Folate stress as a Contributing Factor to Fanconi Anemia

Folate stress as a Contributing Factor to Fanconi Anemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Folate stress as a Contributing Factor to Fanconi Anemia Dongyi Xu, Yichen Bai, Xinlin365 Xu, Ruiyuan Guo, Rong Guo, Weifeng Zhou This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8498123/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 10 You are reading this latest preprint version Abstract Fanconi Anemia (FA) is a rare chromosomal instability disorder characterized by progressive bone marrow failure, congenital abnormalities, and a heightened cancer predisposition. With at least 22 identified FA genes, biallelic mutations in any one of these genes disrupt the FA pathway, a specialized DNA repair mechanism, leading to disease pathogenesis. FA cells are hypersensitive to DNA interstrand crosslinks (ICLs), which have been linked to endogenous aldehydes and oxidative stress, both contributing factors to FA pathogenesis. Our previous work identified replication stress as a significant driver of FA pathology, demonstrating that FA-deficient cells are particularly vulnerable to persistent replication stress. Here, we reveal that folate deficiency, a condition impairing DNA synthesis, repair, and methylation, constitutes a previously unrecognized contributing factor to FA. We show that folate stress causes aberrant DNA replication in FA-deficient cells, leading to chromosomal loss and proliferation delay. Mechanistically, the FA pathway is activated under folate stress and engages a break-induced replication (BIR)-like process to mitigate replication-associated damage. Importantly, feeding Fancl −/− mice a folate-deficient diet induced bone marrow failure, recapitulating a hallmark FA symptom. Our findings suggest that folate supplementation may offer a potential strategy for ameliorating FA symptoms. Biological sciences/Molecular biology/DNA damage and repair/Homologous recombination Biological sciences/Molecular biology/DNA replication/Stalled forks Fanconi Anemia Folate Deficiency DNA Repair Replication Stress Genomic Instability Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Fanconi anemia (FA) is a rare genetic disorder characterized by chromosomal instability, with an estimated incidence of 1 in 100,000 live births[ 1 ]. It is primarily considered a pediatric disease, with a median age of onset around 7 years[ 2 ]. Clinical manifestations include progressive bone marrow failure (BMF), congenital anomalies, and a markedly increased susceptibility to malignancies. BMF resulting from hematopoietic stem cell dysfunction is the leading cause of mortality in FA patients. Hematopoietic stem cell transplantation remains the only curative therapy for BMF, significantly improving patient survival[ 3 ]. Despite considerable phenotypic heterogeneity, approximately 25%–40% of FA patients present without obvious physical abnormalities[ 4 ]. In contrast, skeletal anomalies—such as thumb and forearm malformations, radial ray defects, and others—are observed in over 50% of affected children[ 5 ]. FA patients also face an elevated cancer risk, particularly for acute myeloid leukemia and head and neck squamous cell carcinoma[ 6 – 8 ]. To date, at least 22 FA genes ( FANCA–FANCW ) have been identified. Biallelic inactivation of most FA genes causes autosomal recessive FA, with exceptions including X-linked ( FANCB ) and autosomal dominant ( FANCR ) inheritance. The encoded proteins function collectively in the FA pathway, a dedicated DNA repair network. A hallmark of FA is cellular hypersensitivity to DNA interstrand crosslinks (ICLs), which covalently link the two DNA strands and impede replication and transcription[ 9 ]. This observation has led to the prevailing hypothesis that endogenous ICLs drive FA pathogenesis. Supporting this, studies from mouse and human genetic evidence have linked endogenous aldehydes, which can generate various DNA lesions, including ICLs, to the FA pathway[ 10 – 12 ]. Moreover, substantial evidence implicates oxidative stress as a critical contributor to FA pathogenesis[ 13 – 21 ]. FA cells also exhibit heightened sensitivity to inflammatory cytokines such as TNF-α and IFN-γ, suggesting a potential role for inflammation in disease progression[ 22 – 24 ]. While multiple factors are involved, our prior work established replication stress as a major driver of FA[ 25 ]. We showed that FA-deficient cells are hypersensitive to persistent replication stress induced by hydroxyurea or aphidicolin, and that FA proteins promote replication fork restart via a break-induced replication (BIR)-like pathway[ 25 ]. Furthermore, replication stress can induce BMF in FA-deficient mice[ 25 ]. Nevertheless, the sources of endogenous replication stress in FA remain poorly defined. Elucidating these origins is crucial for developing novel preventive and therapeutic strategies for FA. Folate is an essential B-vitamin that cannot be synthesized endogenously and must be acquired through the diet in human[ 26 ]. It serves as a critical cofactor in one-carbon metabolism, supporting key physiological processes such as amino acid metabolism, the de novo synthesis of purines and thymidylate, and the methylation of proteins, nucleic acids, and lipids[ 27 ]. Consequently, folate is indispensable for genomic integrity by fueling DNA synthesis, repair, and epigenetic regulation. Clinically, folate deficiency is linked to a spectrum of disorders, including megaloblastic anemia, neural tube defects, infertility, certain cancers, and neuropsychiatric conditions[ 28 – 37 ]. At the cellular level, insufficient folate causes genomic instability, manifesting as chromosomal aneuploidy (e.g., chromosome 21)[ 38 ] and replication stress-associated DNA breaks[ 39 ]. Moreover, folate deficiency remains prevalent in various populations worldwide[ 40 – 43 ]. Given its established role in inducing replication stress, we hypothesized that folate deficiency might represent a relevant endogenous stressor in the context of FA. However, a direct connection between folate metabolism and FA pathogenesis has not been established. In this study, we demonstrate that folate deficiency is a contributing factor to FA. We show that folate stress impedes proliferation and causes aberrant DNA replication in FA-deficient cells, leading to chromosomal loss. Mechanistically, we implicate FA proteins in a break-induced replication pathway in response to folate stress. Furthermore, we provide in vivo evidence that a folate-deficient diet induces bone marrow failure in Fancl −/− mice. Our findings suggest that folate supplementation could potentially ameliorate certain FA symptoms. Results Folate stress triggers the activation of the FA pathway. Upon ingestion, folate is converted to 5,10-methylenetetrahydrofolate, which provides the methyl group for the conversion of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP)[ 27 ]. Consequently, folate deficiency leads to dTMP depletion, thereby inducing replication stress. Given that the FA pathway is robustly activated by replication stress-inducing agents such as hydroxyurea and aphidicolin[ 44 ], we investigated whether folate stress similarly activates this pathway. Human colorectal cancer HCT116 or B-lymphoblastoid TK6 cells cultured in folate-deficient medium for 6 days exhibited a significant increase in FANCD2 nuclear foci, as detected by immunofluorescence (Fig. 1 A; Figure S1 A), indicating robust recruitment of FANCD2 to stalled replication forks. Since monoubiquitination of FANCD2 and FANCI serves as the central activation mark of the FA pathway[ 45 ], we assessed FANCD2 monoubiquitination levels under folate stress. Immunoblot analysis confirmed a pronounced increase in monoubiquitinated FANCD2 upon folate deprivation (Fig. 1 B; Figure S1 B). To further corroborate these findings, we utilized 5-fluoro-2'-deoxyuridine (FUdR), a thymidylate synthase inhibitor that blocks dTMP synthesis and mimics the replication stress induced by folate deficiency[ 46 ]. Treatment with FUdR resulted in a dose-dependent increase in FANCD2 foci (Fig. 1 C; Figure S1 A) and induced FANCD2 monoubiquitination (Fig. 1 D; Figure S1 C), phenocopying the effects of folate deficiency. Collectively, these data demonstrate that folate stress activates the FA pathway. Folate deficiency retards the proliferation of FA-deficient cells. As the FA pathway is essential for cellular resistance to replication stress[ 25 ], we asked whether folate deficiency similarly challenges FA-deficient cells. We monitored the proliferation of wild-type and fancc − chicken DT40 B lymphocyte cells cultured in normal (1 mg/mL) or low (0.1 mg/mL) folate medium. While low folate conditions did not affect the growth rate of wild-type cells, they significantly impaired the proliferation of fancc − cells (Fig. 2 A). These results indicate that FA-deficient cells exhibit a greater dependence on folate for maintaining normal proliferative capacity. FA-deficient cells are hypersensitive to persistent replication stress caused by FUdR. We next assessed the sensitivity of FA-deficient cells to transient versus persistent replication stress induced by FUdR. For transient stress, a 3-day MTT assay revealed no significant hypersensitivity in FA-deficient DT40 cells (Figure S2A–C). In contrast, under conditions of persistent stress, evaluated by a colony formation assay over 2–3 weeks, FA-deficient DT40 cells ( fancc − , fancl −/− , and fancd2 −/− ) exhibited marked hypersensitivity to even low concentrations of FUdR (Fig. 2 B–D). This hypersensitivity was corroborated in FA-deficient mammalian cells; both FANCA −/− human HCT116 cells and FANCC −/− human TK6 cells showed significantly reduced survival upon prolonged low-dose FUdR exposure (Fig. 2 E, F). These results establish that persistent, but not transient, replication stress triggered by FUdR is synthetically lethal with FA deficiency. FANCD2 mediates replication stress response through both monoubiquitination-dependent and -independent mechanisms. The monoubiquitination-independent function is critical for resisting transient replication stress[ 47 ], whereas our previous work demonstrated that the monoubiquitination-dependent function is essential for surviving persistent replication stress[ 25 ]. To determine which mechanism operates under folate stress, we utilized FANCD2 K563R knock-in cells, which harbor a monoubiquitination-site mutation. These mutant cells displayed hypersensitivity to persistent FUdR treatment, comparable to FANCD2 -null cells (Fig. 2 D). This finding underscores the critical role of FANCD2 monoubiquitination in cell survival under persistent folate stress. The FA proteins are required for normal replication under folate stress. To investigate whether the impaired proliferation of FA cells under folate deficiency stems from dysregulated DNA synthesis, we performed DNA fiber assays to monitor replication dynamics. Wild-type and fancc − DT40 cells were cultured under normal or low folate conditions and sequentially pulsed with CldU and IdU for 20 minutes. Under normal conditions, ongoing replication forks maintain a constant speed, yielding an IdU-to-CldU track length ratio of approximately 1. Replication stalling perturbs fork progression, causing this ratio to deviate from 1 (Fig. 3 A). We defined a ratio between 0.75 and 1.25 as representing normal, ongoing replication. Folate deficiency significantly increased the proportion of replication forks outside this normal range in fancc − cells compared to wild-type controls (Fig. 3 B, C), indicating a higher frequency of replication stalling. These results demonstrate that folate deficiency disrupts normal replication fork progression in FA-deficient cells. The FA proteins play a role in MiDAS against FUdR. Chromosomal fragile sites are genomic loci prone to gaps or breaks on metaphase chromosomes and are classified as common fragile sites (CFSs) or rare fragile sites (RFSs). CFSs are induced by agents like aphidicolin (APH) or bromodeoxyuridine (BrdU), whereas RFSs are often folate-sensitive[ 48 ]. Under-replicated DNA at both CFSs and RFSs is resolved via mitotic DNA synthesis (MiDAS)[ 49 , 50 ], a process related to the BIR pathway that repairs damaged or collapsed replication forks[ 51 ]. Defective MiDAS leads to chromosome missegregation[ 49 , 52 ]. While the molecular details differ slightly between CFS- and RFS-associated MiDAS[ 49 , 50 ], our prior work established a role for FA proteins in CFS-related MiDAS[ 25 ]. We therefore asked whether FA proteins also function in RFS-related MiDAS under folate stress. Consistent with this hypothesis, immunofluorescence analysis revealed that FANCD2 forms significantly more foci at stalled replication forks during MiDAS in cells treated with FUdR (Fig. 4 A, B). Moreover, the absence of FANCA substantially attenuated MiDAS levels under the same conditions (Fig. 4 C). These data indicate that the FA pathway also participates in RFS-related MiDAS to counteract folate stress. Folate stress induces serious genomic instability in FA-deficient cells. Given that MiDAS defects can cause genomic instability and cell death[ 25 ], we analyzed mitotic chromosome spreads to assess chromosomal integrity. Chromosomal aberrations were rare in both wild-type and FANCC -deficient human TK6 cells under folate deficiency or FUdR treatment (Figure S3A, B), indicating that gross structural abnormalities are not the primary cause of cell death. However, we observed a pronounced increase in chromosome loss under folate stress. Under normal conditions, approximately 80% of both wild-type and FANCC -null cells maintained 47 chromosomes. After six days in low folate medium, over 40% of wild-type cells retained 47 chromosomes, whereas only about 20% of FANCC -null cells did so (Fig. 5 A). A similar trend was observed with FUdR treatment (Fig. 5 B). Moreover, FA- deficient DT40 cells show similar phenotypes (Figure S4A). Since chromosome loss compromises cellular proliferation[ 53 ], we conclude that the gradual loss of chromosomes likely underlies the reduced viability of FA-deficient cells under persistent folate stress, mirroring our earlier findings with hydroxyurea-induced stress[ 25 ]. Under-replicated DNA during replication stress can impede chromosome segregation, leading to micronuclei formation and chromosome loss[ 54 ]. Accordingly, we detected a significant increase in micronuclei in FA-deficient TK6 and DT40 cells compared to wild-type cells under both folate-deficient and FUdR-treated conditions (Fig. 5 C, D; Figure S4B). These findings demonstrate that FA proteins are crucial for maintaining genome stability in the face of folate stress. Folate deficiency induces BMF in Fancl −/− mice. Our in vitro