and the non-steroidal MRA finerenone reduced MR gene expression levels, supporting our hypothesis regarding their potential therapeutic benefit in podocytopathy in FD. In this context, we sought to investigate MR-associated signaling pathways and further demonstrated that 11β-HSD1, aldosterone and cortisol gene expression levels are significantly elevated in Fabry podocytes compared to healthy podocytes. The podocytopathic effects of these molecules and enzyme are also similar in DM, obesity and metabolic syndrome [16,17,14]. Our novel data regarding upregulated gene expressions in Fabry podocytes collectively reflect mineralocorticoid pathway activation, driven by MR overactivity and heightened synthesis of aldosterone and physiologically active cortisol. This suggests that chronically hyperactivated MR signaling specifically within Fabry podocytes may represent a therapeutic target for MR antagonists. To test this hypothesis, we treated Fabry podocytes with both spironolactone and finerenone and demonstrated a reduction in the gene expression levels of active cortisol and aldosterone. To further elucidate the intracellular effects of MR signaling on podocyte integrity, we focused on investigating the Rac1-SGK1 pathway alongside Cdc42, MAPK14 (p38α), and RhoA signaling in Fabry podocytopathy. In general, Rho GTPases such as Rac1, Cdc42, RhoA and their downstream effectors including SGK1 and p38 MAPK are critical regulators of the podocyte actin cytoskeleton, slit diaphragm integrity, survival, and motility [18]. Dysregulation of these pathways is a hallmark feature across many podocytopathies [19,18,20]. Given their high degree of interconnectivity, these pathways are frequently dysregulated concurrently or sequentially. This observation is particularly relevant given previous works demonstrating that Rac1 is a key mediator of high-salt diet-induced MR activation and hypertension in Dahl-S rats [20], podocytopathy in nephrotic syndrome [21] and DKD [22]. Consequently, MR signaling—which modulates key downstream effectors such as Rac1, SGK1, and Cdc42—represents a critical regulatory node in these diseases, making it a rational therapeutic target. Although MR-Rac1-SGK1 axis dysregulation is well-characterized in diabetes and DKD, its role in FD-associated podocytopathy remains unknown. To investigate this relationship, we analyzed Fabry podocytes and demonstrated significant upregulation of Rac1 and SGK1 gene expression, along with increased Rac1 protein levels, compared to healthy controls. Importantly, both spironolactone and finerenone treatment reduced Rac1 and SGK1 gene expression, supporting our hypothesis. To determine whether Rac1 serves as the key regulator in this pathway, we treated Fabry podocytes with the specific Rac1 inhibitor NSC23766. This intervention dramatically decreased gene expression of MR, Rac1, SGK1, cortisol, aldosterone, and 11β-HSD1, along with substantially reduced Rac1 protein levels. These findings strongly implicate MR and Rac1-dependent pathways in the pathogenesis of FD-related podocytopathy. Ras homolog family member A (RhoA) is another member of the small GTPase protein family. Its principal function centers on regulating cytoskeletal organization through binding to diverse effector proteins, thereby controlling critical cellular processes [23]. In this regard, RhoA signaling acts as a crucial restraint on podocyte motility, promoting actin cytoskeletal stability and the formation of focal adhesion complexes to anchor these cells within the glomerular basement membrane and prevent deleterious detachment [24]. Excessive or dysregulated RhoA activity, however, is potently detrimental to podocyte viability, directly inducing actin stress fiber overassembly, cellular contraction, and ultimately apoptosis [25]. In DKD, hyperglycemia and TGF-β drive pathological RhoA activation, leading to cytoskeletal collapse, loss of slit diaphragm integrity, increased motility associated with detachment, and apoptosis, key events in proteinuria development. A previous study has demonstrated that RhoA activation exacerbates DKD progression and suppression of the RhoA/ROCK pathway confers protection against glomerular inflammation and fibrosis in diabetic models, as evidenced by Hirose et al. [26]. Collectively, these observations implicate RhoA in DKD-associated podocyte dysfunction and novel treatments targeting RhoA might be beneficial in diabetic podocytopathy. In alignment with these findings, we demonstrated that RhoA gene expression is similar in Fabry podocytes compared to healthy podocytes. In contrast, both finerenone and spironolactone along with NSC23766 increased the RhoA gene expression in Fabry podocytes. To date, there is no data regarding the effects of spironolactone and finereone on RhoA pathway. Our study is the first to demonstrate finerenone stabilizes RhoaA activity to prevent foot process effacement and glomerular barrier dysfunction. These results may reflect compensatory stabilization of the actin cytoskeleton against Rac1-driven hypermotility. Alternatively, RhoA upregulation could be activated via SGK1 (shown in Fig. 7 ) by other factors rather than Rac1 and these effects might signify maladaptive stress responses. NOX5, a calcium-sensitive NADPH oxidase in human podocytes, is a significant source of pathological reactive oxygen species (ROS). Excessive NOX5-derived ROS directly damages podocytes, disrupts slit diaphragm integrity, and activates pro-inflammatory and pro-fibrotic pathways [27]. This axis is critically involved in diabetic kidney disease (DKD) [28] and angiotensin II-driven injury, where hyperglycemia and AT-2 synergistically upregulate both SGK1 and NOX5, creating a vicious cycle of oxidative stress and podocyte apoptosis [29]. SGK1 and NOX5 are mechanistically linked contributors to podocyte injury in various podocytopathies [30,31]. SGK1 induces podocyte apoptosis and cytoskeletal destabilization by upregulating TRPC6-mediated calcium influx and downregulating nephrin expression in various disorders [30,32]. SGK1 also drives oxidative stress in podocytes by upregulating NOX isoforms [32]. Previously, the pathological involvement of SGK1 in diabetes and its associated complications is well-established. Additionally, functioning as a critical intracellular regulator of nutrient metabolism, SGK1 dysregulation may contribute significantly to the pathogenesis and progression of obesity, insulin resistance, diabetes, and subsequent renal complications [30]. Supporting this mechanistic link, a recent clinical investigation in individuals with type 2 diabetes demonstrated a direct correlation between elevated levels of phosphorylated SGK1 which is an indicative of its activated state and increased circulating glucose concentrations as well as higher glycated hemoglobin A1 levels [30]. These mechanisms are implicated in diabetes and DKD however these has been not identified in Fabry disease. For the first time in the literature, our study explored the role of SGK1 in Fabry podocytes and showed that the gene expression of SGK1 is increased when compared with healthy podocytes. This increased gene expression is reversed by finerenone, spironolactone and NSC23766. These results clearly highlights that MR and Rac1 blockage might be beneficial in FD. Podocyte injury is also mediated by MAPK pathways, particularly MAPK14 (p38), whose activation is an early event in experimental nephropathy. Pharmacological inhibition of p38 attenuates proteinuria [33]. With the background mentioned above, MR activation upregulates the GTPase Rac1, which drives NADPH oxidase-mediated ROS production and inflammation, leading to podocyte dysfunction. Finerenone effectively suppresses Rac1 activity, attenuating oxidative stress and cytokine release. A harmful signaling loop exists between MR and Rac1; salt loading triggers MR overactivation, which upregulates Rac1, stimulating NOX enzymes and causing oxidative stress that leads to podocyte damage, tubular inflammation, and capillary destruction. Blocking this pathway with finerenone or a Rac1 inhibitor significantly reduces albuminuria and structural damage in models, confirming their interconnected roles as therapeutic targets [34]. In our study, as seen in SGK1, the gene expression of NOX5, MAPK14 and IL-6 are found to be increased in Fabry podocytes and reversed by finerenone, spironolactone and NSC23766. According to these results, limiting MR-driven ROS generation and inflammatory and oxidative podocyte damage might be reversed with MR antagonists. These mechanistic insights are clinically validated in diabetic kidney disease via the FIDELIO-DKD and FIGARO-DKD trials, which demonstrate finerenone’s efficacy in reducing albuminuria and attenuating kidney function decline [35]. Our study has certain limitations, most notably the absence of in vivo validation and