Antimalarial resistance in Mozambique: Absence of Plasmodium falciparum Kelch 13 (K13) propeller domain polymorphisms associated with resistance to artemisinins

preprint OA: closed
Full text JSON View at publisher
AI-generated summary by claude@2026-07, 2026-07-15

This study found no <italic>Plasmodium falciparum</italic> Kelch 13 propeller domain polymorphisms associated with artemisinin resistance in samples collected from Mozambique in 2021.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-07, 2026-07-15 · read from full text

This cross-sectional study in Mozambique analyzed Plasmodium falciparum samples from 450 participants with malaria confirmed by rapid diagnostic test at three sites (Niassa, Manica, and Maputo) in 2021, extracting parasite DNA from dried blood spots and Sanger sequencing a pfk13 fragment spanning codons 412–723. Using alignment to PF3D7 and SIFT functional prediction for non-synonymous variants, the authors found no validated pfk13 K13 propeller domain SNPs associated with artemisinin (ACT) resistance, but they detected multiple non-synonymous mutations at prevalences of 10.2% (Niassa), 6% (Manica), and 5% (Maputo), with about half predicted deleterious by SIFT. A key limitation stated by the study is its reliance on presence/absence of known validated K13 markers and computational prediction rather than phenotypic resistance testing. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

Abstract Malaria remains one of the most serious public health problem in sub-Saharan Africa and Mozambique is the world's fourth largest contributor, with 4.7% of disease cases and 3.6% of total deaths due to malaria. Its control relies on the fight against the vector and treatment of confirmed cases with antimalarial drugs. Malaria Molecular surveillance is important tool for monitoring the spread of antimalarial drug resistance. A cross-sectional study recruited 450 participants with malaria infection detected by Rapid Diagnostic Test, from three different study sites (Niassa, Manica and Maputo) to collect blood samples on filter papers (Whatman® FTA® cards), between April and August of 2021. Parasite DNA was extracted from all dried blood spot samples using chelex method and Sanger sequenced. SIFT software (Sorting Intolerant From Tolerant) was used, predict whether an amino acid substitution affects protein function. No pfkelch13-mediated artemisinin resistance gene mutation was detected in our study settings. However, non-synonymous mutations were detected at prevalence of 10.2%, 6% and 5% in Niassa, Manica and Maputo, respectively. Most (56.3%) of the reported non-synonymous mutations were due to substitution at the first base of the codon, 25% at the second base and 18.8% at the third base. Additionally, 50% of non-synonymous mutations showed a SIFTscore bellow cut off value of 0.05, therefore, they were predicted to be deleterious. Our results do not show an emergence of artemisinin resistance cases in Mozambique. However, the increased number of novel non-synonymous mutations highlights the relevance of increasing the number of studies focused on the molecular surveillance of ACTs resistance markers, for its early detection.
Full text 86,304 characters · extracted from preprint-html · click to expand
Antimalarial resistance in Mozambique: Absence of Plasmodium falciparum Kelch 13 (K13) propeller domain polymorphisms associated with resistance to artemisinins | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antimalarial resistance in Mozambique: Absence of Plasmodium falciparum Kelch 13 (K13) propeller domain polymorphisms associated with resistance to artemisinins Clemente Silva, Daniela Matias, Brigite Dias, Beatriz Cancio, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2708793/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 May, 2023 Read the published version in Malaria Journal → Version 1 posted 7 You are reading this latest preprint version Abstract Malaria remains one of the most serious public health problem in sub-Saharan Africa and Mozambique is the world's fourth largest contributor, with 4.7% of disease cases and 3.6% of total deaths due to malaria. Its control relies on the fight against the vector and treatment of confirmed cases with antimalarial drugs. Malaria Molecular surveillance is important tool for monitoring the spread of antimalarial drug resistance. A cross-sectional study recruited 450 participants with malaria infection detected by Rapid Diagnostic Test, from three different study sites (Niassa, Manica and Maputo) to collect blood samples on filter papers (Whatman® FTA® cards), between April and August of 2021. Parasite DNA was extracted from all dried blood spot samples using chelex method and Sanger sequenced. SIFT software (Sorting Intolerant From Tolerant) was used, predict whether an amino acid substitution affects protein function. No pfkelch13 -mediated artemisinin resistance gene mutation was detected in our study settings. However, non-synonymous mutations were detected at prevalence of 10.2%, 6% and 5% in Niassa, Manica and Maputo, respectively. Most (56.3%) of the reported non-synonymous mutations were due to substitution at the first base of the codon, 25% at the second base and 18.8% at the third base. Additionally, 50% of non-synonymous mutations showed a SIFTscore bellow cut off value of 0.05, therefore, they were predicted to be deleterious. Our results do not show an emergence of artemisinin resistance cases in Mozambique. However, the increased number of novel non-synonymous mutations highlights the relevance of increasing the number of studies focused on the molecular surveillance of ACTs resistance markers, for its early detection. Figures Figure 1 Introduction Malaria remains one of the most serious public health problem in sub-Saharan Africa [ 1 ] and Mozambique is the world's fourth largest contributor, with 4.7% of disease cases and 3.6% of total deaths due to malaria [ 2 ]. In 2021, WHO recommended the use of a malaria vaccine to protect children, however, the vaccine has low efficacy and its distribution is not yet widespread in Mozambique [ 3 ]. Therefore, malaria control relies on the fight against the vector and the administration of antimalarial drugs [ 4 ]. Plasmodium falciparum , the most virulent of the five species that infect humans, has developed resistance to the successively introduced antimalarial drugs, including to the currently recommended artemisinin-based combination therapy (ACT) introduced in Mozambique in 2009 [ 5 , 6 ]. Historically, cases of antimalarial resistance have their starting point in Southeast Asia [ 6 , 7 ], move through east Africa’s coast and spread to the rest of the continent [ 8 – 12 ]. In Mozambique, the ACTs artemether–lumefantrine (AL) and artesunate–amodiaquine (AS–AQ) are currently the first-line treatment for uncomplicated malaria [ 1 , 13 – 17 ]. Mutations in the pfk13 propeller domain have been correlated with delayed parasite clearance (partial resistance) after administration of ATCs [ 17 , 18 ]. Some of the mutations are validated Single Nucleotide Polymorphisms (SNPs), used as molecular markers for the surveillance of artemisinin-resistant malaria parasites (F446L, N458Y, M476I, Y493H, R539T, I543T, P553L, R561H, P574L, C580Y) (WHO, 2019). Recently, P. falciparum parasites carrying the validated SNPs F446I, M476I, P553L, R561H, P574L, C580Y and A675V have emerged and expanded or been identified in Africa [ 19 ], in Angola, Ghana [ 20 ], Mali, Rwanda [ 21 – 24 ]. In Mozambique, available studies on the prevalence of pfK13 SNPs, refer to parasite samples collected prior to 2018 [ 25 – 28 ]. Hence, with this study we aim to update the pfk13 SNPs profile of P. falciparum parasite population, currently circulating in Mozambique. Methods Ethical Considerations The study protocol obtained ethical clearance by the National Bioethics Committee for Health of Mozambique (CNBS—IRB00002657) (Ref: 131/CNBS/2021) dated: March 2021. Study Settings And Sample Collection Malaria is endemic throughout Mozambique, ranging from hyper-endemic areas along the coastline, meso-endemic areas in the interior lowlands and some hypo-endemic areas in the interior highlands. Several factors contribute to this endemicity, ranging from climatic and environmental conditions such as favourable temperatures and rainfall, as well as favourable breeding sites for the vector. Most of the country has year-round throughout the year, with peaks during the rainy season from December to April [ 4 ]. Patient recruitment took place in 3 different epidemiological settings, in northern (hospital distrital de Marrupa in Niassa), central ( centro de saúde Eduardo Mondlhane and centro de saúde 7 de abril in Manica) and southern ( hospital provincial da Matola in Maputo) area of Mozambique, between April and August of 2021. One hundred and fifty samples were collected in each study site (Fig. 1A). The choice of Niassa, Manica and Maputo provinces not only is aligned with our scientific goals but also with the objectives of Instituto Nacional de Saúde, and National Malaria Control Programme Mozambique, contributing to the systematic mapping of malaria cases at the national level. A total of 450 participants of all ages with malaria positive Rapid Diagnostic Test were recruited and provided 100µl of blood samples on filter papers (Whatman® FTA® cards), after written informed consent. All dried blood spot samples