data established that FA-deficient cells are hypersensitive to sustained folate stress. We previously showed that persistent replication stress induced by hydroxyurea triggers BMF in Fancl -deficient mice[ 25 ]. This prompted us to investigate whether chronic folate stress represents an endogenous source of replication stress capable of inducing FA-like symptoms in vivo . We obtained Fancl knockout mice on a C57BL/6N background (Figure S5A, B). Crosses of heterozygous breeders yielded Fancl −/− pups at a slightly lower frequency (90/576, 15.6%) than the expected Mendelian ratio of 25% (Figure S5C), but no postnatal lethality was observed. Adult Fancl −/− mice showed no significant difference in body weight compared to wild-type littermates. To model chronic folate stress, we fed weaned wild-type and Fancl −/− mice (approximately three weeks old) a folate-deficient diet until death (Fig. 6 A). While wild-type mice exhibited a trend toward longer survival than Fancl −/− mice under folate deprivation, the difference was not statistically significant, possibly due to limited sample size (Figure S5D). However, folate deficiency led to a significant reduction in all three major blood cell lineages (erythrocytes, leukocytes, and platelets) in Fancl −/− mice compared to wild-type controls after 7 weeks (Fig. 6 B), indicating the onset of anemia and pancytopenia. Histopathological analysis of bone marrow sections revealed that folate deficiency caused a near-complete ablation of hematopoietic activity in Fancl −/− mice (Fig. 6 C). Collectively, these in vivo results demonstrate that persistent folate stress can induce bone marrow failure in the context of FA deficiency. Discussion Our study reveals a novel role for folate deficiency in the pathogenesis of Fanconi Anemia. We demonstrate that folate stress induces replication defects, chromosomal instability, and bone marrow failure in FA-deficient models, thereby establishing folate metabolism as a previously unrecognized environmental contributor to this genetic disorder. By identifying folate deficiency as an endogenous source of replication stress in FA, our work provides a fresh perspective on how nutritional status can influence DNA repair deficiency syndromes. Unlike prior studies focusing on folate in cancer or neural tube defects, our investigation specifically delineates its consequences in the FA context. We uncovered a unique hypersensitivity of FA-deficient cells to folate stress and its profound impact on chromosome integrity through both in vitro and in vivo approaches. The observation that a folate-deficient diet induces BMF in Fancl −/− mice establishes a direct pathophysiological link between dietary folate, replication stress, and a hallmark FA symptom. Notably, the phenotypes induced by folate deficiency in our model were less severe than those triggered by hydroxyurea in a previous study[ 25 ]. This suggests that while folate deficiency is a contributing factor, it may not be the predominant source of replication stress in vivo . It is plausible that multiple endogenous stressors, including ICLs from aldehydes and reactive oxygen species, cooperate or act sequentially to drive FA pathogenesis. The relative contribution of each stressor likely depends on the genetic background and environmental exposures of the individual, which could explain the considerable heterogeneity in age of onset and disease severity among FA patients sharing identical mutations. Nevertheless, our findings provide crucial insights into FA mechanisms and highlight folate supplementation as a potential supportive strategy for symptom management. In conclusion, our work underscores the importance of folate homeostasis in FA pathogenesis and suggests that maintaining adequate folate levels may benefit individuals with FA. These findings emphasize the need for further research into the complex interplay between nutrient metabolism, DNA repair fidelity, and disease manifestation in genetic instability syndromes. Addressing these questions will advance the development of targeted nutritional and therapeutic interventions that not only ameliorate symptoms but also address the underlying metabolic vulnerabilities in FA. Methods Cell culture. Generation of fancc − , fancl −/− , fancd2 −/− and fancd2 −/K563R DT40 cells was carried out according to established protocols[ 55 , 56 ]. These DT40 cells were maintained in RPMI 1640 medium (Gibco) enriched with 10% fetal bovine serum (FBS), 1% chicken serum, 10 mM HEPES, and 1% penicillin–streptomycin solution, under a 5% CO 2 atmosphere at a controlled temperature of 39.5°C. In contrast, HCT116 and TK6 cells were cultivated in RPMI 1640 medium (Gibco), supplemented with 10% FBS and 1% penicillin–streptomycin solution, and incubated at 37°C under a 5% CO 2 environment. Regular mycoplasma testing, performed bimonthly on all cell lines, consistently yielded negative results, ensuring the absence of mycoplasma contamination. Low-folate culture medium was defined as containing 10% of the standard folate concentration (100 µg/mL). Generation of fancc − + chfancc and fancl −/− +hFANCL DT40 cells. The pDEST26-chicken fancc and pDEST26-human FANCL expression vectors, employed for the construction of DT40 rescue cell lines, were subjected to linearization through Kpn I digestion. Following this, the linearized vectors were introduced into the cells via electroporation, facilitating successful integration into the DT40 genome post-transfer. Subsequently, the cells were seeded in 96-well plates and incubated for a period of 5 days, with G418 antibiotic supplementation of the culture medium to select for transformed cells. Once clones were established, they were transferred to 24-well plates for further expansion. The authenticity and integrity of the clones were verified through PCR analysis upon reaching confluence. Cell survival assay. MTT assays of DT40 cells were performed as described previously[ 57 ]. Briefly, a defined number of cells were co-cultured with FUdR at varying concentrations in 96-well plates. Following a 72-hour incubation period, MTT reagent was added to the medium and incubated for an additional 4 hours. Subsequently, the plates were treated overnight with SDS solution on a shaker to dissolve the formed formazan crystals. The absorbance of the samples was then measured at 570 nm using a microplate reader, which allowed for the quantification of cell viability. For colony formation assays with DT40 and TK6 cells, cells were mixed with methylcellulose DMEM-F12 medium containing a range of FUdR concentrations and cultured in six-well plates. After approximately 2–3 weeks of incubation, the cell survival curve was established by enumerating the colonies formed. In the case of HCT116 cells, a specific number of cells were seeded in six-well plates and incubated for 24 hours before the medium was replaced with fresh medium containing various concentrations of FUdR. The cells were then further incubated for 2–3 weeks. At the end of this period, cells were stained with methyl blue to facilitate the enumeration of monoclonal colonies. DNA fiber assay. DNA fiber assays were executed following the protocol detailed in our previous publication[ 58 ]. Cells were treated with IdU and CldU to mark DNA synthesis over a defined period and were also exposed to a culture medium deficient in folate. Post-harvest, the cells were mixed with unlabeled counterparts and affixed to a glass slide. The cells were fixed using a mixture of methanol and acetic acid in a 3:1 ratio, dehydrated with a 2.5 M HCl solution, neutralized with a Na 2 B 4 O 7 solution at pH 8.0, blocked with 5% BSA, and then incubated with a solution containing the BrdU (BU1/75) antibody (Abcam) diluted 1:200 in 1% BSA at 37°C for 1.5 hours. After three washes with PBST, the cells were incubated with a solution containing the Rat (Alexa Fluor® 488) antibody diluted 1:200 in 1% BSA at 37°C for 45 minutes, followed by another three washes with PBST. The cells were then re-blocked with 5% BSA, incubated with a solution containing the BrdU (B44) antibody (BD Biosciences) diluted 1:40 in 1% BSA at 37°C for 1.5 hours, washed for 5 minutes with PBST containing 500mM NaCl, and then washed three additional times with PBST. Subsequently, the cells were incubated with a solution containing the Mouse (Alexa Fluor® 594) antibody diluted 1:200 in 1% BSA at 37°C for 45 minutes, followed by three final washes with PBST. The cells were mounted with a coverslip and sealed. The cells were then visualized using a laser confocal fluorescence microscope, and the lengths of the DNA fibers were quantified using ImageJ software, prior to statistical analysis. Karyotype analysis. TK6 cells were subjected to treatment with FUdR or a folate-depleted culture medium. Colcemid was added to achieve a final concentration, and the cells were incubated for 3 hours prior to the experiment. Post-centrifugation, the supernatant was aspirated, and the cells were resuspended in 75 mM potassium chloride (KCl), followed by a 30-minute incubation at room temperature. A fixative solution, consisting of methanol and acetic acid in a 3:1 ratio, was then added and thoroughly mixed. The cells were dropped onto slides pre-treated with 50% ethanol and left to air dry for 1–2 days. The slides were subsequently immersed in a 3% giemsa staining solution for 10 minutes, followed by drying and sealing with a mounting medium. Images were acquired using a Leica microscope, and the chromosome aberration and counts per cell was determined from these images. Immunofluorescence and MiDAS. The steps for immunofluorescence are as follows. Cells were plated onto 12-well cell culture plates with cover slips and treated with FUdR or a folate-deficient medium. They were fixed with 3% paraformaldehyde at room temperature, followed by treatment with a solution containing 0.5% Triton X-100 on ice. After washing with PBST, the cells were blocked with a 5% BSA solution; the primary antibody is prepared in 1% BSA. The primary antibody was incubated at room temperature for 1.5–2 hours; after washing with PBST, the secondary antibody was incubated at room temperature in the dark for 30 minutes. Following three washes with PBST, the cell nuclei were stained with DAPI for 5 minutes, and after washing with PBST, the slides were mounted. Observation of MiDAS required synchronized cells and was conducted through EdU click-reaction and immunofluorescence of FANCD2. Cells were plated onto 12-well cell culture plates with cover slips and treated with FUdR. Concurrently, cells were synchronized at the G2 phase with RO3306 (CDK1 inhibitor). After 16 hours, the cells were treated with 20 mM EdU for 30 minutes. In addition to the steps identical to immunofluorescence, the cells were reacted with Buffer containing 50 µM Azide H488 at room temperature in the dark for 30 minutes. Subsequently, FANCD2 was labeled using immunofluorescence. The FANCD2 antibody was homemade, and the secondary antibody used was a rabbit 594 antibody. Finally, DAPI staining was applied to observe the cell nuclei. Mice. The Fancl knockout mouse is a strain that was previously maintained in our laboratory[ 25 ]. The mice were housed in the SPF-grade rodent facility at Peking University's Experimental Animal Center, where the temperature was regulated between 22–24°C, and the humidity is maintained at 40%-60%, with a 12-hour light/12-hour dark cycle. Mice were genotyped by PCR using the following primers: F1: GAGTTCCTTCAGCACCATCA R1: GGTAACATCATAGTGTCTGGAG F2: CCAACTGACCTTGGGCAAGAACAT R2: AGGCTTCTTTGGCAGTAGCT All animal experiments undertaken in this study were performed using protocols that were approved by the respective animal care and use committees at Peking University in accordance with the National Institutes of Health Guide for Care and Use of Laboratory Animals. Peripheral blood counts. Peripheral blood was collected from mice at 4 weeks of age until death. Whole blood (20 µL) was collected in EDTA Microvette tubes and analyzed on a Mindray BC-5000 analyzer. Histology. Femurs were obtained immediately after spontaneous death in the folate-deficient group or upon sacrifice at 18 weeks of age in the control group. All harvested samples were fixed in 4% PFA overnight, dehydrated in 70% ethanol, and embedded in paraffin. Sections of 4 µm thickness were cut and subjected to hematoxylin and eosin (H&E) staining. Statistics and reproducibility. Statistical analyses were performed using t-test, one-way or two-way ANOVA by Prism. The data were normally distributed, and the variance between groups being statistically compared was similar. Author contribution X.X. performed the cell proliferation experiment, most of immunofluorescence experiments, a portion of the MiDAS assays and the mouse experiments. B.Y. performed the drug-sensitivity assays, chromosome spread, WB, a portion of the MiDAS assays. Ruiyuan Guo performed the DNA combing assays. Rong Guo, WZ and D.X. designed experiments and interpreted the results. X.X., B.Y. and D.X. wrote the proper. Acknowledgements We thank the Imaging Core at the National Center for Protein Sciences at Peking University. This work was supported by the National Key Research and Development Program of China (2021YFA0909304 to D.X. and 2021YFF0700304 to G.R.), the National Natural Science Foundation of China (32371353 to D.X. and 32401075 to X.X.) and Hubei Provincial Natural Science Foundation of China (Grant No. 2024AFB473 to X.X.). Declarations Acknowledgements We thank the Imaging Core at the National Center for Protein Sciences at Peking University. This work was supported by the National Key Research and Development Program of China (2021YFA0909304 to D.X. and 2021YFF0700304 to G.R.), the National Natural Science Foundation of China (32371353 to D.X. and 32401075 to X.X.) and Hubei Provincial Natural Science Foundation of China (Grant No. 2024AFB473 to X.X.). Author contribution X.X. performed the cell proliferation experiment, most of immunofluorescence experiments, a portion of the MiDAS assays and the mouse experiments. B.Y. performed the drug-sensitivity assays, chromosome spread, WB, a portion of the MiDAS assays. Ruiyuan Guo performed the DNA combing assays. Rong Guo, WZ and D.X. designed experiments and interpreted the results. X.X., B.Y. and D.X. wrote the proper. Conflict of interest statement The authors declare no competing interests. References Dokal, I. & Vulliamy, T. Inherited bone marrow failure syndromes. Haematologica 95, 1236–40 (2010). Rosenberg, P.S., Tamary, H. & Alter, B.P. How high are carrier frequencies of rare recessive syndromes? Contemporary estimates for Fanconi Anemia in the United States and Israel. Am J Med Genet A 155a, 1877–83 (2011). Gluckman, E. et al. Bone marrow transplantation for Fanconi