functional assays, such as podocyte motility experiments. To address these gaps, future research should focus on (i) evaluating the therapeutic effects of finerenone and NSC23766 in Fabry disease animal models, (ii) elucidating the mechanistic link between Gb3 accumulation and the activation of the mineralocorticoid receptor (MR) and Rac1 signaling pathways, and (iii) investigating potential synergistic treatment strategies that combine ERT for Gb3 clearance with targeted inhibition of MR signaling to enhance therapeutic efficacy. These directions will provide deeper insights into disease mechanisms and improve treatment outcomes for Fabry disease. Our study establishes a critical link between aberrant MR/Rac1 signaling and SGK1, NOX, MAPK14, IL-6, RhoA and Ccd42 in Fabry disease-associated podocyte injury. We demonstrate that increased MR-Rac1 signaling, leading to cytoskeletal destabilization and impaired podocyte function, while pharmacological inhibition with finerenone, spironolactone and NSC23766 (Rac1 inhibitor) effectively restores podocyte integrity in vitro . These findings position MR/Rac1 signaling as a novel therapeutic target beyond substrate reduction therapies. This dual-pathway strategy—targeting both upstream Gb3 deposition with ERT and downstream signaling with MR antagonists—may offer synergistic protection against progressive Fabry nephropathy, addressing an unmet clinical need in disease management. Declarations Authors‘contributions: KT, EK and CGE designed the study. CGE and SA did the experiments and statistical analyses. All the authors read and approved the manuscript. Conflict of interest statement: None of the authors have conflict of interest. Funding: This Project is supported by Scientific Research Projects Coordination Unit (BAP) of Necmettin Erbakan University (Project No:23PEDAP18001). Author Contribution KT, EK and CGE designed the study. CGE and SA did the experiments and statistical analyses. All the authors read and approved the manuscript. Data Availability The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. References Turkmen K, Guclu A, Sahin G, Kocyigit I, Demirtas L, Erdur FM, Sengul E, Ozkan O, Emre H, Turgut F, Unal H, Karaman M, Acikel C, Esen H, Balli E, Bitirgen G, Tonbul HZ, Yilmaz MI, Ortiz A (2016) The Prevalence of Fabry Disease in Patients with Chronic Kidney Disease in Turkey: The TURKFAB Study. Kidney Blood Press Res 41 (6):1016-1024. doi:10.1159/000452605 Turkmen K, Baloglu I (2020) Fabry disease: where are we now? Int Urol Nephrol 52 (11):2113-2122. doi:10.1007/s11255-020-02546-3 Turkmen K, Karaselek MA, Celik SC, Esen HH, Ozer H, Baloglu I, Ozturk Y, Guner SN, Reisli I, Keles S (2023) Could immune cells be associated with nephropathy in Fabry disease patients? Int Urol Nephrol 55 (6):1575-1588. doi:10.1007/s11255-023-03468-6 El Dib R, Gomaa H, Carvalho RP, Camargo SE, Bazan R, Barretti P, Barreto FC (2016) Enzyme replacement therapy for Anderson-Fabry disease. Cochrane Database Syst Rev 7 (7):CD006663. doi:10.1002/14651858.CD006663.pub4 Sever S, Schiffer M (2018) Actin dynamics at focal adhesions: a common endpoint and putative therapeutic target for proteinuric kidney diseases. Kidney Int 93 (6):1298-1307. doi:10.1016/j.kint.2017.12.028 Bauersachs J, Jaisser F, Toto R (2015) Mineralocorticoid receptor activation and mineralocorticoid receptor antagonist treatment in cardiac and renal diseases. Hypertension 65 (2):257-263. doi:10.1161/HYPERTENSIONAHA.114.04488 Steichen C, Herve C, Hauet T, Bourmeyster N (2022) Rho GTPases in kidney physiology and diseases. Small GTPases 13 (1):141-161. doi:10.1080/21541248.2021.1932402 Nagase M, Fujita T (2013) Role of Rac1-mineralocorticoid-receptor signalling in renal and cardiac disease. Nat Rev Nephrol 9 (2):86-98. doi:10.1038/nrneph.2012.282 Fedoriuk M, Stefanenko M, Bohovyk R, Semenikhina M, Lipschutz JH, Staruschenko A, Palygin O (2025) Serine proteases and protease-activated receptors signaling in the kidney. Am J Physiol Cell Physiol. doi:10.1152/ajpcell.00143.2025 Holterman CE, Boisvert NC, Thibodeau JF, Kamto E, Novakovic M, Abd-Elrahman KS, Ferguson SSG, Kennedy CRJ (2019) Podocyte NADPH Oxidase 5 Promotes Renal Inflammation Regulated by the Toll-Like Receptor Pathway. Antioxid Redox Signal 30 (15):1817-1830. doi:10.1089/ars.2017.7402 Fujii W, Shibata S (2023) Mineralocorticoid Receptor Antagonists for Preventing Chronic Kidney Disease Progression: Current Evidence and Future Challenges. Int J Mol Sci 24 (9). doi:10.3390/ijms24097719 Lerma EV, Wilson DJ (2022) Finerenone: a mineralocorticoid receptor antagonist for the treatment of chronic kidney disease associated with type 2 diabetes. Expert Rev Clin Pharmacol 15 (5):501-513. doi:10.1080/17512433.2022.2094770 Barrera-Chimal J, Jaisser F (2020) Pathophysiologic mechanisms in diabetic kidney disease: A focus on current and future therapeutic targets. Diabetes Obes Metab 22 Suppl 1:16-31. doi:10.1111/dom.13969 Nagase M (2010) Activation of the aldosterone/mineralocorticoid receptor system in chronic kidney disease and metabolic syndrome. Clin Exp Nephrol 14 (4):303-314. doi:10.1007/s10157-010-0298-8 Ueda K, Nagase M (2014) Mineralocorticoid receptor activation as an etiological factor in kidney diseases. Clin Exp Nephrol 18 (1):16-23. doi:10.1007/s10157-013-0827-3 Gregory S, Hill D, Grey B, Ketelbey W, Miller T, Muniz-Terrera G, Ritchie CW (2020) 11beta-hydroxysteroid dehydrogenase type 1 inhibitor use in human disease-a systematic review and narrative synthesis. Metabolism 108:154246. doi:10.1016/j.metabol.2020.154246 Heise T, Morrow L, Hompesch M, Haring HU, Kapitza C, Abt M, Ramsauer M, Magnone MC, Fuerst-Recktenwald S (2014) Safety, efficacy and weight effect of two 11beta-HSD1 inhibitors in metformin-treated patients with type 2 diabetes. Diabetes Obes Metab 16 (11):1070-1077. doi:10.1111/dom.12317 Blattner SM, Hodgin JB, Nishio M, Wylie SA, Saha J, Soofi AA, Vining C, Randolph A, Herbach N, Wanke R, Atkins KB, Gyung Kang H, Henger A, Brakebusch C, Holzman LB, Kretzler M (2013) Divergent functions of the Rho GTPases Rac1 and Cdc42 in podocyte injury. Kidney Int 84 (5):920-930. doi:10.1038/ki.2013.175 Peng F, Wu D, Gao B, Ingram AJ, Zhang B, Chorneyko K, McKenzie R, Krepinsky JC (2008) RhoA/Rho-kinase contribute to the pathogenesis of diabetic renal disease. Diabetes 57 (6):1683-1692. doi:10.2337/db07-1149 Shibata S, Mu S, Kawarazaki H, Muraoka K, Ishizawa K, Yoshida S, Kawarazaki W, Takeuchi M, Ayuzawa N, Miyoshi J, Takai Y, Ishikawa A, Shimosawa T, Ando K, Nagase M, Fujita T (2011) Rac1 GTPase in rodent kidneys is essential for salt-sensitive hypertension via a mineralocorticoid receptor-dependent pathway. J Clin Invest 121 (8):3233-3243. doi:10.1172/JCI43124 Robins R, Baldwin C, Aoudjit L, Cote JF, Gupta IR, Takano T (2017) Rac1 activation in podocytes induces the spectrum of nephrotic syndrome. Kidney Int 92 (2):349-364. doi:10.1016/j.kint.2017.03.010 Apte M, Khan MS, Bangar N, Gvalani A, Naz H, Tupe RS (2023) Crosstalk between Aldosterone and Glycation through Rac-1 Induces Diabetic Nephropathy. ACS Omega 8 (40):37264-37273. doi:10.1021/acsomega.3c05085 Kloc M, Uosef A, Wosik J, Kubiak JZ, Ghobrial RM (2019) RhoA Pathway and Actin Regulation of the Golgi/Centriole Complex. Results Probl Cell Differ 67:81-93. doi:10.1007/978-3-030-23173-6_5 Zhu L, Jiang R, Aoudjit L, Jones N, Takano T (2011) Activation of RhoA in podocytes induces focal segmental glomerulosclerosis. J Am Soc Nephrol 22 (9):1621-1630. doi:10.1681/ASN.2010111146 Matsuda J, Asano-Matsuda K, Kitzler TM, Takano T (2021) Rho GTPase regulatory proteins in podocytes. Kidney Int 99 (2):336-345. doi:10.1016/j.kint.2020.08.035 Hirose A, Tanikawa T, Mori H, Okada Y, Tanaka Y (2010) Advanced glycation end products increase endothelial permeability through the RAGE/Rho signaling pathway. FEBS Lett 584 (1):61-66. doi:10.1016/j.febslet.2009.11.082 Montezano AC, De Lucca Camargo L, Persson P, Rios FJ, Harvey AP, Anagnostopoulou A, Palacios R, Gandara ACP, Alves-Lopes R, Neves KB, Dulak-Lis M, Holterman CE, de Oliveira PL, Graham D, Kennedy C, Touyz RM (2018) NADPH Oxidase 5 Is a Pro-Contractile Nox Isoform and a Point of Cross-Talk for Calcium and Redox Signaling-Implications in Vascular Function. J Am Heart Assoc 7 (12). doi:10.1161/JAHA.118.009388 Jha JC, Banal C, Okabe J, Gray SP, Hettige T, Chow BSM, Thallas-Bonke V, De Vos L, Holterman CE, Coughlan MT, Power DA, Skene A, Ekinci EI, Cooper ME, Touyz RM, Kennedy CR, Jandeleit-Dahm K (2017) NADPH Oxidase Nox5 Accelerates Renal Injury in Diabetic Nephropathy. Diabetes 66 (10):2691-2703. doi:10.2337/db16-1585 Holterman CE, Thibodeau JF, Towaij C, Gutsol A, Montezano AC, Parks RJ, Cooper ME, Touyz RM, Kennedy CR (2014) Nephropathy and elevated BP in mice with podocyte-specific NADPH oxidase 5 expression. J Am Soc Nephrol 25 (4):784-797. doi:10.1681/ASN.2013040371 Noor S, Mohammad