Is breast cancer in women caused by bovine leukaemia virus and Mycoplasma spp.? An investigation from South Brazil

Is breast cancer in women caused by bovine leukaemia virus and Mycoplasma spp.? An investigation from South Brazil | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Is breast cancer in women caused by bovine leukaemia virus and Mycoplasma spp.? An investigation from South Brazil Juliana do Canto Olegário, Raíssa Canova, Sirlei dos Santos Costa, and 10 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7079614/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bovine leukaemia virus (BLV) is a widespread Deltaretrovirus that remains mostly asymptomatic in cattle but can lead to B-cell lymphoma. Evidence suggests that BLV may infect humans and has been associated with breast cancer. Mycoplasma spp. are bacteria linked to various human diseases, including cancer. This study investigated the presence of BLV and Mycoplasma spp. DNA in fresh and formalin-fixed paraffin-embedded (FFPE) breast tissue and leukocyte samples from 100 women undergoing breast surgery in South Brazil. Polymerase chain reaction (PCR) and nested-PCR targeted four BLV genes in fresh tissue and leukocytes, and two genes in 30 FFPE samples from 21 patients. Fresh tissue was also tested for Mycoplasma spp. One fresh breast tissue sample was positive for the BLV tax gene, confirmed by Sanger sequencing. All leukocyte and FFPE samples were negative for BLV. Mycoplasma spp. DNA was not detected in any fresh tissue sample. Compared to previous studies reporting BLV DNA in fresh tissue from Colombian women and FFPE samples in Brazil, our findings show a lower frequency. The negative results in leukocytes and FFPE samples support the hypothesis that most women in this study were not infected with BLV or Mycoplasma . Biological sciences/Cancer Health sciences/Diseases Biological sciences/Microbiology Biological sciences/Molecular biology Health sciences/Oncology bovine leukaemia virus breast cancer fresh tissue human breast Mycoplasma zoonosis 1. Introduction In recent years, there has been a concentrated effort to investigate the interconnections between various infectious agents, including papillomavirus, hepatitis B virus, and Epstein‒Barr virus, and bacteria, such as Streptococcus bovis, Salmonella typhi, Chlamydia pneumoniae, Bartonella, Helicobacter pylori , and Mycoplasma , and the aetiology of cancer ( 1 ). Bovine leukaemia virus (BLV) is a member of the Deltaretrovirus genus within the Retroviridae family and is genetically related to the human T-lymphotropic virus (HTLV) associated with adult T-cell leukaemia/lymphoma ( 2 ). BLV primarily infects B lymphocytes but also other immune cells ( 3 ), mammary epithelial cells ( 4 ) and endothelial cells of cattle ( 5 ) and is the causative agent of enzootic bovine leukosis (EBL). BLV causes widespread bovine infection in many regions and remains asymptomatic in most animals but can lead to lymphoma due to the mono- or oligo-clonal proliferation of CD5 + B cells after a latency period ( 6 ). The oncogenic potential of BLVs is associated mainly with Tax, a regulatory protein unique to deltaretroviruses that is responsible for activating proviral transcription and capable of inducing cell transformation via different mechanisms that are not yet completely understood ( 7 , 8 ). Like all retroviruses, the BLV genome also has gag , pro, pol and env genes encoding capsid proteins, viral proteases and polymerases, and envelope proteins, respectively, along with two identical long terminal repeat (LTR) chains at the 5’ and 3’ ends ( 9 ). Viral transmission occurs via the transfer of cells from infected animals to naïve animals, primarily through contact with blood ( 10 ) but also through the transfer of other bodily fluids, such as nasal and bronchial secretions ( 11 ), and the ingestion of milk and colostrum ( 12 , 13 ). In addition to cattle, natural infection has been reported in water buffaloes ( 14 ), capybaras ( 15 ), alpacas ( 16 ) and yaks ( 17 ), but BLV can infect experimentally a wide range of other animals, such as sheep, rats, rabbits, chickens and goats, as well as human cells in vitro ( 18 – 22 ). There is increasing evidence that humans are susceptible to BLV infection, which may be associated with breast cancer in women. Viral DNA has been detected in mammary tissue samples from women in Colombia ( 23 , 24 ), the United States ( 25 – 27 ), Australia ( 28 ), Argentina ( 29 ), Brazil ( 30 – 32 ), Iran ( 33 ), Pakistan ( 34 ), Egypt ( 35 ) and Jordan ( 36 ), as well as in blood ( 37 , 38 ), lung squamous cell carcinoma ( 39 ) and lymphoma tissue samples ( 40 ) from humans. The capsid protein p24 has also been identified in the mammary secretory epithelium of the United States and Colombian women ( 24 , 25 ). In addition, several studies were able to significantly correlate the presence of BLV DNA with breast cancer diagnosis ( 24 , 26 – 28 , 30 ), with odds ratios ranging from 0.39 in Pakistan ( 34 ) to 15.82 in Brazil ( 31 ). In contrast, other researchers reported the absence of BLV provirus detection in breast tissue and leucocyte samples from China ( 41 ), Japan ( 42 ), the US, Mexico and Vietnam ( 43 – 45 ), and northeastern Brazil [46, preprint]. Since the virus is present in milk and meat from infected cattle, it is speculated that the main contamination route for humans is consuming bovine-derived food products that have not received adequate heat treatment ( 47 , 48 ). One of the suspected prokaryotes involved in malignancy is Mycoplasma , which are small bacteria with a range of effects on host cells, including alterations in the cell cycle, signalling, and inflammation ( 49 ). In recent years, the association between these bacteria and tumours in humans and other animal species has rapidly evolved ( 50 ). However, the exact connection between Mycoplasma spp. infection and tumours is still under investigation. Recent studies suggest a potential association between chronic Mycoplasma infection and the development of certain types of cancer ( 51 – 53 ), and its presence has been detected in tumours from various tissues, including the lung, breast, prostate, and cervix ( 1 , 49 , 53 – 55 ). These infections are associated with alterations in the tumour microenvironment, which can promote progression and resistance to conventional therapies ( 56 ). Moreover, research suggests that Mycoplasma spp. can trigger complex immune responses, which affects tumour development and dissemination ( 49 ). Most of the published studies that were able to amplify BLV DNA from human mammary tissue have used formalin-fixed paraffin-embedded (FFPE) samples ( 23 , 25 – 36 ), which are known to be more challenging to work with because of the damage and fragmentation that formalin fixation causes to nucleic acids. One study from Colombia identified viral DNA in fresh breast tissue ( 24 ), and one study from the US reported a lack of BLV DNA in fresh-frozen breast cancer tumours ( 45 ). Based on an initial hypothesis that working with fresh-frozen tissue would result in more positive samples due to the possibility of obtaining higher DNA quantity and quality, our study aimed to investigate the presence of BLV in fresh human breast tissue and blood samples from women in southern Brazil. We performed PCR and nested PCR to detect four viral genes (LTR, pol , env and tax ). To compare the results in different sample types, we also performed nested PCR targeting the env and tax genes of BLV in FFPE breast tissues derived from the same subjects as the fresh tissue and blood samples. In addition, we also intended to examine the presence of Mycoplasma spp. DNA in fresh-frozen tissue samples via PCR. Our study represents an important step towards understanding the potential risk of BLV and Mycoplasma spp. infection in humans. 2. Results 2.1 Sampling and DNA isolation In the analysis of personal data collected from the participants, the patients’ mean age at the time of surgery was 51.5 ± 14 years, ranging from 18 to 84 years. Ninety-eight percent self-declared their colour/race as white, and 2% self-declared it as a mixed race. Ninety-one percent lived in urban areas, whereas 9% lived in rural areas. For dietary habits, 89% and 93% of the participants reported regular consumption of meat and dairy products, respectively. Most individuals consumed meat at least three times a week (70/89) and dairy up to five or more times a week (52/93). In relation to cooking and heat treatment preferences, participants consumed mostly well-cooked meat (61/89) and pasteurized or ultrahigh temperature (UHT)-processed milk (92/93), with only one individual reporting the consumption of raw milk. Seventy-one percent had a history of cancer in the family, including breast cancer and various other types of cancer. Among the 100 samples tested, 40 were positive for breast cancer. The DNA extracted from 100 fresh breast tissues and 100 buffy coats had purity scores (A260/280) ranging from 1.25 to 2.06 and recovery rates ranging from 7.1 to 783.1 ng/µL. A 237 bp fragment of the human GAPDH gene was successfully amplified from all the samples. For the DNA isolated from the 30 FFPE tissue samples, the purity and recovery rates ranged from 1.55 to 2.09 ng/µL and from 5.1 to 163.8 ng/µL, respectively, and all the samples amplified a 98 bp fragment of the human beta-actin gene. 2.2 BLV and Mycoplasma spp. investigations Among all fresh breast tissue and blood samples tested for four BLV genes by PCR and nested PCR, one breast tissue sample, named 72 and belonging to a patient without a breast cancer diagnosis, was positive for the tax gene but negative for the env , pol and LTR genes. A second-round PCR with a different pair of inner primers was performed to amplify a 206 bp fragment of tax , and the amplified product was purified and subjected to Sanger sequencing. The resulting sequence was compared through nucleotide MegaBlast with sequences available at GenBank and obtained a degree of similarity of 100% (100% query coverage) with many BLV sequences identified in cattle, thus confirming the result. No other fresh tissue samples, along with the buffy coat samples, were positive for BLV DNA. In addition, Mycoplasma spp. was not detected in any of the investigated fresh-frozen breast tissue samples. FFPE tissues tested for BLV env and tax genes by seminested and nested PCR were all negative for both genes. Moreover, none of the 30 samples analysed from 21 participants belonged to patient 72, whose fresh tissue amplified the tax gene, making the comparison of results between different processed tissue samples from that patient impossible. 3. Discussion There is accumulated evidence regarding the detection of BLV and Mycoplasma spp. in human samples and the association between these pathogens and cancer diagnosis. Nonetheless, this matter has not yet been settled, and more studies exploring the potential of different types of samples and detection techniques are needed to better understand these topics. Notably, most published studies with BLV analysed the presence of viral DNA in FFPE breast tissue from women via methods like in situ PCR performed directly on the tissue slide or liquid phase PCR, which requires DNA extraction (23,25–36). However, the fixation and embedding processes cause significant damage to nucleic acids due to alterations such as cross-linking, fragmentation, and chemical modifications, making working with FFPE samples quite tricky and challenging. Mycoplasma spp. were not detected in the breast tissue samples from women with and without breast cancer in our study. In contrast, a study carried out in China reported the presence of Mycoplasma spp. in 39.7% of FFPE breast cancer samples via immunohistochemistry (58). Currently, no other studies in the literature have investigated the presence of Mycoplasma spp. in human breast tumours. Nevertheless, Mycoplasma infections associated with human cancer have been widely reported via molecular approaches, mostly involving M. hyorhinis , M. penetrans , M. hominis , M. salivarium , and M. genitalium species (59,60). Notably, recovering bacterial DNA from FFPE tissue is still a challenge, and DNA from such samples is a poor template for PCR assays due to its fragmentation. The sample source used in this study for the molecular investigation of Mycoplasma spp. was fresh-frozen breast tissue, which supports the finding that no women included in the research were infected with Mycoplasma spp. In addition, we investigated the presence of BLV DNA in fresh-frozen breast tissue from female patients with and without a breast cancer diagnosis, as well as in blood and FFPE tissue from the participants, via PCR and nested PCR targeting four viral genes. To our knowledge, two published studies have investigated the presence of proviral DNA in fresh-frozen breast tissue samples. One reported the detection of BLV DNA in a high number of fresh mammary samples from Colombian women collected during surgery specifically for this purpose and frozen until processing (24), whereas the other did not find BLV DNA in breast cancer tumours from women in a rural state in the U.S. (45); thus, the evidence concerning this topic is controversial. We initially hypothesized that working with fresh tissue would result in more positive samples than working with FFPE tissue because of the possibility of obtaining higher-quality and quantity DNA. Nonetheless, only one sample amplified the viral gene tax , which we confirmed by Sanger sequencing. This finding is consistent with other reports where the highly conserved tax gene was detected more frequently in human samples than other BLV genes (25,31,33). Evidence shows that segments of viral genomic regions such as env , pol and gag are deleted from the provirus to evade the host immune response (7). Our findings contrast with study results from Colombia, where viral DNA was detected in 63 out of 158 fresh tissues with malignant or benign tumours (24). However, these findings