anemia. Blood 86, 2856–62 (1995). D'Andrea, A.D. Susceptibility pathways in Fanconi's anemia and breast cancer. N Engl J Med 362, 1909–19 (2010). Green, A.M. & Kupfer, G.M. Fanconi anemia. Hematol Oncol Clin North Am 23, 193–214 (2009). Kutler, D.I. et al. High incidence of head and neck squamous cell carcinoma in patients with Fanconi anemia. Arch Otolaryngol Head Neck Surg 129, 106–12 (2003). Kutler, D.I. et al. Natural history and management of Fanconi anemia patients with head and neck cancer: A 10-year follow-up. Laryngoscope 126, 870–9 (2016). Kutler, D.I. et al. A 20-year perspective on the International Fanconi Anemia Registry (IFAR). Blood 101, 1249–56 (2003). Ceccaldi, R., Sarangi, P. & D'Andrea, A.D. The Fanconi anaemia pathway: new players and new functions. Nat Rev Mol Cell Biol 17, 337–49 (2016). Langevin, F., Crossan, G.P., Rosado, I.V., Arends, M.J. & Patel, K.J. Fancd2 counteracts the toxic effects of naturally produced aldehydes in mice. Nature 475, 53–8 (2011). Hira, A. et al. Variant ALDH2 is associated with accelerated progression of bone marrow failure in Japanese Fanconi anemia patients. Blood 122, 3206–3209 (2013). Voulgaridou, G.P., Anestopoulos, I., Franco, R., Panayiotidis, M.I. & Pappa, A. DNA damage induced by endogenous aldehydes: current state of knowledge. Mutat. Res. 711, 13–27 (2011). Bogliolo, M. et al. The Fanconi anaemia genome stability and tumour suppressor network. Mutagenesis 17, 529 – 38 (2002). Cohen-Haguenauer, O. et al. In vivo repopulation ability of genetically corrected bone marrow cells from Fanconi anemia patients. Proceedings of the National Academy of Sciences of the United States of America 103, 2340–5 (2006). Cumming, R.C., Liu, J.M., Youssoufian, H. & Buchwald, M. Suppression of apoptosis in hematopoietic factor-dependent progenitor cell lines by expression of the FAC gene. Blood 88, 4558–67 (1996). Futaki, M. et al. The FANCG Fanconi anemia protein interacts with CYP2E1: possible role in protection against oxidative DNA damage. Carcinogenesis 23, 67–72 (2002). Hadjur, S. et al. Defective hematopoiesis and hepatic steatosis in mice with combined deficiencies of the genes encoding Fancc and Cu/Zn superoxide dismutase. Blood 98, 1003–11 (2001). Kruyt, F.A. et al. Abnormal microsomal detoxification implicated in Fanconi anemia group C by interaction of the FAC protein with NADPH cytochrome P450 reductase. Blood 92, 3050–6 (1998). Pagano, G. et al. Oxidative stress as a multiple effector in Fanconi anaemia clinical phenotype. European journal of haematology 75, 93–100 (2005). Park, S.J. et al. Oxidative stress/damage induces multimerization and interaction of Fanconi anemia proteins. The Journal of biological chemistry 279, 30053–9 (2004). Saadatzadeh, M.R., Bijangi-Vishehsaraei, K., Hong, P., Bergmann, H. & Haneline, L.S. Oxidant hypersensitivity of Fanconi anemia type C-deficient cells is dependent on a redox-regulated apoptotic pathway. The Journal of biological chemistry 279, 16805–12 (2004). Haneline, L.S. et al. Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice. Blood 91, 4092–8 (1998). Rathbun, R.K. et al. Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells. Blood 90, 974 – 85 (1997). Wang, J. et al. Overexpression of the fanconi anemia group C gene (FAC) protects hematopoietic progenitors from death induced by Fas-mediated apoptosis. Cancer research 58, 3538–41 (1998). Xu, X. et al. Fanconi anemia proteins participate in a break-induced-replication-like pathway to counter replication stress. Nat Struct Mol Biol 28, 487–500 (2021). Tamura, T. & Picciano, M.F. Folate and human reproduction. Am. J. Clin. Nutr. 83, 993–1016 (2006). Jacques, P.F. et al. Determinants of plasma total homocysteine concentration in the Framingham Offspring cohort. Am. J. Clin. Nutr. 73, 613–21 (2001). Altmäe, S. et al. Variations in folate pathway genes are associated with unexplained female infertility. Fertil Steril 94, 130–7 (2010). Araújo, J.R., Martel, F., Borges, N., Araújo, J.M. & Keating, E. Folates and aging: Role in mild cognitive impairment, dementia and depression. Ageing Res Rev 22, 9–19 (2015). Ebisch, I.M., Thomas, C.M., Peters, W.H., Braat, D.D. & Steegers-Theunissen, R.P. The importance of folate, zinc and antioxidants in the pathogenesis and prevention of subfertility. Human reproduction update 13, 163 – 74 (2007). García-Closas, R., Castellsagué, X., Bosch, X. & González, C.A. The role of diet and nutrition in cervical carcinogenesis: a review of recent evidence. Int J Cancer 117, 629–37 (2005). Gilbody, S., Lewis, S. & Lightfoot, T. Methylenetetrahydrofolate reductase (MTHFR) genetic polymorphisms and psychiatric disorders: a HuGE review. Am J Epidemiol 165, 1–13 (2007). Mayne, S.T. et al. Nutrient intake and risk of subtypes of esophageal and gastric cancer. Cancer Epidemiol Biomarkers Prev 10, 1055–62 (2001). Morris, M.S., Jacques, P.F., Rosenberg, I.H. & Selhub, J. Folate and vitamin B-12 status in relation to anemia, macrocytosis, and cognitive impairment in older Americans in the age of folic acid fortification. Am J Clin Nutr 85, 193–200 (2007). Rohan, T.E., Jain, M.G., Howe, G.R. & Miller, A.B. Dietary folate consumption and breast cancer risk. J Natl Cancer Inst 92, 266–9 (2000). Wilson, R.D. et al. Pre-conception Folic Acid and Multivitamin Supplementation for the Primary and Secondary Prevention of Neural Tube Defects and Other Folic Acid-Sensitive Congenital Anomalies. J Obstet Gynaecol Can 37, 534–52 (2015). Zhang, S. et al. A prospective study of folate intake and the risk of breast cancer. Jama 281, 1632–7 (1999). Beetstra, S., Thomas, P., Salisbury, C., Turner, J. & Fenech, M. Folic acid deficiency increases chromosomal instability, chromosome 21 aneuploidy and sensitivity to radiation-induced micronuclei. Mutat Res 578, 317–26 (2005). Lamm, N. et al. Folate levels modulate oncogene-induced replication stress and tumorigenicity. EMBO Mol Med 7, 1138–52 (2015). Senti, F.R. & Pilch, S.M. Analysis of folate data from the second National Health and Nutrition Examination Survey (NHANES II). J Nutr 115, 1398–402 (1985). Bailey, L.B. et al. Folacin and iron status and hematological findings in black and Spanish-American adolescents from urban low-income households. Am J Clin Nutr 35, 1023–32 (1982). Mensink, G.B. et al. Mapping low intake of micronutrients across Europe. Br J Nutr 110, 755 – 73 (2013). Roman Viñas, B. et al. Projected prevalence of inadequate nutrient intakes in Europe. Ann Nutr Metab 59, 84–95 (2011). Howlett, N.G., Taniguchi, T., Durkin, S.G., D'Andrea, A.D. & Glover, T.W. The Fanconi anemia pathway is required for the DNA replication stress response and for the regulation of common fragile site stability. Hum Mol Genet 14, 693–701 (2005). Rickman, K.A. et al. Deficiency of UBE2T, the E2 Ubiquitin Ligase Necessary for FANCD2 and FANCI Ubiquitination, Causes FA-T Subtype of Fanconi Anemia. Cell reports 12, 35–41 (2015). Sen, A. & Karati, D. An insight into thymidylate synthase inhibitor as anticancer agents: an explicative review. Naunyn-Schmiedeberg's archives of pharmacology 397, 5437–5448 (2024). Tian, Y. et al. Constitutive role of the Fanconi anemia D2 gene in the replication stress response. J. Biol. Chem. 292, 20184–20195 (2017). Arlt, M.F., Durkin, S.G., Ragland, R.L. & Glover, T.W. Common fragile sites as targets for chromosome rearrangements. DNA repair 5, 1126–35 (2006). Minocherhomji, S. et al. Replication stress activates DNA repair synthesis in mitosis. Nature 528, 286 – 90 (2015). Garribba, L. et al. Folate stress induces SLX1- and RAD51-dependent mitotic DNA synthesis at the fragile X locus in human cells. Proceedings of the National Academy of Sciences of the United States of America 117, 16527–16536 (2020). Costantino, L. et al. Break-induced replication repair of damaged forks induces genomic duplications in human cells. Science (New York, N.Y.) 343, 88–91 (2014). Bjerregaard, V.A., Garribba, L., McMurray, C.T., Hickson, I.D. & Liu, Y. Folate deficiency drives mitotic missegregation of the human FRAXA locus. Proc. Natl. Acad. Sci. U. S. A. 115, 13003–13008 (2018). Hirota, K. et al. SUMO-targeted ubiquitin ligase RNF4 plays a critical role in preventing chromosome loss. Genes to cells: devoted to molecular & cellular mechanisms 19, 743 – 54 (2014). Chan, K.L., Palmai-Pallag, T., Ying, S. & Hickson, I.D. Replication stress induces sister-chromatid bridging at fragile site loci in mitosis. Nat Cell Biol 11, 753–60 (2009). Hirota, K. et al. The POLD3 subunit of DNA polymerase delta can promote translesion synthesis independently of DNA polymerase zeta. Nucleic Acids Res 43, 1671–83 (2015). Seki, S. et al. A requirement of FancL and FancD2 monoubiquitination in DNA repair. Genes Cells 12, 299–310 (2007). Gao, S. et al. An OB-fold complex controls the repair pathways for DNA double-strand breaks. Nat Commun 9, 3925 (2018). Xu, Y. et al. 53BP1 and BRCA1 control pathway choice for stalled replication restart. Elife 6, (2017). Additional Declarations (Not answered) Supplementary Files WesternblotV3.pptx Original Raw Data_Western blots Fig.S1TK6FANCD2V5.1.tif Figure s1 Fig.S2sensitivityV5.1.tif Figure s2 Fig.S3ChrbreakenV5.tif Figure s3 Fig.S4DT40MNXchrV5.1.tif Figure s4 Fig.S5MiceV5.1.tif Figure s5 Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: revise 01 Apr, 2026 Review # 3 received at journal 31 Mar, 2026 Reviewer # 3 agreed at journal 17 Mar, 2026 Review # 1 received at journal 28 Jan, 2026 Reviewer # 2 agreed at journal 20 Jan, 2026 Reviewer # 1 agreed at journal 20 Jan, 2026 Reviewers invited by journal 20 Jan, 2026 Submission checks completed at journal 07 Jan, 2026 First submitted to journal 02 Jan, 2026 Editor assigned by journal 02 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8498123","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":577594427,"identity":"13ea02a4-c334-42e9-b890-2fb3e02909f1","order_by":0,"name":"Dongyi Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYBACgwMMBiCah5+BDUQzk6BFsoFYLZINEC1AvcRq4ZdI3vi44NdhGePbbWkSDBXWiQ3sZw/g1cImkVZsPLPvMI/ZnWPHJBjOpCc28OQlENCSYybN2wPUciO9TYKx7XBigwSPAQGHQbUYzwBp+UeEFskZQC08Pw7zGEikHZNgbCBCi8GZZ8XGvA3pPBJ3jiVbJBxLN27jySGg5TgwxHj+WNvzz24zvPGhxlq2n/0Mfi1gwNjWzMAgAWQkADEbYfUg8KcOomUUjIJRMApGATYAABHgQkzYRV4MAAAAAElFTkSuQmCC","orcid":"","institution":"Peking University","correspondingAuthor":true,"prefix":"","firstName":"Dongyi","middleName":"","lastName":"Xu","suffix":""},{"id":577594428,"identity":"ce91dee4-f879-4e22-89de-9b597cb3b13f","order_by":1,"name":"Yichen Bai","email":"","orcid":"","institution":"Peking university","correspondingAuthor":false,"prefix":"","firstName":"Yichen","middleName":"","lastName":"Bai","suffix":""},{"id":577594429,"identity":"0bffb66c-1a1b-4ef7-be98-a7733c3805f9","order_by":2,"name":"Xinlin365 Xu","email":"","orcid":"https://orcid.org/0009-0004-7874-359X","institution":"Hubei Unversity","correspondingAuthor":false,"prefix":"","firstName":"Xinlin365","middleName":"","lastName":"Xu","suffix":""},{"id":577594430,"identity":"5e6e5079-03b4-47e1-95c8-f2c4703b006d","order_by":3,"name":"Ruiyuan Guo","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Ruiyuan","middleName":"","lastName":"Guo","suffix":""},{"id":577594431,"identity":"a1f96781-7790-4e49-98eb-a9389f584144","order_by":4,"name":"Rong Guo","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Rong","middleName":"","lastName":"Guo","suffix":""},{"id":577594432,"identity":"156bfcf2-fc5a-4c56-b441-8010d7878c74","order_by":5,"name":"Weifeng Zhou","email":"","orcid":"","institution":"Wenzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weifeng","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2026-01-02 05:05:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8498123/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8498123/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100874490,"identity":"5d531cee-e9f3-46c8-8284-3ec97564923a","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16450040,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1D2UbV5.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/72efe4a4e8979081e4a2a51a.tif"},{"id":100950033,"identity":"b723fa94-0fbb-495d-8987-c86376504d6b","added_by":"auto","created_at":"2026-01-23 07:06:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":134145,"visible":true,"origin":"","legend":"","description":"","filename":"Folatemanuscriptv6.2.docx","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/d4b92d48f6bc02e0bd1b70cf.docx"},{"id":100950077,"identity":"96f2985d-3836-4c80-8154-35f7d1b5ade7","added_by":"auto","created_at":"2026-01-23 07:06:49","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6023422,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2sensitivityV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/ea5dbcc29debb94ec4f1ea1f.tif"},{"id":100949943,"identity":"cb3959c3-4078-48af-8582-5aeba6b15363","added_by":"auto","created_at":"2026-01-23 07:06:25","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5997136,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3fiberV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/07da6ce2586f4e2fa019f021.tif"},{"id":100949717,"identity":"50586c48-a09d-435e-ae78-61e9f711a12d","added_by":"auto","created_at":"2026-01-23 07:05:09","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20198410,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4MiDASV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/90e15b325e3bdd27e8de3396.tif"},{"id":100950036,"identity":"1058b8cc-a170-4a86-a187-206138047799","added_by":"auto","created_at":"2026-01-23 07:06:44","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12725042,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5MNXchrV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/e12721e86fe809564bcc6a82.tif"},{"id":100874504,"identity":"0508169c-9bdb-469f-a7a8-e695b32f32d3","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17698504,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6MiceV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/7d3975b5295925de47f2a117.tif"},{"id":100874495,"identity":"337c3fff-e0f9-40d5-bac5-b0c91e9cd361","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11014400,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S1TK6FANCD2V5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/0695879debb42dbfafcee827.tif"},{"id":100874512,"identity":"09da9638-8546-4298-9a24-86a11ee6f013","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5830094,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S2sensitivityV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/bde3ef323002b7c9f6c067f0.tif"},{"id":100874517,"identity":"22cd3ab6-567b-4f52-a02a-a48153d79d84","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5760774,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S3ChrbreakenV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/4bea0b386caa02789259a5fc.tif"},{"id":100950013,"identity":"e699f81f-3cb1-482a-84a3-205123cd9495","added_by":"auto","created_at":"2026-01-23 07:06:41","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10650626,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S4DT40MNXchrV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/8fe1cd99692ba01dac866f86.tif"},{"id":100949942,"identity":"fcd96619-9b07-4a09-be91-bf4e4d7f7370","added_by":"auto","created_at":"2026-01-23 07:06:25","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6192882,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S5MiceV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/103f566cecb2d465b511140d.tif"},{"id":100950399,"identity":"021f7073-3d8c-42a9-a94e-3de649cced66","added_by":"auto","created_at":"2026-01-23 07:07:56","extension":"json","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7266,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS258469.json","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/21be9c8543e9a30c48e74994.json"},{"id":100949974,"identity":"49412305-22e3-4924-bc93-6efb3de34eb9","added_by":"auto","created_at":"2026-01-23 07:06:34","extension":"pptx","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16320864,"visible":true,"origin":"","legend":"","description":"","filename":"WesternblotV3.