T, Ashraf GM, Farhat J, Bilgrami AL, Eapen MS, Sohal SS, Yadav DK, Hassan MI (2021) Mechanistic insights into the role of serum-glucocorticoid kinase 1 in diabetic nephropathy: A systematic review. Int J Biol Macromol 193 (Pt A):562-573. doi:10.1016/j.ijbiomac.2021.10.165 Lang F, Bohmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V (2006) (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev 86 (4):1151-1178. doi:10.1152/physrev.00050.2005 Kobayashi T, Deak M, Morrice N, Cohen P (1999) Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344 Pt 1 (Pt 1):189-197 Koshikawa M, Mukoyama M, Mori K, Suganami T, Sawai K, Yoshioka T, Nagae T, Yokoi H, Kawachi H, Shimizu F, Sugawara A, Nakao K (2005) Role of p38 mitogen-activated protein kinase activation in podocyte injury and proteinuria in experimental nephrotic syndrome. J Am Soc Nephrol 16 (9):2690-2701. doi:10.1681/ASN.2004121084 Hirohama D, Nishimoto M, Ayuzawa N, Kawarazaki W, Fujii W, Oba S, Shibata S, Marumo T, Fujita T (2021) Activation of Rac1-Mineralocorticoid Receptor Pathway Contributes to Renal Injury in Salt-Loaded db/db Mice. Hypertension 78 (1):82-93. doi:10.1161/HYPERTENSIONAHA.121.17263 Bakris GL, Agarwal R, Anker SD, Pitt B, Ruilope LM, Rossing P, Kolkhof P, Nowack C, Schloemer P, Joseph A, Filippatos G, Investigators F-D (2020) Effect of Finerenone on Chronic Kidney Disease Outcomes in Type 2 Diabetes. N Engl J Med 383 (23):2219-2229. doi:10.1056/NEJMoa2025845 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7674021","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":530345059,"identity":"9296a401-7f13-42f6-b6ae-9d99a5ead138","order_by":0,"name":"Kultigin Turkmen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqklEQVRIiWNgGAWjYJACyQYGGyDF2HiABC0JaSAtDSRpOQxmEKfF4PjpxJszf5y3W9t+GGhLjU00YS1ncjdbbki4nbztTCJQy7G03AaCWm7wbpN8ANRidgCohbHhMNFaziWbnX9IipYNCQfszG4Qa4skyC8z0pITzG4AbUkgxi98x89uvNljY2dvdj794YMPNTaEtcBAIlhlArHKQcCeFMWjYBSMglEwwgAA3qJL+Zx0TggAAAAASUVORK5CYII=","orcid":"","institution":"Necmettin Erbakan University","correspondingAuthor":true,"prefix":"","firstName":"Kultigin","middleName":"","lastName":"Turkmen","suffix":""},{"id":530345060,"identity":"8cacfad3-58f4-43fc-834e-dbd0bdcc4e34","order_by":1,"name":"Sedef Akcaalan","email":"","orcid":"","institution":"Necmettin Erbakan University","correspondingAuthor":false,"prefix":"","firstName":"Sedef","middleName":"","lastName":"Akcaalan","suffix":""},{"id":530345061,"identity":"409c73cd-25d5-4119-890a-cedf00bab81e","order_by":2,"name":"Canan Eroglu Gunes","email":"","orcid":"","institution":"Necmettin Erbakan University","correspondingAuthor":false,"prefix":"","firstName":"Canan","middleName":"Eroglu","lastName":"Gunes","suffix":""},{"id":530345062,"identity":"28763ea6-77a8-4f68-a243-d1aabe71f09f","order_by":3,"name":"Ercan Kurar","email":"","orcid":"","institution":"Necmettin Erbakan University","correspondingAuthor":false,"prefix":"","firstName":"Ercan","middleName":"","lastName":"Kurar","suffix":""}],"badges":[],"createdAt":"2025-09-22 11:53:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7674021/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7674021/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93745630,"identity":"7d6ab14d-375e-41fb-9621-3202980accf3","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":961631,"visible":true,"origin":"","legend":"","description":"","filename":"MaintextRac1FN.docx","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/9b845de8c1406ebb69224d22.docx"},{"id":93745651,"identity":"322c5964-b791-4362-99e0-c31c82b1e480","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6228,"visible":true,"origin":"","legend":"","description":"","filename":"764dfc58ab164758ac9d96ac5a425bcc.json","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/a8db34affe0a507b32c6ec48.json"},{"id":93745644,"identity":"bbd244f2-c87a-4981-aac7-d520f0224374","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70384,"visible":true,"origin":"","legend":"","description":"","filename":"764dfc58ab164758ac9d96ac5a425bcc1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/93f651c58b94cb35e97d8508.xml"},{"id":93745653,"identity":"e878de51-ff6a-4f56-adb3-4594af63f3a9","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":64049,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/25812ea85211ec8da8a22fa1.png"},{"id":93745638,"identity":"82806c7d-a702-4137-a7dc-acd9469e373e","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155521,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/cf1c06bf33c2a431324cbab2.jpeg"},{"id":93745646,"identity":"1b980498-a5a4-40dd-9766-8e206cf985e5","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79900,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/5c4eca323585f4f5f6cb7af8.png"},{"id":93745645,"identity":"8b57958f-6f27-4c95-b3d3-a9f32803d808","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82157,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/175898fd63519a233e572be4.png"},{"id":93745652,"identity":"a57ebbf0-711b-486c-9953-9c442e3db12b","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76893,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/a9ec5236c6ad7a71aab9951c.png"},{"id":93745648,"identity":"98a810bd-09fa-44ca-b67a-8378d3418f25","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"emf","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85608,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.emf","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/f8e021475ca209ee079f8f6c.emf"},{"id":93745636,"identity":"8606966d-9f68-465c-992e-baaed8d401c4","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":504002,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/80d1b3bb58c4d64e7bc5a042.png"},{"id":93745655,"identity":"420b02be-3b1f-43fa-8f57-197dd0d74d9b","added_by":"auto","created_at":"2025-10-17 06:31:16","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14409,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/16497593017a0a371012f656.png"},{"id":93745633,"identity":"812a918a-e30d-426c-906f-d0cdfb36b19f","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20076,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/f3e0d5a5ce6f04be6b54f0df.png"},{"id":93745654,"identity":"b5d5439a-2b9e-4e01-b6c9-74be497ec19e","added_by":"auto","created_at":"2025-10-17 06:31:16","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19009,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/a589409ea502f66fbdc1901f.png"},{"id":93746241,"identity":"bd805e45-b400-4a6c-acdc-760216857ed3","added_by":"auto","created_at":"2025-10-17 06:39:15","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18166,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/66eb93e8a090ab0870bd46dc.png"},{"id":93745635,"identity":"86c1057f-d40c-457e-8052-0f2f694749fb","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18219,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/a66195421aee6d50a5f88cce.png"},{"id":93745641,"identity":"88cc8de9-e289-48b1-94b7-23a38a2976a7","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12677,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/2c14bca9e21eecc9cc05f342.png"},{"id":93745647,"identity":"9f51a426-54cc-43c5-9c49-fd5ae53863f7","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":52983,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/5d4b2b518a33a69cdb95edad.png"},{"id":93745656,"identity":"6e61752b-d336-4bbf-8a17-839889b7a8bd","added_by":"auto","created_at":"2025-10-17 06:31:16","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":68587,"visible":true,"origin":"","legend":"","description":"","filename":"764dfc58ab164758ac9d96ac5a425bcc1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/ce7bddb8756d495d54223f64.xml"},{"id":93745650,"identity":"ddf165ad-1f29-4664-a4ad-8ec5fe3674ed","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"html","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76362,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/e0a7946fc11fd70a1cacec21.html"},{"id":93745649,"identity":"c13efc05-d51f-465c-9e35-e82285d956cc","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":93000,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuppression of GLA mRNA and protein levels\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/501d73e6c75a70430fc16988.png"},{"id":93746242,"identity":"cd9063e0-27b3-457c-afee-4776cf3200e9","added_by":"auto","created_at":"2025-10-17 06:39:15","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":155521,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of spironolactone and finerenone on podocyte cell viability\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/1b30897e45d4708c2c743a28.jpeg"},{"id":93745639,"identity":"aa1e29fa-98e9-4b01-b6b9-e392d85bd0f3","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":112824,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges of mRNA levels of MR, aldosterone, cortisol