were then stored under − 20°C until they were used for genotyping. Characterization of Pfk13 gene polymorphisms Parasite genomic DNA from dried blood spots was extracted using the Chelex method [ 29 ], and DNA was stored at -20°C. Real-time PCR was used for P. falciparum confirmation. PCR reactions targeting the 18S rRNA gene were conducted as described in Rosanas-Urgell et al 2010, with modifications. Briefly, forward primer 5’-TATTGCTTTTGAGAGGTTTTGTTACTTTG-3’ and reverse primer ACCTCTGACATCTGAATACGAATGC and the probe FAM-ACGGGTAGTCATGATTGAGTT-MGB-BHQ were used. PCR reaction mixture consisted of 7.5 µL of 2X (NZYTECH, Portugal), 600 nM of each primer and 200 nM of FAM™- labeled probe (IDT Integrated DNA Technologies, USA), 1 µL of genomic DNA and water up to 15 µL. PCR conditions: 50 ºC for 2 minutes and 95 ºC for 10 minutes; these were followed by 40 cycles at 94 ºC for 30 seconds and a final cycle at 60 ºC for 1 minute. Triplicate samples were assayed in the Bio-Rad 500 Real Time PCR System™ (Applied Biosystems, USA). All reactions were performed with positive controls (DNA from 3D7 strain of P. falciparum culture). The Pfk13 fragment, containing the main polymorphisms associated with resistance to artemisinin, was amplified by nested PCR as described by Escobar and co-workers [ 26 ], with slight adjustements. Briefly, specific primers were developed for this purpose (forward—5’-CTATACCCATACCAAAAGATTTAAGTG-3’, reverse—5’-GCTTGGCCCATCTTTATTAGTTCCC-3’), obtaining a fragment of 902bp (from codon 412 to codon 723). PCR conditions [ 30 ]: 94°C 3 min; [94°C 30s, 57°C 30s, 72°C 30s] 10X; [94°C 30s, 55°C 30s, 72°C 30s] 30X; 72°C 3min. PCR products were analyzed by electrophoresis on a 2% agarose gel stained with GreenSafe Premium (Nzytech, Portugal) to confirm amplification of targeted fragments. All positive PCR products were then purified using SureClean Plus (Bioline) and shipped to Eurofins Genomics (GATC services, Germany), to proceed with Sanger sequencing. Successfully sequenced samples were aligned to the PF3D7_1343700 gene using Multalign software ( http://multalin.toulouse.inra.fr/ ; free online) and/or BioEdit version 7.2 for mutation detection. Bar charts with prevalence of artemisinin resistance markers were generated using Graphpad Prism 8.01 software. To predicts biological functional relevance for non-synonymous SNPs we used SIFT software (Sorting Intolerant From Tolerant, free online, https://sift.bii.a-star.edu.sg/index.html ). We predicted the functionality of the protein, using SIFT software, which takes into account the position at which the variation takes place and the type of amino acid change, then SIFT chooses related proteins and obtains an alignment of these proteins with the query [ 31 ]. Finally, it calculates the probability that an amino acid at a position is tolerated [ 31 ]. If the calculated value is less than a cutoff of 0.05, the substitution is predicted to be deleterious, and the opposite is considered not deleterious [ 31 – 33 ]. Results Study participants From the 450 participants included in the study, one third were from each of the three study provinces (Fig. 1). Most of the participants were males, representing 57,53% (259/450) respectively. The age ranged from 6 months to 74 years, and the overall majority (%) were children between 1 to 12 years old, and the average was 15years old. Artemisinin resistance pfk13 polymorphism profile From selected samples, 66,2% (298/450) were confirmed for P. falciparum by real time PCR, and DNA was successfully sequenced for pfk13 , where 98, 100 and 100 were from Niassa, Manica and Maputo, respectively. No validated SNP for artemisinin derivate resistance was detected in our samples. However, in Niassa, 10.2% (09/98) of samples harbored nine different non-synonymous mutations (Fig. 1B). In Manica and Maputo, five different non-synonymous mutations were detected in 6 (6/100) and 5 (5/100) samples, respectively (Fig. 1C-D). 56.3% (9/16) of the non-synonymous mutations reported in this study were by substitution at the 1st base of the codon, 25% (4/16) at the second base and 18.8% (3/16) at the third base. The non-synonymous mutation, W470R, was detected in all provinces and its prevalence decreases from north to south with 3%, 2% and 1% in Niassa, Manica and Maputo, respectively. Synonymous mutations were only detected in samples from Manica and Maputo (Fig. 1E). Prediction Of The Effect Of Observed Non-synonymous Mutations In Protein Funcionality With a cut-off score of 0.05, we predicted that V454E, V494L, A578P, V581A, E509D, E455Q and L663I mutations would be tolerated or have a non-deleterious effect on protein function, with equal score or higher than 0.05 as shown in the Fig. 1E . For the remaining SNPs, were predicted to affect protein function [ 31 – 33 ] with a score of 0.00 (Fig. 1E). Discussion In Mozambique, the first line for uncomplicated malaria treatment is AL and ASAQ the second line and an alternative in case of contraindications[ 13 ]. Artemisinin and its derivatives play an important role in killing Plasmodium falciparum by inhibiting the activity of phosphatidylinositol-3-kinase (PfPI3K) [ 18 , 34 ] and like any other drug, it may have side effects, but they are poorly expressed [ 18 , 35 , 36 ]. Surveillance of validated and/or resistance-associated SNPs of the aforementioned ACTs is a powerful weapon to control the spread of parasite resistance through early detection of mutations [ 37 – 39 ]. Moreover, these mutations are being associated with the reduction in pfkelch13 function, a protein required for parasite-mediated endocytosis of host haemoglobin in the newly invaded intra-erythrocytic ring stages [ 7 , 39 ]. Thus, the present study was designed to update the current profile of SNPs in P. falciparum pfk13 associated with partial artemisinin resistance in 3 provinces of Mozambique (Niassa, Manica and Maputo), from April to August 2021. Our results showed that 66,2% of selected samples were confirmed for P. falciparum by real time PCR, and successfully sequenced for pfk13 gene. No validated mutation for artemisinin resistance was observed in our samples. Furthermore, we detected 16 non-synonymous (G449R (GGT»CGT), V454E (GTA»GAA), E455Q (GAA»CAA), D464Y (GAT»CAT), W470R (TGG»AGG), V494L (GTT»CTT), C532W (TGT»TGG), I543S(ATT»AGT) A578S (GCT»TCT), A578P (GCT»CCT), V581A (GTT»GCT), D464H (GAT»CAT), E509D (AGA»AAA), Q654H (CAA»CAC), Q661H ( CAA»CAC), L663I (CAA»CAC)) and 5 Synonymous (S459S, C469C , L598L, G548G, G549G) mutations. However, most of these mutations were due to substitution at one or more bases of the codons. Out of these 21 point mutations, three have been reported in Africa, namely C469C [ 40 , 41 ], A578S [ 41 – 43 ] and Q661H [ 41 , 44 ]. The remaining point mutations were reported for the first time in our study, as far as we are concerned, not even in Mozambique. Escobar and co-workers detected a non-synonym mutation (V494I) in two samples from Maputo [ 26 ]. Another study from Mozambique reported 4 polymorphisms (L619L, F656I, V666V, and G690G) with no mutations associated with resistance to the same drugs aforementioned [ 27 ]. A recent study with samples collected in 4 study settings from Mozambique (Montepuez, Moatize, Mopeia, Massinga) in 2018, in the context of the therapeutic efficacy, detected synonymous mutations in two samples [ 25 ]. In Uganda, 5 non-synonymous and 1 synonymous, no validated or associated to resistance mutation were reported by [ 11 ], while in Tanzania, 31 mutations in codon R561H were reported by [ 46 ], however, none of these mutation were associated with artemisinin resistance[ 45 ]. The same mutation was reported in Rwanda, with the addition of another mutation at codon P574L, in a therapeutic efficacy study in children under 6–59 months old in 2018 [ 22 ]. Although these results illustrate an emergence of resistance cases in Africa, the reported non-synonymous mutation from our study is not enough to raise alarm in these countries, as well as in Mozambique. Furthermore, the latest therapeutic efficacy study in Mozambique confirmed the susceptibility of P. falciparum to the drugs currently in use [ 15 ], however, continuous surveillance of ACTs resistance markers is urgently needed. We predicted the functionality of the protein. Thus, the obtained SIFT scores (Fig. 1) for V454E, V494L, A578P, V581A, E509D, E455Q and L663I indicate that these mutations are tolerated or have non-deleterious effect on protein function, because they are equal or above the cut off value of 0.05 [ 31 – 33 ]. For the remaining non-synonymous mutations, SIFT scores predicted them to be deleterious, with a score of 0.00, bellow cut off value of 0.05 [ 31 – 33 ]. SIFT issued a warning stating that there is low confidence in this prediction, since these substitutions may have been predicted to be deleterious just because the sequences used were not diverse enough. According to Pauline C. Ng and Steven Henikoff, SIFT builds alignments with a median conservation value of 3.0. Usually, predictions based on sequence alignments with higher median conservation values are less diverse and will have a higher false positive error [ 31 ]. Our results showed that we do not have an emergency of artemisinin resistance cases, even though we observed novel non-synonymous mutations, highlighting the relevance of increasing the number of studies focused on the molecular surveillance of resistance