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/51986d3ad503e6f897660146.pptx"},{"id":100874519,"identity":"91de513a-e051-4eed-b449-a53d806f7b41","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122767,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2584690enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/abe3ea49ee85c2aa8c4bd65a.xml"},{"id":100874507,"identity":"72654754-a2c7-4684-8b08-35678dd0dd81","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16450040,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1D2UbV5.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/cfaf7cd34d73e4a3c43be774.tif"},{"id":100874493,"identity":"d92833bd-6466-42ce-970e-179e72a7dade","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6023422,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2sensitivityV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/c6e60cf65190b6aec64946dc.tif"},{"id":100874513,"identity":"c54a251d-cdc5-4f7e-a615-373bc3936f3a","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5997136,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3fiberV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/754244a3fe836ebbeeca6842.tif"},{"id":100950083,"identity":"f4c49f24-654d-4c9a-9e6d-c3e4f1a74547","added_by":"auto","created_at":"2026-01-23 07:06:50","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20198410,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4MiDASV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/6e70c999f1bce2548c8803b3.tif"},{"id":100950011,"identity":"b7687536-c4aa-4502-8a7b-8792092af134","added_by":"auto","created_at":"2026-01-23 07:06:41","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12725042,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5MNXchrV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/db01011c17b28950f5318a7c.tif"},{"id":100950351,"identity":"39fc8b01-3e25-4d63-bf61-6e951369acaa","added_by":"auto","created_at":"2026-01-23 07:07:48","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17698504,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6MiceV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/3073fb30bffd4930ad15fbcd.tif"},{"id":100874499,"identity":"55b95c1d-aa8c-43bb-abec-db87d5d8838c","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11014400,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S1TK6FANCD2V5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/49da3fb8f01919e2888136e4.tif"},{"id":100874520,"identity":"5cc65de5-04b0-4121-bb9c-1deb722dbbf0","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"tif","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5830094,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S2sensitivityV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/6860cc6bb9919d74e389ae80.tif"},{"id":100874498,"identity":"b747c087-c53b-4cf2-bbf2-01dda197b15c","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5760774,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S3ChrbreakenV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/d973457f1b25b7381a5a0ff2.tif"},{"id":100874496,"identity":"78ecc55f-effe-482e-a55e-cfc05f6f1f75","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10650626,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S4DT40MNXchrV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/46523a7906fe00ae5e9a3328.tif"},{"id":100874509,"identity":"5174740f-6e21-4ba3-8c96-270db68ef2b7","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"tif","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6192882,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.S5MiceV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/7495394941ea18aabda3b747.tif"},{"id":100874491,"identity":"a6196368-8709-4d80-8e3f-00a79b35fcb7","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":911424,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.1D2UbV5.2.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/eea21552c8237a26e1ad0782.png"},{"id":100950287,"identity":"ec336095-c8da-4716-b0fe-79cce7c1461b","added_by":"auto","created_at":"2026-01-23 07:07:32","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":490187,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.2sensitivityV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/2e72b68fd0f4820ecc196786.png"},{"id":100874500,"identity":"c72ff750-23cd-40d6-ab97-ca3763076e33","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":552556,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.3fiberV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/6968f5445693b8a9a9f10723.png"},{"id":100949762,"identity":"ca68d0e1-88c2-43f8-b300-c7a516088e77","added_by":"auto","created_at":"2026-01-23 07:05:27","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":936386,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.4MiDASV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/dddd1d63f89fbfbc5a84d0e7.png"},{"id":100950214,"identity":"58fa9d48-e89b-4799-bebd-168348648927","added_by":"auto","created_at":"2026-01-23 07:07:16","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":969859,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.5MNXchrV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/05e463e24196c3fee84fa415.png"},{"id":100874511,"identity":"9e4f98c2-dbda-4aa7-8259-a0dc82ff4feb","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1685343,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.6MiceV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/39c99fd7dbb548b4a6045f09.png"},{"id":100874505,"identity":"8c0aa937-b75b-4dc5-909d-afb72a9d8906","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":743749,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.S1TK6FANCD2V5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/d640525dee880ea464b454e3.png"},{"id":101202551,"identity":"b941391a-f4f0-4b28-b77d-0355e0645e79","added_by":"auto","created_at":"2026-01-27 09:36:12","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":444233,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.S2sensitivityV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/bd4855c9f0a4f3d0517c91e3.png"},{"id":100874518,"identity":"3829e755-54e2-4d8e-8599-d430775fa657","added_by":"auto","created_at":"2026-01-22 10:06:25","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":414343,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.S3ChrbreakenV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/c133b0cd9773d6e3ca2dc0b0.png"},{"id":100874503,"identity":"f9ae1f7b-e274-4bfe-8327-fed5a8dfeb93","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":913824,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.S4DT40MNXchrV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/fa7a6aa94417c94b9fc1f7b9.png"},{"id":100949728,"identity":"8f66b571-2a0f-4d9a-80c2-552414ca5dfb","added_by":"auto","created_at":"2026-01-23 07:05:14","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":593122,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig.S5MiceV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/7f58a3ae314da9c213002f6b.png"},{"id":100874508,"identity":"69f359e6-2f27-439f-9c65-db2be88f1ac0","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"xml","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120728,"visible":true,"origin":"","legend":"","description":"","filename":"CDDIS2584690structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/378c5640633e44ee14205bec.xml"},{"id":100874501,"identity":"6ad454a6-42fb-4049-94cb-a5722e5ffd79","added_by":"auto","created_at":"2026-01-22 10:06:24","extension":"html","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":137646,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/a24a4eec5aa00ad87f7ac7a4.html"},{"id":100874486,"identity":"aa12b7f6-2cd6-495e-9ad6-772704088952","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6099746,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFolate stress triggers the activation of the FA pathway.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA, C\u003c/strong\u003e) Immunofluorescence (left panels) and quantification (right panels) of FANCD2 (green) foci in nuclei (blue) induced by folate-deficient medium (\u003cstrong\u003eA\u003c/strong\u003e) and FUdR (\u003cstrong\u003eC\u003c/strong\u003e) in HCT116 cells, scale bar, 5 μm. All experiments were repeated three times; the mean and s.d. are shown. The data were analysed by one-way ANOVA using Tukey's multiple comparisons test; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ****,\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.0001. (\u003cstrong\u003eB, D\u003c/strong\u003e) Immunoblot showing FANCD2 protein monoubiquitination status induced by no folate medium (\u003cstrong\u003eB\u003c/strong\u003e) and FUdR (\u003cstrong\u003eD\u003c/strong\u003e) in HCT116 cells. Cells were treated with or without folate for 6 days or 50 μg/mL FUdR for 16 hours. FANCD2 and UB-FANCD2 denote the non-ubiquitinated and monoubiquitinated forms of the protein, respectively.\u003c/p\u003e","description":"","filename":"Fig.1D2UbV5.2.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/9fdd235d749304ea4e0a7c7f.png"},{"id":100949982,"identity":"bb74c423-b743-4fae-8793-11b55dd97353","added_by":"auto","created_at":"2026-01-23 07:06:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1388521,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe FA pathway is required for cellular resistance to replication stress by folate deficiency and FUdR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Growth curves for DT40 wild-type and \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e-\u003c/sup\u003e cells using both low folate medium (Low folate) and standard medium (Unt). The data were analysed by one-way ANOVA using Tukey's\u0026nbsp;multiple\u0026nbsp;comparisons\u0026nbsp;test; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; \u003cem\u003en.s.\u003c/em\u003e, not significant. (\u003cstrong\u003eB-F\u003c/strong\u003e) FUdR sensitivity of the \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u003cem\u003e-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eand chicken \u003cem\u003efancc\u003c/em\u003e (\u003cem\u003echfancc\u003c/em\u003e) complemented \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u003cem\u003e-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eDT40 cells (\u003cstrong\u003eB\u003c/strong\u003e), \u003cem\u003efancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e and human \u003cem\u003efancl\u003c/em\u003e (\u003cem\u003ehfanccl\u003c/em\u003e) complemented \u003cem\u003efancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eDT40 cells (\u003cstrong\u003eC\u003c/strong\u003e), \u003cem\u003efancd2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eand\u003cem\u003e fancd2\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/K563R \u003c/em\u003e\u003c/sup\u003eDT40 cells (\u003cstrong\u003eD\u003c/strong\u003e), \u003cem\u003eFANCA\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/- \u003c/em\u003e\u003c/sup\u003eHCT116 cells (\u003cstrong\u003eE\u003c/strong\u003e) and \u003cem\u003eFANCC\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/- \u003c/em\u003e\u003c/sup\u003eTK6 cells (\u003cstrong\u003eF\u003c/strong\u003e) assessed by colony formation assay. The mean and s.d. from 3 independent experiments are shown.\u003c/p\u003e","description":"","filename":"Fig.2sensitivityV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/5ddc4e805d449e767ca8785c.png"},{"id":100874478,"identity":"66955532-4331-47a6-bd6a-d967c16462fa","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1251610,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe FA proteins are required for normal replication under folate stress.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) The schematic diagram shows normal and stalled forks in DNA fiber assay. (\u003cstrong\u003eB, C\u003c/strong\u003e) Culture DT40 wild-type and \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e-\u003c/sup\u003e cells in low folate medium and standard medium for 6 days and statistically evaluate the asymmetry of their replication. The mean and s.d. are shown. The data were analysed by one-way ANOVA using Tukey's\u0026nbsp;multiple\u0026nbsp;comparisons\u0026nbsp;test; ****,\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.0001; \u003cem\u003en.s.\u003c/em\u003e, not significant.\u003c/p\u003e","description":"","filename":"Fig.3fiberV5.