and 11β-HSD1 genes\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/dd957b64f43f13daf9c7d638.png"},{"id":93745631,"identity":"a2cc13a0-7015-4730-9470-ce7c467b7a96","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":118721,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges of mRNA levels of Rac1, SGK1 and MAPK14 genes\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/a4792e0f5749c38337d06823.png"},{"id":93745643,"identity":"c9537bbb-b9e4-4b2d-91a3-5d57c49de45f","added_by":"auto","created_at":"2025-10-17 06:31:15","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":110406,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges of mRNA levels of NOX5, IL6, Cdc42 and RhoA genes\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/85de5063c656b0ae08d0761f.png"},{"id":93745634,"identity":"042dff98-cb89-4c8d-a570-52b43194ab31","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":12677,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eChanges of Rac1 protein levels\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/eae8b2778a1554d4b159a5aa.png"},{"id":93745637,"identity":"30f14680-bf29-4ed4-b031-d3a045d4980e","added_by":"auto","created_at":"2025-10-17 06:31:14","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":504002,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe Proposed Mechanism of Podocyte Injury in Fabry Disease\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/e84bbee9fec62b91aa92575c.png"},{"id":95797417,"identity":"d8c55b62-5b05-46b0-a9f3-3f4d0565bd69","added_by":"auto","created_at":"2025-11-13 08:04:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2044675,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7674021/v1/addd7a82-bcfc-4e58-ac74-cde683bd5e7c.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mineralocorticoid Receptor/Rac1-Driven Podocyte Injury in Fabry Disease: Finerenone and Spironolactone migitate the overactive signaling cascade","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eFabry disease (FD) stems from GLA gene mutations, causing α-galactosidase A deficiency and subsequent globotriacylceramide (Gb3) accumulation in organs like the kidneys [1]. Podocyte injury is a critical driver of Fabry nephropathy (FN), leading to proteinuria, glomerulosclerosis, and progressive renal decline [2] which enzyme replacement therapy (ERT) often fails to fully halt [3,4]. As terminally differentiated cells, podocytes are essential for maintaining the glomerular filtration barrier, and their apoptosis is a key event in proteinuric kidney diseases including diabetic kidney disease (DKD) [5].\u003c/p\u003e\u003cp\u003eThe mineralocorticoid receptor (MR/NR3C2) expression has been demonstrated in cultured human podocytes, mesangial cells, and fibroblasts. Excessive MR expression was found as a key mediator of renal injury via promoting inflammation, fibrosis, and oxidative stress [6]. Additionally, 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) is an enzyme expressed in kidney tissues including podocytes that converts inactive cortisone into its active form, cortisol. Increased expression of 11β-HSD1 may lead to excessive cortisol activation, potentially exacerbating podocyte injury [6].\u003c/p\u003e\u003cp\u003eRac1 (Ras-related C3 botulinum toxin substrate 1), a small GTPase, plays a crucial role in maintaining cytoskeletal dynamics and podocyte structural integrity in podocyte health and diseases [7]. Activation of Rac1 and related pathways including cell division protein 42 (Cdc42), serine/threonine kinase 1 (SGK1) via increased podocyte motility have been shown in proteinuric and diabetic kidney diseases [8]. Dysregulation of the Rac1-Cdc42-SGK1 pathways contribute to cytoskeletal disorganization, increased oxidative stress, and heightened susceptibility to podocyte damage [8,9]. NADPH oxidase 5 (NOX 5) enzyme is encoded in humans that is also closely related podocyte injury by increasing oxidative stress [10].\u003c/p\u003e\u003cp\u003eSpironolactone, steroidal MR antagonist and finerenone, a non-steroidal MR antagonist, have both shown promise as a therapeutic agent in renal diseases by modulating inflammatory and fibrotic processes [11]. Finerenone also confers nephroprotection in DKD by ameliorating podocyte injury through multi-targeted inhibition of MR-dependent signaling pathways [12].\u003c/p\u003e\u003cp\u003eBased on this background, this study aimed to investigate the involvement of the MR-Rac1-SGK1 pathway, the oxidative stress and inflammation markers in human Fabry podocytes. Furthermore, we evaluated the effects of spironolactone, finerenone, and direct Rac1 inhibition on this signaling axis.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Cell Culture and Conditions\u003c/h2\u003e\u003cp\u003eThe human podocyte cells were purchased from Celprogen and cultured following manufacturer\u0026rsquo;s instructions. Podocytes were maintained and proliferated in a 37\u0026deg;C, 5% CO2, 95% humidified incubator. Podocytes were grown and maintained in Human Podocyte Cell Culture Complete Media with Serum (Celprogen). Media were renewed every 2\u0026ndash;3 days and cells were subcultured at 60\u0026ndash;70% confluency, at a 1:2 cell density.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Fabry Disease Model Establishment\u003c/h2\u003e\u003cp\u003eA cell model of Fabry disease was created using shRNA targeting the α-Gal A mRNA sequence, delivered to cells using lentiviral vector. V2LHS_82973 (Antisense: ATAAAGAGGCCACTCACAG) and V2LHS_82975 (Antisense: TATCATAGCTACAGCCCAG) were obtained as distinct viral stocks of GIPZ lentiviral particles. (Dharmacon, UK). The efficiency of cell transduction in this study was first assessed using GIPZ non-silencing control viral particles. Following this, podocyte cells were transduced in line with the manufacturer\u0026rsquo;s protocol. Cells were plated in 24-well plates at a density of 5\u0026times;10⁴ cells per well and maintained at 37\u0026deg;C with 5% CO₂ for 24 h. After incubation, the medium was replaced with 225 \u0026micro;L of serum-free medium containing 25 \u0026micro;L of viral particles pre-diluted at a ratio of 1:25. The cells were then exposed to this mixture for 4 h at 37\u0026deg;C in a CO₂ incubator, after which 1 mL of complete medium was added. To remove non-transduced cells, puromycin selection was carried out by treating the cultures with puromycin-containing medium (5 \u0026micro;g/mL). The selective medium was refreshed every 2\u0026ndash;3 days over a period of 10\u0026ndash;14 days until stable populations of transduced cells were established.\u003c/p\u003e\u003cp\u003eA Fabry disease podocyte model was established by supressing GLA gene expression using shRNA in a commercially purchased human podocyte cell line. The control group (wild type, -wt controls) and GLA-suppressed cells (Fabry podocytes as sh-controls) were used for subsequent experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Drug Treatments\u003c/h2\u003e\u003cp\u003eTo determine the highest non-toxic concentrations of finerenone and spironolactone, a CCK8 assay was conducted. Briefly, podocyte cells were seeded into 96-well plates and incubated at 37\u0026deg;C in a CO₂ incubator for 24 h. The medium was then replaced with fresh medium containing different concentrations of finerenone or spironolactone, while control wells received only medium. After 48 h of incubation, CCK8 solution was added to each well and incubated for an additional 4 h, followed by measurement of absorbance at 450 nm using a spectrophotometer. Cell viability was compared with that of the control group, and the percentage of viable cells was calculated using the following formula: % Cell Viability = (Sample optical density value) / (Control optical density value) \u0026times; 100. Based on the assay results, 25 nM spironolactone and 10 nM finerenone was selected for treatment. Additionally, 50 \u0026micro;M of the Rac1 inhibitor (NSC23766) was chosen based on literature data and applied to experimental groups.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. Real-time quantitative PCR (RT-qPCR) analysis\u003c/h2\u003e\u003cp\u003ePodocyte cells were grown in 6-well plates, and total RNA was isolated using the RiboEx reagent (GeneAll) according to the manufacturer\u0026rsquo;s guidelines. To remove residual genomic DNA, RNA samples were treated with DNase I (Thermo Scientific) and subsequently converted into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). RT-qPCR was then conducted on the Bio-Rad CFX platform with SYBR Green detection. Each reaction contained cDNA templates along with gene-specific primers (Table\u0026nbsp;1). Briefly, The RT-qPCR reactions were prepared to a final concentration of 1X, containing 5X SYBR Green mix, 12.5 pmol forward primer, 12.5 pmol reverse primer, 2 \u0026micro;L of cDNA template, and nuclease-free RNase/DNase-free water to a final volume of 10 \u0026micro;L. The thermal cycling conditions consisted of an initial denaturation step at 95\u0026deg;C for 15 min, followed by 40 cycles of amplification (95\u0026deg;C for 15 s, 60\u0026deg;C for 20 s, and 72\u0026deg;C for 20 s). Subsequently, a melt curve analysis was conducted by gradually increasing the temperature from 60\u0026deg;C to 95\u0026deg;C at a rate of 0.5\u0026deg;C/s with continuous fluorescence detection. The Ct values obtained from qPCR were recorded, and target gene expression levels were normalized against the reference genes ACTB, CYCA, and 18S rRNA.