markers to ACTs. Conclusions No pfkelch13 -mediated artemisinin resistance validated gene mutation was found in our samples. Non-synonymous mutations were detected in all three provinces, with a prevalence of 11.22%, 6% and 5% in Niassa, Manica and Maputo respectively. These results are limited to the provinces and districts selected by us. Hence the need to replicate these experiences and always with the aim of better informing PNCM decision making and ultimately the genomics of malaria in Mozambique to become a programmatic activity. Further research is currently being done and will provide more information on the resistance profile to pfKelch13 [ 47 ] Declarations Funding This research was funded by Fundação para a Ciência e Tecnologia (https://www.fct.pt/) project GHTM - UID/04413/2020 (https://ghtm.ihmt.unl.pt/). Instituto CAMÕES (https://www.instituto-camoes.pt/) BOLSAS CAMÕES, FUNDAÇÃO MILLENNIUM BCP (https://www.fundacaomillenniumbcp.pt/en/). Paróquia de São Nicolau - Lisboa. Acknowledgements We thank all study participants, everyone who supported this study directly or indirectly. Our most profound gratitude to Dr. Salomão Tomás, Alfa Moiane, Filipe Murgorgo. Authors’ contributions C.d.S., B.D., B.C., D.M., M.S., R.V. and D.D., F.N: Conducted laboratory activities C.d.S., B.D., B.C., DM, M.S., and R.V.: Wrote the first draft of the manuscript; C.d.S., N.C., S.L., C.S.: Conducted the field activities (sample collection); F.N., C.d.S, P.A. and S.E.: Designed the study protocol and reviewed the manuscript. Conflicts of Interest : The authors declare no conflict of interest. Availability of data and materials The data and materials analyzed in this study are available from the corresponding author. Authors' information 1 Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa. 2 Instituto Nacional de Saúde, Maputo (Mozambique) (INS). 3 Hospital Provincial de Matola, Maputo (Mozambique). 4 Malaria Consortium, Mozambique. References Sato S. Correction to: Plasmodium—a brief introduction to the parasites causing human malaria and their basic biology (Journal of Physiological Anthropology, (2021), 40, 1, (1), 10.1186/s40101-020-00251-9). J Physiol Anthropol. Journal of Physiological Anthropology; 2021;40:1–13. WHO. Word Malaria Report 2021. Word Malar. Rep. Geneva World Heal. Organ. (2021). Licence CC. 2021. World Health Organization. Full Evidence Report on the RTS,S/AS01 Malaria Vaccine. SAGE Yellow B Oct 2021 [Internet]. 2021;1–90. Available from: https://cdn.who.int/media/docs/default-source/immunization/mvip/full-evidence-report-on-the-rtss-as01-malaria-vaccine-for-sage-mpag-(sept 2021).pdf?sfvrsn=c9737be_5#:~:text=Impact%3A The DSMB concluded that,of which were statistically significant. INS INE. PNCM. Inquérito Nacional sobre Indicadores de Malária. 2019;190. Plowe CV, Roper C, Barnwell JW, Happi CT, Joshi HH, Mbacham W, et al. World Antimalarial Resistance Network (WARN) III: Molecular markers for drug resistant malaria. Malar J. 2007;6:1–10. World Health Organization. Status report on artemisinin resistance and ACT efficacy (August 2018). World Heal Organ [Internet]. 2018;10. Available from: https://www.who.int/malaria/publications/atoz/artemisinin-resistance-august2018/en/ Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J et al. Artemisinin Resistance in. Drug Ther (NY) [Internet]. 2009;361:455–67. Available from: http://www.ncbi.nlm.nih.gov/pubmed/21543403 Wongsrichanalai C, Pickard AL, Wernsdorfer WH, Meshnick SR. Reviews Epidemiology of drug-resistant malaria. 2002;2:209–18. Rasmussen C, Alonso P, Ringwald P. Current and emerging strategies to combat antimalarial resistance. Expert Rev Anti Infect Ther [Internet]. Taylor & Francis; 2022;20:353–72. Available from: https://doi.org/10.1080/14787210.2021.1962291 Rana R, Khan N, Sandeepta S, Pati S, Das A, Bal M et al. Molecular surveillance of anti-malarial drug resistance genes in Plasmodium falciparum isolates in Odisha, India. Malar J [Internet]. BioMed Central; 2022;21:394. Available from: https://doi.org/10.1186/s12936-022-04403-3 Ocan M, Ashaba FK, Mwesigwa S, Edgar K, Kamya MR, Nsobya SL. Prevalence of arps10, fd, pfmdr-2, pfcrt and pfkelch13 gene mutations in Plasmodium falciparum parasite population in Uganda. PLoS One [Internet]. 2022;17:1–10. Available from: http://dx.doi.org/10.1371/journal.pone.0268095 Takala-Harrison S, Laufer MK. Antimalarial drug resistance in Africa: Key lessons for the future. Ann N Y Acad Sci. 2015;1342:62–7. Baltazar Candrinho A, Tiago S, Mabunda. Francisco Saúte e Paula Caupers RM. Normas de Tratamento da Malária em Moçambique. 3rd ed. MISAU, editor. Maputo; 2017. Fidock D. Mutations in the P. falciparum Digestive Vacuole Transmembrane Protein PfCRT and Evidence for Their Role in Chloroquine Resistance. Mol Cell. 2000;6:861–71. Nhama A, Nhamússua L, Macete E, Bassat Q, Salvador C, Enosse S et al. In vivo efficacy and safety of artemether–lumefantrine and amodiaquine–artesunate for uncomplicated Plasmodium falciparum malaria in Mozambique, 2018. Malar J [Internet]. BioMed Central; 2021;20:1–12. Available from: https://doi.org/10.1186/s12936-021-03922-9 Rosanas-Urgell A, Mueller D, Betuela I, Barnadas C, Iga J, Zimmerman PA, et al. Comparison of diagnostic methods for the detection and quantification of the four sympatric Plasmodium species in field samples from Papua New Guinea. Malar J. 2010;9:1–8. WHO. Report on antimalarial drug efficacy, resistance and response. 2019. Dong Y, Wang J, Sun A, Deng Y, Chen M, Xu Y et al. Genetic association between the Pfk13 gene mutation and artemisinin resistance phenotype in Plasmodium falciparum isolates from Yunnan Province, China. Malar J [Internet]. BioMed Central; 2018;17:1–12. Available from: https://doi.org/10.1186/s12936-018-2619-4 Ndwiga L, Kimenyi KM, Wamae K, Osoti V, Akinyi M, Omedo I et al. A review of the frequencies of Plasmodium falciparum Kelch 13 artemisinin resistance mutations in Africa. Int J Parasitol Drugs Drug Resist [Internet]. Elsevier Ltd; 2021;16:155–61. Available from: https://doi.org/10.1016/j.ijpddr.2021.06.001 Matrevi SA, Tandoh KZ, Bruku S, Opoku-Agyeman P, Adams T, Ennuson NA et al. Novel pfk13 polymorphisms in Plasmodium falciparum population in Ghana. Sci Rep [Internet]. Nature Publishing Group UK; 2022;12:1–9. Available from: https://doi.org/10.1038/s41598-022-11790-9 Uwimana A, Legrand E, Stokes BH, Ndikumana JLM, Warsame M, Umulisa N, et al. Emergence and clonal expansion of in vitro artemisinin-resistant Plasmodium falciparum kelch13 R561H mutant parasites in Rwanda. Nat Med. 2020;26:1602–8. Uwimana A, Umulisa N, Venkatesan M, Svigel SS, Zhou Z, Munyaneza T et al.genotypes with delayed parasite clearance in Rwanda: 2021;21. Bergmann C, Loon W, Van, Habarugira F, Tacoli C, Jäger JC, Savelsberg D, et al. Increase in Kelch 13 Polymorphisms in Plasmodium. 2021;27:5–7. Straimer J, Gandhi P, Renner KC, Schmitt EK. High Prevalence of Plasmodium falciparum K13 Mutations in Rwanda Is Associated With Slow Parasite Clearance After Treatment With Artemether-Lumefantrine. J Infect Dis. 2022;225:1411–4. Chidimatembue A, Svigel SS, Mayor A, Aíde P, Nhama A, Nhamussua L et al. Molecular surveillance for polymorphisms associated with artemisinin – based combination therapy resistance in Plasmodium falciparum isolates collected in Mozambique, 2018. Malar J [Internet]. BioMed Central; 2021;1–9. Available from: https://doi.org/10.1186/s12936-021-03930-9 Escobar C, Pateira S, Lobo E, Lobo L, Teodosio R, Dias F, et al. Polymorphisms in Plasmodium falciparum K13-propeller in angola and mozambique after the introduction of the ACTs. PLoS ONE. 2015;10:2–7. Gupta H, Macete E, Bulo H, Salvador C, Warsame M, Carvalho E et al. Drug-Resistant Polymorphisms and Copy Numbers in. 2018;24. Preston MD, Campino S, Assefa SA, Echeverry DF, Ocholla H, Amambua-Ngwa A, et al. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains. Nat Commun. 2014;5:6–11. Bereczky S, Mårtensson A, Gil JP, Färnert A. Short report: Rapid DNA extraction from archive blood spots on filter paper for genotyping of Plasmodium falciparum. Am J Trop Med Hyg. 2005;72:249–51. Serrano D, Santos-Reis A, Silva C, Dias A, Dias B, Toscano C, et al. Imported malaria in portugal: Prevalence of polymorphisms in the anti-malarial drug resistance genes pfmdr1 and pfk13. Microorganisms. 2021;9:1–12. Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31:3812–4. Hu J, Ng PC. SIFT Indel: Predictions for the Functional Effects of Amino Acid Insertions/Deletions in Proteins. PLoS ONE. 2013;8:1–8. Hu J, Ng PC. Predicting the effects of frameshifting indels.Genome Biol. 2012;13. Tu Y. The discovery of artemisinin (qinghaosu) and gifts from Chinese medicine. Nat Med [Internet]. Nature Publishing Group; 2011;17:1217–20. Available from: http://dx.doi.org/10.1038/nm.2471 Miller LH, Su X, Artemisinin. Discovery from the Chinese herbal garden. Cell [Internet]. Elsevier Inc.; 2011;146:855–8. Available from: http://dx.doi.org/10.1016/j.cell.2011.08.024 Mok S, Ashley EA, Ferreira PE, Zhu L, Lin Z, Yeo T, et al. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance. Sci (80-). 