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/a493f20344871dc11df9d538.png"},{"id":100874482,"identity":"85b1661a-538f-43fc-9e54-c992a96caf7d","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6958359,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe FA proteins are required for MiDAS induced by FUdR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Workflow of MiDAS imaging. (\u003cstrong\u003eB\u003c/strong\u003e) Immunofluorescence (left panels) and quantification (right panels) of FANCD2 foci (red) at MiDAS sites (EdU foci, green). DAPI (blue) was used as a nuclear counterstain. (\u003cstrong\u003eC\u003c/strong\u003e) Images (left panels) and quantification (right panels) of MiDAS (EdU, green) and DAPI-stained nuclei (blue) in HCT116 WT and \u003cem\u003eFANCA\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/- \u003c/em\u003e\u003c/sup\u003ecells cultured with 0.25 μg/mL FUdR; scale bar, 5 μm. The mean and s.d. are shown. The data were analysed by one-way ANOVA using Tukey's\u0026nbsp;multiple\u0026nbsp;comparisons\u0026nbsp;test; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ***,\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.4MiDASV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/a952e483741e2c7b3fd0d431.png"},{"id":100874480,"identity":"0e4ab647-3072-4023-ad5e-399c90e4058d","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4009049,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFolate stress induces serious genomic instability in FA-deficient cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e, \u003cstrong\u003eB\u003c/strong\u003e) Chromosome number quantification of wild-type and \u003cem\u003eFANCC\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003eTK6 cells over time. Cells were cultured with low folate medium (\u003cstrong\u003eA\u003c/strong\u003e) or medium containing 0.05 μg/mL FUdR (\u003cstrong\u003eB\u003c/strong\u003e) for 6 days. (\u003cstrong\u003eC\u003c/strong\u003e, \u003cstrong\u003eD\u003c/strong\u003e) Micronuclei (left panels) and their quantification (right panels) in wild-type and \u003cem\u003eFANCC\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e TK6 cells, scale bar, 10 μm. Cells were treated with low folate medium for 6 days (\u003cstrong\u003eC\u003c/strong\u003e) or FUdR (10 μg/mL) for 24 h (\u003cstrong\u003eD\u003c/strong\u003e), scale bar, 5 μm. All experiments were repeated three times. The mean and s.d. are shown. The data were analysed by one-way ANOVA using Tukey's\u0026nbsp;multiple\u0026nbsp;comparisons\u0026nbsp;test; *, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ****,\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.0001; \u003cem\u003en.s.\u003c/em\u003e, not significant.\u003c/p\u003e","description":"","filename":"Fig.5MNXchrV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/dd31d9d63adcbf3e89b2277f.png"},{"id":100950292,"identity":"b0ffbb89-3cbe-4f52-86ac-15db821c2f0e","added_by":"auto","created_at":"2026-01-23 07:07:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":10445050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFolate deficiency induces bone marrow failure in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eFancl\u003c/strong\u003e\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u003cstrong\u003e-/-\u003c/strong\u003e\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003emice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Schematic outline of the folate deprivation experiment. (\u003cstrong\u003eB\u003c/strong\u003e) Blood count analysis of \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003emice with or without folate deprivation. WBC, white blood cells; RBC, red blood cells; PLT, platelets. (\u003cstrong\u003eC\u003c/strong\u003e) Hematoxylin and eosin (H\u0026amp;E) staining (left panels) and quantification (right panels) of bone marrow sections from mice with or without folate deprivation. The mean and s.d. are shown. The data were analysed by one-way ANOVA using Tukey's\u0026nbsp;multiple\u0026nbsp;comparisons\u0026nbsp;test; n = 3 mice. Scale bar, 200 μm. *, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05; **, \u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01; ***,\u003cem\u003e P \u003c/em\u003e\u0026lt; 0.001; \u003cem\u003en.s.\u003c/em\u003e, not significant.\u003c/p\u003e","description":"","filename":"Fig.6MiceV5.png","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/599be3a9c0438cf645fa67b2.png"},{"id":100949806,"identity":"abb92773-affd-4cfe-9e3a-5583c61be6bf","added_by":"auto","created_at":"2026-01-23 07:05:49","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":16320864,"visible":true,"origin":"","legend":"Original Raw Data_Western blots","description":"","filename":"WesternblotV3.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/e825ec6beeaf95c6b8f7f380.pptx"},{"id":100950403,"identity":"0b5b1fc7-fba3-4a2e-a1e8-c550f80d4013","added_by":"auto","created_at":"2026-01-23 07:07:57","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":11014400,"visible":true,"origin":"","legend":"Figure s1","description":"","filename":"Fig.S1TK6FANCD2V5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/71b577516803b60a7432b0a7.tif"},{"id":100949908,"identity":"90d81700-7949-4a9f-b640-41e0e70a6aa1","added_by":"auto","created_at":"2026-01-23 07:06:19","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":5830094,"visible":true,"origin":"","legend":"\u003cp\u003eFigure s2\u003c/p\u003e","description":"","filename":"Fig.S2sensitivityV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/3c41a278f5f376f913219a77.tif"},{"id":100874485,"identity":"7b6dadca-61fe-485a-8272-26ae094f5631","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":5760774,"visible":true,"origin":"","legend":"\u003cp\u003eFigure s3\u003c/p\u003e","description":"","filename":"Fig.S3ChrbreakenV5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/76ffe0b7f0dcce0cf23b1521.tif"},{"id":100874487,"identity":"688c6139-38c5-469a-b586-c083e3e58dcc","added_by":"auto","created_at":"2026-01-22 10:06:23","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":10650626,"visible":true,"origin":"","legend":"\u003cp\u003eFigure s4\u003c/p\u003e","description":"","filename":"Fig.S4DT40MNXchrV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/800059b59432c6f32bb0710b.tif"},{"id":100950204,"identity":"8ec0cbbc-9ec1-4134-8c31-76f70d8a7615","added_by":"auto","created_at":"2026-01-23 07:07:13","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":6192882,"visible":true,"origin":"","legend":"\u003cp\u003eFigure s5\u003c/p\u003e","description":"","filename":"Fig.S5MiceV5.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8498123/v1/7946020163a3c0be28aeabba.tif"}],"financialInterests":"(Not answered)","formattedTitle":"Folate stress as a Contributing Factor to Fanconi Anemia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eFanconi anemia (FA) is a rare genetic disorder characterized by chromosomal instability, with an estimated incidence of 1 in 100,000 live births[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It is primarily considered a pediatric disease, with a median age of onset around 7 years[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Clinical manifestations include progressive bone marrow failure (BMF), congenital anomalies, and a markedly increased susceptibility to malignancies. BMF resulting from hematopoietic stem cell dysfunction is the leading cause of mortality in FA patients. Hematopoietic stem cell transplantation remains the only curative therapy for BMF, significantly improving patient survival[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Despite considerable phenotypic heterogeneity, approximately 25%\u0026ndash;40% of FA patients present without obvious physical abnormalities[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In contrast, skeletal anomalies\u0026mdash;such as thumb and forearm malformations, radial ray defects, and others\u0026mdash;are observed in over 50% of affected children[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. FA patients also face an elevated cancer risk, particularly for acute myeloid leukemia and head and neck squamous cell carcinoma[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo date, at least 22 FA genes (\u003cem\u003eFANCA\u0026ndash;FANCW\u003c/em\u003e) have been identified. Biallelic inactivation of most FA genes causes autosomal recessive FA, with exceptions including X-linked (\u003cem\u003eFANCB\u003c/em\u003e) and autosomal dominant (\u003cem\u003eFANCR\u003c/em\u003e) inheritance. The encoded proteins function collectively in the FA pathway, a dedicated DNA repair network. A hallmark of FA is cellular hypersensitivity to DNA interstrand crosslinks (ICLs), which covalently link the two DNA strands and impede replication and transcription[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. This observation has led to the prevailing hypothesis that endogenous ICLs drive FA pathogenesis. Supporting this, studies from mouse and human genetic evidence have linked endogenous aldehydes, which can generate various DNA lesions, including ICLs, to the FA pathway[\u003cspan additionalcitationids=\"CR11\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Moreover, substantial evidence implicates oxidative stress as a critical contributor to FA pathogenesis[\u003cspan additionalcitationids=\"CR14 CR15 CR16 CR17 CR18 CR19 CR20\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. FA cells also exhibit heightened sensitivity to inflammatory cytokines such as TNF-α and IFN-γ, suggesting a potential role for inflammation in disease progression[\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. While multiple factors are involved, our prior work established replication stress as a major driver of FA[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. We showed that FA-deficient cells are hypersensitive to persistent replication stress induced by hydroxyurea or aphidicolin, and that FA proteins promote replication fork restart via a break-induced replication (BIR)-like pathway[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Furthermore, replication stress can induce BMF in FA-deficient mice[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Nevertheless, the sources of endogenous replication stress in FA remain poorly defined. Elucidating these origins is crucial for developing novel preventive and therapeutic strategies for FA.\u003c/p\u003e \u003cp\u003eFolate is an essential B-vitamin that cannot be synthesized endogenously and must be acquired through the diet in human[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. It serves as a critical cofactor in one-carbon metabolism, supporting key physiological processes such as amino acid metabolism, the \u003cem\u003ede novo\u003c/em\u003e synthesis of purines and thymidylate, and the methylation of proteins, nucleic acids, and lipids[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Consequently, folate is indispensable for genomic integrity by fueling DNA synthesis, repair, and epigenetic regulation. Clinically, folate deficiency is linked to a spectrum of disorders, including megaloblastic anemia, neural tube defects, infertility, certain cancers, and neuropsychiatric conditions[\u003cspan additionalcitationids=\"CR29 CR30 CR31 CR32 CR33 CR34 CR35 CR36\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. At the cellular level, insufficient folate causes genomic instability, manifesting as chromosomal aneuploidy (e.g., chromosome 21)[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] and replication stress-associated DNA breaks[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Moreover, folate deficiency remains prevalent in various populations worldwide[\u003cspan additionalcitationids=\"CR41 CR42\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Given its established role in inducing replication stress, we hypothesized that folate deficiency might represent a relevant endogenous stressor in the context of FA. However, a direct connection between folate metabolism and FA pathogenesis has not been established. In this study, we demonstrate that folate deficiency is a contributing factor to FA. We show that folate stress impedes proliferation and causes aberrant DNA replication in FA-deficient cells, leading to chromosomal loss. Mechanistically, we implicate FA proteins in a break-induced replication pathway in response to folate stress. Furthermore, we provide \u003cem\u003ein vivo\u003c/em\u003e evidence that a folate-deficient diet induces bone marrow failure in \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice. Our findings suggest that folate supplementation could potentially ameliorate certain FA symptoms.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eFolate stress triggers the activation of the FA pathway.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eUpon ingestion, folate is converted to 5,10-methylenetetrahydrofolate, which provides the methyl group for the conversion of deoxyuridine monophosphate (dUMP) to deoxythymidine monophosphate (dTMP)[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Consequently, folate deficiency leads to dTMP depletion, thereby inducing replication stress. Given that the FA pathway is robustly activated by replication stress-inducing agents such as hydroxyurea and aphidicolin[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], we investigated whether folate stress similarly activates this pathway. Human colorectal cancer HCT116 or B-lymphoblastoid TK6 cells cultured in folate-deficient medium for 6 days exhibited a significant increase in FANCD2 nuclear foci, as detected by immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA; Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA), indicating robust recruitment of FANCD2 to stalled replication forks. Since monoubiquitination of FANCD2 and FANCI serves as the central activation mark of the FA pathway[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], we assessed FANCD2 monoubiquitination levels under folate stress. Immunoblot analysis confirmed a pronounced increase in monoubiquitinated FANCD2 upon folate deprivation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB; Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further corroborate these findings, we utilized 5-fluoro-2'-deoxyuridine (FUdR), a thymidylate synthase inhibitor that blocks dTMP synthesis and mimics the replication stress induced by folate deficiency[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Treatment with FUdR resulted in a dose-dependent increase in FANCD2 foci (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC; Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA) and induced FANCD2 monoubiquitination (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD; Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), phenocopying the effects of folate deficiency. Collectively, these data demonstrate that folate stress activates the FA pathway.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFolate deficiency retards the proliferation of FA-deficient cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs the FA pathway is essential for cellular resistance to replication stress[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], we asked whether folate deficiency similarly challenges FA-deficient cells. We monitored the proliferation of wild-type and \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e chicken DT40 B lymphocyte cells cultured in normal (1 mg/mL) or low (0.1 mg/mL) folate medium. While low folate conditions did not affect the growth rate of wild-type cells, they significantly impaired the proliferation of \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). These results indicate that FA-deficient cells exhibit a greater dependence on folate for maintaining normal proliferative capacity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFA-deficient cells are hypersensitive to persistent replication stress caused by FUdR.