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward primer (5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer (5'\u0026rarr;3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eLength (bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eReferences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGLA\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAACCTTGACTGCCAGGAAGA\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003eCTCATAACCTGCATCCTTCCAGC\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e231/108\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRAC1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTTGTGAGTCCTGCATCAT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003eCACTAGGATGATGGGAGTGTTG\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e91\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eThis study\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eRhoA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTCTGTCCCAACGTGCCCATCAT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCTGCCTTCTTCAGGTTTCACCG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e118/257\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCdc42\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTGACAGATTACGACCGCTGAGTT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGGAGTCTTTGGACAGTGGTGAG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e135\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eSGK1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGCTGAAATAGCCAGTGCCTTGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGTTCTCCTTGCAGAGTCCGAAG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e132\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMR\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eAAATCACACGGCGACCTGTCGT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eATGGCATCCTGAAGCCTCATCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e162\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eMAPK14\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGAGCGTTACCAGAACCTGTCTC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eAGTAACCGCAGTTCTCTGTAGGT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e161\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e11β-HSD1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGTTACGTGGTCCTGACTGTAGC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGCAGCAACCATTGGATAAGCCAC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e109\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eNOX5\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCCACCATTGCTCGCTATGAGTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGCCTTGAAGGACTCATACAGCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e127\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eIL6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eCTATGCTGCCTGCTCTTACTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGGGAAGTGGGTGCAGTTATT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e83\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCYP11B1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGGTGCTGAAACACCTCCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eGAACATGCTGGGCCTCAATA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e85\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCYP11B2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eGCACCTGCACCTGGAGATG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCACACACCATGCGTGGTCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e86\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e[13]\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eACTB\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eAGCACGGCATCGTCACCAACT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eTGGCTGGGGTGTTGAAGGTCT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e179\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e[14]\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003eCYCA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eTATCTGCACTGCCAAGACTGAGTG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eCTTCTTGCTGGTCTTGCCATTCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e126\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003e[15]\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e18SrRNA\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cb\u003eACGGACCAGAGCGAAAGCAT\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e\u003cb\u003eTGTCAATCCTGTCCGTGTCC\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u003cb\u003e310\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Western Blotting\u003c/h2\u003e\u003cp\u003eCells were lysed in RIPA buffer (VWR, USA) containing protease inhibitors (Thermo Scientific), and the resulting lysates were centrifuged at 14,000 \u0026times; g for 15 min at 4\u0026deg;C. Protein concentrations were quantified using the Bradford assay with BSA standards. A total of 50 \u0026micro;g of protein per sample was separated by SDS-PAGE and transferred onto PVDF membranes (Millipore) using the Trans-Blot\u0026reg; Turbo\u0026trade; transfer system (Bio-Rad). The membranes were blocked with 3% skim milk for 1 h, then incubated overnight at 4\u0026deg;C with the respective primary antibodies, followed by incubation with HRP-conjugated secondary antibodies for 2 h at room temperature. Detection was performed using an ECL substrate (Boster AR1170), and protein bands were visualized on an Azure C280 imaging system. The primary antibodies used included anti-GLA (1:1000 Elabscience Bionovation Inc; Cat# -AB-6701 and anti-GAPDH (Santa Cruz Biotechnology; Cat# sc-25778, 1:1000), while goat anti-rabbit IgG (Santa Cruz Biotechnology; Cat# sc-2054, 1:5000) was employed as the secondary antibody.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Rac1 Enzyme-Linked Immunosorbent Assay (ELISA)\u003c/h2\u003e\u003cp\u003eRac1 levels in podocyte cells were measured using a Rac1 ELISA kit. After lysis of ~\u0026thinsp;10⁶ cells, 40 \u0026micro;L of supernatant was added to each well, followed by antibody and streptavidin-HRP incubation at 37\u0026deg;C for 60 min. After washing, substrate solutions A and B were added, incubated for 10 min in the dark, and the reaction was stopped. Absorbance was recorded at 450 nm.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Statistical Analysis\u003c/h2\u003e\u003cp\u003eqPCR expression data were normalized to housekeeping gene levels, and gene expression was analyzed using the 2\u003csup\u003e\u003cem\u003e(\u0026minus;ΔCT)\u003c/em\u003e\u003c/sup\u003e method. Statistical comparisons between groups were performed using the \u0026ldquo;One-way ANOVA\u0026rdquo; multiple comparison test in GraphPad\u0026reg; Prism version 9.3.0. A p-value of \u0026lt;\u0026thinsp;0.05 was considered statistically significant for all analyses.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003eSuppression of GLA mRNA and protein was confirmed by RT-qPCR and Western blot, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). shRNA treatment significantly reduced GLA mRNA expression: 5.01-fold with sh1, 16.90-fold with sh2, and 8.37-fold with sh1\u0026thinsp;+\u0026thinsp;sh2, compared to the negative control. The difference between sh2 and sh1\u0026thinsp;+\u0026thinsp;sh2 was not statistically significant (p\u0026thinsp;=\u0026thinsp;0.09). Western blot analysis confirmed a corresponding reduction in GLA protein levels, with the most pronounced silencing observed in the sh2 group. Consequently, the sh2-silenced group, designated GLA (-), was selected for all subsequent experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe cytotoxic effects of different concentrations of spironolactone and finerenone on podocyte cell viability were evaluated at 48th hour using the CCK8 cell viability assay. Based on the assay results, the highest non-toxic concentrations 25 nM spironolactone and 10 nM finerenone was selected for treatment (Figure. 2).