2015;347:431–5. Nsanzabana C, Djalle D, Guérin PJ, Ménard D, González IJ. Tools for surveillance of anti-malarial drug resistance: An assessment of the current landscape. Malar J [Internet]. BioMed Central; 2018;17:1–16. Available from: https://doi.org/10.1186/s12936-018-2185-9 Nsanzabana C. Time to scale up molecular surveillance for anti-malarial drug resistance in sub-saharan Africa. Malar J [Internet]. BioMed Central; 2021;20:1–5. Available from: https://doi.org/10.1186/s12936-021-03942-5 Ariey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50–5. Wang X, Ruan W, Zhou S, Huang F, Lu Q, Feng X et al. Molecular surveillance of Pfcrt and k13 propeller polymorphisms of imported Plasmodium falciparum cases to Zhejiang Province, China between 2016 and 2018. Malar J [Internet]. BioMed Central; 2020;19:1–9. Available from: https://doi.org/10.1186/s12936-020-3140-0 Ajogbasile FV, Oluniyi PE, Kayode AT, Akano KO, Adegboyega BB, Philip C et al. Molecular profiling of the artemisinin resistance Kelch 13 gene in Plasmodium falciparum from Nigeria. PLoS One [Internet]. 2022;17:1–14. Available from: http://dx.doi.org/10.1371/journal.pone.0264548 Ouattara A, Kone A, Adams M, Fofana B, Maiga AW, Hampton S, et al. Polymorphisms in the K13-propeller gene in artemisinin-susceptible Plasmodium falciparum parasites from Bougoula-Hameau and Bandiagara, Mali. Am J Trop Med Hyg. 2015;92:1202–6. Igbasi U, Oyibo W, Omilabu S, Quan H, Chen SB, Shen HM, et al. Kelch 13 propeller gene polymorphism among Plasmodium falciparum isolates in Lagos, Nigeria: Molecular Epidemiologic Study. Trop Med Int Heal. 2019;24:1011–7. Idowu AO, Oyibo WA, Bhattacharyya S, Khubbar M, Mendie UE, Bumah VV et al. Rare mutations in Pfmdr1 gene of Plasmodium falciparum detected in clinical isolates from patients treated with anti-malarial drug in Nigeria. Malar J [Internet]. BioMed Central; 2019;18:1–9. Available from: https://doi.org/10.1186/s12936-019-2947-z Bwire GM, Ngasala B, Mikomangwa WP, Kilonzi M, Kamuhabwa AAR. Detection of mutations associated with artemisinin resistance at k13-propeller gene and a near complete return of chloroquine susceptible falciparum malaria in Southeast of Tanzania. Sci Rep [Internet]. Springer US; 2020;10:1–7. Available from: http://dx.doi.org/10.1038/s41598-020-60549-7 Amambua-Ngwa A, Tetteh KKA, Manske M, Gomez-Escobar N, Stewart LB, Deerhake ME et al. Population Genomic Scan for Candidate Signatures of Balancing Selection to Guide Antigen Characterization in Malaria Parasites.PLoS Genet. 2012;8. Mayor A, Da Silva C, Rovira-Vallbona E, Roca-Feltrer A, Bonnington C, Wharton-Smith A, et al. Prospective surveillance study to detect antimalarial drug resistance, gene deletions of diagnostic relevance and genetic diversity of Plasmodium falciparum in Mozambique: protocol. BMJ Open. 2022;12:1–11. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 19 May, 2023 Read the published version in Malaria Journal → Version 1 posted Editorial decision: Major revision 26 Apr, 2023 Reviews received at journal 04 Apr, 2023 Reviewers agreed at journal 03 Apr, 2023 Reviewers invited by journal 31 Mar, 2023 Submission checks completed at journal 25 Mar, 2023 Editor assigned by journal 25 Mar, 2023 First submitted to journal 18 Mar, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2708793","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":186360664,"identity":"9bd6c48d-dd85-4a0e-96c1-191eb65a2540","order_by":0,"name":"Clemente Silva","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIiWNgGAWjYDACZuYGCIOdgfEBkOLhI6yFEaqFmYHZAKSFjbA1CC1sEiCaoBb5dsY2iR9/7BL7m5mfVX7NsZNhY2B++OgGHi0GhxnbJHt4khNnHGYzuy27LRnoMDZj4xx8WpgZmw14JJiNGQ4zmN2W3MYM1MLDJo1Pi3wzY7PhH4N6Y/nD7N+KJbfVE9bCcJix8TFPwmE5g8M8Zowftx0mrMUApEXmwHE5w8M8xdKM247zsDET8It8/+EDB9/8qeaRO96+8ePPbdX2/OzNDx/jdRgyYOYBk8QqBwHGH6SoHgWjYBSMghEDAPvYP7kpwVhZAAAAAElFTkSuQmCC","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":true,"prefix":"","firstName":"Clemente","middleName":"","lastName":"Silva","suffix":""},{"id":186360665,"identity":"75a789bd-b634-4d88-86b2-f2cb2d701d08","order_by":1,"name":"Daniela Matias","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Daniela","middleName":"","lastName":"Matias","suffix":""},{"id":186360666,"identity":"dba439ad-6e78-4ed4-b14e-7bb4a117cf0c","order_by":2,"name":"Brigite Dias","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Brigite","middleName":"","lastName":"Dias","suffix":""},{"id":186360667,"identity":"43ba10b4-f522-4c1d-a4e1-a46f009050ad","order_by":3,"name":"Beatriz Cancio","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Beatriz","middleName":"","lastName":"Cancio","suffix":""},{"id":186360668,"identity":"2f64c7b4-6880-4c16-a457-df40c188d87f","order_by":4,"name":"Miguel Silva","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Miguel","middleName":"","lastName":"Silva","suffix":""},{"id":186360669,"identity":"94ef3ee5-d0d8-4dc2-ba11-10e6cb2c007b","order_by":5,"name":"Ruben Viegas","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Ruben","middleName":"","lastName":"Viegas","suffix":""},{"id":186360670,"identity":"ed825811-ddf9-418c-9714-1d7f1482e2e4","order_by":6,"name":"Nordino Chivale","email":"","orcid":"","institution":"Instituto Nacional de Saúde","correspondingAuthor":false,"prefix":"","firstName":"Nordino","middleName":"","lastName":"Chivale","suffix":""},{"id":186360671,"identity":"aebacd4d-ac34-45d1-8908-b5088de1de39","order_by":7,"name":"Sonia Luis","email":"","orcid":"","institution":"Hospital Provincial de Matola","correspondingAuthor":false,"prefix":"","firstName":"Sonia","middleName":"","lastName":"Luis","suffix":""},{"id":186360672,"identity":"5c10e367-8a00-4835-9623-098373c0c239","order_by":8,"name":"Crizolgo Salvador","email":"","orcid":"","institution":"Instituto Nacional de Saúde","correspondingAuthor":false,"prefix":"","firstName":"Crizolgo","middleName":"","lastName":"Salvador","suffix":""},{"id":186360673,"identity":"87808dc7-9599-42f2-aea3-8c15a4769818","order_by":9,"name":"Denise Duarte","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Denise","middleName":"","lastName":"Duarte","suffix":""},{"id":186360675,"identity":"8df5b35c-a774-44ed-a395-3eeb93bad86d","order_by":10,"name":"Paulo Arnaldo","email":"","orcid":"","institution":"Instituto Nacional de Saúde","correspondingAuthor":false,"prefix":"","firstName":"Paulo","middleName":"","lastName":"Arnaldo","suffix":""},{"id":186360676,"identity":"e9442d96-05f8-4f91-91a1-12095a15857a","order_by":11,"name":"Sonia Enosse","email":"","orcid":"","institution":"Malaria Consortium","correspondingAuthor":false,"prefix":"","firstName":"Sonia","middleName":"","lastName":"Enosse","suffix":""},{"id":186360679,"identity":"e5550d02-5a09-4fbc-91e2-bb233ebdc270","order_by":12,"name":"Fatima Nogueira","email":"","orcid":"","institution":"Global Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa","correspondingAuthor":false,"prefix":"","firstName":"Fatima","middleName":"","lastName":"Nogueira","suffix":""}],"badges":[],"createdAt":"2023-03-18 18:14:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2708793/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2708793/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12936-023-04589-0","type":"published","date":"2023-05-19T20:54:22+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":34922763,"identity":"07695366-9e12-4b67-b3cf-56afa2929fa1","added_by":"auto","created_at":"2023-03-28 14:01:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":369302,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eStudy sites and sample size. n-sample size in each province. Pie chart depict the percentage of children (Beau blue) and adults (Steel blue) enrolled in the study. (\u003cstrong\u003eB, C and D) \u003c/strong\u003ePrevalence of \u003cem\u003epfk13 \u003c/em\u003emutations in Niassa, Manica, and Maputo, respectively. Non-synonymous mutation (orange), synonymous mutation (yellow) and Wild type (green). \u003cstrong\u003eE \u003c/strong\u003eMutations in 3 provinces and the respective codons and SIFT scores. Syn- Synonymous; Non.Syn- Non-synonymous. Figure was created using Illustrator version 26.3.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-2708793/v1/d2adc9d9a8b8b179b6b90dd9.png"},{"id":44729208,"identity":"95244516-d8db-4a55-b3ba-4eb5fdc1bf8a","added_by":"auto","created_at":"2023-10-16 21:14:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":611865,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2708793/v1/3d8ad6d1-3c72-4c30-a697-0d11bd6259e9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antimalarial resistance in Mozambique: Absence of Plasmodium falciparum Kelch 13 (K13) propeller domain polymorphisms associated with resistance to artemisinins","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMalaria remains one of the most serious public health problem in sub-Saharan Africa [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and Mozambique is the world's fourth largest contributor, with 4.7% of disease cases and 3.6% of total deaths due to malaria [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In 2021, WHO recommended the use of a malaria vaccine to protect children, however, the vaccine has low efficacy and its distribution is not yet widespread in Mozambique [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, malaria control relies on the fight against the vector and the administration of antimalarial drugs [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003ePlasmodium falciparum\u003c/em\u003e, the most virulent of the five species that infect humans, has developed resistance to the successively introduced antimalarial drugs, including to the currently recommended artemisinin-based combination therapy (ACT) introduced in Mozambique in 2009 