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe next assessed the sensitivity of FA-deficient cells to transient versus persistent replication stress induced by FUdR. For transient stress, a 3-day MTT assay revealed no significant hypersensitivity in FA-deficient DT40 cells (Figure S2A\u0026ndash;C). In contrast, under conditions of persistent stress, evaluated by a colony formation assay over 2\u0026ndash;3 weeks, FA-deficient DT40 cells (\u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e, \u003cem\u003efancl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, and \u003cem\u003efancd2\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) exhibited marked hypersensitivity to even low concentrations of FUdR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB\u0026ndash;D). This hypersensitivity was corroborated in FA-deficient mammalian cells; both \u003cem\u003eFANCA\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e human HCT116 cells and \u003cem\u003eFANCC\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e human TK6 cells showed significantly reduced survival upon prolonged low-dose FUdR exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, F). These results establish that persistent, but not transient, replication stress triggered by FUdR is synthetically lethal with FA deficiency.\u003c/p\u003e \u003cp\u003eFANCD2 mediates replication stress response through both monoubiquitination-dependent and -independent mechanisms. The monoubiquitination-independent function is critical for resisting transient replication stress[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], whereas our previous work demonstrated that the monoubiquitination-dependent function is essential for surviving persistent replication stress[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. To determine which mechanism operates under folate stress, we utilized FANCD2 K563R knock-in cells, which harbor a monoubiquitination-site mutation. These mutant cells displayed hypersensitivity to persistent FUdR treatment, comparable to \u003cem\u003eFANCD2\u003c/em\u003e-null cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). This finding underscores the critical role of FANCD2 monoubiquitination in cell survival under persistent folate stress.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe FA proteins are required for normal replication under folate stress.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether the impaired proliferation of FA cells under folate deficiency stems from dysregulated DNA synthesis, we performed DNA fiber assays to monitor replication dynamics. Wild-type and \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e DT40 cells were cultured under normal or low folate conditions and sequentially pulsed with CldU and IdU for 20 minutes. Under normal conditions, ongoing replication forks maintain a constant speed, yielding an IdU-to-CldU track length ratio of approximately 1. Replication stalling perturbs fork progression, causing this ratio to deviate from 1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We defined a ratio between 0.75 and 1.25 as representing normal, ongoing replication. Folate deficiency significantly increased the proportion of replication forks outside this normal range in \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e cells compared to wild-type controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C), indicating a higher frequency of replication stalling. These results demonstrate that folate deficiency disrupts normal replication fork progression in FA-deficient cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe FA proteins play a role in MiDAS against FUdR.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eChromosomal fragile sites are genomic loci prone to gaps or breaks on metaphase chromosomes and are classified as common fragile sites (CFSs) or rare fragile sites (RFSs). CFSs are induced by agents like aphidicolin (APH) or bromodeoxyuridine (BrdU), whereas RFSs are often folate-sensitive[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Under-replicated DNA at both CFSs and RFSs is resolved via mitotic DNA synthesis (MiDAS)[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], a process related to the BIR pathway that repairs damaged or collapsed replication forks[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Defective MiDAS leads to chromosome missegregation[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. While the molecular details differ slightly between CFS- and RFS-associated MiDAS[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], our prior work established a role for FA proteins in CFS-related MiDAS[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. We therefore asked whether FA proteins also function in RFS-related MiDAS under folate stress. Consistent with this hypothesis, immunofluorescence analysis revealed that FANCD2 forms significantly more foci at stalled replication forks during MiDAS in cells treated with FUdR (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). Moreover, the absence of FANCA substantially attenuated MiDAS levels under the same conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These data indicate that the FA pathway also participates in RFS-related MiDAS to counteract folate stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFolate stress induces serious genomic instability in FA-deficient cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGiven that MiDAS defects can cause genomic instability and cell death[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], we analyzed mitotic chromosome spreads to assess chromosomal integrity. Chromosomal aberrations were rare in both wild-type and \u003cem\u003eFANCC\u003c/em\u003e-deficient human TK6 cells under folate deficiency or FUdR treatment (Figure S3A, B), indicating that gross structural abnormalities are not the primary cause of cell death. However, we observed a pronounced increase in chromosome loss under folate stress. Under normal conditions, approximately 80% of both wild-type and \u003cem\u003eFANCC\u003c/em\u003e-null cells maintained 47 chromosomes. After six days in low folate medium, over 40% of wild-type cells retained 47 chromosomes, whereas only about 20% of \u003cem\u003eFANCC\u003c/em\u003e-null cells did so (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). A similar trend was observed with FUdR treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Moreover, FA- deficient DT40 cells show similar phenotypes (Figure S4A). Since chromosome loss compromises cellular proliferation[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], we conclude that the gradual loss of chromosomes likely underlies the reduced viability of FA-deficient cells under persistent folate stress, mirroring our earlier findings with hydroxyurea-induced stress[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eUnder-replicated DNA during replication stress can impede chromosome segregation, leading to micronuclei formation and chromosome loss[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Accordingly, we detected a significant increase in micronuclei in FA-deficient TK6 and DT40 cells compared to wild-type cells under both folate-deficient and FUdR-treated conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D; Figure S4B). These findings demonstrate that FA proteins are crucial for maintaining genome stability in the face of folate stress.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFolate deficiency induces BMF in\u003c/b\u003e \u003cb\u003eFancl\u003c/b\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e \u003cb\u003emice.\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vitro\u003c/em\u003e data established that FA-deficient cells are hypersensitive to sustained folate stress. We previously showed that persistent replication stress induced by hydroxyurea triggers BMF in \u003cem\u003eFancl\u003c/em\u003e-deficient mice[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This prompted us to investigate whether chronic folate stress represents an endogenous source of replication stress capable of inducing FA-like symptoms \u003cem\u003ein vivo\u003c/em\u003e. We obtained \u003cem\u003eFancl\u003c/em\u003e knockout mice on a C57BL/6N background (Figure S5A, B). Crosses of heterozygous breeders yielded \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e pups at a slightly lower frequency (90/576, 15.6%) than the expected Mendelian ratio of 25% (Figure S5C), but no postnatal lethality was observed. Adult \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cb\u003e\u0026minus;/\u0026minus;\u003c/b\u003e\u003c/sup\u003e mice showed no significant difference in body weight compared to wild-type littermates.\u003c/p\u003e \u003cp\u003eTo model chronic folate stress, we fed weaned wild-type and \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (approximately three weeks old) a folate-deficient diet until death (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). While wild-type mice exhibited a trend toward longer survival than \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice under folate deprivation, the difference was not statistically significant, possibly due to limited sample size (Figure S5D). However, folate deficiency led to a significant reduction in all three major blood cell lineages (erythrocytes, leukocytes, and platelets) in \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice compared to wild-type controls after 7 weeks (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), indicating the onset of anemia and pancytopenia. Histopathological analysis of bone marrow sections revealed that folate deficiency caused a near-complete ablation of hematopoietic activity in \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Collectively, these \u003cem\u003ein vivo\u003c/em\u003e results demonstrate that persistent folate stress can induce bone marrow failure in the context of FA deficiency.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study reveals a novel role for folate deficiency in the pathogenesis of Fanconi Anemia. We demonstrate that folate stress induces replication defects, chromosomal instability, and bone marrow failure in FA-deficient models, thereby establishing folate metabolism as a previously unrecognized environmental contributor to this genetic disorder.\u003c/p\u003e \u003cp\u003eBy identifying folate deficiency as an endogenous source of replication stress in FA, our work provides a fresh perspective on how nutritional status can influence DNA repair deficiency syndromes. Unlike prior studies focusing on folate in cancer or neural tube defects, our investigation specifically delineates its consequences in the FA context. We uncovered a unique hypersensitivity of FA-deficient cells to folate stress and its profound impact on chromosome integrity through both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e approaches. The observation that a folate-deficient diet induces BMF in \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice establishes a direct pathophysiological link between dietary folate, replication stress, and a hallmark FA symptom. Notably, the phenotypes induced by folate deficiency in our model were less severe than those triggered by hydroxyurea in a previous study[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This suggests that while folate deficiency is a contributing factor, it may not be the predominant source of replication stress \u003cem\u003ein vivo\u003c/em\u003e. It is plausible that multiple endogenous stressors, including ICLs from aldehydes and reactive oxygen species, cooperate or act sequentially to drive FA pathogenesis. The relative contribution of each stressor likely depends on the genetic background and environmental exposures of the individual, which could explain the considerable heterogeneity in age of onset and disease severity among FA patients sharing identical mutations. Nevertheless, our findings provide crucial insights into FA mechanisms and highlight folate supplementation as a potential supportive strategy for symptom management.\u003c/p\u003e \u003cp\u003eIn conclusion, our work underscores the importance of folate homeostasis in FA pathogenesis and suggests that maintaining adequate folate levels may benefit individuals with FA. These findings emphasize the need for further research into the complex interplay between nutrient metabolism, DNA repair fidelity, and disease manifestation in genetic instability syndromes. Addressing these questions will advance the development of targeted nutritional and therapeutic interventions that not only ameliorate symptoms but also address the underlying metabolic vulnerabilities in FA.\u003c/p\u003e"},{"header":"Methods","content":" \u003cp\u003e \u003cstrong\u003eCell culture.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eGeneration of \u003cem\u003efancc\u003c/em\u003e\u003csup\u003e\u003cem\u003e−\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003efancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003efancd2\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003eand \u003cem\u003efancd2\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/K563R\u003c/em\u003e\u003c/sup\u003e DT40 cells was carried out according to established protocols[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. These DT40 cells were maintained in RPMI 1640 medium (Gibco) enriched with 10% fetal bovine serum (FBS), 1% chicken serum, 10 mM HEPES, and 1% penicillin–streptomycin solution, under a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere at a controlled temperature of 39.5°C. In contrast, HCT116 and TK6 cells were cultivated in RPMI 1640 medium (Gibco), supplemented with 10% FBS and 1% penicillin–streptomycin solution, and incubated at 37°C under a 5% CO\u003csub\u003e2\u003c/sub\u003e environment. Regular mycoplasma testing, performed bimonthly on all cell lines, consistently yielded negative results, ensuring the absence of mycoplasma contamination. Low-folate culture medium was defined as containing 10% of the standard folate concentration (100 µg/mL).\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eGeneration of fancc\u003csup\u003e−\u003c/sup\u003e + chfancc and fancl\u003csup\u003e−/−\u003c/sup\u003e +hFANCL DT40 cells.