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eGene expression analysis revealed significant upregulation of MR (NR3C2), aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, MAPK14, Cdc42, and IL-6 in Fabry podocytes compared to wild-type (WT) controls (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Treatment with spironolactone or finerenone significantly reduced the expression of these genes. The Rac1 inhibitor NSC23766 produced similar but less pronounced reductions (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). In contrast, RhoA expression was unchanged in Fabry podocytes. Notably, finerenone and NSC23766 increased RhoA expression, whereas spironolactone had no effect (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eElevated Rac1 protein levels were detected in the supernatant of Fabry podocytes compared to wt podocytes in ELISA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Finerenone and NSC23766 treatment led to a significant decrease in Rac1 protein levels. Sprinolactone treatment also reduced Rac1 protein levels but to a lesser extent than finerenone and Rac 1 inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThis study elucidates novel molecular mechanisms driving podocyte injury in Fabry nephropathy. The principal findings of our study are as follows; i) Fabry podocytes exhibit significantly increased gene expression of MR, aldosterone, cortisol and 11β-HSD1 compared to normal podocytes. ii) Gene expression of key intracellular effectors regulating podocyte integrity including Rac1, SGK1, CDC42, and MAPK14 were also upregulated and RHOA gene expression is downregulated in Fabry podocytes. iii) Furthermore, Rac1 protein levels, the oxidative stress marker NOX5 and inflammation marker IL-6 gene expression were also elevated. iv) Additionaly, these pathological alterations were effectively reversed by treatment with the non-steroidal mineralocorticoid receptor blocker finerenone, steroidal MR blocker sprinolactone and the Rac1 inhibitor, NSC23766.\u003c/p\u003e\u003cp\u003eIncreased MR levels render podocytes hyper-responsive to mineralocorticoids. This pathological alteration is similarly observed in podocytes of DKD patients and contributes to their heightened susceptibility to podocyte injury [13]. Previous studies also indicated that elevated MR levels in podocytes may increase susceptibility to injury in various disorders [14,15]. To our knowledge, our study provides the first report in the literature of elevated MR levels in Fabry podocytes, a finding analogous to that seen in patients with DKD. Consequently, this mechanism may underlie the inability of ERT to completely reverse podocyte loss in FD. Additionally, we demonstrated that both the steroidal MRA spironolactone and the non-steroidal MRA finerenone reduced MR gene expression levels, supporting our hypothesis regarding their potential therapeutic benefit in podocytopathy in FD.\u003c/p\u003e\u003cp\u003eIn this context, we sought to investigate MR-associated signaling pathways and further demonstrated that 11β-HSD1, aldosterone and cortisol gene expression levels are significantly elevated in Fabry podocytes compared to healthy podocytes. The podocytopathic effects of these molecules and enzyme are also similar in DM, obesity and metabolic syndrome [16,17,14]. Our novel data regarding upregulated gene expressions in Fabry podocytes collectively reflect mineralocorticoid pathway activation, driven by MR overactivity and heightened synthesis of aldosterone and physiologically active cortisol. This suggests that chronically hyperactivated MR signaling specifically within Fabry podocytes may represent a therapeutic target for MR antagonists. To test this hypothesis, we treated Fabry podocytes with both spironolactone and finerenone and demonstrated a reduction in the gene expression levels of active cortisol and aldosterone.\u003c/p\u003e\u003cp\u003eTo further elucidate the intracellular effects of MR signaling on podocyte integrity, we focused on investigating the Rac1-SGK1 pathway alongside Cdc42, MAPK14 (p38α), and RhoA signaling in Fabry podocytopathy. In general, Rho GTPases such as Rac1, Cdc42, RhoA and their downstream effectors including SGK1 and p38 MAPK are critical regulators of the podocyte actin cytoskeleton, slit diaphragm integrity, survival, and motility [18]. Dysregulation of these pathways is a hallmark feature across many podocytopathies [19,18,20]. Given their high degree of interconnectivity, these pathways are frequently dysregulated concurrently or sequentially. This observation is particularly relevant given previous works demonstrating that Rac1 is a key mediator of high-salt diet-induced MR activation and hypertension in Dahl-S rats [20], podocytopathy in nephrotic syndrome [21] and DKD [22]. Consequently, MR signaling\u0026mdash;which modulates key downstream effectors such as Rac1, SGK1, and Cdc42\u0026mdash;represents a critical regulatory node in these diseases, making it a rational therapeutic target. Although MR-Rac1-SGK1 axis dysregulation is well-characterized in diabetes and DKD, its role in FD-associated podocytopathy remains unknown. To investigate this relationship, we analyzed Fabry podocytes and demonstrated significant upregulation of Rac1 and SGK1 gene expression, along with increased Rac1 protein levels, compared to healthy controls. Importantly, both spironolactone and finerenone treatment reduced Rac1 and SGK1 gene expression, supporting our hypothesis.\u003c/p\u003e\u003cp\u003eTo determine whether Rac1 serves as the key regulator in this pathway, we treated Fabry podocytes with the specific Rac1 inhibitor NSC23766. This intervention dramatically decreased gene expression of MR, Rac1, SGK1, cortisol, aldosterone, and 11β-HSD1, along with substantially reduced Rac1 protein levels. These findings strongly implicate MR and Rac1-dependent pathways in the pathogenesis of FD-related podocytopathy.\u003c/p\u003e\u003cp\u003eRas homolog family member A (RhoA) is another member of the small GTPase protein family. Its principal function centers on regulating cytoskeletal organization through binding to diverse effector proteins, thereby controlling critical cellular processes [23]. In this regard, RhoA signaling acts as a crucial restraint on podocyte motility, promoting actin cytoskeletal stability and the formation of focal adhesion complexes to anchor these cells within the glomerular basement membrane and prevent deleterious detachment [24]. Excessive or dysregulated RhoA activity, however, is potently detrimental to podocyte viability, directly inducing actin stress fiber overassembly, cellular contraction, and ultimately apoptosis [25]. In DKD, hyperglycemia and TGF-β drive pathological RhoA activation, leading to cytoskeletal collapse, loss of slit diaphragm integrity, increased motility associated with detachment, and apoptosis, key events in proteinuria development. A previous study has demonstrated that RhoA activation exacerbates DKD progression and suppression of the RhoA/ROCK pathway confers protection against glomerular inflammation and fibrosis in diabetic models, as evidenced by Hirose et al. [26]. Collectively, these observations implicate RhoA in DKD-associated podocyte dysfunction and novel treatments targeting RhoA might be beneficial in diabetic podocytopathy.\u003c/p\u003e\u003cp\u003eIn alignment with these findings, we demonstrated that RhoA gene expression is similar in Fabry podocytes compared to healthy podocytes. In contrast, both finerenone and spironolactone along with NSC23766 increased the RhoA gene expression in Fabry podocytes. To date, there is no data regarding the effects of spironolactone and finereone on RhoA pathway. Our study is the first to demonstrate finerenone stabilizes RhoaA activity to prevent foot process effacement and glomerular barrier dysfunction. These results may reflect compensatory stabilization of the actin cytoskeleton against Rac1-driven hypermotility. Alternatively, RhoA upregulation could be activated via SGK1 (shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e) by other factors rather than Rac1 and these effects might signify maladaptive stress responses.\u003c/p\u003e\u003cp\u003eNOX5, a calcium-sensitive NADPH oxidase in human podocytes, is a significant source of pathological reactive oxygen species (ROS). Excessive NOX5-derived ROS directly damages podocytes, disrupts slit diaphragm integrity, and activates pro-inflammatory and pro-fibrotic pathways [27]. This axis is critically involved in diabetic kidney disease (DKD) [28] and angiotensin II-driven injury, where hyperglycemia and AT-2 synergistically upregulate both SGK1 and NOX5, creating a vicious cycle of oxidative stress and podocyte apoptosis [29].