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Historically, cases of antimalarial resistance have their starting point in Southeast Asia [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], move through east Africa\u0026rsquo;s coast and spread to the rest of the continent [\u003cspan additionalcitationids=\"CR9 CR10 CR11\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In Mozambique, the ACTs artemether\u0026ndash;lumefantrine (AL) and artesunate\u0026ndash;amodiaquine (AS\u0026ndash;AQ) are currently the first-line treatment for uncomplicated malaria [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMutations in the \u003cem\u003epfk13\u003c/em\u003e propeller domain have been correlated with delayed parasite clearance (partial resistance) after administration of ATCs [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Some of the mutations are validated Single Nucleotide Polymorphisms (SNPs), used as molecular markers for the surveillance of artemisinin-resistant malaria parasites (F446L, N458Y, M476I, Y493H, R539T, I543T, P553L, R561H, P574L, C580Y) (WHO, 2019). Recently, \u003cem\u003eP. falciparum\u003c/em\u003e parasites carrying the validated SNPs F446I, M476I, P553L, R561H, P574L, C580Y and A675V have emerged and expanded or been identified in Africa [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], in Angola, Ghana [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], Mali, Rwanda [\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In Mozambique, available studies on the prevalence of \u003cem\u003epfK13\u003c/em\u003e SNPs, refer to parasite samples collected prior to 2018 [\u003cspan additionalcitationids=\"CR26 CR27\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Hence, with this study we aim to update the \u003cem\u003epfk13\u003c/em\u003e SNPs profile of \u003cem\u003eP. falciparum\u003c/em\u003e parasite population, currently circulating in Mozambique.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthical Considerations\u003c/h2\u003e \u003cp\u003e The study protocol obtained ethical clearance by the National Bioethics Committee for Health of Mozambique (CNBS\u0026mdash;IRB00002657) (Ref: 131/CNBS/2021) dated: March 2021.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eStudy Settings And Sample Collection\u003c/h3\u003e\n\u003cp\u003eMalaria is endemic throughout Mozambique, ranging from hyper-endemic areas along the coastline, meso-endemic areas in the interior lowlands and some hypo-endemic areas in the interior highlands. Several factors contribute to this endemicity, ranging from climatic and environmental conditions such as favourable temperatures and rainfall, as well as favourable breeding sites for the vector. Most of the country has year-round throughout the year, with peaks during the rainy season from December to April [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Patient recruitment took place in 3 different epidemiological settings, in northern (hospital distrital de Marrupa in Niassa), central (\u003cem\u003ecentro de sa\u0026uacute;de Eduardo Mondlhane\u003c/em\u003e and \u003cem\u003ecentro de sa\u0026uacute;de 7 de abril\u003c/em\u003e in Manica) and southern (\u003cem\u003ehospital provincial da Matola\u003c/em\u003e in Maputo) area of Mozambique, between April and August of 2021. One hundred and fifty samples were collected in each study site (Fig.\u0026nbsp;1A). The choice of Niassa, Manica and Maputo provinces not only is aligned with our scientific goals but also with the objectives of Instituto Nacional de Sa\u0026uacute;de, and National Malaria Control Programme Mozambique, contributing to the systematic mapping of malaria cases at the national level.\u003c/p\u003e \u003cp\u003e A total of 450 participants of all ages with malaria positive Rapid Diagnostic Test were recruited and provided 100\u0026micro;l of blood samples on filter papers (Whatman\u0026reg; FTA\u0026reg; cards), after written informed consent. All dried blood spot samples were then stored under \u0026minus;\u0026thinsp;20\u0026deg;C until they were used for genotyping.\u003c/p\u003e \u003cp\u003e \u003cb\u003eCharacterization of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003ePfk13\u003c/span\u003e \u003cb\u003egene polymorphisms\u003c/b\u003e\u003c/p\u003e \u003cp\u003eParasite genomic DNA from dried blood spots was extracted using the Chelex method [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and DNA was stored at -20\u0026deg;C. Real-time PCR was used for \u003cem\u003eP. falciparum\u003c/em\u003e confirmation. PCR reactions targeting the 18S rRNA gene were conducted as described in Rosanas-Urgell et al 2010, with modifications. Briefly, forward primer 5\u0026rsquo;-TATTGCTTTTGAGAGGTTTTGTTACTTTG-3\u0026rsquo; and reverse primer ACCTCTGACATCTGAATACGAATGC and the probe FAM-ACGGGTAGTCATGATTGAGTT-MGB-BHQ were used. PCR reaction mixture consisted of 7.5 \u0026micro;L of 2X (NZYTECH, Portugal), 600 nM of each primer and 200 nM of FAM\u0026trade;- labeled probe (IDT Integrated DNA Technologies, USA), 1 \u0026micro;L of genomic DNA and water up to 15 \u0026micro;L. PCR conditions: 50 \u0026ordm;C for 2 minutes and 95 \u0026ordm;C for 10 minutes; these were followed by 40 cycles at 94 \u0026ordm;C for 30 seconds and a final cycle at 60 \u0026ordm;C for 1 minute. Triplicate samples were assayed in the Bio-Rad 500 Real Time PCR System\u0026trade; (Applied Biosystems, USA). All reactions were performed with positive controls (DNA from 3D7 strain of \u003cem\u003eP. falciparum\u003c/em\u003e culture).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003ePfk13\u003c/em\u003e fragment, containing the main polymorphisms associated with resistance to artemisinin, was amplified by nested PCR as described by Escobar and co-workers [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], with slight adjustements. Briefly, specific primers were developed for this purpose (forward\u0026mdash;5\u0026rsquo;-CTATACCCATACCAAAAGATTTAAGTG-3\u0026rsquo;, reverse\u0026mdash;5\u0026rsquo;-GCTTGGCCCATCTTTATTAGTTCCC-3\u0026rsquo;), obtaining a fragment of 902bp (from codon 412 to codon 723). PCR conditions [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]: 94\u0026deg;C 3 min; [94\u0026deg;C 30s, 57\u0026deg;C 30s, 72\u0026deg;C 30s] 10X; [94\u0026deg;C 30s, 55\u0026deg;C 30s, 72\u0026deg;C 30s] 30X; 72\u0026deg;C 3min. PCR products were analyzed by electrophoresis on a 2% agarose gel stained with GreenSafe Premium (Nzytech, Portugal) to confirm amplification of targeted fragments. All positive PCR products were then purified using SureClean Plus (Bioline) and shipped to Eurofins Genomics (GATC services, Germany), to proceed with Sanger sequencing. Successfully sequenced samples were aligned to the PF3D7_1343700 gene using Multalign software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://multalin.toulouse.inra.fr/\u003c/span\u003e\u003cspan address=\"http://multalin.toulouse.inra.fr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; free online) and/or BioEdit version 7.2 for mutation detection. Bar charts with prevalence of artemisinin resistance markers were generated using Graphpad Prism 8.01 software. To predicts biological functional relevance for non-synonymous SNPs we used SIFT software (Sorting Intolerant From Tolerant, free online, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://sift.bii.a-star.edu.sg/index.html\u003c/span\u003e\u003cspan address=\"https://sift.bii.a-star.edu.sg/index.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). We predicted the functionality of the protein, using SIFT software, which takes into account the position at which the variation takes place and the type of amino acid change, then SIFT chooses related proteins and obtains an alignment of these proteins with the query [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Finally, it calculates the probability that an amino acid at a position is tolerated [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. If the calculated value is less than a cutoff of 0.05, the substitution is predicted to be deleterious, and the opposite is considered not deleterious [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStudy participants\u003c/h2\u003e \u003cp\u003eFrom the 450 participants included in the study, one third were from each of the three study provinces (Fig.\u0026nbsp;1). Most of the participants were males, representing 57,53% (259/450) respectively. The age ranged from 6 months to 74 years, and the overall majority (%) were children between 1 to 12 years old, and the average was 15years old.\u003c/p\u003e \u003cp\u003e \u003cb\u003eArtemisinin resistance\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003epfk13\u003c/span\u003e \u003cb\u003epolymorphism profile\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFrom selected samples, 66,2% (298/450) were confirmed for \u003cem\u003eP. falciparum\u003c/em\u003e by real time PCR, and DNA was successfully sequenced for \u003cem\u003epfk13\u003c/em\u003e, where 98, 100 and 100 were from Niassa, Manica and Maputo, respectively. No validated SNP for artemisinin derivate resistance was detected in our samples. However, in Niassa, 10.2% (09/98) of samples harbored nine different non-synonymous mutations (Fig.\u0026nbsp;1B). In Manica and Maputo, five different non-synonymous mutations were detected in 6 (6/100) and 5 (5/100) samples, respectively (Fig.\u0026nbsp;1C-D). 