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eThe pDEST26-chicken \u003cem\u003efancc\u003c/em\u003e and pDEST26-human \u003cem\u003eFANCL\u003c/em\u003e expression vectors, employed for the construction of DT40 rescue cell lines, were subjected to linearization through \u003cem\u003eKpn\u003c/em\u003eI digestion. Following this, the linearized vectors were introduced into the cells via electroporation, facilitating successful integration into the DT40 genome post-transfer. Subsequently, the cells were seeded in 96-well plates and incubated for a period of 5 days, with G418 antibiotic supplementation of the culture medium to select for transformed cells. Once clones were established, they were transferred to 24-well plates for further expansion. The authenticity and integrity of the clones were verified through PCR analysis upon reaching confluence.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCell survival assay.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eMTT assays of DT40 cells were performed as described previously[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Briefly, a defined number of cells were co-cultured with FUdR at varying concentrations in 96-well plates. Following a 72-hour incubation period, MTT reagent was added to the medium and incubated for an additional 4 hours. Subsequently, the plates were treated overnight with SDS solution on a shaker to dissolve the formed formazan crystals. The absorbance of the samples was then measured at 570 nm using a microplate reader, which allowed for the quantification of cell viability.\u003c/p\u003e \u003cp\u003eFor colony formation assays with DT40 and TK6 cells, cells were mixed with methylcellulose DMEM-F12 medium containing a range of FUdR concentrations and cultured in six-well plates. After approximately 2–3 weeks of incubation, the cell survival curve was established by enumerating the colonies formed. In the case of HCT116 cells, a specific number of cells were seeded in six-well plates and incubated for 24 hours before the medium was replaced with fresh medium containing various concentrations of FUdR. The cells were then further incubated for 2–3 weeks. At the end of this period, cells were stained with methyl blue to facilitate the enumeration of monoclonal colonies.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eDNA fiber assay.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eDNA fiber assays were executed following the protocol detailed in our previous publication[\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Cells were treated with IdU and CldU to mark DNA synthesis over a defined period and were also exposed to a culture medium deficient in folate. Post-harvest, the cells were mixed with unlabeled counterparts and affixed to a glass slide. The cells were fixed using a mixture of methanol and acetic acid in a 3:1 ratio, dehydrated with a 2.5 M HCl solution, neutralized with a Na\u003csub\u003e2\u003c/sub\u003eB\u003csub\u003e4\u003c/sub\u003eO\u003csub\u003e7\u003c/sub\u003e solution at pH 8.0, blocked with 5% BSA, and then incubated with a solution containing the BrdU (BU1/75) antibody (Abcam) diluted 1:200 in 1% BSA at 37°C for 1.5 hours. After three washes with PBST, the cells were incubated with a solution containing the Rat (Alexa Fluor® 488) antibody diluted 1:200 in 1% BSA at 37°C for 45 minutes, followed by another three washes with PBST. The cells were then re-blocked with 5% BSA, incubated with a solution containing the BrdU (B44) antibody (BD Biosciences) diluted 1:40 in 1% BSA at 37°C for 1.5 hours, washed for 5 minutes with PBST containing 500mM NaCl, and then washed three additional times with PBST. Subsequently, the cells were incubated with a solution containing the Mouse (Alexa Fluor® 594) antibody diluted 1:200 in 1% BSA at 37°C for 45 minutes, followed by three final washes with PBST. The cells were mounted with a coverslip and sealed. The cells were then visualized using a laser confocal fluorescence microscope, and the lengths of the DNA fibers were quantified using ImageJ software, prior to statistical analysis.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eKaryotype analysis.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eTK6 cells were subjected to treatment with FUdR or a folate-depleted culture medium. Colcemid was added to achieve a final concentration, and the cells were incubated for 3 hours prior to the experiment. Post-centrifugation, the supernatant was aspirated, and the cells were resuspended in 75 mM potassium chloride (KCl), followed by a 30-minute incubation at room temperature. A fixative solution, consisting of methanol and acetic acid in a 3:1 ratio, was then added and thoroughly mixed. The cells were dropped onto slides pre-treated with 50% ethanol and left to air dry for 1–2 days. The slides were subsequently immersed in a 3% giemsa staining solution for 10 minutes, followed by drying and sealing with a mounting medium. Images were acquired using a Leica microscope, and the chromosome aberration and counts per cell was determined from these images.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eImmunofluorescence and MiDAS.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eThe steps for immunofluorescence are as follows. Cells were plated onto 12-well cell culture plates with cover slips and treated with FUdR or a folate-deficient medium. They were fixed with 3% paraformaldehyde at room temperature, followed by treatment with a solution containing 0.5% Triton X-100 on ice. After washing with PBST, the cells were blocked with a 5% BSA solution; the primary antibody is prepared in 1% BSA. The primary antibody was incubated at room temperature for 1.5–2 hours; after washing with PBST, the secondary antibody was incubated at room temperature in the dark for 30 minutes. Following three washes with PBST, the cell nuclei were stained with DAPI for 5 minutes, and after washing with PBST, the slides were mounted.\u003c/p\u003e \u003cp\u003eObservation of MiDAS required synchronized cells and was conducted through EdU click-reaction and immunofluorescence of FANCD2. Cells were plated onto 12-well cell culture plates with cover slips and treated with FUdR. Concurrently, cells were synchronized at the G2 phase with RO3306 (CDK1 inhibitor). After 16 hours, the cells were treated with 20 mM EdU for 30 minutes. In addition to the steps identical to immunofluorescence, the cells were reacted with Buffer containing 50 µM Azide H488 at room temperature in the dark for 30 minutes. Subsequently, FANCD2 was labeled using immunofluorescence. The FANCD2 antibody was homemade, and the secondary antibody used was a rabbit 594 antibody. Finally, DAPI staining was applied to observe the cell nuclei.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMice.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eThe \u003cem\u003eFancl\u003c/em\u003e knockout mouse is a strain that was previously maintained in our laboratory[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The mice were housed in the SPF-grade rodent facility at Peking University's Experimental Animal Center, where the temperature was regulated between 22–24°C, and the humidity is maintained at 40%-60%, with a 12-hour light/12-hour dark cycle. Mice were genotyped by PCR using the following primers:\u003c/p\u003e \u003cp\u003eF1: GAGTTCCTTCAGCACCATCA\u003c/p\u003e \u003cp\u003eR1: GGTAACATCATAGTGTCTGGAG\u003c/p\u003e \u003cp\u003eF2: CCAACTGACCTTGGGCAAGAACAT\u003c/p\u003e \u003cp\u003eR2: AGGCTTCTTTGGCAGTAGCT\u003c/p\u003e \u003cp\u003e All animal experiments undertaken in this study were performed using protocols that were approved by the respective animal care and use committees at Peking University in accordance with the National Institutes of Health Guide for Care and Use of Laboratory Animals.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePeripheral blood counts.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003ePeripheral blood was collected from mice at 4 weeks of age until death. Whole blood (20 µL) was collected in EDTA Microvette tubes and analyzed on a Mindray BC-5000 analyzer.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eHistology.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eFemurs were obtained immediately after spontaneous death in the folate-deficient group or upon sacrifice at 18 weeks of age in the control group. All harvested samples were fixed in 4% PFA overnight, dehydrated in 70% ethanol, and embedded in paraffin. Sections of 4 µm thickness were cut and subjected to hematoxylin and eosin (H\u0026amp;E) staining.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eStatistics and reproducibility.\u003c/strong\u003e \u003c/p\u003e\u003cp\u003eStatistical analyses were performed using t-test, one-way or two-way ANOVA by Prism. The data were normally distributed, and the variance between groups being statistically compared was similar.\u003c/p\u003e \u003cp\u003e\u003c/p\u003e\u003ch2\u003eAuthor contribution\u003c/h2\u003e \u003cp\u003eX.X. performed the cell proliferation experiment, most of immunofluorescence experiments, a portion of the MiDAS assays and the mouse experiments. B.Y. performed the drug-sensitivity assays, chromosome spread, WB, a portion of the MiDAS assays. Ruiyuan Guo performed the DNA combing assays. Rong Guo, WZ and D.X. designed experiments and interpreted the results. X.X., B.Y. and D.X. wrote the proper.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank the Imaging Core at the National Center for Protein Sciences at Peking University. This work was supported by the National Key Research and Development Program of China (2021YFA0909304 to D.X. and 2021YFF0700304 to G.R.), the National Natural Science Foundation of China (32371353 to D.X. and 32401075 to X.X.) and Hubei Provincial Natural Science Foundation of China (Grant No. 2024AFB473 to X.X.).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank the Imaging Core at the National Center for Protein Sciences at Peking University. This work was supported by the National Key Research and Development Program of China (2021YFA0909304 to D.X. and 2021YFF0700304 to G.R.), the National Natural Science Foundation of China (32371353 to D.X. and 32401075 to X.X.) and Hubei Provincial Natural Science Foundation of China (Grant No. 2024AFB473 to X.X.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eX.X. performed the cell proliferation experiment, most of immunofluorescence experiments, a portion of the MiDAS assays and the mouse experiments. B.Y. performed the drug-sensitivity assays, chromosome spread, WB, a portion of the MiDAS assays. Ruiyuan Guo performed the DNA combing assays. Rong Guo, WZ and D.X. designed experiments and interpreted the results. X.X., B.Y. and D.X. wrote the proper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDokal, I. \u0026amp; Vulliamy, T. Inherited bone marrow failure syndromes. \u003cem\u003eHaematologica\u003c/em\u003e 95, 1236\u0026ndash;40 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenberg, P.S., Tamary, H. \u0026amp; Alter, B.P. How high are carrier frequencies of rare recessive syndromes? Contemporary estimates for Fanconi Anemia in the United States and Israel. \u003cem\u003eAm J Med Genet A\u003c/em\u003e 155a, 1877\u0026ndash;83 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGluckman, E. \u003cem\u003eet al.\u003c/em\u003e Bone marrow transplantation for Fanconi anemia. \u003cem\u003eBlood\u003c/em\u003e 86, 2856\u0026ndash;62 (1995).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Andrea, A.D. Susceptibility pathways in Fanconi's anemia and breast cancer. \u003cem\u003eN Engl J Med\u003c/em\u003e 362, 1909\u0026ndash;19 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreen, A.M. \u0026amp; Kupfer, G.M. Fanconi anemia. \u003cem\u003eHematol Oncol Clin North Am\u003c/em\u003e 23, 193\u0026ndash;214 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKutler, D.I. \u003cem\u003eet al.\u003c/em\u003e High incidence of head and neck squamous cell carcinoma in patients with Fanconi anemia. \u003cem\u003eArch Otolaryngol Head Neck Surg\u003c/em\u003e 129, 106\u0026ndash;12 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKutler, D.I. \u003cem\u003eet al.\u003c/em\u003e Natural history and management of Fanconi anemia patients with head and neck cancer: A 10-year follow-up. \u003cem\u003eLaryngoscope\u003c/em\u003e 126, 870\u0026ndash;9 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKutler, D.I. \u003cem\u003eet al.\u003c/em\u003e A 20-year perspective on the International Fanconi Anemia Registry (IFAR). \u003cem\u003eBlood\u003c/em\u003e 101, 1249\u0026ndash;56 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCeccaldi, R., Sarangi, P. \u0026amp; D'Andrea, A.D. The Fanconi anaemia pathway: new players and new functions. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 17, 337\u0026ndash;49 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangevin, F., Crossan, G.P., Rosado, I.V., Arends, M.J. \u0026amp; Patel, K.J. Fancd2 counteracts the toxic effects of naturally produced aldehydes in mice. \u003cem\u003eNature\u003c/em\u003e 475, 53\u0026ndash;8 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHira, A. \u003cem\u003eet al.\u003c/em\u003e Variant ALDH2 is associated with accelerated progression of bone marrow failure in Japanese Fanconi anemia patients. \u003cem\u003eBlood\u003c/em\u003e 122, 3206\u0026ndash;3209 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVoulgaridou, G.P., Anestopoulos, I., Franco, R., Panayiotidis, M.I. \u0026amp; Pappa, A. DNA damage induced by endogenous aldehydes: current state of knowledge. \u003cem\u003eMutat. Res.\u003c/em\u003e 711, 13\u0026ndash;27 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBogliolo, M. \u003cem\u003eet al.\u003c/em\u003e The Fanconi anaemia genome stability and tumour suppressor network. \u003cem\u003eMutagenesis\u003c/em\u003e 17, 529\u0026thinsp;\u0026ndash;\u0026thinsp;38 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen-Haguenauer, O. \u003cem\u003eet al.\u003c/em\u003e In vivo repopulation ability of genetically corrected bone marrow cells from Fanconi anemia patients. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e 103, 2340\u0026ndash;5 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCumming, R.C., Liu, J.M., Youssoufian, H. \u0026amp; Buchwald, M. Suppression of apoptosis in hematopoietic factor-dependent progenitor cell lines by expression of the FAC gene. \u003cem\u003eBlood\u003c/em\u003e 88, 4558\u0026ndash;67 (1996).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFutaki, M. \u003cem\u003eet al.\u003c/em\u003e The FANCG Fanconi anemia protein interacts with CYP2E1: possible role in protection against oxidative DNA damage. \u003cem\u003eCarcinogenesis\u003c/em\u003e 23, 67\u0026ndash;72 (2002).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHadjur, S. \u003cem\u003eet al.