\u003c/p\u003e\u003cp\u003eSGK1 and NOX5 are mechanistically linked contributors to podocyte injury in various podocytopathies [30,31]. SGK1 induces podocyte apoptosis and cytoskeletal destabilization by upregulating TRPC6-mediated calcium influx and downregulating nephrin expression in various disorders [30,32]. SGK1 also drives oxidative stress in podocytes by upregulating NOX isoforms [32]. Previously, the pathological involvement of SGK1 in diabetes and its associated complications is well-established. Additionally, functioning as a critical intracellular regulator of nutrient metabolism, SGK1 dysregulation may contribute significantly to the pathogenesis and progression of obesity, insulin resistance, diabetes, and subsequent renal complications [30]. Supporting this mechanistic link, a recent clinical investigation in individuals with type 2 diabetes demonstrated a direct correlation between elevated levels of phosphorylated SGK1 which is an indicative of its activated state and increased circulating glucose concentrations as well as higher glycated hemoglobin A1 levels [30]. These mechanisms are implicated in diabetes and DKD however these has been not identified in Fabry disease. For the first time in the literature, our study explored the role of SGK1 in Fabry podocytes and showed that the gene expression of SGK1 is increased when compared with healthy podocytes. This increased gene expression is reversed by finerenone, spironolactone and NSC23766. These results clearly highlights that MR and Rac1 blockage might be beneficial in FD.\u003c/p\u003e\u003cp\u003ePodocyte injury is also mediated by MAPK pathways, particularly MAPK14 (p38), whose activation is an early event in experimental nephropathy. Pharmacological inhibition of p38 attenuates proteinuria [33]. With the background mentioned above, MR activation upregulates the GTPase Rac1, which drives NADPH oxidase-mediated ROS production and inflammation, leading to podocyte dysfunction. Finerenone effectively suppresses Rac1 activity, attenuating oxidative stress and cytokine release. A harmful signaling loop exists between MR and Rac1; salt loading triggers MR overactivation, which upregulates Rac1, stimulating NOX enzymes and causing oxidative stress that leads to podocyte damage, tubular inflammation, and capillary destruction. Blocking this pathway with finerenone or a Rac1 inhibitor significantly reduces albuminuria and structural damage in models, confirming their interconnected roles as therapeutic targets [34].\u003c/p\u003e\u003cp\u003eIn our study, as seen in SGK1, the gene expression of NOX5, MAPK14 and IL-6 are found to be increased in Fabry podocytes and reversed by finerenone, spironolactone and NSC23766. According to these results, limiting MR-driven ROS generation and inflammatory and oxidative podocyte damage might be reversed with MR antagonists. These mechanistic insights are clinically validated in diabetic kidney disease via the FIDELIO-DKD and FIGARO-DKD trials, which demonstrate finerenone\u0026rsquo;s efficacy in reducing albuminuria and attenuating kidney function decline [35].\u003c/p\u003e\u003cp\u003eOur study has certain limitations, most notably the absence of \u003cem\u003ein vivo\u003c/em\u003e validation and functional assays, such as podocyte motility experiments. To address these gaps, future research should focus on (i) evaluating the therapeutic effects of finerenone and NSC23766 in Fabry disease animal models, (ii) elucidating the mechanistic link between Gb3 accumulation and the activation of the mineralocorticoid receptor (MR) and Rac1 signaling pathways, and (iii) investigating potential synergistic treatment strategies that combine ERT for Gb3 clearance with targeted inhibition of MR signaling to enhance therapeutic efficacy. These directions will provide deeper insights into disease mechanisms and improve treatment outcomes for Fabry disease.\u003c/p\u003e\u003cp\u003eOur study establishes a critical link between aberrant MR/Rac1 signaling and SGK1, NOX, MAPK14, IL-6, RhoA and Ccd42 in Fabry disease-associated podocyte injury. We demonstrate that increased MR-Rac1 signaling, leading to cytoskeletal destabilization and impaired podocyte function, while pharmacological inhibition with finerenone, spironolactone and NSC23766 (Rac1 inhibitor) effectively restores podocyte integrity \u003cem\u003ein vitro\u003c/em\u003e. These findings position MR/Rac1 signaling as a novel therapeutic target beyond substrate reduction therapies. This dual-pathway strategy\u0026mdash;targeting both upstream Gb3 deposition with ERT and downstream signaling with MR antagonists\u0026mdash;may offer synergistic protection against progressive Fabry nephropathy, addressing an unmet clinical need in disease management.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthors\u0026lsquo;contributions:\u003c/h2\u003e\n\u003cp\u003eKT, EK and CGE designed the study. CGE and SA did the experiments and statistical analyses. All the authors read and approved the manuscript.\u003c/p\u003e\n\u003ch2\u003eConflict of interest statement:\u003c/h2\u003e\n\u003cp\u003eNone of the authors have conflict of interest.\u003c/p\u003e\n\u003ch2\u003eFunding:\u003c/h2\u003e\n\u003cp\u003eThis Project is supported by Scientific Research Projects Coordination Unit (BAP) of Necmettin Erbakan University (Project No:23PEDAP18001).\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eKT, EK and CGE designed the study. CGE and SA did the experiments and statistical analyses. All the authors read and approved the manuscript.\u003c/p\u003e\n\u003ch2\u003eData Availability\u003c/h2\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTurkmen K, Guclu A, Sahin G, Kocyigit I, Demirtas L, Erdur FM, Sengul E, Ozkan O, Emre H, Turgut F, Unal H, Karaman M, Acikel C, Esen H, Balli E, Bitirgen G, Tonbul HZ, Yilmaz MI, Ortiz A (2016) The Prevalence of Fabry Disease in Patients with Chronic Kidney Disease in Turkey: The TURKFAB Study. Kidney Blood Press Res 41 (6):1016-1024. doi:10.1159/000452605\u003c/li\u003e\n\u003cli\u003eTurkmen K, Baloglu I (2020) Fabry disease: where are we now? Int Urol Nephrol 52 (11):2113-2122. doi:10.1007/s11255-020-02546-3\u003c/li\u003e\n\u003cli\u003eTurkmen K, Karaselek MA, Celik SC, Esen HH, Ozer H, Baloglu I, Ozturk Y, Guner SN, Reisli I, Keles S (2023) Could immune cells be associated with nephropathy in Fabry disease patients? Int Urol Nephrol 55 (6):1575-1588. doi:10.1007/s11255-023-03468-6\u003c/li\u003e\n\u003cli\u003eEl Dib R, Gomaa H, Carvalho RP, Camargo SE, Bazan R, Barretti P, Barreto FC (2016) Enzyme replacement therapy for Anderson-Fabry disease. Cochrane Database Syst Rev 7 (7):CD006663. doi:10.1002/14651858.CD006663.pub4\u003c/li\u003e\n\u003cli\u003eSever S, Schiffer M (2018) Actin dynamics at focal adhesions: a common endpoint and putative therapeutic target for proteinuric kidney diseases. Kidney Int 93 (6):1298-1307. doi:10.1016/j.kint.2017.12.028\u003c/li\u003e\n\u003cli\u003eBauersachs J, Jaisser F, Toto R (2015) Mineralocorticoid receptor activation and mineralocorticoid receptor antagonist treatment in cardiac and renal diseases. Hypertension 65 (2):257-263. doi:10.1161/HYPERTENSIONAHA.114.04488\u003c/li\u003e\n\u003cli\u003eSteichen C, Herve C, Hauet T, Bourmeyster N (2022) Rho GTPases in kidney physiology and diseases. Small GTPases 13 (1):141-161. doi:10.1080/21541248.2021.1932402\u003c/li\u003e\n\u003cli\u003eNagase M, Fujita T (2013) Role of Rac1-mineralocorticoid-receptor signalling in renal and cardiac disease. Nat Rev Nephrol 9 (2):86-98. doi:10.1038/nrneph.2012.282\u003c/li\u003e\n\u003cli\u003eFedoriuk M, Stefanenko M, Bohovyk R, Semenikhina M, Lipschutz JH, Staruschenko A, Palygin O (2025) Serine proteases and protease-activated receptors signaling in the kidney. Am J Physiol Cell Physiol. doi:10.1152/ajpcell.00143.2025\u003c/li\u003e\n\u003cli\u003eHolterman CE, Boisvert NC, Thibodeau JF, Kamto E, Novakovic M, Abd-Elrahman KS, Ferguson SSG, Kennedy CRJ (2019) Podocyte NADPH Oxidase 5 Promotes Renal Inflammation Regulated by the Toll-Like Receptor Pathway. Antioxid Redox Signal 30 (15):1817-1830. doi:10.1089/ars.2017.7402\u003c/li\u003e\n\u003cli\u003eFujii W, Shibata S (2023) Mineralocorticoid Receptor Antagonists for Preventing Chronic Kidney Disease Progression: Current Evidence and Future Challenges. Int J Mol Sci 24 (9). doi:10.3390/ijms24097719\u003c/li\u003e\n\u003cli\u003eLerma EV, Wilson DJ (2022) Finerenone: a mineralocorticoid receptor antagonist for the treatment of chronic kidney disease associated with type 2 diabetes. Expert Rev Clin Pharmacol 15 (5):501-513. doi:10.1080/17512433.2022.2094770\u003c/li\u003e\n\u003cli\u003eBarrera-Chimal J, Jaisser F (2020) Pathophysiologic mechanisms in diabetic kidney disease: A focus on current and future therapeutic targets. Diabetes Obes Metab 22 Suppl 1:16-31. doi:10.1111/dom.13969\u003c/li\u003e\n\u003cli\u003eNagase M (2010) Activation of the aldosterone/mineralocorticoid receptor system in chronic kidney disease and metabolic syndrome. Clin Exp Nephrol 14 (4):303-314. doi:10.1007/s10157-010-0298-8\u003c/li\u003e\n\u003cli\u003eUeda K, Nagase M (2014) Mineralocorticoid receptor activation as an etiological factor in kidney diseases. Clin Exp Nephrol 18 (1):16-23. doi:10.1007/s10157-013-0827-3\u003c/li\u003e\n\u003cli\u003eGregory