56.3% (9/16) of the non-synonymous mutations reported in this study were by substitution at the 1st base of the codon, 25% (4/16) at the second base and 18.8% (3/16) at the third base. The non-synonymous mutation, W470R, was detected in all provinces and its prevalence decreases from north to south with 3%, 2% and 1% in Niassa, Manica and Maputo, respectively. Synonymous mutations were only detected in samples from Manica and Maputo (Fig.\u0026nbsp;1E).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrediction Of The Effect Of Observed Non-synonymous Mutations In Protein Funcionality\u003c/h3\u003e\n\u003cp\u003e With a cut-off score of 0.05, we predicted that V454E, V494L, A578P, V581A, E509D, E455Q and L663I mutations would be tolerated or have a non-deleterious effect on protein function, with equal score or higher than 0.05 as shown in the \u003cb\u003eFig.\u0026nbsp;1E\u003c/b\u003e. For the remaining SNPs, were predicted to affect protein function [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] with a score of 0.00 (Fig.\u0026nbsp;1E).\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003eIn Mozambique, the first line for uncomplicated malaria treatment is AL and ASAQ the second line and an alternative in case of contraindications[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Artemisinin and its derivatives play an important role in killing \u003cem\u003ePlasmodium falciparum\u003c/em\u003e by inhibiting the activity of phosphatidylinositol-3-kinase (PfPI3K) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and like any other drug, it may have side effects, but they are poorly expressed [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Surveillance of validated and/or resistance-associated SNPs of the aforementioned ACTs is a powerful weapon to control the spread of parasite resistance through early detection of mutations [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Moreover, these mutations are being associated with the reduction in \u003cem\u003epfkelch13\u003c/em\u003e function, a protein required for parasite-mediated endocytosis of host haemoglobin in the newly invaded intra-erythrocytic ring stages [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Thus, the present study was designed to update the current profile of SNPs in \u003cem\u003eP. falciparum pfk13\u003c/em\u003e associated with partial artemisinin resistance in 3 provinces of Mozambique (Niassa, Manica and Maputo), from April to August 2021.\u003c/p\u003e \u003cp\u003eOur results showed that 66,2% of selected samples were confirmed for \u003cem\u003eP. falciparum\u003c/em\u003e by real time PCR, and successfully sequenced for \u003cem\u003epfk13\u003c/em\u003e gene. No validated mutation for artemisinin resistance was observed in our samples. Furthermore, we detected 16 non-synonymous (G449R (GGT\u0026raquo;CGT), V454E (GTA\u0026raquo;GAA), E455Q (GAA\u0026raquo;CAA), D464Y (GAT\u0026raquo;CAT), W470R (TGG\u0026raquo;AGG), V494L (GTT\u0026raquo;CTT), C532W (TGT\u0026raquo;TGG), I543S(ATT\u0026raquo;AGT) \u003cb\u003eA578S\u003c/b\u003e (GCT\u0026raquo;TCT), A578P (GCT\u0026raquo;CCT), V581A (GTT\u0026raquo;GCT), D464H (GAT\u0026raquo;CAT), E509D (AGA\u0026raquo;AAA), Q654H (CAA\u0026raquo;CAC), \u003cb\u003eQ661H (\u003c/b\u003eCAA\u0026raquo;CAC), L663I (CAA\u0026raquo;CAC)) and 5 Synonymous (S459S, \u003cb\u003eC469C\u003c/b\u003e, L598L, G548G, G549G) mutations. However, most of these mutations were due to substitution at one or more bases of the codons. Out of these 21 point mutations, three have been reported in Africa, namely C469C [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], A578S [\u003cspan additionalcitationids=\"CR42\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] and Q661H [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The remaining point mutations were reported for the first time in our study, as far as we are concerned, not even in Mozambique. Escobar and co-workers detected a non-synonym mutation (V494I) in two samples from Maputo [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Another study from Mozambique reported 4 polymorphisms (L619L, F656I, V666V, and G690G) with no mutations associated with resistance to the same drugs aforementioned [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. A recent study with samples collected in 4 study settings from Mozambique (Montepuez, Moatize, Mopeia, Massinga) in 2018, in the context of the therapeutic efficacy, detected synonymous mutations in two samples [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In Uganda, 5 non-synonymous and 1 synonymous, no validated or associated to resistance mutation were reported by [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], while in Tanzania, 31 mutations in codon R561H were reported by [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], however, none of these mutation were associated with artemisinin resistance[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. The same mutation was reported in Rwanda, with the addition of another mutation at codon P574L, in a therapeutic efficacy study in children under 6\u0026ndash;59 months old in 2018 [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Although these results illustrate an emergence of resistance cases in Africa, the reported non-synonymous mutation from our study is not enough to raise alarm in these countries, as well as in Mozambique. Furthermore, the latest therapeutic efficacy study in Mozambique confirmed the susceptibility of \u003cem\u003eP. falciparum\u003c/em\u003e to the drugs currently in use [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], however, continuous surveillance of ACTs resistance markers is urgently needed.\u003c/p\u003e \u003cp\u003eWe predicted the functionality of the protein. Thus, the obtained SIFT scores (Fig.\u0026nbsp;1) for V454E, V494L, A578P, V581A, E509D, E455Q and L663I indicate that these mutations are tolerated or have non-deleterious effect on protein function, because they are equal or above the cut off value of 0.05 [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. For the remaining non-synonymous mutations, SIFT scores predicted them to be deleterious, with a score of 0.00, bellow cut off value of 0.05 [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. SIFT issued a warning stating that there is low confidence in this prediction, since these substitutions may have been predicted to be deleterious just because the sequences used were not diverse enough. According to Pauline C. Ng and Steven Henikoff, SIFT builds alignments with a median conservation value of 3.0. Usually, predictions based on sequence alignments with higher median conservation values are less diverse and will have a higher false positive error [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur results showed that we do not have an emergency of artemisinin resistance cases, even though we observed novel non-synonymous mutations, highlighting the relevance of increasing the number of studies focused on the molecular surveillance of resistance markers to ACTs.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eNo \u003cem\u003epfkelch13\u003c/em\u003e-mediated artemisinin resistance validated gene mutation was found in our samples. Non-synonymous mutations were detected in all three provinces, with a prevalence of 11.22%, 6% and 5% in Niassa, Manica and Maputo respectively.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eThese results are limited to the provinces and districts selected by us. Hence the need to replicate these experiences and always with the aim of better informing PNCM decision making and ultimately the genomics of malaria in Mozambique to become a programmatic activity. Further research is currently being done and will provide more information on the resistance profile to pfKelch13 [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Funda\u0026ccedil;\u0026atilde;o para a Ci\u0026ecirc;ncia e Tecnologia (https://www.fct.pt/) project GHTM - UID/04413/2020 (https://ghtm.ihmt.unl.pt/). Instituto CAM\u0026Otilde;ES (https://www.instituto-camoes.pt/) BOLSAS CAM\u0026Otilde;ES, FUNDA\u0026Ccedil;\u0026Atilde;O MILLENNIUM BCP (https://www.fundacaomillenniumbcp.pt/en/). Par\u0026oacute;quia de S\u0026atilde;o Nicolau - Lisboa.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank all study participants, everyone who supported this study directly or indirectly. Our most profound gratitude to Dr. Salom\u0026atilde;o Tom\u0026aacute;s, Alfa Moiane, Filipe Murgorgo.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eC.d.S., B.D., B.C., D.M., M.S., R.V. and D.D., F.N: Conducted laboratory activities\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eC.d.S., B.D., B.C., DM, M.S., and R.V.: Wrote the first draft of the manuscript;\u003c/p\u003e\n\u003cp\u003eC.d.S., N.C., S.L., C.S.: Conducted the field activities (sample collection);\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eF.N., C.d.S, P.A. and S.E.: Designed the study protocol and reviewed the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data and materials analyzed in this study are available from the corresponding\u003cbr\u003e\u0026nbsp;author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; information\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eGlobal Health and Tropical Medicine (GHTM), Department of Medical Parasitology, Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa. \u003csup\u003e2\u003c/sup\u003eInstituto Nacional de Sa\u0026uacute;de, Maputo (Mozambique) (INS). \u003csup\u003e3\u003c/sup\u003eHospital Provincial de Matola, Maputo (Mozambique). \u003csup\u003e4\u003c/sup\u003eMalaria Consortium, Mozambique.