\u003c/em\u003e Defective hematopoiesis and hepatic steatosis in mice with combined deficiencies of the genes encoding Fancc and Cu/Zn superoxide dismutase. \u003cem\u003eBlood\u003c/em\u003e 98, 1003\u0026ndash;11 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKruyt, F.A. \u003cem\u003eet al.\u003c/em\u003e Abnormal microsomal detoxification implicated in Fanconi anemia group C by interaction of the FAC protein with NADPH cytochrome P450 reductase. \u003cem\u003eBlood\u003c/em\u003e 92, 3050\u0026ndash;6 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePagano, G. \u003cem\u003eet al.\u003c/em\u003e Oxidative stress as a multiple effector in Fanconi anaemia clinical phenotype. \u003cem\u003eEuropean journal of haematology\u003c/em\u003e 75, 93\u0026ndash;100 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, S.J. \u003cem\u003eet al.\u003c/em\u003e Oxidative stress/damage induces multimerization and interaction of Fanconi anemia proteins. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e 279, 30053\u0026ndash;9 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaadatzadeh, M.R., Bijangi-Vishehsaraei, K., Hong, P., Bergmann, H. \u0026amp; Haneline, L.S. Oxidant hypersensitivity of Fanconi anemia type C-deficient cells is dependent on a redox-regulated apoptotic pathway. \u003cem\u003eThe Journal of biological chemistry\u003c/em\u003e 279, 16805\u0026ndash;12 (2004).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaneline, L.S. \u003cem\u003eet al.\u003c/em\u003e Multiple inhibitory cytokines induce deregulated progenitor growth and apoptosis in hematopoietic cells from Fac-/- mice. \u003cem\u003eBlood\u003c/em\u003e 91, 4092\u0026ndash;8 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRathbun, R.K. \u003cem\u003eet al.\u003c/em\u003e Inactivation of the Fanconi anemia group C gene augments interferon-gamma-induced apoptotic responses in hematopoietic cells. \u003cem\u003eBlood\u003c/em\u003e 90, 974\u0026thinsp;\u0026ndash;\u0026thinsp;85 (1997).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J. \u003cem\u003eet al.\u003c/em\u003e Overexpression of the fanconi anemia group C gene (FAC) protects hematopoietic progenitors from death induced by Fas-mediated apoptosis. \u003cem\u003eCancer research\u003c/em\u003e 58, 3538\u0026ndash;41 (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, X. \u003cem\u003eet al.\u003c/em\u003e Fanconi anemia proteins participate in a break-induced-replication-like pathway to counter replication stress. \u003cem\u003eNat Struct Mol Biol\u003c/em\u003e 28, 487\u0026ndash;500 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura, T. \u0026amp; Picciano, M.F. Folate and human reproduction. \u003cem\u003eAm. J. Clin. Nutr.\u003c/em\u003e 83, 993\u0026ndash;1016 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacques, P.F. \u003cem\u003eet al.\u003c/em\u003e Determinants of plasma total homocysteine concentration in the Framingham Offspring cohort. \u003cem\u003eAm. J. Clin. Nutr.\u003c/em\u003e 73, 613\u0026ndash;21 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAltm\u0026auml;e, S. \u003cem\u003eet al.\u003c/em\u003e Variations in folate pathway genes are associated with unexplained female infertility. \u003cem\u003eFertil Steril\u003c/em\u003e 94, 130\u0026ndash;7 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAra\u0026uacute;jo, J.R., Martel, F., Borges, N., Ara\u0026uacute;jo, J.M. \u0026amp; Keating, E. Folates and aging: Role in mild cognitive impairment, dementia and depression. \u003cem\u003eAgeing Res Rev\u003c/em\u003e 22, 9\u0026ndash;19 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEbisch, I.M., Thomas, C.M., Peters, W.H., Braat, D.D. \u0026amp; Steegers-Theunissen, R.P. The importance of folate, zinc and antioxidants in the pathogenesis and prevention of subfertility. \u003cem\u003eHuman reproduction update\u003c/em\u003e 13, 163\u0026thinsp;\u0026ndash;\u0026thinsp;74 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarc\u0026iacute;a-Closas, R., Castellsagu\u0026eacute;, X., Bosch, X. \u0026amp; Gonz\u0026aacute;lez, C.A. The role of diet and nutrition in cervical carcinogenesis: a review of recent evidence. \u003cem\u003eInt J Cancer\u003c/em\u003e 117, 629\u0026ndash;37 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGilbody, S., Lewis, S. \u0026amp; Lightfoot, T. Methylenetetrahydrofolate reductase (MTHFR) genetic polymorphisms and psychiatric disorders: a HuGE review. \u003cem\u003eAm J Epidemiol\u003c/em\u003e 165, 1\u0026ndash;13 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMayne, S.T. \u003cem\u003eet al.\u003c/em\u003e Nutrient intake and risk of subtypes of esophageal and gastric cancer. \u003cem\u003eCancer Epidemiol Biomarkers Prev\u003c/em\u003e 10, 1055\u0026ndash;62 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorris, M.S., Jacques, P.F., Rosenberg, I.H. \u0026amp; Selhub, J. Folate and vitamin B-12 status in relation to anemia, macrocytosis, and cognitive impairment in older Americans in the age of folic acid fortification. \u003cem\u003eAm J Clin Nutr\u003c/em\u003e 85, 193\u0026ndash;200 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRohan, T.E., Jain, M.G., Howe, G.R. \u0026amp; Miller, A.B. Dietary folate consumption and breast cancer risk. \u003cem\u003eJ Natl Cancer Inst\u003c/em\u003e 92, 266\u0026ndash;9 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson, R.D. \u003cem\u003eet al.\u003c/em\u003e Pre-conception Folic Acid and Multivitamin Supplementation for the Primary and Secondary Prevention of Neural Tube Defects and Other Folic Acid-Sensitive Congenital Anomalies. \u003cem\u003eJ Obstet Gynaecol Can\u003c/em\u003e 37, 534\u0026ndash;52 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, S. \u003cem\u003eet al.\u003c/em\u003e A prospective study of folate intake and the risk of breast cancer. \u003cem\u003eJama\u003c/em\u003e 281, 1632\u0026ndash;7 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeetstra, S., Thomas, P., Salisbury, C., Turner, J. \u0026amp; Fenech, M. Folic acid deficiency increases chromosomal instability, chromosome 21 aneuploidy and sensitivity to radiation-induced micronuclei. \u003cem\u003eMutat Res\u003c/em\u003e 578, 317\u0026ndash;26 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamm, N. \u003cem\u003eet al.\u003c/em\u003e Folate levels modulate oncogene-induced replication stress and tumorigenicity. \u003cem\u003eEMBO Mol Med\u003c/em\u003e 7, 1138\u0026ndash;52 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSenti, F.R. \u0026amp; Pilch, S.M. Analysis of folate data from the second National Health and Nutrition Examination Survey (NHANES II). \u003cem\u003eJ Nutr\u003c/em\u003e 115, 1398\u0026ndash;402 (1985).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBailey, L.B. \u003cem\u003eet al.\u003c/em\u003e Folacin and iron status and hematological findings in black and Spanish-American adolescents from urban low-income households. \u003cem\u003eAm J Clin Nutr\u003c/em\u003e 35, 1023\u0026ndash;32 (1982).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMensink, G.B. \u003cem\u003eet al.\u003c/em\u003e Mapping low intake of micronutrients across Europe. \u003cem\u003eBr J Nutr\u003c/em\u003e 110, 755\u0026thinsp;\u0026ndash;\u0026thinsp;73 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoman Vi\u0026ntilde;as, B. \u003cem\u003eet al.\u003c/em\u003e Projected prevalence of inadequate nutrient intakes in Europe. \u003cem\u003eAnn Nutr Metab\u003c/em\u003e 59, 84\u0026ndash;95 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHowlett, N.G., Taniguchi, T., Durkin, S.G., D'Andrea, A.D. \u0026amp; Glover, T.W. The Fanconi anemia pathway is required for the DNA replication stress response and for the regulation of common fragile site stability. \u003cem\u003eHum Mol Genet\u003c/em\u003e 14, 693\u0026ndash;701 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRickman, K.A. \u003cem\u003eet al.\u003c/em\u003e Deficiency of UBE2T, the E2 Ubiquitin Ligase Necessary for FANCD2 and FANCI Ubiquitination, Causes FA-T Subtype of Fanconi Anemia. \u003cem\u003eCell reports\u003c/em\u003e 12, 35\u0026ndash;41 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSen, A. \u0026amp; Karati, D. An insight into thymidylate synthase inhibitor as anticancer agents: an explicative review. \u003cem\u003eNaunyn-Schmiedeberg's archives of pharmacology\u003c/em\u003e 397, 5437\u0026ndash;5448 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, Y. \u003cem\u003eet al.\u003c/em\u003e Constitutive role of the Fanconi anemia D2 gene in the replication stress response. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e 292, 20184\u0026ndash;20195 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArlt, M.F., Durkin, S.G., Ragland, R.L. \u0026amp; Glover, T.W. Common fragile sites as targets for chromosome rearrangements. \u003cem\u003eDNA repair\u003c/em\u003e 5, 1126\u0026ndash;35 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMinocherhomji, S. \u003cem\u003eet al.\u003c/em\u003e Replication stress activates DNA repair synthesis in mitosis. \u003cem\u003eNature\u003c/em\u003e 528, 286\u0026thinsp;\u0026ndash;\u0026thinsp;90 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarribba, L. \u003cem\u003eet al.\u003c/em\u003e Folate stress induces SLX1- and RAD51-dependent mitotic DNA synthesis at the fragile X locus in human cells. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America\u003c/em\u003e 117, 16527\u0026ndash;16536 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCostantino, L. \u003cem\u003eet al.\u003c/em\u003e Break-induced replication repair of damaged forks induces genomic duplications in human cells. \u003cem\u003eScience (New York, N.Y.)\u003c/em\u003e 343, 88\u0026ndash;91 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBjerregaard, V.A., Garribba, L., McMurray, C.T., Hickson, I.D. \u0026amp; Liu, Y. Folate deficiency drives mitotic missegregation of the human FRAXA locus. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 115, 13003\u0026ndash;13008 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirota, K. \u003cem\u003eet al.\u003c/em\u003e SUMO-targeted ubiquitin ligase RNF4 plays a critical role in preventing chromosome loss. \u003cem\u003eGenes to cells: devoted to molecular \u0026amp; cellular mechanisms\u003c/em\u003e 19, 743\u0026thinsp;\u0026ndash;\u0026thinsp;54 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChan, K.L., Palmai-Pallag, T., Ying, S. \u0026amp; Hickson, I.D. Replication stress induces sister-chromatid bridging at fragile site loci in mitosis. \u003cem\u003eNat Cell Biol\u003c/em\u003e 11, 753\u0026ndash;60 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHirota, K. \u003cem\u003eet al.\u003c/em\u003e The POLD3 subunit of DNA polymerase delta can promote translesion synthesis independently of DNA polymerase zeta. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 43, 1671\u0026ndash;83 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeki, S. \u003cem\u003eet al.\u003c/em\u003e A requirement of FancL and FancD2 monoubiquitination in DNA repair. \u003cem\u003eGenes Cells\u003c/em\u003e 12, 299\u0026ndash;310 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao, S. \u003cem\u003eet al.\u003c/em\u003e An OB-fold complex controls the repair pathways for DNA double-strand breaks. \u003cem\u003eNat Commun\u003c/em\u003e 9, 3925 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, Y. \u003cem\u003eet al.\u003c/em\u003e 53BP1 and BRCA1 control pathway choice for stalled replication restart. \u003cem\u003eElife\u003c/em\u003e 6, (2017).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Fanconi Anemia, Folate Deficiency, DNA Repair, Replication Stress, Genomic Instability","lastPublishedDoi":"10.21203/rs.3.rs-8498123/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8498123/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFanconi Anemia (FA) is a rare chromosomal instability disorder characterized by progressive bone marrow failure, congenital abnormalities, and a heightened cancer predisposition. With at least 22 identified FA genes, biallelic mutations in any one of these genes disrupt the FA pathway, a specialized DNA repair mechanism, leading to disease pathogenesis. FA cells are hypersensitive to DNA interstrand crosslinks (ICLs), which have been linked to endogenous aldehydes and oxidative stress, both contributing factors to FA pathogenesis. Our previous work identified replication stress as a significant driver of FA pathology, demonstrating that FA-deficient cells are particularly vulnerable to persistent replication stress. Here, we reveal that folate deficiency, a condition impairing DNA synthesis, repair, and methylation, constitutes a previously unrecognized contributing factor to FA. We show that folate stress causes aberrant DNA replication in FA-deficient cells, leading to chromosomal loss and proliferation delay. Mechanistically, the FA pathway is activated under folate stress and engages a break-induced replication (BIR)-like process to mitigate replication-associated damage. Importantly, feeding \u003cem\u003eFancl\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice a folate-deficient diet induced bone marrow failure, recapitulating a hallmark FA symptom. Our findings suggest that folate supplementation may offer a potential strategy for ameliorating FA symptoms.\u003c/p\u003e","manuscriptTitle":"Folate stress as a Contributing Factor to Fanconi Anemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-22 10:06:18","doi":"10.21203/rs.3.rs-8498123/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-04-01T09:09:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-03-31T13:15:41+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-03-17T17:39:41+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-01-28T21:34:07+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-20T17:45:26+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-01-20T15:34:42+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-01-20T15:14:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-07T14:34:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2026-01-02T05:01:37+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-02T05:01:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ff4893cf-593b-4676-a4aa-58fb98ebc48c","owner":[],"postedDate":"January 22nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[{"id":61450568,"name":"Biological sciences/Molecular biology/DNA damage and repair/Homologous recombination"},{"id":61450569,"name":"Biological sciences/Molecular biology/DNA replication/Stalled forks"}],"tags":[],"updatedAt":"2026-04-01T09:15:31+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-22 10:06:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8498123","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8498123","identity":"rs-8498123","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}