S, Hill D, Grey B, Ketelbey W, Miller T, Muniz-Terrera G, Ritchie CW (2020) 11beta-hydroxysteroid dehydrogenase type 1 inhibitor use in human disease-a systematic review and narrative synthesis. Metabolism 108:154246. doi:10.1016/j.metabol.2020.154246\u003c/li\u003e\n\u003cli\u003eHeise T, Morrow L, Hompesch M, Haring HU, Kapitza C, Abt M, Ramsauer M, Magnone MC, Fuerst-Recktenwald S (2014) Safety, efficacy and weight effect of two 11beta-HSD1 inhibitors in metformin-treated patients with type 2 diabetes. Diabetes Obes Metab 16 (11):1070-1077. doi:10.1111/dom.12317\u003c/li\u003e\n\u003cli\u003eBlattner SM, Hodgin JB, Nishio M, Wylie SA, Saha J, Soofi AA, Vining C, Randolph A, Herbach N, Wanke R, Atkins KB, Gyung Kang H, Henger A, Brakebusch C, Holzman LB, Kretzler M (2013) Divergent functions of the Rho GTPases Rac1 and Cdc42 in podocyte injury. Kidney Int 84 (5):920-930. doi:10.1038/ki.2013.175\u003c/li\u003e\n\u003cli\u003ePeng F, Wu D, Gao B, Ingram AJ, Zhang B, Chorneyko K, McKenzie R, Krepinsky JC (2008) RhoA/Rho-kinase contribute to the pathogenesis of diabetic renal disease. Diabetes 57 (6):1683-1692. doi:10.2337/db07-1149\u003c/li\u003e\n\u003cli\u003eShibata S, Mu S, Kawarazaki H, Muraoka K, Ishizawa K, Yoshida S, Kawarazaki W, Takeuchi M, Ayuzawa N, Miyoshi J, Takai Y, Ishikawa A, Shimosawa T, Ando K, Nagase M, Fujita T (2011) Rac1 GTPase in rodent kidneys is essential for salt-sensitive hypertension via a mineralocorticoid receptor-dependent pathway. J Clin Invest 121 (8):3233-3243. doi:10.1172/JCI43124\u003c/li\u003e\n\u003cli\u003eRobins R, Baldwin C, Aoudjit L, Cote JF, Gupta IR, Takano T (2017) Rac1 activation in podocytes induces the spectrum of nephrotic syndrome. Kidney Int 92 (2):349-364. doi:10.1016/j.kint.2017.03.010\u003c/li\u003e\n\u003cli\u003eApte M, Khan MS, Bangar N, Gvalani A, Naz H, Tupe RS (2023) Crosstalk between Aldosterone and Glycation through Rac-1 Induces Diabetic Nephropathy. ACS Omega 8 (40):37264-37273. doi:10.1021/acsomega.3c05085\u003c/li\u003e\n\u003cli\u003eKloc M, Uosef A, Wosik J, Kubiak JZ, Ghobrial RM (2019) RhoA Pathway and Actin Regulation of the Golgi/Centriole Complex. Results Probl Cell Differ 67:81-93. doi:10.1007/978-3-030-23173-6_5\u003c/li\u003e\n\u003cli\u003eZhu L, Jiang R, Aoudjit L, Jones N, Takano T (2011) Activation of RhoA in podocytes induces focal segmental glomerulosclerosis. J Am Soc Nephrol 22 (9):1621-1630. doi:10.1681/ASN.2010111146\u003c/li\u003e\n\u003cli\u003eMatsuda J, Asano-Matsuda K, Kitzler TM, Takano T (2021) Rho GTPase regulatory proteins in podocytes. Kidney Int 99 (2):336-345. doi:10.1016/j.kint.2020.08.035\u003c/li\u003e\n\u003cli\u003eHirose A, Tanikawa T, Mori H, Okada Y, Tanaka Y (2010) Advanced glycation end products increase endothelial permeability through the RAGE/Rho signaling pathway. FEBS Lett 584 (1):61-66. doi:10.1016/j.febslet.2009.11.082\u003c/li\u003e\n\u003cli\u003eMontezano AC, De Lucca Camargo L, Persson P, Rios FJ, Harvey AP, Anagnostopoulou A, Palacios R, Gandara ACP, Alves-Lopes R, Neves KB, Dulak-Lis M, Holterman CE, de Oliveira PL, Graham D, Kennedy C, Touyz RM (2018) NADPH Oxidase 5 Is a Pro-Contractile Nox Isoform and a Point of Cross-Talk for Calcium and Redox Signaling-Implications in Vascular Function. J Am Heart Assoc 7 (12). doi:10.1161/JAHA.118.009388\u003c/li\u003e\n\u003cli\u003eJha JC, Banal C, Okabe J, Gray SP, Hettige T, Chow BSM, Thallas-Bonke V, De Vos L, Holterman CE, Coughlan MT, Power DA, Skene A, Ekinci EI, Cooper ME, Touyz RM, Kennedy CR, Jandeleit-Dahm K (2017) NADPH Oxidase Nox5 Accelerates Renal Injury in Diabetic Nephropathy. Diabetes 66 (10):2691-2703. doi:10.2337/db16-1585\u003c/li\u003e\n\u003cli\u003eHolterman CE, Thibodeau JF, Towaij C, Gutsol A, Montezano AC, Parks RJ, Cooper ME, Touyz RM, Kennedy CR (2014) Nephropathy and elevated BP in mice with podocyte-specific NADPH oxidase 5 expression. J Am Soc Nephrol 25 (4):784-797. doi:10.1681/ASN.2013040371\u003c/li\u003e\n\u003cli\u003eNoor S, Mohammad T, Ashraf GM, Farhat J, Bilgrami AL, Eapen MS, Sohal SS, Yadav DK, Hassan MI (2021) Mechanistic insights into the role of serum-glucocorticoid kinase 1 in diabetic nephropathy: A systematic review. Int J Biol Macromol 193 (Pt A):562-573. doi:10.1016/j.ijbiomac.2021.10.165\u003c/li\u003e\n\u003cli\u003eLang F, Bohmer C, Palmada M, Seebohm G, Strutz-Seebohm N, Vallon V (2006) (Patho)physiological significance of the serum- and glucocorticoid-inducible kinase isoforms. Physiol Rev 86 (4):1151-1178. doi:10.1152/physrev.00050.2005\u003c/li\u003e\n\u003cli\u003eKobayashi T, Deak M, Morrice N, Cohen P (1999) Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344 Pt 1 (Pt 1):189-197\u003c/li\u003e\n\u003cli\u003eKoshikawa M, Mukoyama M, Mori K, Suganami T, Sawai K, Yoshioka T, Nagae T, Yokoi H, Kawachi H, Shimizu F, Sugawara A, Nakao K (2005) Role of p38 mitogen-activated protein kinase activation in podocyte injury and proteinuria in experimental nephrotic syndrome. J Am Soc Nephrol 16 (9):2690-2701. doi:10.1681/ASN.2004121084\u003c/li\u003e\n\u003cli\u003eHirohama D, Nishimoto M, Ayuzawa N, Kawarazaki W, Fujii W, Oba S, Shibata S, Marumo T, Fujita T (2021) Activation of Rac1-Mineralocorticoid Receptor Pathway Contributes to Renal Injury in Salt-Loaded db/db Mice. Hypertension 78 (1):82-93. doi:10.1161/HYPERTENSIONAHA.121.17263\u003c/li\u003e\n\u003cli\u003eBakris GL, Agarwal R, Anker SD, Pitt B, Ruilope LM, Rossing P, Kolkhof P, Nowack C, Schloemer P, Joseph A, Filippatos G, Investigators F-D (2020) Effect of Finerenone on Chronic Kidney Disease Outcomes in Type 2 Diabetes. N Engl J Med 383 (23):2219-2229. doi:10.1056/NEJMoa2025845\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7674021/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7674021/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePodocyte injury is a key driver of Fabry nephropathy (FN), precipitating proteinuria and renal decline. Although mechanisms remain partially elucidated, dysregulated pathways involving mineralocorticoid receptor (MR) activation and Rac1-SGK1 signaling are implicated. This study investigates the role of MR/Rac1/SGK1 signaling and evaluates the nephroprotective potential of MR antagonists (finerenone, spironolactone) and Rac1 inhibition in FN.\u003c/p\u003e\u003cp\u003eAn in vitro FD model was established via stable shRNA-mediated knockdown of GLA in a human podocyte cell line. The model was confirmed by a significant reduction in both GLA mRNA (RT-qPCR) and α-galactosidaseA protein (Western blot). Experimental groups included wild-type (WT) and GLA-deficient podocytes, subsequently treated with finerenone, spironolactone, or the Rac1 inhibitor, NSC23766. CCK-8 assays determined non-cytotoxic concentrations as10 nM finerenone, 25 \u0026micro;M spironolactone, and 50 \u0026micro;M NSC23766. The mRNA levels of MR, aldosterone, cortisol, Rac1, SGK1, 11β-HSD1, NOX5, IL-6, RhoA, Cdc42 and Rac1 protein levels were analyzed before and after treatment with finerenone, spironolactone, or NSC23766.\u003c/p\u003e\u003cp\u003eCompared to WT, Fabry podocytes exhibited significant upregulation in gene expression for MR, aldosterone, cortisol, 11β-HSD1, Rac1, SGK1, NOX5, Cdc42, and IL-6, alongside downregulated RhoA. Consistent with these findings, Rac1 protein levels were also elevated. Treatment with finerenone or spironolactone markedly reduced gene expression of Rac1, SGK1, NOX5, 11β-HSD1, IL-6, Cdc42, and MR, decreased Rac1 protein, and increased RhoA transcription. Pharmacological Rac1 inhibition recapitulated these effects.\u003c/p\u003e\u003cp\u003eHyperactive MR-Rac1-SGK1 signaling might be a pivotal driver of podocyte injury in FN. Both MR antagonists and Rac1 inhibition normalize the dysregulation and restore RhoA, suggesting cytoskeletal stabilization. Finerenone, spironolactone, and Rac1 inhibition represent promising adjunct therapies in FN.\u003c/p\u003e","manuscriptTitle":"Mineralocorticoid Receptor/Rac1-Driven Podocyte Injury in Fabry Disease: Finerenone and Spironolactone migitate the overactive signaling cascade","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-17 06:31:08","doi":"10.21203/rs.3.rs-7674021/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2239e64c-ab07-4d39-a3d8-e0891718a0bf","owner":[],"postedDate":"October 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":56377459,"name":"Biological sciences/Cell biology"},{"id":56377460,"name":"Health sciences/Diseases"},{"id":56377461,"name":"Biological sciences/Molecular biology"},{"id":56377462,"name":"Health sciences/Nephrology"}],"tags":[],"updatedAt":"2025-11-11T07:08:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-17 06:31:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7674021","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7674021","identity":"rs-7674021","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00