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSato S. Correction to: Plasmodium\u0026mdash;a brief introduction to the parasites causing human malaria and their basic biology (Journal of Physiological Anthropology, (2021), 40, 1, (1), 10.1186/s40101-020-00251-9). J Physiol Anthropol. Journal of Physiological Anthropology; 2021;40:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO. Word Malaria Report 2021. Word Malar. Rep. Geneva World Heal. Organ. (2021). Licence CC. 2021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. Full Evidence Report on the RTS,S/AS01 Malaria Vaccine. SAGE Yellow B Oct 2021 [Internet]. 2021;1\u0026ndash;90. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cdn.who.int/media/docs/default-source/immunization/mvip/full-evidence-report-on-the-rtss-as01-malaria-vaccine-for-sage-mpag-(sept\u003c/span\u003e\u003cspan address=\"https://cdn.who.int/media/docs/default-source/immunization/mvip/full-evidence-report-on-the-rtss-as01-malaria-vaccine-for-sage-mpag-(sept\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e2021).pdf?sfvrsn=c9737be_5#:~:text=Impact%3A The DSMB concluded that,of which were statistically significant.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eINS INE. PNCM. Inqu\u0026eacute;rito Nacional sobre Indicadores de Mal\u0026aacute;ria. 2019;190.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlowe CV, Roper C, Barnwell JW, Happi CT, Joshi HH, Mbacham W, et al. World Antimalarial Resistance Network (WARN) III: Molecular markers for drug resistant malaria. Malar J. 2007;6:1\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorld Health Organization. Status report on artemisinin resistance and ACT efficacy (August 2018). World Heal Organ [Internet]. 2018;10. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/malaria/publications/atoz/artemisinin-resistance-august2018/en/\u003c/span\u003e\u003cspan address=\"https://www.who.int/malaria/publications/atoz/artemisinin-resistance-august2018/en/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J et al. Artemisinin Resistance in. Drug Ther (NY) [Internet]. 2009;361:455\u0026ndash;67. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/pubmed/21543403\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/pubmed/21543403\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWongsrichanalai C, Pickard AL, Wernsdorfer WH, Meshnick SR. Reviews Epidemiology of drug-resistant malaria. 2002;2:209\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasmussen C, Alonso P, Ringwald P. Current and emerging strategies to combat antimalarial resistance. Expert Rev Anti Infect Ther [Internet]. Taylor \u0026amp; Francis; 2022;20:353\u0026ndash;72. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/14787210.2021.1962291\u003c/span\u003e\u003cspan address=\"10.1080/14787210.2021.1962291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRana R, Khan N, Sandeepta S, Pati S, Das A, Bal M et al. Molecular surveillance of anti-malarial drug resistance genes in Plasmodium falciparum isolates in Odisha, India. Malar J [Internet]. BioMed Central; 2022;21:394. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-022-04403-3\u003c/span\u003e\u003cspan address=\"10.1186/s12936-022-04403-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOcan M, Ashaba FK, Mwesigwa S, Edgar K, Kamya MR, Nsobya SL. Prevalence of arps10, fd, pfmdr-2, pfcrt and pfkelch13 gene mutations in Plasmodium falciparum parasite population in Uganda. PLoS One [Internet]. 2022;17:1\u0026ndash;10. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1371/journal.pone.0268095\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0268095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakala-Harrison S, Laufer MK. Antimalarial drug resistance in Africa: Key lessons for the future. Ann N Y Acad Sci. 2015;1342:62\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaltazar Candrinho A, Tiago S, Mabunda. Francisco Sa\u0026uacute;te e Paula Caupers RM. Normas de Tratamento da Mal\u0026aacute;ria em Mo\u0026ccedil;ambique. 3rd ed. MISAU, editor. Maputo; 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFidock D. Mutations in the P. falciparum Digestive Vacuole Transmembrane Protein PfCRT and Evidence for Their Role in Chloroquine Resistance. Mol Cell. 2000;6:861\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNhama A, Nham\u0026uacute;ssua L, Macete E, Bassat Q, Salvador C, Enosse S et al. In vivo efficacy and safety of artemether\u0026ndash;lumefantrine and amodiaquine\u0026ndash;artesunate for uncomplicated Plasmodium falciparum malaria in Mozambique, 2018. Malar J [Internet]. BioMed Central; 2021;20:1\u0026ndash;12. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-021-03922-9\u003c/span\u003e\u003cspan address=\"10.1186/s12936-021-03922-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosanas-Urgell A, Mueller D, Betuela I, Barnadas C, Iga J, Zimmerman PA, et al. Comparison of diagnostic methods for the detection and quantification of the four sympatric Plasmodium species in field samples from Papua New Guinea. Malar J. 2010;9:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO. Report on antimalarial drug efficacy, resistance and response. 2019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDong Y, Wang J, Sun A, Deng Y, Chen M, Xu Y et al. Genetic association between the Pfk13 gene mutation and artemisinin resistance phenotype in Plasmodium falciparum isolates from Yunnan Province, China. Malar J [Internet]. BioMed Central; 2018;17:1\u0026ndash;12. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-018-2619-4\u003c/span\u003e\u003cspan address=\"10.1186/s12936-018-2619-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNdwiga L, Kimenyi KM, Wamae K, Osoti V, Akinyi M, Omedo I et al. A review of the frequencies of Plasmodium falciparum Kelch 13 artemisinin resistance mutations in Africa. Int J Parasitol Drugs Drug Resist [Internet]. Elsevier Ltd; 2021;16:155\u0026ndash;61. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijpddr.2021.06.001\u003c/span\u003e\u003cspan address=\"10.1016/j.ijpddr.2021.06.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatrevi SA, Tandoh KZ, Bruku S, Opoku-Agyeman P, Adams T, Ennuson NA et al. Novel pfk13 polymorphisms in Plasmodium falciparum population in Ghana. Sci Rep [Internet]. Nature Publishing Group UK; 2022;12:1\u0026ndash;9. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-11790-9\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-11790-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUwimana A, Legrand E, Stokes BH, Ndikumana JLM, Warsame M, Umulisa N, et al. Emergence and clonal expansion of in vitro artemisinin-resistant Plasmodium falciparum kelch13 R561H mutant parasites in Rwanda. Nat Med. 2020;26:1602\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUwimana A, Umulisa N, Venkatesan M, Svigel SS, Zhou Z, Munyaneza T et al.genotypes with delayed parasite clearance in Rwanda: 2021;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBergmann C, Loon W, Van, Habarugira F, Tacoli C, J\u0026auml;ger JC, Savelsberg D, et al. Increase in Kelch 13 Polymorphisms in Plasmodium. 2021;27:5\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStraimer J, Gandhi P, Renner KC, Schmitt EK. High Prevalence of Plasmodium falciparum K13 Mutations in Rwanda Is Associated With Slow Parasite Clearance After Treatment With Artemether-Lumefantrine. J Infect Dis. 2022;225:1411\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChidimatembue A, Svigel SS, Mayor A, A\u0026iacute;de P, Nhama A, Nhamussua L et al. Molecular surveillance for polymorphisms associated with artemisinin \u0026ndash; based combination therapy resistance in Plasmodium falciparum isolates collected in Mozambique, 2018. Malar J [Internet]. BioMed Central; 2021;1\u0026ndash;9. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-021-03930-9\u003c/span\u003e\u003cspan address=\"10.1186/s12936-021-03930-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEscobar C, Pateira S, Lobo E, Lobo L, Teodosio R, Dias F, et al. Polymorphisms in Plasmodium falciparum K13-propeller in angola and mozambique after the introduction of the ACTs. PLoS ONE. 2015;10:2\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGupta H, Macete E, Bulo H, Salvador C, Warsame M, Carvalho E et al. Drug-Resistant Polymorphisms and Copy Numbers in. 2018;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePreston MD, Campino S, Assefa SA, Echeverry DF, Ocholla H, Amambua-Ngwa A, et al. A barcode of organellar genome polymorphisms identifies the geographic origin of Plasmodium falciparum strains. Nat Commun. 2014;5:6\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBereczky S, M\u0026aring;rtensson A, Gil JP, F\u0026auml;rnert A. Short report: Rapid DNA extraction from archive blood spots on filter paper for genotyping of Plasmodium falciparum. Am J Trop Med Hyg. 2005;72:249\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSerrano D, Santos-Reis A, Silva C, Dias A, Dias B, Toscano C, et al. Imported malaria in portugal: Prevalence of polymorphisms in the anti-malarial drug resistance genes pfmdr1 and pfk13. Microorganisms. 