are similar to those reported by Amato et al. (45) in the US, where no evidence of proviral DNA was found in breast tumour samples. Both studies used a similar liquid-phase nested-PCR protocol and the same primer pairs targeting the tax gene previously described by Buehring et al. [25], which we employed in our experiments. Our results suggest two possible conclusions. First, limitations in our sampling method led to the absence of amplification of viral and bacterial genes in most tissues; second, all patients except one were indeed negative for BLV and Mycoplasma spp. DNA. We had some disadvantages regarding our fresh tissue samples, which could be a reason for not detecting viral and bacterial DNA. The tissue fragments were collected randomly from the breasts of the patients during surgery in areas adjacent to the malignant or benign lesions when present. Regardless of size, the tumours were removed and sent entirely to the pathology laboratory responsible for the histological diagnosis of breast cancer and subjected to FFPE processing, which indicated that all analysed fresh samples were healthy tissue fragments. Although BLV has been identified in breast tissue without any specific pathology from women subjected to reduction mammoplasty or a similar intervention (31–33), including the positive sample in this study, the prevalence of viral DNA is greater in samples with malignant changes, and amplification is usually achieved within the benign or malignant lesions of FFPE tissues in both the case and control groups (26,27,30). Furthermore, it can be difficult to evaluate fat tissue content macroscopically and differentiate it from mammary epithelial tissue precisely. Therefore, even though we tried to avoid tissue areas with a high-fat content when collecting samples and extracting DNA, some fragments still had a considerable fat percentage, and it has been shown in previous studies that viral detection occurs inside mammary secretory epithelial cells (25,26,28). Olaya-Galán et al. (24) selected only fresh samples from malignant, premalignant and benign tumours with enough material for histopathological and molecular analysis and excluded tissues with a high-fat content, which could explain their relatively high viral detection rate. To circumvent this issue, we subjected 30 FFPE breast tissue samples from 21 participants to PCRs targeting the env and tax genes, selecting areas with large numbers of epithelial cells and evidence of benign or malignant pathology, if present, and cut them from the paraffin blocks with a 2 mm dermatological punch. Despite the damage caused by fixation and paraffinization, FFPE tissue could be a better option for BLV proviral detection because the breast is characterized by a high-fat content and, therefore, the possibility of avoiding adipose cells and identifying precisely the epithelial cells where the virus is expected to be. We quantified and checked the purity of the isolated DNA via a NanoDrop spectrophotometer. The quality of the DNA was verified via amplification of the human beta-actin gene, to which 30 samples were positive. All the results were negative for viral amplification, which favours the conclusion that most women in our study were indeed negative for BLV DNA. To address this possibility, we also collected and tested buffy coats from participants’ blood samples, which were all negative for the four viral genes assessed. Although there are fewer reports of BLV DNA detected in human blood than in breast tissue, Buhering et al. (37) and Mendoza et al. (38) identified the provirus in 38% and 13% of analysed blood samples in the US and Colombia, respectively, and Olaya-Galán et al. (24) reported evidence of the presence of the virus in both breast tissue and blood from the same patients, with a concordance of 94%. Consequently, the fact that no blood samples were positive for the virus supports the negative results found in tissues and indicates that nearly all tested women were not infected with BLV. However, this is contrary to previously published reports from Brazil, where proviral DNA was identified in 44.4% (30), 79.5% (31) and 86.4% (32) of FFPE tissue samples from female subjects. These differences could be due to several inherent aspects of the studied population, such as geographical location. Delarmelina et al. [31] speculated that the high prevalence of BLV DNA found in samples from Minas Gerais State was related to the regional tradition of consuming unpasteurized dairy products. Mendoza et al. [37] reported a significant relationship between the molecular detection of BLV in human blood samples and veterinary occupation, as well as a greater risk of acquiring the virus in individuals with a history of at least one accident with surgical material during work with animals. Although a large portion of the patients in our study reported regular meat and dairy consumption, most products underwent heat processes that inactivated the virus. In addition, most of our samples were obtained from patients who lived in urban areas and had little contact with rural areas. Recently, da Mota Nunes et al. (46) reported in a preprint article the absence of BLV DNA in FFPE breast cancer samples from women in northeastern Brazil, although human papillomavirus (HPV) DNA was detected in 46.2% of the same samples. These authors speculated that the negative result for BLV could be due to environmental factors such as lower meat consumption and coinfections with different viruses. The primer pairs and PCR protocols used in our study to detect viral DNA in blood, fresh and FFPE tissue samples and controls were chosen based on previous reports and have been utilized in many published studies. Additionally, one strength of our research is that we had bovine positive controls equivalent to the human samples we worked with. We used positive controls based on fresh and FFPE lymphoma tissue and blood drawn from cattle with EBL. Furthermore, all extracted DNA from human samples was evaluated through spectrophotometry and PCRs targeting human housekeeping genes. This suggests our results were not due to limitations in the selected methodology for processing and testing samples. Nevertheless, as highlighted by Adekanmbi et al. (44), testing the same set of samples by all reported detection methods would be beneficial for resolving the current contradictory evidence regarding BLV detection in human samples and its role in breast cancer. Moreover, more studies testing different samples (e.g., fresh tissue, FFPE tissue, and blood) from the same patients with these techniques could help elucidate this topic. 4. Conclusions In conclusion, our work is one of the few existing studies that explored the presence of BLV and Mycoplasma spp. DNA in fresh-frozen breast tissue, as well as viral DNA in leukocytes and FFPE breast tissue, from women with and without a breast cancer diagnosis in South Brazil. We detected the BLV tax gene in only one tissue sample, while Mycoplasma spp. DNA was absent. These findings revealed a lower frequency of BLV and Mycoplasma spp. detection than other studies did. Nevertheless, the negative results in the leukocyte and FFPE samples suggest that most women in this study were not infected with BLV. 5. Methods 5.1 Fresh tissue and blood samples Between August 2020 and January 2023, fresh mammary tissue and blood samples were collected from 100 self-selected female patients undergoing breast surgery at Moinhos de Vento Hospital (HMV) in Porto Alegre city, Rio Grande do Sul state, southern Brazil. Women were invited to participate during the consultation and voluntarily signed informed consent agreements to have samples and personal information collected and used in the study. Individuals over 18 and under 90 years of age were included regardless of diagnosis and type of surgical intervention (e.g., mastectomy; breast segmentectomy; reduction or augmentation mammoplasty), but current treatment with antiretroviral drugs was an exclusion criterion. The use of human subjects was performed in accordance with the World Medical Association Declaration of Helsinki and the 466/12 Resolution for guidelines and regulations of research involving human beings from the National Health Council of the Brazilian Ministry of Health. The study was approved by the Committees on Research Ethics of HMV (protocol number: 4.173.386). All data were used with confidentiality. Five fragments of approximately 100 mg of fresh tissue were randomly collected from each patient during surgery and stored in microtubes, trying to avoid areas with high-fat content. Blood was drawn into two tubes containing EDTA anticoagulant during the preanaesthetic routine. The samples were refrigerated for a maximum of 24 hours until they were transferred to the research laboratory, where the tissues were immediately frozen at -80°C and the blood was centrifuged at 500 × g for 10 minutes. The buffy coat and plasma were transferred to separate microtubes and frozen at -80°C until processing. 5.2 FFPE tissue samples A total of 30 FFPE breast tissues from 21 participants were used in our study. Upon surgical removal, the tissue fragments were fixed with 10% buffered formalin for 24–48 hours and subsequently embedded in paraffin blocks. Microscopic slides were made for histopathological diagnosis of breast cancer and for identifying tissue areas with large amounts of mammary epithelial cells to be used for DNA extraction. 5.3 DNA isolation DNA was extracted from fresh tissues, buffy coats and controls with QIAamp® DNA Mini Kit (QIAGEN, Germany). Approximately 25 mg of tissue and 200 µL of leucocytes from each patient and controls were processed following the manufacturer’s instructions, and the DNA was eluted in 50 µL of elution buffer. DNA isolation from FFPE samples and controls was performed with QIAamp® DNA FFPE Tissue Kit (QIAGEN, Germany). After the selection of tissue areas with large clusters of mammary epithelial cells, 4–5 2 mm diameter tissue fragments were extracted from each block with a disposable sterile dermatological punch, transferred to a microtube, deparaffinized with 1 mL of xylene and washed twice with 1 mL of 100% ethanol. The recovered DNA was eluted in 30 µL of elution buffer. The quantity and purity of the DNA extracted from all the samples and controls were verified with a NanoDrop Lite (Thermo Fisher Scientific, USA). The quality of human DNA was assessed by amplifying the human housekeeping genes GAPDH ( 25 ) and beta-actin ( 31 ) in fresh and FFPE samples, respectively. 5.4 Molecular detection of BLV and Mycoplasma spp. DNA For the presence of the BLV env , pol , LTR, and tax genes in fresh tissue and blood, the evaluation was performed via PCR and nested PCR with specific primers previously described in the literature ( 25 , 57 ). Reactions were prepared with buffer, 1.5 mM magnesium chloride, 0.2 mM each dNTP, 0.2–0.4 µM forward primer and 0.2–0.4 µM reverse primer, 1.25 units of GoTaq® DNA Polymerase (Promega, USA), 20–100 ng of template DNA or 2 µL of the first-round PCR product, and nuclease-free water to a final volume of 25 µL. For sequencing of positive samples for the tax gene, a second pair of inner primers was used to amplify a longer product in positive samples ( 25 ) compared to the 113 bp fragment obtained with the first pair of inner primers. For FFPE tissue samples, semi-nested and nested PCR amplification was conducted to target the tax and env genes, respectively ( 31 ). For tax detection, the second pair of inner primers amplifying a 206 bp fragment was used as the outer primer in the first step of the nested-PCR assay, followed by a subsequent reaction with the inner primers to amplify a 113 bp fragment, as described by Delarmelina et al. [31]. The PCR mixture was prepared as described above. For positive controls of BLV, fragments of tumours in the lymphoid organs of two adult cattle that had clinical and necropsy signs suggestive of EBL were provided by the Veterinary Pathology Sector (SPV) of the Federal University of Rio Grande do Sul (UFRGS). Additionally, blood drawn from an adult cow with clinical signs compatible with EBL was provided by the Large Ruminant Sector (SGR) of UFRGS, and the buffy coat and plasma were separated as described for human blood samples. Bovine fresh-frozen tumours and buffy coats were confirmed positive for BLV DNA by PCRs targeting the env , LTR, pol , and tax genes. Tumours and buffy coats were used as positive controls in processing fresh-frozen tissue and blood samples from human patients. For the positive control for FFPE tissue sample processing, fragments of the same cattle BLV-derived tumours described above were subjected to formalin fixation for 24 hours with 10% buffered formalin and paraffin embedding. Ultrapure DNase and RNase-free water were used as negative controls. DNA from positive and negative controls was isolated as described previously. A conventional PCR assay was performed to detect Mycoplasma spp. in the fresh-frozen breast tissue samples. Each reaction contained 1 U of Taq DNA polymerase, recombinant (Thermo Fisher Scientific, USA), 10× reaction buffer, 1.5 mM MgCl 2 , 0.4 µM each primer, 0.2 mM dNTPs, and 50 ng of template DNA. The PCR amplification conditions included initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 1 min, annealing at 54°C for 45 s, and extension at 72°C for 45 s, with a final extension at 72°C for 5 min. The Mycoplasma hyopneumoniae 7448 strain was used as a positive control. Details regarding all PCR assays performed for BLV and Mycoplasma spp. DNA detection, and housekeeping genes, in fresh-frozen tissue, buffy coat, and FFPE tissue samples are described in Table 1 . Table 1 Primers and PCR conditions for analysing breast tissue and buffy coat samples for BLV, Mycoplasma spp., and housekeeping genes. Target Primer sequences (5’-3’) Nested-PCR Annealing temp. (ºC) Amplicon size (bp) Analyzed sample Reference GAPDH F: CCTTCATTGACCTTCACTACATGGTCTA R: GCTGTAGCCAAATTCATTGTCGTACCA - 50 237 Fresh-frozen