2021;9:1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 2003;31:3812\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu J, Ng PC. SIFT Indel: Predictions for the Functional Effects of Amino Acid Insertions/Deletions in Proteins. PLoS ONE. 2013;8:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu J, Ng PC. Predicting the effects of frameshifting indels.Genome Biol. 2012;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu Y. The discovery of artemisinin (qinghaosu) and gifts from Chinese medicine. Nat Med [Internet]. Nature Publishing Group; 2011;17:1217\u0026ndash;20. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/nm.2471\u003c/span\u003e\u003cspan address=\"10.1038/nm.2471\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiller LH, Su X, Artemisinin. Discovery from the Chinese herbal garden. Cell [Internet]. Elsevier Inc.; 2011;146:855\u0026ndash;8. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1016/j.cell.2011.08.024\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2011.08.024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMok S, Ashley EA, Ferreira PE, Zhu L, Lin Z, Yeo T, et al. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance. Sci (80-). 2015;347:431\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNsanzabana C, Djalle D, Gu\u0026eacute;rin PJ, M\u0026eacute;nard D, Gonz\u0026aacute;lez IJ. Tools for surveillance of anti-malarial drug resistance: An assessment of the current landscape. Malar J [Internet]. BioMed Central; 2018;17:1\u0026ndash;16. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-018-2185-9\u003c/span\u003e\u003cspan address=\"10.1186/s12936-018-2185-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNsanzabana C. Time to scale up molecular surveillance for anti-malarial drug resistance in sub-saharan Africa. Malar J [Internet]. BioMed Central; 2021;20:1\u0026ndash;5. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-021-03942-5\u003c/span\u003e\u003cspan address=\"10.1186/s12936-021-03942-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAriey F, Witkowski B, Amaratunga C, Beghain J, Langlois AC, Khim N, et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature. 2014;505:50\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Ruan W, Zhou S, Huang F, Lu Q, Feng X et al. Molecular surveillance of Pfcrt and k13 propeller polymorphisms of imported Plasmodium falciparum cases to Zhejiang Province, China between 2016 and 2018. Malar J [Internet]. BioMed Central; 2020;19:1\u0026ndash;9. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-020-3140-0\u003c/span\u003e\u003cspan address=\"10.1186/s12936-020-3140-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAjogbasile FV, Oluniyi PE, Kayode AT, Akano KO, Adegboyega BB, Philip C et al. Molecular profiling of the artemisinin resistance Kelch 13 gene in Plasmodium falciparum from Nigeria. PLoS One [Internet]. 2022;17:1\u0026ndash;14. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1371/journal.pone.0264548\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0264548\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuattara A, Kone A, Adams M, Fofana B, Maiga AW, Hampton S, et al. Polymorphisms in the K13-propeller gene in artemisinin-susceptible Plasmodium falciparum parasites from Bougoula-Hameau and Bandiagara, Mali. Am J Trop Med Hyg. 2015;92:1202\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIgbasi U, Oyibo W, Omilabu S, Quan H, Chen SB, Shen HM, et al. Kelch 13 propeller gene polymorphism among Plasmodium falciparum isolates in Lagos, Nigeria: Molecular Epidemiologic Study. Trop Med Int Heal. 2019;24:1011\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIdowu AO, Oyibo WA, Bhattacharyya S, Khubbar M, Mendie UE, Bumah VV et al. Rare mutations in Pfmdr1 gene of Plasmodium falciparum detected in clinical isolates from patients treated with anti-malarial drug in Nigeria. Malar J [Internet]. BioMed Central; 2019;18:1\u0026ndash;9. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12936-019-2947-z\u003c/span\u003e\u003cspan address=\"10.1186/s12936-019-2947-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBwire GM, Ngasala B, Mikomangwa WP, Kilonzi M, Kamuhabwa AAR. Detection of mutations associated with artemisinin resistance at k13-propeller gene and a near complete return of chloroquine susceptible falciparum malaria in Southeast of Tanzania. Sci Rep [Internet]. Springer US; 2020;10:1\u0026ndash;7. Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/s41598-020-60549-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-60549-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmambua-Ngwa A, Tetteh KKA, Manske M, Gomez-Escobar N, Stewart LB, Deerhake ME et al. Population Genomic Scan for Candidate Signatures of Balancing Selection to Guide Antigen Characterization in Malaria Parasites.PLoS Genet. 2012;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayor A, Da Silva C, Rovira-Vallbona E, Roca-Feltrer A, Bonnington C, Wharton-Smith A, et al. Prospective surveillance study to detect antimalarial drug resistance, gene deletions of diagnostic relevance and genetic diversity of Plasmodium falciparum in Mozambique: protocol. BMJ Open. 2022;12:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"malaria-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"malj","sideBox":"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)","snPcode":"12936","submissionUrl":"https://submission.nature.com/new-submission/12936/3","title":"Malaria Journal","twitterHandle":"@malariajournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-2708793/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2708793/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMalaria remains one of the most serious public health problem in sub-Saharan Africa and Mozambique is the world's fourth largest contributor, with 4.7% of disease cases and 3.6% of total deaths due to malaria. Its control relies on the fight against the vector and treatment of confirmed cases with antimalarial drugs. Malaria Molecular surveillance is important tool for monitoring the spread of antimalarial drug resistance. A cross-sectional study recruited 450 participants with malaria infection detected by Rapid Diagnostic Test, from three different study sites (Niassa, Manica and Maputo) to collect blood samples on filter papers (Whatman\u0026reg; FTA\u0026reg; cards), between April and August of 2021. Parasite DNA was extracted from all dried blood spot samples using chelex method and Sanger sequenced. SIFT software (Sorting Intolerant From Tolerant) was used, predict whether an amino acid substitution affects protein function. No \u003cem\u003epfkelch13\u003c/em\u003e-mediated artemisinin resistance gene mutation was detected in our study settings. However, non-synonymous mutations were detected at prevalence of 10.2%, 6% and 5% in Niassa, Manica and Maputo, respectively. Most (56.3%) of the reported non-synonymous mutations were due to substitution at the first base of the codon, 25% at the second base and 18.8% at the third base. Additionally, 50% of non-synonymous mutations showed a SIFTscore bellow cut off value of 0.05, therefore, they were predicted to be deleterious. Our results do not show an emergence of artemisinin resistance cases in Mozambique. However, the increased number of novel non-synonymous mutations highlights the relevance of increasing the number of studies focused on the molecular surveillance of ACTs resistance markers, for its early detection.\u003c/p\u003e","manuscriptTitle":"Antimalarial resistance in Mozambique: Absence of Plasmodium falciparum Kelch 13 (K13) propeller domain polymorphisms associated with resistance to artemisinins","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-03-28 14:01:18","doi":"10.21203/rs.3.rs-2708793/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2023-04-26T15:20:01+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-04-04T08:52:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"51ec2d6e-8ee7-4cff-838f-78c7ff530eb0","date":"2023-04-03T08:22:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-03-31T14:19:16+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-03-25T04:23:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-03-25T04:23:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Malaria Journal","date":"2023-03-18T18:03:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"malaria-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"malj","sideBox":"Learn more about [Malaria Journal](http://malariajournal.biomedcentral.com/)","snPcode":"12936","submissionUrl":"https://submission.nature.com/new-submission/12936/3","title":"Malaria Journal","twitterHandle":"@malariajournal","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3327b77b-d40d-4dd3-b25f-be3584900bdf","owner":[],"postedDate":"March 28th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T21:01:36+00:00","versionOfRecord":{"articleIdentity":"rs-2708793","link":"https://doi.org/10.1186/s12936-023-04589-0","journal":{"identity":"malaria-journal","isVorOnly":false,"title":"Malaria Journal"},"publishedOn":"2023-05-19 20:54:22","publishedOnDateReadable":"May 19th, 2023"},"versionCreatedAt":"2023-03-28 14:01:18","video":"","vorDoi":"10.1186/s12936-023-04589-0","vorDoiUrl":"https://doi.org/10.1186/s12936-023-04589-0","workflowStages":[]},"version":"v1","identity":"rs-2708793","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2708793","identity":"rs-2708793","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00