breast tissue Buffy coat [25] Beta-actin F: GGCATCCTGACCCTGAAGTA R: CGCAGCTCGTTGTAGAAGGT - 60 98 FFPE breast tissue [31] BLV env F: CTTTGTGTGCCAAGTCTCCCAGATACA R: CCAACATATAGCACAGTCTGGGAAGGC - 60 440 Fresh-frozen breast tissue Buffy coat [57] F: TGATTGCGAGCCCCGATG R: GGAAAGTCGGGTTGAGGG Outer 60 230 FFPE breast tissue [31] F: CCTCCCAGGCCGATCAAG Inner 58 165 BLV pol F: TAGCCTACGTACATCTAACC R: AATCCAATTGTCTAGAGAGG Outer 52 232 Fresh-frozen breast tissue Buffy coat [25] F: GGTCCACCCTGGTACTCTTC R: TATGGGCTTGGCATACGAGC Inner 57 157 BLV LTR F: TAGGAGCCGCCACCGC R: GCGGTGGTCTCAGCCGA Outer 57 329 Fresh-frozen breast tissue Buffy coat F: AAACTGCAGCGTAAACCAGACAGAGACG R: CACCCTCCAAACCGTGCTTG Inner 58 290 BLV tax F: CTTCGGGATCCATTACCTGA R: GCTCGAAGGGGGAAAGTGAA Outer 55 373 Fresh-frozen breast tissue Buffy coat FFPE breast tissue F: ATGTCACCATCGATGCCTGG R: CATCGGCGGTCCAGTTGATA Inner 55 113 F: GGCCCCACTCTCTACATGC R: AGACATGCAGTCGAGGGAAC Inner 2 (Outer for FFPE samples) 56 206 Mycoplasma spp. F: ACACCATGGGAGCTGGTAAT R: CGTAGGTTGTACTCCGTAGAAAGG - 54 150 Fresh-frozen breast tissue In this study 1. Primer sequences, annealing temperatures in ºC, amplicon sizes in number of base pairs, and sample types analyzed for each target are described in the table. GAPDH was used as a housekeeping gene for quality control of fresh breast tissue and buffy coat sample, and beta-actin was used for FFPE tissue samples. Four BLV genes, env , pol , long terminal repeat (LTR), and tax , were analyzed by PCR and nested-PCR in fresh breast tissue and buffy coat samples, while tax was also tested in FFPE samples using an additional internal primer set. Mycoplasma spp. detection was performed in fresh breast tissue using primers developed in this study. Amplicon sizes ranged from 98 to 440 bp, and annealing temperatures varied from 50°C to 60°C. References are provided for previously published primers. Precautions were taken to guarantee result reliability and to prevent cross-contamination between samples and positive controls. A DNA-free room equipped with specific materials was used exclusively to prepare PCR mixtures, while extracted DNA and the first-round PCR product were handled in different rooms. A maximum of 18 samples, plus positive and negative controls, were processed at a time, and at least one positive control and one negative control were added to each batch during the execution of the experiments. The results for BLV and Mycoplasma spp. detection were assessed via the electrophoresis of PCR products in 1.5–2% agarose gels using a fluorescent nucleic acid dye with Gel Red, bromophenol and xylene cyanol (Quatro G Biotecnologia, Brazil). Amplified products from positive samples were purified with a ReliaPrep™ DNA Clean-up and Concentration System Kit (Promega, USA) following the manufacturer's instructions. Both forward and reverse DNA strands were subjected to Sanger sequencing with an ABI PRISM 3100 Genetic Analyser using BigDye Terminator v.3.1 Cycle Sequencing Kit (Thermo Scientific, USA) to confirm the specificity of the amplification products. The obtained sequences were compared with sequences available in GenBank through nucleotide MegaBlast. Samples showing amplified products with the expected sizes via electrophoresis were considered positive when positive and negative controls did and did not present amplification, respectively, and after confirmation by sequencing. Declarations Data Availability The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Acknowledgements We sincerely thank the Veterinary Pathology Sector (SPV) and the Large Ruminant Sector (SGR) for their support in providing the samples used as positive controls in this study. We acknowledge the efforts of all individuals involved in sample collection and processing. Funding The following Brazilian Institutes supported this study: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq nº 405786/2022-0), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Finance Code 001, Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (FAPERGS nº 23/2551-0002221-4), and Pró-Reitoria de Pesquisa (PROPESQ-UFRGS). The authors thank these institutes for their financial support. Author Contributions Statement JCO was involved in conceptualization, formal sample analysis, defining the methodology and writing of the original draft; RC was involved in conceptualization, formal sample analysis, defining the methodology, project administration and writing of the original draft; SSC was involved in defining the methodology, project administration, review and editing of the manuscript; RMB was involved in defining the methodology, project administration, review and editing of the manuscript; ACKP was involved in defining the methodology, project administration, review and editing of the manuscript; ALM was involved in defining the methodology and formal sample analysis; FAM was involved in formal sample analysis; BSC was involved in formal sample analysis; VR was involved in formal sample analysis; MED was involved in defining the methodology, formal sample analysis and writing of the original draft; GMB was involved in defining the methodology, formal sample analysis and writing of the original draft; FMS was involved in defining the methodology, project supervision, review and editing of the manuscript; CWC was involved in conceptualization, defining the methodology, project supervision, review and editing of the manuscript. All authors read and approved the final manuscript. Additional Information The authors declare that they have no competing interest. Ethics approval and consent to participate This study was approved by the Committees on Research Ethics of Moinhos de Vento Hospital under protocol number 4.173.386 in July 2020. The use of human subjects was performed in accordance with the World Medical Association Declaration of Helsinki and the 466/12 Resolution for guidelines and regulations of research involving human beings from the National Health Council of the Brazilian Ministry of Health. The privacy rights of human subjects have been observed and informed consent was obtained for experimentation with human subjects. Women invited to participate in this study voluntarily signed free and informed consent agreements (Termo de Consentimento Livre e Esclarecido – TCLE) to have samples and personal information collected and used in the study and future resultant publications, in a manner that does not allow the identification of specific individuals. References Yacoub E., Saed Abdul-Wahab O.M., Al-Shyarba M.H. & Ben Abdelmoumen Mardassi B. The Relationship between Mycoplasmas and Cancer: Is It Fact or Fiction? Narrative Review and Update on the Situation. J. Oncol . 2021 , 9986550; 10.1155/2021/9986550 (2021). Sagata N. et al. Complete nucleotide sequence of the genome of bovine leukemia virus: Its evolutionary relationship to other retroviruses. Proc. Natl. Acad. Sci. USA . 82 , 677-681; 10.1073/pnas.82.3.677 (1985). Schwartz I. & Lévy D. Pathobiology of bovine leukemia virus. Vet. Res . 25 , 521-536 (1994). Buehring G.C., Kramme P.M. & Schultz R.D. Evidence for bovine leukemia virus in the mammary epithelial cells of infected cows. Lab Invest. 71 , 359-365 (1994). Rovnak J., Casey J.W., Boyd A.L., Gonda M.A. & Cockerell G.L. Isolation of bovine leukemia virus infected endothelial cells from cattle with persistent lymphocytosis. Lab. Invest . 65 , 192–202 (1991). Polat M., Takeshima S.N. & Aida Y. Epidemiology and genetic diversity of bovine leukemia virus. Virol. J . 14 , 209; 10.1186/s12985-017-0876-4 (2017). Gillet N. et al. Mechanisms of leukemogenesis induced by bovine leukemia virus: Prospects for novel anti-retroviral therapies in human. Retrovirology . 4 , 18; 10.1186/1742-4690-4-18 (2007). Rosewick N. et al. Cis-perturbation of cancer drivers by the HTLV-1/BLV proviruses is an early determinant of leukemogenesis. Nat. Commun . 8 , 15264; 10.1038/ncomms15264 (2017). Coffin J. et al. ICTV Virus Taxonomy Profile: Retroviridae 2021. Journal of General Virology . 102 ; 10.1099/JGV.0.001712 (2021). Hopkins S.G. & DiGiacomo R.F. Natural transmission of bovine leukemia virus in dairy and beef cattle. Vet. Clin. North. Am. Food. Anim. Pract . 13 , 107–128. 10.1016/S0749-0720(15)30367-4 (1997). Vahlenkamp T.W., Choudhury B. & Kuzmak J. Enzootic Bovine Leukosis in Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Terrestrial Manual) (ed. World Organisation for Animal Health) chapter 3.4.9 (Paris, 2018). Romero C.H., Cruz G.B. & Rowe C.A. Transmission of bovine leukaemia virus in milk. Trop. Anim. Health Prod . 15 , 215-218; 10.1007/BF02242060 (1983). Gutiérrez G., Lomonaco M., Alvarez I., Fernandez F. & Trono K. Characterization of colostrum from dams of BLV endemic dairy herds. Vet. Microbiol . 177 , 366–369; 10.1016/j.vetmic.2015.03.001 (2015). Meas S. et al. Infection of Bovine Immunodeficiency Virus and Bovine Leukemia Virus in Water Buffalo and Cattle Populations in Pakistan. J. Vet. Med. Sci . 62 , 329-331; 10.1292/jvms.62.329 (2000). Burny A. et al. Bovine Leukaemia: Facts and Hypotheses Derived from the Study of an Infectious Cancer. Vet. Microbiol . 17 , 197-218; 10.1016/0378-1135(88)90066-1 (1988). Lee L.C., Scarratt W.K., Buehring G.C. & Saunders G.K. Bovine leukemia virus infection in a juvenile alpaca with multicentric lymphoma. Can. Vet. J. 53 , 283-286 (2012). Ma J.G. et al. First Report of Bovine Leukemia Virus Infection in Yaks (Bos mutus) in China. Biomed. Res. Int . 2016 , 9170167; 10.1155/2016/9170167 (2016). Suneya M. et al. Induction of lymphosarcoma in sheep inoculated with bovine leukaemia virus. J. Comp. Pathol . 94 , 301–309; 10.1016/0021-9975(84)90048-3 (1984). Dimitrov P. et al. Pathological features of experimental bovine leukaemia viral (BLV) infection in rats and rabbits. Bull. Vet. Inst. Pulawy . 56 , 115–120; 10.2478/v10213-012-0021-5 (2012). Altanerova V., Ban J., Kettmann R. & Altaner C. Induction of leukemia in chicken by bovine leukemia virus due to insertional mutagenesis. Arch Geschwulstforsch . 60 , 89–96 (1990). Olson C., Kettmann R., Burny A. & Kaja R. Goat lymphosarcoma from bovine leukemia virus. J. Natl. Cancer Inst . 67 , 671–675 (1981). Olaya-Galán N.N. et al. In vitro Susceptibility of Human Cell Lines Infection by Bovine Leukemia Virus. Front. Microbiol . 13 , 793348; 10.3389/fmicb.2022.793348 (2022). Giovanna M., Carlos U.J., María U.A. & Gutierrez M.F. Bovine Leukemia Virus Gene Segment Detected in Human Breast Tissue. Open J. Med. Microbiol . 3 , 84–90; 10.4236/ojmm.2013.31013 (2013). Olaya-Galan N.N. et al. Risk factor for breast cancer development under exposure to bovine leukemia virus in Colombian women: A case-control study. PLoS One . 16 , e0257492; 10.1371/journal.pone.0257492 (2021). Buehring G.C. et al. Bovine leukemia virus DNA in human breast tissue. Emerg. Infect. Dis . 20 , 772–782; 10.3201/eid2005.131298 (2014). Buehring G.C et al. Exposure to bovine leukemia virus is associated with breast cancer: A case-control study. PLoS One . 10 , e0134304; 10.1371/journal.pone.0134304 (2015). Baltzell K.A. et al. Bovine leukemia virus linked to breast cancer but not coinfection with human papillomavirus: Case-control study of women in Texas. Cancer . 124 , 1342–1349; 10.1002/cncr.31169 (2018). Buehring G.C., Shen H.M., Schwartz D.A. & Lawson J.S. Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development. PLoS One . 12 , e0179367; 10.1371/journal.pone.0179367 (2017). Ceriani M.C. et al. Bovine leukemia virus presence in breast tissue of Argentinian women. Its association with cell proliferation and prognosis markers. Multidiscip. Cancer Investig . 2 , 16-24; 10.30699/acadpub.mci.4.16 (2018). Schwingel D., Andreolla A.P., Erpen L.M.S., Frandoloso R. & Kreutz L.C. Bovine leukemia virus DNA associated with breast cancer in women from South Brazil. Sci. Rep . 9 , 2949; 10.1038/s41598-019-39834-7 (2019). Delarmelina E. et al. High positivity values for bovine leukemia virus in human breast cancer cases from Minas Gerais, Brazil. PLoS One . 15 , e0239745; 10.1371/journal.pone.0239745 (2020). Canova R. et al. Bovine leukemia viral DNA found on human breast tissue is genetically related to the cattle virus. One Health . 13 , 100252; 10.1016/j.onehlt.2021.100252 (2021). Khalilian M., Hosseini S.M. & Madadgar O. Bovine leukemia virus detected in the breast tissue and blood of Iranian women. Microb. Pathog . 135 , 103566; 10.1016/j.micpath.2019.103566 (2019). Khan Z. et al. Molecular investigation of possible relationships concerning bovine leukemia virus and breast cancer. Sci. Rep . 12 , 4161; 10.1038/s41598-022-08181-5 (2022). Elmatbouly A., Badr R.I., Masallat D.T., Youssef M.Y. & Omar N.S. Prevalence of Bovine leukemia virus in Egyptian women’s breast cancer tissues. Egypt. J. Basic Appl. Sci . 10 , 824–34; 10.1080/2314808X.2023.2287811 (2023). Khasawneh A.I. et al. Are Mouse Mammary Tumor Virus and Bovine Leukemia Virus Linked to Breast Cancer among Jordanian Women?. Microbiol. Res . 15 , 914–925; 10.3390/microbiolres15020060 (2024). Buehring G.C. et al. Bovine leukemia virus discovered in human blood. BMC Infect. Dis . 19 , 297; 10.1186/s12879-019-3891-9 (2019). Mendoza W., Isaza J.P., López L., López-Herrera A. & Gutiérrez L.A. Bovine Leukemia Virus molecular detection and associated factors among dairy herd workers in Antioquia, Colombia. Acta Trop . 256 , 107253; 10.1016/j.actatropica.2024.107253 (2024). Robinson L.A. et al. Molecular evidence of viral DNA in non-small cell lung cancer and non-neoplastic lung. Br. J. Cancer . 115 , 497-504; 10.1038/bjc.2016.213 (2016). Taghadosi C., Kojouri G., Ahadi A., Hashemi Bahremani M. & Kojouri A. Bovine Leukaemia Virus Tax Antigen Identification in Human Lymphoma Tissue: Possibility of onco-protein Gene T transmission. Research in Molecular Medicine . 7 , 25–32; 10.32598/rmm.7.2.75 (2019). Zhang R. et al. Lack of association between bovine leukemia virus and breast cancer in Chinese patients. Breast Cancer Res . 18 , 101; 10.1186/s13058-016-0763-8 (2016). Yamanaka M.P. et al. No evidence of bovine leukemia virus proviral DNA and antibodies in human specimens from Japan. Retrovirology . 19 , 7; 10.1186/s12977-022-00592-6 (2022). Gillet N.A. & Willems L. Whole genome sequencing of 51 breast cancers reveals that tumors are devoid of bovine leukemia virus DNA. Retrovirology . 13 , 75; 10.1186/s12977-016-0308-3 (2016). Adekanmbi F. et al. Absence of bovine leukemia virus in the buffy coats of breast cancer cases from Alabama, USA. Microb. Pathog . 161 , 105238; 10.1016/j.micpath.2021.105238 (2021). Amato S. et al. Exploring the presence of bovine leukemia virus among breast cancer tumors in a rural state. Breast Cancer Res. Treat . 202 , 325–334; 10.1007/s10549-023-07061-4 (2023). Nunes Z.M. et al. Detection of Human Papillomavirus (HPV) and Bovine Leukemia Virus (BLV) in Breast Cancer Patients from Northeastern Brazil. Preprint; 10.20944/preprints202408.1024.v1 (2024). Olaya-Galán N.N. et al. Bovine leukaemia virus DNA in fresh milk and raw beef for human consumption. Epidemiol. Infect . 145 , 3125–3130; 10.1017/S0950268817002229 (2017). de Quadros D.L. et al. Oncogenic viral DNA related to human breast cancer found on cattle milk and meat. Comp. Immunol. Microbiol. Infect. Dis . 101 , 102053; 10.1016/j.cimid.2023.102053 (2023). Benedetti F., Curreli S. & Zella D. Mycoplasmas–host interaction: Mechanisms of inflammation and association with cellular transformation. Microorganisms . 8 , 1–21; 10.3390/microorganisms8091351 (2020). Barykova Y.A. et al. Association of Mycoplasma hominis infection with prostate cancer. Oncotarget . 2 , 289-297; 10.18632/oncotarget.256 (2011). Zakariah M. et al. To decipher the mycoplasma hominis proteins targeting into the endoplasmic reticulum and their implications in prostate cancer etiology using next-generation sequencing data. Molecules . 23 , 994; 10.3390/molecules23050994 (2018). Tantengco O.A.G., Aquino I.M.C., de Castro Silva M., Rojo R.D. & Abad C.L.R. Association of mycoplasma with prostate cancer: A systematic review and meta-analysis. Cancer Epidemiol . 75 , 102021; 10.1016/j.canep.2021.102021 (2021). Hosseininasab-nodoushan S.A., Ghazvini K., Jamialahmadi T., Keikha M. & Sahebkar A. Association of Chlamydia and Mycoplasma infections with susceptibility to ovarian cancer: A systematic review and meta-analysis. Semin. Cancer Biol . 86 , 923-928; 10.1016/j.semcancer.2021.07.016 (2022). Klein C. et al. Mycoplasma co-infection is associated with cervical cancer risk. Cancers (Basel) . 12 , 1093; 10.3390/cancers12051093 (2020). Mitin V., Tumanova L. & Botnariuc N. Mycoplasma Faucium and Breast Cancer. bioRxiv . Preprint, 089128; 10.1101/089128 (2016). Zella D. et al. Mycoplasma promotes malignant transformation in vivo, and its DnaK, a bacterial chaperon protein, has broad oncogenic properties. Proc. Natl. Acad. Sci. USA . 115 , E12005-E12014; 10.1073/pnas.1815660115 (2018). Rodakiewicz S.M. et al. Heterogeneity determination of bovine leukemia virus genome in Santa Catarina state, Brazil. Arq. Inst. Biol . 85 ; 10.1590/1808-1657000742016 (2018). Huang S., You Li J., Wu J., Meng L. & Chao Shou C. Mycoplasma infections and different human carcinomas. World J. Gastroenterol . 7 , 266-269; 10.3748/wjg.v7.i2.266 (2001). Erturhan S.M. et al. Can mycoplasma contribute to formation of prostate cancer?. Int. Urol. Nephrol . 45 , 33–38; 10.1007/s11255-012-0299-5 (2013). Zarei O., Rezania S. & Mousavi A. Mycoplasma genitalium and cancer: A brief review. Asian Pac. J. Cancer. Prev . 14 , 3425-8; 10.7314/apjcp.2013.14.6.3425 (2013). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7079614","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":495973315,"identity":"a2d18630-fae1-42a0-a64a-3553a66d9d90","order_by":0,"name":"Juliana do Canto Olegário","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Juliana","middleName":"do Canto","lastName":"Olegário","suffix":""},{"id":495973316,"identity":"62e5bf1f-6b28-4b55-82a0-f3512db512ed","order_by":1,"name":"Raíssa Canova","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Raíssa","middleName":"","lastName":"Canova","suffix":""},{"id":495973317,"identity":"75a5972f-c911-405c-9e30-e751077f08b3","order_by":2,"name":"Sirlei dos Santos Costa","email":"","orcid":"","institution":"Hospital Moinhos de Vento","correspondingAuthor":false,"prefix":"","firstName":"Sirlei","middleName":"dos Santos","lastName":"Costa","suffix":""},{"id":495973318,"identity":"466a1b21-e49a-4a0d-b0ed-f33e6ca4207c","order_by":3,"name":"Rosa Maria Blotta","email":"","orcid":"","institution":"Hospital Moinhos de Vento","correspondingAuthor":false,"prefix":"","firstName":"Rosa","middleName":"Maria","lastName":"Blotta","suffix":""},{"id":495973319,"identity":"af4fb509-30dc-40cb-a671-c72dc941b1b2","order_by":4,"name":"Antônio Carlos Kruel Pütten","email":"","orcid":"","institution":"Hospital Moinhos de Vento","correspondingAuthor":false,"prefix":"","firstName":"Antônio","middleName":"Carlos Kruel","lastName":"Pütten","suffix":""},{"id":495973320,"identity":"30d0de8a-c723-405e-8a86-ffd7e685870a","order_by":5,"name":"Alessandra Loureiro Morassutti","email":"","orcid":"","institution":"Universidade de Passo Fundo","correspondingAuthor":false,"prefix":"","firstName":"Alessandra","middleName":"Loureiro","lastName":"Morassutti","suffix":""},{"id":495973321,"identity":"e6b03852-5c96-4598-a583-e86f8fe2d5cf","order_by":6,"name":"Franciéli Adriane Molossi","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Franciéli","middleName":"Adriane","lastName":"Molossi","suffix":""},{"id":495973322,"identity":"5441b914-3472-4c38-8879-cf213c844bd1","order_by":7,"name":"Bianca Santana Cecco","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Bianca","middleName":"Santana","lastName":"Cecco","suffix":""},{"id":495973323,"identity":"c5a3ef71-2eac-4951-9298-21b0c038229a","order_by":8,"name":"Vitória Rabaioli","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Vitória","middleName":"","lastName":"Rabaioli","suffix":""},{"id":495973324,"identity":"6460d1d8-bca7-4e25-b7b1-6d2397529abe","order_by":9,"name":"Maria Eduarda Dias","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Eduarda","lastName":"Dias","suffix":""},{"id":495973325,"identity":"353fe187-9472-48e3-a61e-95fe5a264b4a","order_by":10,"name":"Gabriela Merker Breyer","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Gabriela","middleName":"Merker","lastName":"Breyer","suffix":""},{"id":495973326,"identity":"5b5cc1b5-fd80-461d-ad09-54b93c5675ed","order_by":11,"name":"Franciele Maboni Siqueira","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Franciele","middleName":"Maboni","lastName":"Siqueira","suffix":""},{"id":495973327,"identity":"6ca3a802-b95a-4e5f-8555-6a24e8cff3e3","order_by":12,"name":"Cláudio Wageck Canal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYDACdiDmMYByHlQw8INoZrxamJG1JJxhkGwgTguMk9hGhBb+ZuZnEm8KbBj4288e/JA477CEef/yB8yFe3BrkTjMZiY5xyCNQeJMXrJE4rbDEjI33hgwz3iGW4sBM4OZNI/BYQYDhhwDkJY6CYkzDMw8B/BpYf8G0cL/xvhH4pzDEhISxx8Q0MIDtUUix0wisQGohb/BAK8WicM8xZZAv/BI3HhjZpFwLB1oC9CEGXi08Le3b7zx5o+NHH9/jvGNDzXWQFuOP3xcgEcLDPAgmBIJDERoQLWYVA2jYBSMglEw3AEAXd1IIpoGLnEAAAAASUVORK5CYII=","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":true,"prefix":"","firstName":"Cláudio","middleName":"Wageck","lastName":"Canal","suffix":""}],"badges":[],"createdAt":"2025-07-09 04:23:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7079614/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7079614/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":89262383,"identity":"88773cc4-b392-4263-8026-becae50d066d","added_by":"auto","created_at":"2025-08-18 07:17:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":870582,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7079614/v1/be97cf02-e649-4a11-a5a1-d0f7069d5ec5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Is breast cancer in women caused by bovine leukaemia virus and Mycoplasma spp.? An investigation from South Brazil","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIn recent years, there has been a concentrated effort to investigate the interconnections between various infectious agents, including papillomavirus, hepatitis B virus, and Epstein‒Barr virus, and bacteria, such as \u003cem\u003eStreptococcus bovis, Salmonella typhi, Chlamydia pneumoniae, Bartonella, Helicobacter pylori\u003c/em\u003e, and \u003cem\u003eMycoplasma\u003c/em\u003e, and the aetiology of cancer (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBovine leukaemia virus (BLV) is a member of the \u003cem\u003eDeltaretrovirus\u003c/em\u003e genus within the \u003cem\u003eRetroviridae\u003c/em\u003e family and is genetically related to the human T-lymphotropic virus (HTLV) associated with adult T-cell leukaemia/lymphoma (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). BLV primarily infects B lymphocytes but also other immune cells (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e), mammary epithelial cells (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) and endothelial cells of cattle (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e) and is the causative agent of enzootic bovine leukosis (EBL). BLV causes widespread bovine infection in many regions and remains asymptomatic in most animals but can lead to lymphoma due to the mono- or oligo-clonal proliferation of CD5\u0026thinsp;+\u0026thinsp;B cells after a latency period (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). The oncogenic potential of BLVs is associated mainly with Tax, a regulatory protein unique to deltaretroviruses that is responsible for activating proviral transcription and capable of inducing cell transformation via different mechanisms that are not yet completely understood (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Like all retroviruses, the BLV genome also has \u003cem\u003egag\u003c/em\u003e, \u003cem\u003epro, pol\u003c/em\u003e and \u003cem\u003eenv\u003c/em\u003e genes encoding capsid proteins, viral proteases and polymerases, and envelope proteins, respectively, along with two identical long terminal repeat (LTR) chains at the 5\u0026rsquo; and 3\u0026rsquo; ends (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eViral transmission occurs via the transfer of cells from infected animals to na\u0026iuml;ve animals, primarily through contact with blood (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e) but also through the transfer of other bodily fluids, such as nasal and bronchial secretions (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e), and the ingestion of milk and colostrum (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). In addition to cattle, natural infection has been reported in water buffaloes (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), capybaras (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e), alpacas (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e) and yaks (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e), but BLV can infect experimentally a wide range of other animals, such as sheep, rats, rabbits, chickens and goats, as well as human cells \u003cem\u003ein vitro\u003c/em\u003e (\u003cspan additionalcitationids=\"CR19 CR20 CR21\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThere is increasing evidence that humans are susceptible to BLV infection, which may be associated with breast cancer in women. Viral DNA has been detected in mammary tissue samples from women in Colombia (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e), the United States (\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e), Australia (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), Argentina (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e), Brazil (\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e), Iran (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e), Pakistan (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e), Egypt (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e) and Jordan (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), as well as in blood (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e), lung squamous cell carcinoma (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e) and lymphoma tissue samples (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e) from humans. The capsid protein p24 has also been identified in the mammary secretory epithelium of the United States and Colombian women (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). In addition, several studies were able to significantly correlate the presence of BLV DNA with breast cancer diagnosis (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e), with odds ratios ranging from 0.39 in Pakistan (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) to 15.82 in Brazil (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In contrast, other researchers reported the absence of BLV provirus detection in breast tissue and leucocyte samples from China (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e), Japan (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e), the US, Mexico and Vietnam (\u003cspan additionalcitationids=\"CR44\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e), and northeastern Brazil [46, preprint]. Since the virus is present in milk and meat from infected cattle, it is speculated that the main contamination route for humans is consuming bovine-derived food products that have not received adequate heat treatment (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOne of the suspected prokaryotes involved in malignancy is \u003cem\u003eMycoplasma\u003c/em\u003e, which are small bacteria with a range of effects on host cells, including alterations in the cell cycle, signalling, and inflammation (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). In recent years, the association between these bacteria and tumours in humans and other animal species has rapidly evolved (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). However, the exact connection between \u003cem\u003eMycoplasma\u003c/em\u003e spp. infection and tumours is still under investigation. Recent studies suggest a potential association between chronic \u003cem\u003eMycoplasma\u003c/em\u003e infection and the development of certain types of cancer (\u003cspan additionalcitationids=\"CR52\" citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e), and its presence has been detected in tumours from various tissues, including the lung, breast, prostate, and cervix (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan additionalcitationids=\"CR54\" citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e). These infections are associated with alterations in the tumour microenvironment, which can promote progression and resistance to conventional therapies (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). Moreover, research suggests that \u003cem\u003eMycoplasma\u003c/em\u003e spp. can trigger complex immune responses, which affects tumour development and dissemination (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eMost of the published studies that were able to amplify BLV DNA from human mammary tissue have used formalin-fixed paraffin-embedded (FFPE) samples (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan additionalcitationids=\"CR26 CR27 CR28 CR29 CR30 CR31 CR32 CR33 CR34 CR35\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e), which are known to be more challenging to work with because of the damage and fragmentation that formalin fixation causes to nucleic acids. One study from Colombia identified viral DNA in fresh breast tissue (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e), and one study from the US reported a lack of BLV DNA in fresh-frozen breast cancer tumours (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eBased on an initial hypothesis that working with fresh-frozen tissue would result in more positive samples due to the possibility of obtaining higher DNA quantity and quality, our study aimed to investigate the presence of BLV in fresh human breast tissue and blood samples from women in southern Brazil. We performed PCR and nested PCR to detect four viral genes (LTR, \u003cem\u003epol\u003c/em\u003e, \u003cem\u003eenv\u003c/em\u003e and \u003cem\u003etax\u003c/em\u003e). To compare the results in different sample types, we also performed nested PCR targeting the \u003cem\u003eenv\u003c/em\u003e and \u003cem\u003etax\u003c/em\u003e genes of BLV in FFPE breast tissues derived from the same subjects as the fresh tissue and blood samples. In addition, we also intended to examine the presence of \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA in fresh-frozen tissue samples via PCR. Our study represents an important step towards understanding the potential risk of BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. infection in humans.\u003c/p\u003e"},{"header":"2. Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 Sampling and DNA isolation\u003c/h2\u003e\u003cp\u003eIn the analysis of personal data collected from the participants, the patients\u0026rsquo; mean age at the time of surgery was 51.5\u0026thinsp;\u0026plusmn;\u0026thinsp;14 years, ranging from 18 to 84 years. Ninety-eight percent self-declared their colour/race as white, and 2% self-declared it as a mixed race. Ninety-one percent lived in urban areas, whereas 9% lived in rural areas. For dietary habits, 89% and 93% of the participants reported regular consumption of meat and dairy products, respectively. Most individuals consumed meat at least three times a week (70/89) and dairy up to five or more times a week (52/93). In relation to cooking and heat treatment preferences, participants consumed mostly well-cooked meat (61/89) and pasteurized or ultrahigh temperature (UHT)-processed milk (92/93), with only one individual reporting the consumption of raw milk. Seventy-one percent had a history of cancer in the family, including breast cancer and various other types of cancer. Among the 100 samples tested, 40 were positive for breast cancer.\u003c/p\u003e\u003cp\u003eThe DNA extracted from 100 fresh breast tissues and 100 buffy coats had purity scores (A260/280) ranging from 1.25 to 2.06 and recovery rates ranging from 7.1 to 783.1 ng/\u0026micro;L. A 237 bp fragment of the human GAPDH gene was successfully amplified from all the samples. For the DNA isolated from the 30 FFPE tissue samples, the purity and recovery rates ranged from 1.55 to 2.09 ng/\u0026micro;L and from 5.1 to 163.8 ng/\u0026micro;L, respectively, and all the samples amplified a 98 bp fragment of the human beta-actin gene.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2 BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. investigations\u003c/h2\u003e\u003cp\u003eAmong all fresh breast tissue and blood samples tested for four BLV genes by PCR and nested PCR, one breast tissue sample, named 72 and belonging to a patient without a breast cancer diagnosis, was positive for the \u003cem\u003etax\u003c/em\u003e gene but negative for the \u003cem\u003eenv\u003c/em\u003e, \u003cem\u003epol\u003c/em\u003e and LTR genes. A second-round PCR with a different pair of inner primers was performed to amplify a 206 bp fragment of \u003cem\u003etax\u003c/em\u003e, and the amplified product was purified and subjected to Sanger sequencing. The resulting sequence was compared through nucleotide MegaBlast with sequences available at GenBank and obtained a degree of similarity of 100% (100% query coverage) with many BLV sequences identified in cattle, thus confirming the result. No other fresh tissue samples, along with the buffy coat samples, were positive for BLV DNA. In addition, \u003cem\u003eMycoplasma\u003c/em\u003e spp. was not detected in any of the investigated fresh-frozen breast tissue samples.\u003c/p\u003e\u003cp\u003eFFPE tissues tested for BLV \u003cem\u003eenv\u003c/em\u003e and \u003cem\u003etax\u003c/em\u003e genes by seminested and nested PCR were all negative for both genes. Moreover, none of the 30 samples analysed from 21 participants belonged to patient 72, whose fresh tissue amplified the \u003cem\u003etax\u003c/em\u003e gene, making the comparison of results between different processed tissue samples from that patient impossible.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eThere is accumulated evidence regarding the detection of BLV and \u003cem\u003eMycoplasma\u0026nbsp;\u003c/em\u003espp. in human samples and the association between these pathogens and cancer diagnosis. Nonetheless, this matter has not yet been settled, and more studies exploring the potential of different types of samples and detection techniques are needed to better understand these topics. Notably, most published studies with BLV analysed the presence of viral DNA in FFPE breast tissue from women via methods like \u003cem\u003ein situ\u003c/em\u003e PCR performed directly on the tissue slide or liquid phase PCR, which requires DNA extraction (23,25–36). However, the fixation and embedding processes cause significant damage to nucleic acids due to alterations such as cross-linking, fragmentation, and chemical modifications, making working with FFPE samples quite tricky and challenging.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMycoplasma\u0026nbsp;\u003c/em\u003espp. were not detected in the breast tissue samples from women with and without breast cancer in our study. In contrast, a study carried out in China reported the presence of \u003cem\u003eMycoplasma\u0026nbsp;\u003c/em\u003espp. in 39.7% of FFPE breast cancer samples via immunohistochemistry (58). Currently, no other studies in the literature have investigated the presence of \u003cem\u003eMycoplasma\u003c/em\u003e spp. in human breast tumours. Nevertheless, \u003cem\u003eMycoplasma\u0026nbsp;\u003c/em\u003einfections associated with human cancer have been widely reported via molecular approaches, mostly involving \u003cem\u003eM. hyorhinis\u003c/em\u003e, \u003cem\u003eM. penetrans\u003c/em\u003e, \u003cem\u003eM. hominis\u003c/em\u003e, \u003cem\u003eM. salivarium\u003c/em\u003e, and \u003cem\u003eM. genitalium\u003c/em\u003e species (59,60). Notably, recovering bacterial DNA from FFPE tissue is still a challenge, and DNA from such samples is a poor template for PCR assays due to its fragmentation. The sample source used in this study for the molecular investigation of \u003cem\u003eMycoplasma\u003c/em\u003e spp. was fresh-frozen breast tissue, which supports the finding that no women included in the research were infected with \u003cem\u003eMycoplasma\u0026nbsp;\u003c/em\u003espp.\u003c/p\u003e\n\u003cp\u003eIn addition, we investigated the presence of BLV DNA in fresh-frozen breast tissue from female patients with and without a breast cancer diagnosis, as well as in blood and FFPE tissue from the participants, via PCR and nested PCR targeting four viral genes. To our knowledge, two published studies have investigated the presence of proviral DNA in fresh-frozen breast tissue samples. One reported the detection of BLV DNA in a high number of fresh mammary samples from Colombian women collected during surgery specifically for this purpose and frozen until processing (24), whereas the other did not find BLV DNA in breast cancer tumours from women in a rural state in the U.S. (45); thus, the evidence concerning this topic is controversial.\u003c/p\u003e\n\u003cp\u003eWe initially hypothesized that working with fresh tissue would result in more positive samples than working with FFPE tissue because of the possibility of obtaining higher-quality and quantity DNA. Nonetheless, only one sample amplified the viral gene \u003cem\u003etax\u003c/em\u003e, which we confirmed by Sanger sequencing. This finding is consistent with other reports where the highly conserved \u003cem\u003etax\u003c/em\u003e gene was detected more frequently in human samples than other BLV genes (25,31,33). Evidence shows that segments of viral genomic regions such as \u003cem\u003eenv\u003c/em\u003e, \u003cem\u003epol\u0026nbsp;\u003c/em\u003eand \u003cem\u003egag\u003c/em\u003e are deleted from the provirus to evade the host immune response (7). Our findings contrast with study results from Colombia, where viral DNA was detected in 63 out of 158 fresh tissues with malignant or benign tumours (24). However, these findings are similar to those reported by Amato et al. (45) in the US, where no evidence of proviral DNA was found in breast tumour samples. Both studies used a similar liquid-phase nested-PCR protocol and the same primer pairs targeting the \u003cem\u003etax\u003c/em\u003e gene previously described by Buehring et al. [25], which we employed in our experiments.\u003c/p\u003e\n\u003cp\u003eOur results suggest two possible conclusions. First, limitations in our sampling method led to the absence of amplification of viral and bacterial genes in most tissues; second, all patients except one were indeed negative for BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA. We had some disadvantages regarding our fresh tissue samples, which could be a reason for not detecting viral and bacterial DNA. The tissue fragments were collected randomly from the breasts of the patients during surgery in areas adjacent to the malignant or benign lesions when present. Regardless of size, the tumours were removed and sent entirely to the pathology laboratory responsible for the histological diagnosis of breast cancer and subjected to FFPE processing, which indicated that all analysed fresh samples were healthy tissue fragments. Although BLV has been identified in breast tissue without any specific pathology from women subjected to reduction mammoplasty or a similar intervention (31–33), including the positive sample in this study, the prevalence of viral DNA is greater in samples with malignant changes, and amplification is usually achieved within the benign or malignant lesions of FFPE tissues in both the case and control groups (26,27,30). Furthermore, it can be difficult to evaluate fat tissue content macroscopically and differentiate it from mammary epithelial tissue precisely. Therefore, even though we tried to avoid tissue areas with a high-fat content when collecting samples and extracting DNA, some fragments still had a considerable fat percentage, and it has been shown in previous studies that viral detection occurs inside mammary secretory epithelial cells (25,26,28). Olaya-Galán et al. (24) selected only fresh samples from malignant, premalignant and benign tumours with enough material for histopathological and molecular analysis and excluded tissues with a high-fat content, which could explain their relatively high viral detection rate.\u003c/p\u003e\n\u003cp\u003eTo circumvent this issue, we subjected 30 FFPE breast tissue samples from 21 participants to PCRs targeting the \u003cem\u003eenv\u003c/em\u003e and \u003cem\u003etax\u003c/em\u003e genes, selecting areas with large numbers of epithelial cells and evidence of benign or malignant pathology, if present, and cut them from the paraffin blocks with a 2 mm dermatological punch. Despite the damage caused by fixation and paraffinization, FFPE tissue could be a better option for BLV proviral detection because the breast is characterized by a high-fat content and, therefore, the possibility of avoiding adipose cells and identifying precisely the epithelial cells where the virus is expected to be. We quantified and checked the purity of the isolated DNA via a NanoDrop spectrophotometer. The quality of the DNA was verified via amplification of the human beta-actin gene, to which 30 samples were positive. All the results were negative for viral amplification, which favours the conclusion that most women in our study were indeed negative for BLV DNA. To address this possibility, we also collected and tested buffy coats from participants’ blood samples, which were all negative for the four viral genes assessed. Although there are fewer reports of BLV DNA detected in human blood than in breast tissue, Buhering et al. (37) and Mendoza et al. (38) identified the provirus in 38% and 13% of analysed blood samples in the US and Colombia, respectively, and Olaya-Galán et al. (24) reported evidence of the presence of the virus in both breast tissue and blood from the same patients, with a concordance of 94%. Consequently, the fact that no blood samples were positive for the virus supports the negative results found in tissues and indicates that nearly all tested women were not infected with BLV.\u003c/p\u003e\n\u003cp\u003eHowever, this is contrary to previously published reports from Brazil, where proviral DNA was identified in 44.4% (30), 79.5% (31) and 86.4% (32) of FFPE tissue samples from female subjects. These differences could be due to several inherent aspects of the studied population, such as geographical location. Delarmelina et al. [31] speculated that the high prevalence of BLV DNA found in samples from Minas Gerais State was related to the regional tradition of consuming unpasteurized dairy products. Mendoza et al. [37] reported a significant relationship between the molecular detection of BLV in human blood samples and veterinary occupation, as well as a greater risk of acquiring the virus in individuals with a history of at least one accident with surgical material during work with animals. Although a large portion of the patients in our study reported regular meat and dairy consumption, most products underwent heat processes that inactivated the virus. In addition, most of our samples were obtained from patients who lived in urban areas and had little contact with rural areas. Recently, da Mota Nunes et al. (46) reported in a preprint article the absence of BLV DNA in FFPE breast cancer samples from women in northeastern Brazil, although human papillomavirus (HPV) DNA was detected in 46.2% of the same samples. These authors speculated that the negative result for BLV could be due to environmental factors such as lower meat consumption and coinfections with different viruses.\u003c/p\u003e\n\u003cp\u003eThe primer pairs and PCR protocols used in our study to detect viral DNA in blood, fresh and FFPE tissue samples and controls were chosen based on previous reports and have been utilized in many published studies. Additionally, one strength of our research is that we had bovine positive controls equivalent to the human samples we worked with. We used positive controls based on fresh and FFPE lymphoma tissue and blood drawn from cattle with EBL. Furthermore, all extracted DNA from human samples was evaluated through spectrophotometry and PCRs targeting human housekeeping genes. This suggests our results were not due to limitations in the selected methodology for processing and testing samples. Nevertheless, as highlighted by Adekanmbi et al. (44), testing the same set of samples by all reported detection methods would be beneficial for resolving the current contradictory evidence regarding BLV detection in human samples and its role in breast cancer. Moreover, more studies testing different samples (e.g., fresh tissue, FFPE tissue, and blood) from the same patients with these techniques could help elucidate this topic.\u003c/p\u003e"},{"header":"4. Conclusions","content":"\u003cp\u003eIn conclusion, our work is one of the few existing studies that explored the presence of BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA in fresh-frozen breast tissue, as well as viral DNA in leukocytes and FFPE breast tissue, from women with and without a breast cancer diagnosis in South Brazil. We detected the BLV \u003cem\u003etax\u003c/em\u003e gene in only one tissue sample, while \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA was absent. These findings revealed a lower frequency of BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. detection than other studies did. Nevertheless, the negative results in the leukocyte and FFPE samples suggest that most women in this study were not infected with BLV.\u003c/p\u003e"},{"header":"5. Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e5.1 Fresh tissue and blood samples\u003c/h2\u003e\n \u003cp\u003eBetween August 2020 and January 2023, fresh mammary tissue and blood samples were collected from 100 self-selected female patients undergoing breast surgery at Moinhos de Vento Hospital (HMV) in Porto Alegre city, Rio Grande do Sul state, southern Brazil. Women were invited to participate during the consultation and voluntarily signed informed consent agreements to have samples and personal information collected and used in the study. Individuals over 18 and under 90 years of age were included regardless of diagnosis and type of surgical intervention (e.g., mastectomy; breast segmentectomy; reduction or augmentation mammoplasty), but current treatment with antiretroviral drugs was an exclusion criterion. The use of human subjects was performed in accordance with the World Medical Association Declaration of Helsinki and the 466/12 Resolution for guidelines and regulations of research involving human beings from the National Health Council of the Brazilian Ministry of Health. The study was approved by the Committees on Research Ethics of HMV (protocol number: 4.173.386). All data were used with confidentiality.\u003c/p\u003e\n \u003cp\u003eFive fragments of approximately 100 mg of fresh tissue were randomly collected from each patient during surgery and stored in microtubes, trying to avoid areas with high-fat content. Blood was drawn into two tubes containing EDTA anticoagulant during the preanaesthetic routine. The samples were refrigerated for a maximum of 24 hours until they were transferred to the research laboratory, where the tissues were immediately frozen at -80\u0026deg;C and the blood was centrifuged at 500 \u0026times; g for 10 minutes. The buffy coat and plasma were transferred to separate microtubes and frozen at -80\u0026deg;C until processing.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e5.2 FFPE tissue samples\u003c/h2\u003e\n \u003cp\u003eA total of 30 FFPE breast tissues from 21 participants were used in our study. Upon surgical removal, the tissue fragments were fixed with 10% buffered formalin for 24\u0026ndash;48 hours and subsequently embedded in paraffin blocks. Microscopic slides were made for histopathological diagnosis of breast cancer and for identifying tissue areas with large amounts of mammary epithelial cells to be used for DNA extraction.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e5.3 DNA isolation\u003c/h2\u003e\n \u003cp\u003eDNA was extracted from fresh tissues, buffy coats and controls with QIAamp\u0026reg; DNA Mini Kit (QIAGEN, Germany). Approximately 25 mg of tissue and 200 \u0026micro;L of leucocytes from each patient and controls were processed following the manufacturer\u0026rsquo;s instructions, and the DNA was eluted in 50 \u0026micro;L of elution buffer.\u003c/p\u003e\n \u003cp\u003eDNA isolation from FFPE samples and controls was performed with QIAamp\u0026reg; DNA FFPE Tissue Kit (QIAGEN, Germany). After the selection of tissue areas with large clusters of mammary epithelial cells, 4\u0026ndash;5 2 mm diameter tissue fragments were extracted from each block with a disposable sterile dermatological punch, transferred to a microtube, deparaffinized with 1 mL of xylene and washed twice with 1 mL of 100% ethanol. The recovered DNA was eluted in 30 \u0026micro;L of elution buffer.\u003c/p\u003e\n \u003cp\u003eThe quantity and purity of the DNA extracted from all the samples and controls were verified with a NanoDrop Lite (Thermo Fisher Scientific, USA). The quality of human DNA was assessed by amplifying the human housekeeping genes GAPDH (\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e) and beta-actin (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e) in fresh and FFPE samples, respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cstrong\u003e5.4 Molecular detection of BLV and\u003c/strong\u003e \u003cstrong\u003eMycoplasma\u003c/strong\u003e \u003cstrong\u003espp. DNA\u003c/strong\u003e\u003c/h2\u003e\n \u003cp\u003eFor the presence of the BLV \u003cem\u003eenv\u003c/em\u003e, \u003cem\u003epol\u003c/em\u003e, LTR, and \u003cem\u003etax\u003c/em\u003e genes in fresh tissue and blood, the evaluation was performed via PCR and nested PCR with specific primers previously described in the literature (\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e57\u003c/span\u003e). Reactions were prepared with buffer, 1.5 mM magnesium chloride, 0.2 mM each dNTP, 0.2\u0026ndash;0.4 \u0026micro;M forward primer and 0.2\u0026ndash;0.4 \u0026micro;M reverse primer, 1.25 units of GoTaq\u0026reg; DNA Polymerase (Promega, USA), 20\u0026ndash;100 ng of template DNA or 2 \u0026micro;L of the first-round PCR product, and nuclease-free water to a final volume of 25 \u0026micro;L. For sequencing of positive samples for the \u003cem\u003etax\u003c/em\u003e gene, a second pair of inner primers was used to amplify a longer product in positive samples (\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e) compared to the 113 bp fragment obtained with the first pair of inner primers.\u003c/p\u003e\n \u003cp\u003eFor FFPE tissue samples, semi-nested and nested PCR amplification was conducted to target the \u003cem\u003etax\u003c/em\u003e and \u003cem\u003eenv\u003c/em\u003e genes, respectively (\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e). For \u003cem\u003etax\u003c/em\u003e detection, the second pair of inner primers amplifying a 206 bp fragment was used as the outer primer in the first step of the nested-PCR assay, followed by a subsequent reaction with the inner primers to amplify a 113 bp fragment, as described by Delarmelina et al. [31]. The PCR mixture was prepared as described above.\u003c/p\u003e\n \u003cp\u003eFor positive controls of BLV, fragments of tumours in the lymphoid organs of two adult cattle that had clinical and necropsy signs suggestive of EBL were provided by the Veterinary Pathology Sector (SPV) of the Federal University of Rio Grande do Sul (UFRGS). Additionally, blood drawn from an adult cow with clinical signs compatible with EBL was provided by the Large Ruminant Sector (SGR) of UFRGS, and the buffy coat and plasma were separated as described for human blood samples. Bovine fresh-frozen tumours and buffy coats were confirmed positive for BLV DNA by PCRs targeting the \u003cem\u003eenv\u003c/em\u003e, LTR, \u003cem\u003epol\u003c/em\u003e, and \u003cem\u003etax\u003c/em\u003e genes. Tumours and buffy coats were used as positive controls in processing fresh-frozen tissue and blood samples from human patients. For the positive control for FFPE tissue sample processing, fragments of the same cattle BLV-derived tumours described above were subjected to formalin fixation for 24 hours with 10% buffered formalin and paraffin embedding. Ultrapure DNase and RNase-free water were used as negative controls. DNA from positive and negative controls was isolated as described previously.\u003c/p\u003e\n \u003cp\u003eA conventional PCR assay was performed to detect \u003cem\u003eMycoplasma\u003c/em\u003e spp. in the fresh-frozen breast tissue samples. Each reaction contained 1 U of Taq DNA polymerase, recombinant (Thermo Fisher Scientific, USA), 10\u0026times; reaction buffer, 1.5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.4 \u0026micro;M each primer, 0.2 mM dNTPs, and 50 ng of template DNA. The PCR amplification conditions included initial denaturation at 94\u0026deg;C for 5 min, followed by 35 cycles of 94\u0026deg;C for 1 min, annealing at 54\u0026deg;C for 45 s, and extension at 72\u0026deg;C for 45 s, with a final extension at 72\u0026deg;C for 5 min. The \u003cem\u003eMycoplasma hyopneumoniae\u003c/em\u003e 7448 strain was used as a positive control. Details regarding all PCR assays performed for BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA detection, and housekeeping genes, in fresh-frozen tissue, buffy coat, and FFPE tissue samples are described in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimers and PCR conditions for analysing breast tissue and buffy coat samples for BLV, Mycoplasma spp., and housekeeping genes.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer sequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNested-PCR\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAnnealing temp. (\u0026ordm;C)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eAmplicon size (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAnalyzed sample\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CCTTCATTGACCTTCACTACATGGTCTA\u003c/p\u003e\n \u003cp\u003eR: GCTGTAGCCAAATTCATTGTCGTACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e237\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003cp\u003eBuffy coat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e[25]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eBeta-actin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: GGCATCCTGACCCTGAAGTA\u003c/p\u003e\n \u003cp\u003eR: CGCAGCTCGTTGTAGAAGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFFPE breast tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e[31]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eBLV\u003c/strong\u003e \u003cstrong\u003eenv\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CTTTGTGTGCCAAGTCTCCCAGATACA\u003c/p\u003e\n \u003cp\u003eR: CCAACATATAGCACAGTCTGGGAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e440\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003cp\u003eBuffy coat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e[57]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TGATTGCGAGCCCCGATG\u003c/p\u003e\n \u003cp\u003eR: GGAAAGTCGGGTTGAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOuter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e60\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\" rowspan=\"2\"\u003e\n \u003cp\u003eFFPE breast tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e[31]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CCTCCCAGGCCGATCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e165\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eBLV\u003c/strong\u003e \u003cstrong\u003epol\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TAGCCTACGTACATCTAACC\u003c/p\u003e\n \u003cp\u003eR: AATCCAATTGTCTAGAGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOuter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e52\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e232\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003cp\u003eBuffy coat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"7\"\u003e\n \u003cp\u003e[25]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: GGTCCACCCTGGTACTCTTC\u003c/p\u003e\n \u003cp\u003eR: TATGGGCTTGGCATACGAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e157\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003e\u003cstrong\u003eBLV LTR\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TAGGAGCCGCCACCGC\u003c/p\u003e\n \u003cp\u003eR: GCGGTGGTCTCAGCCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOuter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e57\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e329\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003cp\u003eBuffy coat\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: AAACTGCAGCGTAAACCAGACAGAGACG\u003c/p\u003e\n \u003cp\u003eR: CACCCTCCAAACCGTGCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e290\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003e\u003cstrong\u003eBLV\u003c/strong\u003e \u003cstrong\u003etax\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CTTCGGGATCCATTACCTGA\u003c/p\u003e\n \u003cp\u003eR: GCTCGAAGGGGGAAAGTGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eOuter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e373\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"3\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003cp\u003eBuffy coat\u003c/p\u003e\n \u003cp\u003eFFPE breast tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: ATGTCACCATCGATGCCTGG\u003c/p\u003e\n \u003cp\u003eR: CATCGGCGGTCCAGTTGATA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e55\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e113\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: GGCCCCACTCTCTACATGC\u003c/p\u003e\n \u003cp\u003eR: AGACATGCAGTCGAGGGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInner 2 (Outer for FFPE samples)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e206\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMycoplasma\u003c/strong\u003e \u003cstrong\u003espp.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: ACACCATGGGAGCTGGTAAT\u003c/p\u003e\n \u003cp\u003eR: CGTAGGTTGTACTCCGTAGAAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e54\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e150\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFresh-frozen breast tissue\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eIn this study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e1. Primer sequences, annealing temperatures in \u0026ordm;C, amplicon sizes in number of base pairs, and sample types analyzed for each target are described in the table. GAPDH was used as a housekeeping gene for quality control of fresh breast tissue and buffy coat sample, and beta-actin was used for FFPE tissue samples. Four BLV genes, \u003cem\u003eenv\u003c/em\u003e, \u003cem\u003epol\u003c/em\u003e, long terminal repeat (LTR), and \u003cem\u003etax\u003c/em\u003e, were analyzed by PCR and nested-PCR in fresh breast tissue and buffy coat samples, while tax was also tested in FFPE samples using an additional internal primer set. \u003cem\u003eMycoplasma\u003c/em\u003e spp. detection was performed in fresh breast tissue using primers developed in this study. Amplicon sizes ranged from 98 to 440 bp, and annealing temperatures varied from 50\u0026deg;C to 60\u0026deg;C. References are provided for previously published primers.\u003c/p\u003e\n \u003cp\u003ePrecautions were taken to guarantee result reliability and to prevent cross-contamination between samples and positive controls. A DNA-free room equipped with specific materials was used exclusively to prepare PCR mixtures, while extracted DNA and the first-round PCR product were handled in different rooms. A maximum of 18 samples, plus positive and negative controls, were processed at a time, and at least one positive control and one negative control were added to each batch during the execution of the experiments.\u003c/p\u003e\n \u003cp\u003eThe results for BLV and \u003cem\u003eMycoplasma\u003c/em\u003e spp. detection were assessed via the electrophoresis of PCR products in 1.5\u0026ndash;2% agarose gels using a fluorescent nucleic acid dye with Gel Red, bromophenol and xylene cyanol (Quatro G Biotecnologia, Brazil). Amplified products from positive samples were purified with a ReliaPrep\u0026trade; DNA Clean-up and Concentration System Kit (Promega, USA) following the manufacturer\u0026apos;s instructions. Both forward and reverse DNA strands were subjected to Sanger sequencing with an ABI PRISM 3100 Genetic Analyser using BigDye Terminator v.3.1 Cycle Sequencing Kit (Thermo Scientific, USA) to confirm the specificity of the amplification products. The obtained sequences were compared with sequences available in GenBank through nucleotide MegaBlast. Samples showing amplified products with the expected sizes via electrophoresis were considered positive when positive and negative controls did and did not present amplification, respectively, and after confirmation by sequencing.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe sincerely thank the Veterinary Pathology Sector (SPV) and the Large Ruminant Sector (SGR) for their support in providing the samples used as positive controls in this study. We acknowledge the efforts of all individuals involved in sample collection and processing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe following Brazilian Institutes supported this study: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq nº 405786/2022-0), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) Finance Code 001, Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (FAPERGS nº 23/2551-0002221-4), and Pró-Reitoria de Pesquisa (PROPESQ-UFRGS). The authors thank these institutes for their financial support.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJCO was involved in conceptualization, formal sample analysis, defining the methodology and writing of the original draft; RC was involved in conceptualization, formal sample analysis, defining the methodology, project administration and writing of the original draft; SSC was involved in defining the methodology, project administration, review and editing of the manuscript; RMB was involved in defining the methodology, project administration, review and editing of the manuscript; ACKP was involved in defining the methodology, project administration, review and editing of the manuscript; ALM was involved in defining the methodology and formal sample analysis; FAM was involved in formal sample analysis; BSC was involved in formal sample analysis; VR was involved in formal sample analysis; MED was involved in defining the methodology, formal sample analysis and writing of the original draft; GMB was involved in defining the methodology, formal sample analysis and writing of the original draft; FMS was involved in defining the methodology, project supervision, review and editing of the manuscript; CWC was involved in conceptualization, defining the methodology, project supervision, review and editing of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Committees on Research Ethics of Moinhos de Vento Hospital under protocol number 4.173.386 in July 2020. The use of human subjects was performed in accordance with the World Medical Association Declaration of Helsinki and the 466/12 Resolution for guidelines and regulations of research involving human beings from the National Health Council of the Brazilian Ministry of Health. The privacy rights of human subjects have been observed and informed consent was obtained for experimentation with human subjects. Women invited to participate in this study voluntarily signed free and informed consent agreements (Termo de Consentimento Livre e Esclarecido – TCLE) to have samples and personal information collected and used in the study and future resultant publications, in a manner that does not allow the identification of specific individuals.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYacoub E., Saed Abdul-Wahab O.M., Al-Shyarba M.H. \u0026amp; Ben Abdelmoumen Mardassi B. The Relationship between Mycoplasmas and Cancer: Is It Fact or Fiction? Narrative Review and Update on the Situation. \u003cem\u003eJ. Oncol\u003c/em\u003e. \u003cstrong\u003e2021\u003c/strong\u003e, 9986550; 10.1155/2021/9986550 (2021).\u003c/li\u003e\n\u003cli\u003eSagata N. et al. Complete nucleotide sequence of the genome of bovine leukemia virus: Its evolutionary relationship to other retroviruses. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e. \u003cstrong\u003e82\u003c/strong\u003e, 677-681; 10.1073/pnas.82.3.677 (1985).\u003c/li\u003e\n\u003cli\u003eSchwartz I. \u0026amp; L\u0026eacute;vy D. Pathobiology of bovine leukemia virus. \u003cem\u003eVet. Res\u003c/em\u003e. \u003cstrong\u003e25\u003c/strong\u003e, 521-536 (1994).\u003c/li\u003e\n\u003cli\u003eBuehring G.C., Kramme P.M. \u0026amp; Schultz R.D. Evidence for bovine leukemia virus in the mammary epithelial cells of infected cows. Lab Invest. \u003cstrong\u003e71\u003c/strong\u003e, 359-365 (1994).\u003c/li\u003e\n\u003cli\u003eRovnak J., Casey J.W., Boyd A.L., Gonda M.A. \u0026amp; Cockerell G.L. Isolation of bovine leukemia virus infected endothelial cells from cattle with persistent lymphocytosis. \u003cem\u003eLab. Invest\u003c/em\u003e. \u003cstrong\u003e65\u003c/strong\u003e, 192\u0026ndash;202 (1991). \u003c/li\u003e\n\u003cli\u003ePolat M., Takeshima S.N. \u0026amp; Aida Y. Epidemiology and genetic diversity of bovine leukemia virus. \u003cem\u003eVirol. J\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, 209; 10.1186/s12985-017-0876-4 (2017).\u003c/li\u003e\n\u003cli\u003eGillet N. et al. Mechanisms of leukemogenesis induced by bovine leukemia virus: Prospects for novel anti-retroviral therapies in human. \u003cem\u003eRetrovirology\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e, 18; 10.1186/1742-4690-4-18 (2007).\u003c/li\u003e\n\u003cli\u003eRosewick N. et al. Cis-perturbation of cancer drivers by the HTLV-1/BLV proviruses is an early determinant of leukemogenesis. \u003cem\u003eNat. Commun\u003c/em\u003e. \u003cstrong\u003e8\u003c/strong\u003e, 15264; 10.1038/ncomms15264 (2017).\u003c/li\u003e\n\u003cli\u003eCoffin J. et al. ICTV Virus Taxonomy Profile: Retroviridae 2021. \u003cem\u003eJournal of General Virology\u003c/em\u003e. \u003cstrong\u003e102\u003c/strong\u003e; 10.1099/JGV.0.001712 (2021). \u003c/li\u003e\n\u003cli\u003eHopkins S.G. \u0026amp; DiGiacomo R.F. Natural transmission of bovine leukemia virus in dairy and beef cattle. \u003cem\u003eVet. Clin. North. Am. Food. Anim. Pract\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 107\u0026ndash;128. 10.1016/S0749-0720(15)30367-4 (1997).\u003c/li\u003e\n\u003cli\u003eVahlenkamp T.W., Choudhury B. \u0026amp; Kuzmak J. Enzootic Bovine Leukosis in \u003cem\u003eManual of Diagnostic Tests and Vaccines for Terrestrial Animals (Terrestrial Manual)\u003c/em\u003e (ed. World Organisation for Animal Health) chapter 3.4.9 (Paris, 2018).\u003c/li\u003e\n\u003cli\u003eRomero C.H., Cruz G.B. \u0026amp; Rowe C.A. Transmission of bovine leukaemia virus in milk. \u003cem\u003eTrop. Anim. Health Prod\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 215-218; 10.1007/BF02242060 (1983).\u003c/li\u003e\n\u003cli\u003eGuti\u0026eacute;rrez G., Lomonaco M., Alvarez I., Fernandez F. \u0026amp; Trono K. Characterization of colostrum from dams of BLV endemic dairy herds. \u003cem\u003eVet. Microbiol\u003c/em\u003e. \u003cstrong\u003e177\u003c/strong\u003e, 366\u0026ndash;369; 10.1016/j.vetmic.2015.03.001 (2015).\u003c/li\u003e\n\u003cli\u003eMeas S. et al. Infection of Bovine Immunodeficiency Virus and Bovine Leukemia Virus in Water Buffalo and Cattle Populations in Pakistan. \u003cem\u003eJ. Vet. Med. Sci\u003c/em\u003e. \u003cstrong\u003e62\u003c/strong\u003e, 329-331; 10.1292/jvms.62.329 (2000).\u003c/li\u003e\n\u003cli\u003eBurny A. et al. Bovine Leukaemia: Facts and Hypotheses Derived from the Study of an Infectious Cancer. \u003cem\u003eVet. Microbiol\u003c/em\u003e. \u003cstrong\u003e17\u003c/strong\u003e, 197-218; 10.1016/0378-1135(88)90066-1 (1988).\u003c/li\u003e\n\u003cli\u003eLee L.C., Scarratt W.K., Buehring G.C. \u0026amp; Saunders G.K. Bovine leukemia virus infection in a juvenile alpaca with multicentric lymphoma. \u003cem\u003eCan. Vet. J.\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 283-286 (2012).\u003c/li\u003e\n\u003cli\u003eMa J.G. et al. First Report of Bovine Leukemia Virus Infection in Yaks (Bos mutus) in China. \u003cem\u003eBiomed. Res. Int\u003c/em\u003e. \u003cstrong\u003e2016\u003c/strong\u003e, 9170167; 10.1155/2016/9170167 (2016). \u003c/li\u003e\n\u003cli\u003eSuneya M. et al. Induction of lymphosarcoma in sheep inoculated with bovine leukaemia virus. \u003cem\u003eJ. Comp. Pathol\u003c/em\u003e. \u003cstrong\u003e94\u003c/strong\u003e, 301\u0026ndash;309; 10.1016/0021-9975(84)90048-3 (1984).\u003c/li\u003e\n\u003cli\u003eDimitrov P. et al. Pathological features of experimental bovine leukaemia viral (BLV) infection in rats and rabbits. \u003cem\u003eBull. Vet. Inst. Pulawy\u003c/em\u003e. \u003cstrong\u003e56\u003c/strong\u003e, 115\u0026ndash;120; 10.2478/v10213-012-0021-5 (2012).\u003c/li\u003e\n\u003cli\u003eAltanerova V., Ban J., Kettmann R. \u0026amp; Altaner C. Induction of leukemia in chicken by bovine leukemia virus due to insertional mutagenesis. \u003cem\u003eArch Geschwulstforsch\u003c/em\u003e. \u003cstrong\u003e60\u003c/strong\u003e, 89\u0026ndash;96 (1990).\u003c/li\u003e\n\u003cli\u003eOlson C., Kettmann R., Burny A. \u0026amp; Kaja R. Goat lymphosarcoma from bovine leukemia virus. \u003cem\u003eJ. Natl. Cancer Inst\u003c/em\u003e. \u003cstrong\u003e67\u003c/strong\u003e, 671\u0026ndash;675 (1981).\u003c/li\u003e\n\u003cli\u003eOlaya-Gal\u0026aacute;n N.N. et al. In vitro Susceptibility of Human Cell Lines Infection by Bovine Leukemia Virus. \u003cem\u003eFront. Microbiol\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 793348; 10.3389/fmicb.2022.793348 (2022).\u003c/li\u003e\n\u003cli\u003eGiovanna M., Carlos U.J., Mar\u0026iacute;a U.A. \u0026amp; Gutierrez M.F. Bovine Leukemia Virus Gene Segment Detected in Human Breast Tissue. \u003cem\u003eOpen J. Med. Microbiol\u003c/em\u003e. \u003cstrong\u003e3\u003c/strong\u003e, 84\u0026ndash;90; 10.4236/ojmm.2013.31013 (2013).\u003c/li\u003e\n\u003cli\u003eOlaya-Galan N.N. et al. Risk factor for breast cancer development under exposure to bovine leukemia virus in Colombian women: A case-control study. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e16\u003c/strong\u003e, e0257492; 10.1371/journal.pone.0257492 (2021). \u003c/li\u003e\n\u003cli\u003eBuehring G.C. et al. Bovine leukemia virus DNA in human breast tissue. \u003cem\u003eEmerg. Infect. Dis\u003c/em\u003e. \u003cstrong\u003e20\u003c/strong\u003e, 772\u0026ndash;782; 10.3201/eid2005.131298 (2014).\u003c/li\u003e\n\u003cli\u003eBuehring G.C et al. Exposure to bovine leukemia virus is associated with breast cancer: A case-control study. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, e0134304; 10.1371/journal.pone.0134304 (2015).\u003c/li\u003e\n\u003cli\u003eBaltzell K.A. et al. Bovine leukemia virus linked to breast cancer but not coinfection with human papillomavirus: Case-control study of women in Texas. \u003cem\u003eCancer\u003c/em\u003e. \u003cstrong\u003e124\u003c/strong\u003e, 1342\u0026ndash;1349; 10.1002/cncr.31169 (2018).\u003c/li\u003e\n\u003cli\u003eBuehring G.C., Shen H.M., Schwartz D.A. \u0026amp; Lawson J.S. Bovine leukemia virus linked to breast cancer in Australian women and identified before breast cancer development. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, e0179367; 10.1371/journal.pone.0179367 (2017).\u003c/li\u003e\n\u003cli\u003eCeriani M.C. et al. Bovine leukemia virus presence in breast tissue of Argentinian women. Its association with cell proliferation and prognosis markers. \u003cem\u003eMultidiscip. Cancer Investig\u003c/em\u003e. \u003cstrong\u003e2\u003c/strong\u003e, 16-24; 10.30699/acadpub.mci.4.16 (2018).\u003c/li\u003e\n\u003cli\u003eSchwingel D., Andreolla A.P., Erpen L.M.S., Frandoloso R. \u0026amp; Kreutz L.C. Bovine leukemia virus DNA associated with breast cancer in women from South Brazil. \u003cem\u003eSci. Rep\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, 2949; 10.1038/s41598-019-39834-7 (2019).\u003c/li\u003e\n\u003cli\u003eDelarmelina E. et al. High positivity values for bovine leukemia virus in human breast cancer cases from Minas Gerais, Brazil. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, e0239745; 10.1371/journal.pone.0239745 (2020).\u003c/li\u003e\n\u003cli\u003eCanova R. et al. Bovine leukemia viral DNA found on human breast tissue is genetically related to the cattle virus. \u003cem\u003eOne Health\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 100252; 10.1016/j.onehlt.2021.100252 (2021).\u003c/li\u003e\n\u003cli\u003eKhalilian M., Hosseini S.M. \u0026amp; Madadgar O. Bovine leukemia virus detected in the breast tissue and blood of Iranian women. \u003cem\u003eMicrob. Pathog\u003c/em\u003e. \u003cstrong\u003e135\u003c/strong\u003e, 103566; 10.1016/j.micpath.2019.103566 (2019).\u003c/li\u003e\n\u003cli\u003eKhan Z. et al. Molecular investigation of possible relationships concerning bovine leukemia virus and breast cancer. \u003cem\u003eSci. Rep\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, 4161; 10.1038/s41598-022-08181-5 (2022).\u003c/li\u003e\n\u003cli\u003eElmatbouly A., Badr R.I., Masallat D.T., Youssef M.Y. \u0026amp; Omar N.S. Prevalence of Bovine leukemia virus in Egyptian women\u0026rsquo;s breast cancer tissues. \u003cem\u003eEgypt. J. Basic Appl. Sci\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e, 824\u0026ndash;34; 10.1080/2314808X.2023.2287811 (2023).\u003c/li\u003e\n\u003cli\u003eKhasawneh A.I. et al. Are Mouse Mammary Tumor Virus and Bovine Leukemia Virus Linked to Breast Cancer among Jordanian Women?. \u003cem\u003eMicrobiol. Res\u003c/em\u003e. \u003cstrong\u003e15\u003c/strong\u003e, 914\u0026ndash;925; 10.3390/microbiolres15020060 (2024). \u003c/li\u003e\n\u003cli\u003eBuehring G.C. et al. Bovine leukemia virus discovered in human blood. \u003cem\u003eBMC Infect. Dis\u003c/em\u003e. \u003cstrong\u003e19\u003c/strong\u003e, 297; 10.1186/s12879-019-3891-9 (2019). \u003c/li\u003e\n\u003cli\u003eMendoza W., Isaza J.P., L\u0026oacute;pez L., L\u0026oacute;pez-Herrera A. \u0026amp; Guti\u0026eacute;rrez L.A. Bovine Leukemia Virus molecular detection and associated factors among dairy herd workers in Antioquia, Colombia. \u003cem\u003eActa Trop\u003c/em\u003e. \u003cstrong\u003e256\u003c/strong\u003e, 107253; 10.1016/j.actatropica.2024.107253 (2024). \u003c/li\u003e\n\u003cli\u003eRobinson L.A. et al. Molecular evidence of viral DNA in non-small cell lung cancer and non-neoplastic lung. \u003cem\u003eBr. J. Cancer\u003c/em\u003e. \u003cstrong\u003e115\u003c/strong\u003e, 497-504; 10.1038/bjc.2016.213 (2016).\u003c/li\u003e\n\u003cli\u003eTaghadosi C., Kojouri G., Ahadi A., Hashemi Bahremani M. \u0026amp; Kojouri A. Bovine Leukaemia Virus Tax Antigen Identification in Human Lymphoma Tissue: Possibility of onco-protein Gene T transmission. \u003cem\u003eResearch in Molecular Medicine\u003c/em\u003e. \u003cstrong\u003e7\u003c/strong\u003e, 25\u0026ndash;32; 10.32598/rmm.7.2.75 (2019).\u003c/li\u003e\n\u003cli\u003eZhang R. et al. Lack of association between bovine leukemia virus and breast cancer in Chinese patients. \u003cem\u003eBreast Cancer Res\u003c/em\u003e. \u003cstrong\u003e18\u003c/strong\u003e, 101; 10.1186/s13058-016-0763-8 (2016).\u003c/li\u003e\n\u003cli\u003eYamanaka M.P. et al. No evidence of bovine leukemia virus proviral DNA and antibodies in human specimens from Japan. \u003cem\u003eRetrovirology\u003c/em\u003e. \u003cstrong\u003e19\u003c/strong\u003e, 7; 10.1186/s12977-022-00592-6 (2022).\u003c/li\u003e\n\u003cli\u003eGillet N.A. \u0026amp; Willems L. Whole genome sequencing of 51 breast cancers reveals that tumors are devoid of bovine leukemia virus DNA. \u003cem\u003eRetrovirology\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 75; 10.1186/s12977-016-0308-3 (2016).\u003c/li\u003e\n\u003cli\u003eAdekanmbi F. et al. Absence of bovine leukemia virus in the buffy coats of breast cancer cases from Alabama, USA. \u003cem\u003eMicrob. Pathog\u003c/em\u003e. \u003cstrong\u003e161\u003c/strong\u003e, 105238; 10.1016/j.micpath.2021.105238 (2021).\u003c/li\u003e\n\u003cli\u003eAmato S. et al. Exploring the presence of bovine leukemia virus among breast cancer tumors in a rural state. \u003cem\u003eBreast Cancer Res. Treat\u003c/em\u003e. \u003cstrong\u003e202\u003c/strong\u003e, 325\u0026ndash;334; 10.1007/s10549-023-07061-4 (2023).\u003c/li\u003e\n\u003cli\u003eNunes Z.M. et al. Detection of Human Papillomavirus (HPV) and Bovine Leukemia Virus (BLV) in Breast Cancer Patients from Northeastern Brazil. Preprint; 10.20944/preprints202408.1024.v1 (2024).\u003c/li\u003e\n\u003cli\u003eOlaya-Gal\u0026aacute;n N.N. et al. Bovine leukaemia virus DNA in fresh milk and raw beef for human consumption. \u003cem\u003eEpidemiol. Infect\u003c/em\u003e. \u003cstrong\u003e145\u003c/strong\u003e, 3125\u0026ndash;3130; 10.1017/S0950268817002229 (2017).\u003c/li\u003e\n\u003cli\u003ede Quadros D.L. et al. Oncogenic viral DNA related to human breast cancer found on cattle milk and meat. \u003cem\u003eComp. Immunol. Microbiol. Infect. Dis\u003c/em\u003e. \u003cstrong\u003e101\u003c/strong\u003e, 102053; 10.1016/j.cimid.2023.102053 (2023).\u003c/li\u003e\n\u003cli\u003eBenedetti F., Curreli S. \u0026amp; Zella D. Mycoplasmas\u0026ndash;host interaction: Mechanisms of inflammation and association with cellular transformation. \u003cem\u003eMicroorganisms\u003c/em\u003e. \u003cstrong\u003e8\u003c/strong\u003e, 1\u0026ndash;21; 10.3390/microorganisms8091351 (2020).\u003c/li\u003e\n\u003cli\u003eBarykova Y.A. et al. Association of Mycoplasma hominis infection with prostate cancer. \u003cem\u003eOncotarget\u003c/em\u003e. \u003cstrong\u003e2\u003c/strong\u003e, 289-297; 10.18632/oncotarget.256 (2011).\u003c/li\u003e\n\u003cli\u003eZakariah M. et al. To decipher the mycoplasma hominis proteins targeting into the endoplasmic reticulum and their implications in prostate cancer etiology using next-generation sequencing data. \u003cem\u003eMolecules\u003c/em\u003e. \u003cstrong\u003e23\u003c/strong\u003e, 994; 10.3390/molecules23050994 (2018).\u003c/li\u003e\n\u003cli\u003eTantengco O.A.G., Aquino I.M.C., de Castro Silva M., Rojo R.D. \u0026amp; Abad C.L.R. Association of mycoplasma with prostate cancer: A systematic review and meta-analysis. \u003cem\u003eCancer Epidemiol\u003c/em\u003e. \u003cstrong\u003e75\u003c/strong\u003e, 102021; 10.1016/j.canep.2021.102021 (2021).\u003c/li\u003e\n\u003cli\u003eHosseininasab-nodoushan S.A., Ghazvini K., Jamialahmadi T., Keikha M. \u0026amp; Sahebkar A. Association of Chlamydia and Mycoplasma infections with susceptibility to ovarian cancer: A systematic review and meta-analysis. \u003cem\u003eSemin. Cancer Biol\u003c/em\u003e. \u003cstrong\u003e86\u003c/strong\u003e, 923-928; 10.1016/j.semcancer.2021.07.016 (2022). \u003c/li\u003e\n\u003cli\u003eKlein C. et al. Mycoplasma co-infection is associated with cervical cancer risk. \u003cem\u003eCancers (Basel)\u003c/em\u003e. \u003cstrong\u003e12\u003c/strong\u003e, 1093; 10.3390/cancers12051093 (2020).\u003c/li\u003e\n\u003cli\u003eMitin V., Tumanova L. \u0026amp; Botnariuc N. Mycoplasma Faucium and Breast Cancer. \u003cem\u003ebioRxiv\u003c/em\u003e. Preprint, 089128; 10.1101/089128 (2016).\u003c/li\u003e\n\u003cli\u003eZella D. et al. Mycoplasma promotes malignant transformation in vivo, and its DnaK, a bacterial chaperon protein, has broad oncogenic properties. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e. \u003cstrong\u003e115\u003c/strong\u003e, E12005-E12014; 10.1073/pnas.1815660115 (2018).\u003c/li\u003e\n\u003cli\u003eRodakiewicz S.M. et al. Heterogeneity determination of bovine leukemia virus genome in Santa Catarina state, Brazil. \u003cem\u003eArq. Inst. Biol\u003c/em\u003e. \u003cstrong\u003e85\u003c/strong\u003e; 10.1590/1808-1657000742016 (2018).\u003c/li\u003e\n\u003cli\u003eHuang S., You Li J., Wu J., Meng L. \u0026amp; Chao Shou C. Mycoplasma infections and different human carcinomas. \u003cem\u003eWorld J. Gastroenterol\u003c/em\u003e. \u003cstrong\u003e7\u003c/strong\u003e, 266-269; 10.3748/wjg.v7.i2.266 (2001).\u003c/li\u003e\n\u003cli\u003eErturhan S.M. et al. Can mycoplasma contribute to formation of prostate cancer?. \u003cem\u003eInt. Urol. Nephrol\u003c/em\u003e. \u003cstrong\u003e45\u003c/strong\u003e, 33\u0026ndash;38; 10.1007/s11255-012-0299-5 (2013).\u003c/li\u003e\n\u003cli\u003eZarei O., Rezania S. \u0026amp; Mousavi A. Mycoplasma genitalium and cancer: A brief review. \u003cem\u003eAsian Pac. J. Cancer. Prev\u003c/em\u003e. \u003cstrong\u003e14\u003c/strong\u003e, 3425-8; 10.7314/apjcp.2013.14.6.3425 (2013). \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"bovine leukaemia virus, breast cancer, fresh tissue, human breast, Mycoplasma, zoonosis","lastPublishedDoi":"10.21203/rs.3.rs-7079614/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7079614/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBovine leukaemia virus (BLV) is a widespread Deltaretrovirus that remains mostly asymptomatic in cattle but can lead to B-cell lymphoma. Evidence suggests that BLV may infect humans and has been associated with breast cancer. \u003cem\u003eMycoplasma\u003c/em\u003e spp. are bacteria linked to various human diseases, including cancer. This study investigated the presence of BLV and Mycoplasma spp. DNA in fresh and formalin-fixed paraffin-embedded (FFPE) breast tissue and leukocyte samples from 100 women undergoing breast surgery in South Brazil. Polymerase chain reaction (PCR) and nested-PCR targeted four BLV genes in fresh tissue and leukocytes, and two genes in 30 FFPE samples from 21 patients. Fresh tissue was also tested for Mycoplasma spp. One fresh breast tissue sample was positive for the BLV \u003cem\u003etax\u003c/em\u003egene, confirmed by Sanger sequencing. All leukocyte and FFPE samples were negative for BLV. \u003cem\u003eMycoplasma\u003c/em\u003e spp. DNA was not detected in any fresh tissue sample. Compared to previous studies reporting BLV DNA in fresh tissue from Colombian women and FFPE samples in Brazil, our findings show a lower frequency. The negative results in leukocytes and FFPE samples support the hypothesis that most women in this study were not infected with BLV or \u003cem\u003eMycoplasma\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Is breast cancer in women caused by bovine leukaemia virus and Mycoplasma spp.? An investigation from South Brazil","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-06 13:54:23","doi":"10.21203/rs.3.rs-7079614/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"47e62a16-c98f-4bb6-92c1-eab6e96aa666","owner":[],"postedDate":"August 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52677691,"name":"Biological sciences/Cancer"},{"id":52677692,"name":"Health sciences/Diseases"},{"id":52677693,"name":"Biological sciences/Microbiology"},{"id":52677694,"name":"Biological sciences/Molecular biology"},{"id":52677695,"name":"Health sciences/Oncology"}],"tags":[],"updatedAt":"2025-08-18T07:09:02+00:00","versionOfRecord":[],"versionCreatedAt":"2025-08-06 13:54:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7079614","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7079614","identity":"rs-7079614","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}